Sie sind auf Seite 1von 4

Amblyseius largoensis voucher TT SD7E 12S

ribosomal RNA gene, partial sequence;


mitochondrial
GenBank: KF234113.1
GenBank Graphics PopSet
>gi|631812915|gb|KF234113.1| Amblyseius largoensis voucher TT SD7E 12S
ribosomal RNA gene, partial sequence; mitochondrial
ACGAATGTTAGGTAGTAGGTGTTGTGCATGAAACTTAAATTTATTGGCGGCTTTTTAAATTTTTTAGAGG
AATTTATTCTATAAAGGATAAAACACCAAAATCTTACTTTAAATTGTATTTACAGTTTGTCTACCGCTAT
TTAATTATGTGTAAATTTATTTTTTTCTCTAAGGTTAGTGGTGTTTTAGGTTAAGGTTCAGCTTATTTTA
AAGATTGAAATAAATTATATAAATTATTATTTAACTATAGTTTTTTTTTAATAAGGAATTAAAGAAAAAT
TTAAAAGTAAAATTTTTAAGCGAATTATTCTTATTTAGATTTTATTTATTTGTGTACATATCGCCCGTCA
CTCTTGAGCAAAGATAAGTCGTAACATAGTA

Amblyseius largoensis voucher TT SD7F 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234114.1
GenBank Graphics PopSet
>gi|631812916|gb|KF234114.1| Amblyseius largoensis voucher TT SD7F 12S
ribosomal RNA gene, partial sequence; mitochondrial
TGAAACTTAAATTTATTGGCGGCTTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAAACACCA
AAATCTTACTTTAAATTGTATTTACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTTTTTTCT
CTAAGGTTAGTGGTGTTTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAAATTATT
ATTTAACTATAGTTTTTTTTTAATAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCGAATTAT
TCTTATTTAGATTTTATTTATTTGTGTACATATCGCCCGTCACTCTTGAGCAAAGATAAGTCGTAACATA
GTA

Amblyseius largoensis voucher TT SD7G 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234115.1
GenBank Graphics PopSet
>gi|631812917|gb|KF234115.1| Amblyseius largoensis voucher TT SD7G 12S
ribosomal RNA gene, partial sequence; mitochondrial
GCATGAAACTTAAATTTATTGGCGGCTTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAAACA
CCAAAATCTTACTTTAAATTGTATTTACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTTTTT

TCTCTAAGGTTAGTGGTGTTTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAAATT
ATTATTTAACTATAGTTTTTTTTTAATAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCGAAT
TATTCTTATTTAGATTTTATTTATTTGTGTACATATCGCCCGTCACTCTTGAGCAAAGATAAGTCGTAAC
ATAGTA

Amblyseius largoensis voucher TT SD7I 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234116.1
GenBank Graphics PopSet
>gi|631812918|gb|KF234116.1| Amblyseius largoensis voucher TT SD7I 12S
ribosomal RNA gene, partial sequence; mitochondrial
CTAGGATTAGATACCCTATTAGGTGTACGAATGTTAGGTAGTAGGTGTTGTGCATGAAACTTAAATTTAT
TGGCGGCTTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAAACACCAAAATCTTACTTTAAAT
TGTATTTACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTTTTTTCTCTAAGGTTAGTGGTGT
TTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAAATTATTATTTAACTATAGTTTT
TTTTTAATAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCGAATTATTCTTATTTAGATTTTA
TTTATTTGTGTACATATCGCCCGTCACTCTTGAGCAAAGATAAGTCGTAACATAGTA

Amblyseius largoensis voucher TT SD7C 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234112.1
GenBank Graphics PopSet
>gi|631812914|gb|KF234112.1| Amblyseius largoensis voucher TT SD7C 12S
ribosomal RNA gene, partial sequence; mitochondrial
TAGATACCCTATTAGGTGTACGAATGTTAGGTAGTAGGTGTTGTGCATGAAACTTAAATTTATTGGCGGC
TTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAAACACCAAAATCTTACTTTAAATTGTATTT
ACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTTTTTTCTCTAAGGTTAGTGGTGTTTTAGGT
TAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAAATTATTATTTAACTATAGTTTTTTTTTAA
TAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCGAATTATTCTTATTTAGATTTTATTTATTT
GTGTACATATCGCCCGTCACTCTTGAGCAAAGATAAGTCGTAACATAGTA

Amblyseius largoensis voucher RE2D 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234122.1

GenBank Graphics PopSet


>gi|631812924|gb|KF234122.1| Amblyseius largoensis voucher RE2D 12S
ribosomal RNA gene, partial sequence; mitochondrial
CTAGGATTAGATACCCTATTAGGTGTATGAATGTTAGGTAGTAAGTGTTATACATGAAACTTAAATTTAT
TGGCGGCTTTATAAATTTTTTAGAGGAATTTATTCTATTAAGGATAAAACACCAAAATCTTACTTTAAAT
TGTACTTACAGTTTGTCTACCGCTATTTAACTATATGTAAGTTTATTTTTTTTTCTAGAGTTAGTGATGT
TTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATGAATTATTATTTAACTATAATTTC
TTTTTAATAAGAGATTAAAGAAAAATTTAAAAGTAATATTTGCTAATTAGGCTTATTTAAATTTTATTTA
TTTGTGTACATATCGCCCGTCACTCTTGTGTAAAGATAAGTCGTAACATA

Amblyseius largoensis voucher BR AP8G 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234120.1
GenBank Graphics PopSet
>gi|631812922|gb|KF234120.1| Amblyseius largoensis voucher BR AP8G 12S
ribosomal RNA gene, partial sequence; mitochondrial
TGTGCATGAAACTTAAATTTATTGGCGGCTTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAA
ACACCAAAATCTTACTTTAAATTGTATTTACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTT
TTTTCTCTAAGGTTAGTGGTGTTTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAA
ATTATTATTTAACTATAGTTTTTTTTTAATAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCG
AATTATTCTTATTTAGATTTTATTTATTTGTGTACATATCGCCCGTCACTCTTGAGCAAAGATAAGTCGT

Amblyseius largoensis voucher RE2I 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234123.1
GenBank Graphics PopSet
>gi|631812925|gb|KF234123.1| Amblyseius largoensis voucher RE2I 12S
ribosomal RNA gene, partial sequence; mitochondrial
CTAGGATTAGATACCCTATTAGGTGTATGAATGTTAGGTAGTAAGTGTTATACATGAAACTTAAATTTAT
TGGCGGCTTTATAAATTTTTTAGAGGAATTTATTCTATTAAGGATAAAACACCAAAATCTTACTTTAAAT
TGTACTTACAGTTTGTCTACCGCTATTTAACTATATGTAAGTTTATTTTTTTTTCTAGAGTTAGTGATGT
TTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATGAATTATTATTTAACTATAATTTC
TTTTTAATAAGAGATTAAAGAAAAATTTAAAAGTAATATTTGCTAATTAGGCTTATTTAAA

Amblyseius largoensis voucher BR AP8D 12S ribosomal


RNA gene, partial sequence; mitochondrial
GenBank: KF234119.1
GenBank Graphics PopSet
>gi|631812921|gb|KF234119.1| Amblyseius largoensis voucher BR AP8D 12S
ribosomal RNA gene, partial sequence; mitochondrial
TAGATACCCTATTAGGTGTACGAATGTTAGGTAGTAGGTGTTGTGCATGAAACTTAAATTTATTGGCGGC
TTTTTAAATTTTTTAGAGGAATTTATTCTATAAAGGATAAAACACCAAAATCTTACTTTAAATTGTATTT
ACAGTTTGTCTACCGCTATTTAATTATGTGTAAATTTATTTTTTTCTCTAAGGTTAGTGGTGTTTTAGGT
TAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTATATAAATTATTATTTAACTATAGTTTTTTTTTAA
TAAGGAATTAAAGAAAAATTTAAAAGTAAAATTTTTAAGCGAATTATTCTTATTTAGATTTTATTTATTT
GTGTACATATCGCCCGTCACTCTTGAGCAAAGA

Amblyseius largoensis voucher RE3 12S ribosomal RNA


gene, partial sequence; mitochondrial
GenBank: KF234129.1
GenBank Graphics PopSet
>gi|631812931|gb|KF234129.1| Amblyseius largoensis voucher RE3 12S
ribosomal RNA gene, partial sequence; mitochondrial
AGTGTTATACATGAAACTTAAATTTATTGGCGGCTTTATAAATTTTTTAGAGGAATTTATTCTATTAAGG
ATAAAACACCAAAATCTTACTTTAAATTGTACTTACAGTTTGTTTACCGCTATTTAACTATATGTAAGTT
TATTTTTTTTTCTAGAGTTAGTGATGTTTTAGGTTAAGGTTCAGCTTATTTTAAAGATTGAAATAAATTA
TATGAATTATTATTTAACTATAATTTCTTTTTAATAAGAGATTAAAGAAAAATTTAAAAGTAATATTTGC
TAATTAGG