Sie sind auf Seite 1von 11

>gi|251831106|ref|NC_012920.

1| Homo sapiens mitochondrion, complete genome GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTC TGGGGG GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTT TGATTC CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGT GTGTTA ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACA GACATC ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCT CTGCCA AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGT ATGCAC TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCA TCAATA CAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCA AACCCC AAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGAC GGGCTC ACATCACCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC ATGCAA GCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCA CGCAGC AATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAG CAATAA ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTC ACACGA TTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCT AAAACT CACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCT GAACAC ACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGT TAAATC AACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTT CATATC CCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCC TATATA CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGT TAGGTC AAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGC CCTTAT GAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGCTTAGTTGAACAGGG CCCTGA

AGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCC TACGCA TTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAG AGTGTA GCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTA AACCTA GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTA TAGGCG ATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATGAAAAATTATAACCA AGCATA ATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGG AGAGCC AAAGCTAAGACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGTCTAT GTAGCA AAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTC CAAGAT AGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTG TTAGTC CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTAACAC CCATAG TAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATC CCAAAC ATATAACTGAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATGTTAG TATAAG TAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTAAAACACTGAACTGACAATTAA CAGCCC AATATCTACAATCAACCAACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCA TAAGGA AAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACC TCTAGC ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACCCTAACC GTGCAA AGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCCACGAGGGTTCAGCT GTCTCT TACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGGCATAACACAGCAAGACGAGAAG ACCCTA TGGAGCTTTAATTTATTAATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACC TGCATT AAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTT CACCAG TCAAAGCGAACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGG ATAACA GCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAGGAC ATCCCG

ATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCA GACCGG AGTAATCCAGGTCGGTTTCTATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATA AGGCCT ACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCAC CCAAGA ACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGG TTCAAT TCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCA ATGGCA TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTG TAGGCC CCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACC CGCCAC ATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGA ACCCCC CTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTA GCCTAG CCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACT GCGAGC AGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATA AGTGGC TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGAC CCTTGG CCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGG GGAGTC CGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCC GAATAC ACAAACATTATTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCAC TCTCCC CTGAACTCTACACAACATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAAT TCGAAC AGCATACCCCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTC ACCCTA GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAG AAATAT GTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGA CTATGA GAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAAGT AAGGTC AGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAA TCCCCT GGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCAC TGATTT

TTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAA ACCCTC GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAAT AGCTAT CCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTCATCA TTAATA ATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCTTTCACTTCTGAGTCCCAGAGGTTA CCCAAG GCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCAT ATACCA AATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGC AGTTGA GGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGAT GAATAA TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAAC TACTAC CGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTATCTCGCACCTGAAAC AAGCTA ACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCG GCTTTT TGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATCATCCCCACCATCAT AGCCAC CATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTC CCCATA TCTAACAACGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACAC TCATCG CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTAGGTT AAATAC AGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACT GCAAAA CCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTACTAGACCA ATGGGA CTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCT CCCGCC GCCGGGAAAAAAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCA ATATGA AAATCACCTCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTT CACTCA GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGA CATTGG AACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATT CGAGCC GAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCC ATGCAT

TTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCC CCTAAT AATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCC TCTCTC CTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTC CCTTAG CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGG TGTCTC CTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACC CAATAC CAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAG TCCTAG CTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGG AGGAGG AGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATC CTACCA GGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACA TAGGTA TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTAC AGTAGG AATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGC GTCAAA GTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAG CCCTAG GATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGA CATCGT ACTACACGACACGTACTACGTTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTT GCCATC ATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCA AAATCC ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATC CGGAAT GCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGC TCATTC ATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAA AAGTCC TAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACAC ATTCGA AGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCA AGCCAA CCCCATGGCCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAG TTAAAT TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACT TCCCCT

ATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCC TAGTCC TGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGA AATAGA AACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATC CTTTAC ATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAA CCTACG AGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACC AGGCGA CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATA ATTACA TCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCG GACGTC TAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTG TGGAGC AAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCC GTATTT ACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTT TAAGTT AAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCC CACCAT AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTAC CACCTA CCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGA AAATCT GTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTT CCCCCT CTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAA TCAAAC TAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGT ATCCTT AATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACC CAACTA TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGCTCTA AGATTA AAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTAT TATCGA AACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCA GGCCAC CTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACAC TTATCA TCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGT TTTCAC

ACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATA TAGTAA AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCAT GTGATT TCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAA TGATGG CGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTC GATACG GGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCA CTCCAG CCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCC CTAGAA GTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATA GTCTAA TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTT TACCCT CCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACA TTTTTT GTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCA TCCGCC AACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCA TTTTGT AGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATA AATAGT ACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAA TTTTAA TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGG CTACAT AGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCC ATAAAA TTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTAC CATGAG CCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGC CCTAAG TCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAA ACGAAT GATTTCGACTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTA TACTAG CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATG CCTAGA AGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTA GCCAAT ATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAG TCTCAA

TCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATC GTCCCA ACAATTATATTACTACCACTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCA CCCACA GCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTG TTCCCC AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTC ACAATC ATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATAC TAATCT CCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTT CGAAAC CACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCA GGCACA TACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACA ACACCC TAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAA CAACTT AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGA CTCCCT AAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGTACTCTTAAAACTAG GCGGCT ATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCT TGTACT ATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTC ATTGCA TACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCT TCACCG GCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTC AAACTA CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATA GCTTTT TGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAAC TCTCTG TGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGT CACAGC CCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAAC ATAAAA CCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCC TCAACC CCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATC TGACAA CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATG TCTAAC

AACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTT GGTGCA ACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATT CCCCCC ATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTG TCGCAT CCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTAT CTCGAA CTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCC ATAATA TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATAAACT CAGACC CAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATACTAATCTTAGTTAC CGCTAA CAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGT TGATGA TACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAATCCTATACAACCGTATCGGCGATA TCGGTT TCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCT TCTAAA CGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAA TTAGGT CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAA GCACTA TAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCACTAAT CCAAAC TCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCAGCAGTCTGCGCCCTTACACAAAAT GACATC AAAAAAATCGTAGCCTTCTCCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCA ACCAAC CACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTC CGGGTC CATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATA CCTCTC ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCT ACTCCA AAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCT CATCGC TACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGC TTCCCC ACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAAACGCCTGGCAGCCG GAAGCC TATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCC CCTCTA

CCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTAC CTAACC AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTCTACC CTAGCA TCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCT AGACCT AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCTCCACCTCCATCATC ACCTCA ACCCAAAAAGGCATAATTAAACTTTACTTCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTAC TCCTAA TCACATAACCTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAAC CAGTAA CTACTACTAATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAA CCCTGA CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCA TCATAC TCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAACACTCACCAAGACCT CAACCC CTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAACCAT CATTCC CCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACA CACCCG ACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCA CAAACC CCATTACTAAACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAAC CACGAC CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATACGCAAA ACTAAC CCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATCCAACATCTCCGCAT GATGAA ACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAGCCAT GCACTA CTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGTAAATTATGGC TGAATC ATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGC GAGGCC TATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAAC TATAGC AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATT ACAAAC TTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAG TAGACA GTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGC AACACT

CCACCTCCTATTCTTGCACGAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGAT AAAATC ACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAA TGACAT TAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAA CACCCC TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCCTAAC AAACTA GGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATAT CCAAAC AACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCT CATTCT AACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTA CTATAC TTCACAACAATCCTAATCCTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGG CCTGTC CTTGTAGTATAAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAA ATCAGA GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCTCTGT TCTTTC ATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTT CGTACA TTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAA AACCCA ATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCAC ACATCA ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT ACATAG TACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGA CCCCCC TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTC TCCTCG CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTC AGGGTC ATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG