Association between a Single Nucleotide Polymorphisms in Neuregulin-1 and

Schizophrenia in a Pakistani Population: A Case-control study

Haider A. Naqvi1, Shafqat Huma2, Hira Waseem1, Hina Zuberi3, Afzal Javed4

Department of Psychiatry, Aga Khan University

University College of Medicine & Dentistry, University of Lahore

Department of Biological and Biomedical Sciences, Aga Khan University

Pakistan Psychiatric Research Center, Fountain House, Lahore

Corresponding Author:
Haider A. Naqvi e-mail: (haideralinaqvi9@gmail.com)
Department of Psychiatry, Aga Khan University

Abstract
Objective: The aim of this case-control study is to determine the association of single nucleotide
polymorphism, SNP8nrg433E1006, in the NRG-1 gene associated with schizophrenia in samples
from the Pakistani population. The study was carried out at Aga Khan University Hospital,
Karachi and Fountain House, Lahore from July 2010 to June 2013.
Methodology: A total of 630 samples (n=321 cases of schizophrenia and n= 309 controls) were
collected from the Fountain House, Lahore and the Psychiatric Clinics at Aga Khan University.
Among them 418 were males while 212 were females. The total genomic DNA was isolated and
SNP8nrg433E1006 was screened by nested PCR followed by sequencing. The Neuregulin 1
(NRG1) gene sequences from patients and controls were aligned with Human NRG1-GGF2 gene
sequence (Accession number NM_013962.2), which served as a reference sequence. The single
nucleotide polymorphism (SNP) G/A was characterized at position 433 in NRG1 gene by
aligning test and control sequences with NRG1-GGF2 sequence using ClustalW algorithm,
implemented in the BioEdit software.
Results: The SNP SNP8nrg433E1006 was present in 62% of the cases, while it was present in
30% of control subjects. The analysis showed that the odds ratio of having the schizophrenia is
3.8 times higher in the presence of this SNP at the 92 bp of NRG-1 gene with the 95% CI, 2.0471
to 7.2033, and highly significant P value, 0.0001.
Conclusion: There is a strong association of SNP8nrg433E1006 in the NRG-1 gene with
schizophrenia in a Pakistani population. Further studies are required to establish the functional
association of this gene with chronic psychosis.

Background:
Schizophrenia is a mental disorder which runs a chronic course leading to brain dysfunction and
the deterioration of personality. It affects one individual out of a hundred. Heritability and
genetic risk is postulated to play a major role in the etiology of schizophrenia. The completion
of the human genome project has allowed us to understand the molecular basis of a number of
human diseases. Research pertaining to genetics of schizophrenia has also progressed rapidly
over the past decade. High throughput mapping and scanning of the human genome by emerging
technologies has enabled us to identify disease-specific gene mutations quickly. Genetic mapping
follows the descent down the generations of DNA markers in pedigree and their segregation with
illness. Either a very large single pedigree, or a collection of smaller families where the effects of
linkage is additive, are studied. The rates of schizophrenia were greater among the biological
relatives of the schizophrenic adoptees than among the relatives of controls; a finding that
supports the genetic hypothesis. Furthermore, the rate of schizophrenia was not increased among
couples that adopted the schizophrenic adoptees, suggesting that environmental factors were not
of substantial importance.

Neuregulin-1 of NRG-1 is a gene that has shown perhaps one of the most robust linkages in
terms of disease causation. NRG-1 is located on chromosome 8p and is a large gene of about 1.2
Mbp, with at least 30 exons and 9 potential promoters. Chromosome 8 has been one of the more
problematic chromosomes in terms of sequence assembly and marker orders, with further
complications arising due to inversion polymorphisms (Giglio et al., 2001) and deletions (Yu et
al., 2002). This may, in part, explain the differences in the intervals reported. Alternatively, there
may be a second schizophrenia gene on chromosome 8p.A core haplotype (HAP ice) was
identified by Stefansson and colleagues in the original study on the Icelandic population that first
implicated this gene. Recently the same region was identified in the Irish, Scottish and Chinese
populations. NRG-1 is a plausible susceptibility gene as it plays a direct role in the expression of
the NMDA receptor by regulating of glutamate and the neurotransmitters.
The purpose of this project is to determine if mutations in the NRG-1 are associated with
schizophrenia in a sample of the Pakistani population. The genetic analysis is being carried out
by employing the PCR techniques (specific forward and reverse primers) and the region
harboring the mutations will be screened. A single nucleotide polymorphism SNP i.e.,
Snp8nrg433E1006 and two microsatellites (478B14848, 420M91395) were screened. Three
SNPs, snp8nrg221132, snp8nrg221533, snp8nrg241930 are to be screened in the next phase of
the project.

Methodology:
Patients with the clinical diagnosis for schizophrenia (as per ICD 10) who meet the study
inclusion criteria were asked to participate in the study. They were assessed for clinical
remission, social and occupational functioning. Details of socio-demographic variables were
collected on a predesigned proforma. All control and patients consented to participate in the
study. Information on the educational status, marital status, occupation, family history of
psychiatric disorder, birth order was collected. First degree relatives were enrolled as controls.
Patients were recruited from two centers. The Department of Psychiatry, Aga Khan University
conducted around 44 out-patients clinics in a week. Recruitment was carried out from patients
visiting the clinics or admitted in the Psychiatry Ward, AKU. The other center was Fountain
House, Lahore. Fountain House is a rehabilitation center for the psychiatric patients. It was
established in 1971. It is a day and night residential center in the world for the mentally ill
persons. At a given time around 300 patients are admitted in the Fountain House, Lahore.
Sampling was carried out on patients whose relatives gave consent. The Aga Khan University
Department of Pathology has a STAT Lab in a nearby location, which was used for temporary
storage and shipment of samples.
Five milliliters (5ml) of blood was collected from the enrolled patients and their healthy (relative
controls). Blood samples were stored temporarily at 4 0 C. The blood samples were shipped on
the same day from Lahore Center as per protocol. Once they were received in the AKU campus
they were transferred to DNA suit in the Multidisciplinary Lab, Department of Biological and
Biomedical Sciences. A Research Office, hired for the purpose of data collection at the Karachi
and Lahore Center conducted the interview, take informed consent and did the phlebotomy. The
samples from the Lahore center were supervised by Medical Pathologist, Senior Research
Associate and the Administrative staff for quality control and safe transfer to the MDL Lab at
AKU. A Unique ID code was generated for each patient. The data was initially entered in the
Excel file which was later transferred to SPSS for analysis (see tables).
DNA extraction: DNA extraction form the blood samples were carried out in the
Multidisciplinary Lab in the Department of Biological and Biomedical Sciences (BBS) at Aga
Khan University under the supervision of the project investigators. The department has a
separate DNA extraction area and sample handling space.
DNA extraction was performed using a genomic DNA isolation kit (Qiagen) as given in the
manufacturers protocol. A 250 sample DNA extraction kit was purchased under the budget title
assigned for the chemicals .Permanent equipment, such as pipettes of different volumes (1000
ml, 200 ml and 20 ml), was procured for the sample handling purpose under the budget code of
the permanent equipment. Chemicals used for the procedure of the DNA isolation were also

obtained under the budget code of chemicals and supplies (see financial report).
The isolated DNA was stored permanently after processing at -20C in the freezers at the
department of biological and biomedical sciences (BBS), AKU where separate sample storage
spaces are given to individual projects.
PCR methodology/genotyping: The total genomic DNA was isolated from the blood samples of
cases and controls. The SNP8nrg433E1006 which lies in the 5 exon of GGF2 was screened by
Nested PCR followed by sequencing the 163bp product. The outer primers were
CCTACCCCTGCACCCCCTAAATAA and CTTCCTGTCGACTGCCCCCTGCT. 30ng of
genomic DNA was amplified in the presence of 3.5pmol of each primer, 0.25U Taq polymerase,
0.2mM dNTPs, 10%DMSO, 1% glycerol and 2.5mM MgCl. Cycling conditions were 95 oC for
10 min, followed by 40 cycles of 94 oC for 15s, annealing at 63oC for 30 s, and extension at 72 oC
for 1 min. The second round was performed using same concentration of the inner primers,
TGCCACTACTGCTGCTGCT and ACCTTTCCCTCGATCACCAC. Except for the addition of
3 ul of the first amplification reaction, as a template, to 27ul of the mixture, conditions were the
same as in the first amplification reaction. Cycling conditions for the second amplification were
95oC for 10 min, followed by 35 cycles at 94oC for 15 s, annealing at 58 oC for 30 s, and
extension at 72oC for 1 min. The 163 bp PCR product was sent for sequencing to Macrogen with
inner forward primer. The microsatellites 478B14-848 and 420M9-1395 were screened by the
markers/primers used to amplify the region of interest but with different PCR cycling conditions.
The microsatellite was found on the 5 region of exon of the NRG-1 gene. The amplification
reaction
was
done
using
primers
CCACATGTCCAACTGAAGAGG
and
TGATATGTATTGTTTTACACATGGAGA. The reaction volume was 10 ml, and for each PCR,
1 l of genomic DNA was amplified in the presence of 1 pmol of each primer, 0.7 U Taq
polymerase, 0.5 mM dNTPs, 1 l of glycerol, and 2.5 mM MgCl2 (buffer was supplied by the
manufacturer). Cycling conditions were 950C for 10 min, followed by 40 cycles at 94 C for 15s,
annealing at 64.2C for 30 s, and extension at 72 C for1 min,hold at 4C. The PCR product size
was 219 bp. PCR products were run in the 1% agarose gel. Ethidium bromide was used for
staining purposes and the amplified products were viewed under UV light in the Gene Doc gel
documentation system. The results obtained after the gel electrophoresis are given in the results
section.

The microsatellite 420M9-1395 was also found on the 5 region of the exon of NRG-1 gene. The
amplification reaction was done using primers TGTTGTTGTATATTTCAGAATTTCCTT and
TTTTTGCTATTCTTTCATGATTAAAAG. The reaction volume was 10 ml, and for each PCR, 1
l of genomic DNA was amplified in the presence of 1 pmol of each primer, 0.7 U Taq
polymerase, 0.5 mM dNTPs, 1 l of glycerol, and 2.5 mM MgCl2 (buffer was supplied by the
manufacturer). Cycling conditions were 95C for 10 min, followed by 40 cycles at 94 C for 15s,
annealing at 56.4C for 30 s, and extension at 72C for1 min, held at 4C. The PCR product size

was 294 bp. PCR products were run in the 1% agarose gel. Ethidium bromide was used for
staining purpose and the amplified products were visualized under UV light in the Gene Doc
gel documentation system. The results obtained after the gel electrophoresis are given in the
results section.
The Neuregulin 1 (NRG1) gene sequences from patients and controls were aligned with Human
NRG1-GGF2 gene sequence (Accession number NM_013962.2), which served as a reference
sequence. The single nucleotide polymorphism (SNP) G/A has been characterized at position 433
in NRG1 gene. The position 433, after aligning the NRG1-GGF2 gene, corresponded to position
92 in the alignment. We used NRG1-GGF2 sequence (position 92 in alignments) to locate SNP
in the test and control groups. The test and control sequences were aligned with NRG1-GGF2
sequence using ClustalW algorithm implemented in the BioEdit software, and SNPs at position
92, in the respective test and control sequences were identified, using position 92 of the NRG1GGF2 gene as reference.

Results:
Patients profile:
A total of 630 samples were collected as part of this study (Table 1). Among them 321 were cases
while 309 were controls. Of all 261 cases and 252 controls were recruited from the Lahore
center. The Karachi center provided 60 cases and 57 controls. Thus, an ethnically diverse sample
was recruited as planned. In our sample there were 418 males (181 cases; 237 controls) and 212
females (140 cases; 72 controls) thus making the sample representative in terms of gender
representation. About 40% cases had secondary school education while 73% controls had
secondary school or higher education. Approximately 8.8% cases and 76% controls were
married. 97% cases were unemployed and dependent on family/others for source of financial
support. Family history of definite mental illness was reported in 46% cases while probable
mental illness was present in 32% cases. A definite history of schizophrenia was present in 32%
cases while probable schizophrenia was present in 47% cases.
Analysis of SNP SNP8nrg433E1006 in case and control samples
The total genomic DNA was isolated and SNP8nrg433E1006 was screened by nested PCR
followed by sequencing. The gel pictures of the two microsatellite markers that were screened
using the PCR and gel electrophoresis techniques are shown in Fig 1.
The Neuregulin 1 (NRG1) gene sequences from patients and controls were aligned with Human
NRG1-GGF2 gene sequence (Accession number NM_013962.2), which served as a reference

sequence. The single nucleotide polymorphism (SNP) G/A was characterized at position 433 in
NRG1 gene. The position 433, after aligning the NRG1-GGF2 gene, corresponded to position 92
in the alignment. We used NRG1-GGF2 sequence (position 92 in alignments) to locate SNP in
the test and control groups. The test and control sequences were aligned with NRG1-GGF2
sequence using ClustalW algorithm implemented in the BioEdit software, and SNPs at position
92, in the respective test and control sequences were identified, using position 92 of the NRG1GGF2 gene as reference (Fig 2, Black arrow). The SNP was identified to be located on the
(location) at the 92nd bp of the 163bp long amplified product. The nucleotide G was present in
62% of the cases while it was present in 30% of control subjects. The analysis showed that the
odds ratio of having the schizophrenia is 3.844.00 times higher in the presence of this SNP at the
92 bp of NRG-1 gene with the 95% CI, 2.0471 to 7.2033 and highly significant P value, 0.0001
(Table 2).
Discussion:
The NRG1 gene is identified as a susceptibility gene for schizophrenia by using association
methodologies based on microsatellite markers, detecting Single Nucleotide Polymorphism
(SNPs; pronounced as SNIPS). In the present case-control study, we are investigating the
frequency of the at-risk gene markers in a Pakistani population. One of the roles that NRG1 plays
in the adult CNS is the expression and phosphorylation of certain neurotransmitter-receptor
subunits, in certain neurons and their related complexes, in an activity dependent manner (Ozaki
et al., 1997; Rieff et al., 1999; Garcia et al., 2000; Cameron et al., 2001). NRG1 does not appear
to be restricted to a single neurotransmitter system; rather, it appears to play a role in NMDA and
acetylcholine, as well as g-amino butyric acidreceptor, regulation, at least in certain neuronal
systems (Fischbach and Rosen, 1997; Ozaki et al., 1997; Rieff et al,.1999; Cameron et al., 2001).
With the completion of the Human Genome Project in April 2003, public gene databases have
led to genome wide association studies that have identified many candidate genes. However,
these findings have not always been replicated in different studies and merely signify an
association with schizophrenia. Two recent meta-analyses have supported possible linkage at 1q,
2q, 3p, 5q, 6p, 8p, 11q, 13q, 14p, 20q and 22q. Genes such as neuregulin 1 (NRG1) and catechol
O-methyltransferase (COMT) has been identified as candidates for causing schizophrenia.
Epigenetic influences such as increased methylation on DRD2 gene (which is dopamine receptor
gene) in normal individual has also been proposed which is not found in monozygotic twin with
schizophrenia. Other genes proposed in 2005 by Harrison and Weinberger included G72, DAO,
RGS4, proline dehydrogenase (PRODH), mGluR3, DISC1, COMT, Neuregulin (NRG1) and
Dysbyndin.
Catechol-O-methyl transferase (COMT) is the most plausible of the susceptibility genes. Located
on chromosome 22q11, it codes for the postsynaptic intracellular enzyme COMT, which is
involved in the methylation and degradation of the catecholamine neurotransmitters dopamine,

epinephrine, and norepinephrine. The gene has multiple variants that have an effect on its
activity. A variant with the valine-methionine configuration is known to have a protective effect
against schizophrenia as compared to the valine-valine variant which has a greater dopamine
degradation effect.
Another gene that codes for the nitric oxide synthase 1 adaptor protein (NOS1AP) is found in
high concentration in inhibitory neurons in the brain. Nitric oxide is an intracellular messenger.
Using a recently developed statistical technique of linkage disequilibrium, researchers have
succeeded in identifying a single-nucleotide polymorphism (SNP) associated with increased
levels of expression of this gene in postmortem brain samples from patients with schizophrenia.
Another gene associated with schizophrenia is RELN, which codes for the protein reelin that is
involved in the regulation of brain development and GABAergic activity. In an international
study, a common variant in this gene increased the risk of developing schizophrenia, but only in
the female population.
Numerous studies have also found evidence linking abnormalities in neurodevelopmental genes
with an increased susceptibility to schizophrenia. Genes such as DISC1, NRG1, DTNBP1 have
been associated with schizophrenia in a number of studies, but with a variability of results. Such
findings are also indicative of the hypothesis that multiple genetic variations may result in a
common clinical outcome in the case of schizophrenia. A case-control study conducted through
the collaborative efforts of researchers from University of North Carolina School of Medicine,
the Karolinska Institutet in Sweden, the Stanley Center for Psychiatric Research at the Broad
Institute of MIT and Harvard, and the Mt. Sinai School of Medicine in New York published in
2013 concluded that two genetically determined processes were of particular importance to
schizophrenia, the calcium channel pathway and the micro-RNA 137 pathway.
Despite investment of many years of research, the etiology of schizophrenia is yet to be
unraveled. The methods used for mapping susceptibility genes, including genome-wide
association studies (GWAS) and copy number variation (CNV) studies, have progressed over the
years. Even so, some patients with schizophrenia have no known family history of the disorder
and this may be the result of new mutations. Support for this phenomenon lies in the observation
that de novo mutations are more common in patients with schizophrenia as compared to the
normal population. In conclusion, many genes are associated with schizophrenia, but further
studies still need to be conducted to confirm and establish the complex causal relationships
involved in the development of this disorder.
Conclusion: The SNP was identified to be located on the (location) at the 92 nd bp of the 163bp
long amplified product. In our sample the nucleotide G was present in 62% of the cases while it
was present in 30% of control subjects. Our analysis shows that the odds ratio of having the

schizophrenia is 3.844 times higher in the presence of this SNP at the 92 bp of NRG-1 gene with
the 95% CI, 1.3852 to 11.5508 and highly significant P value, 0.01404.
References:
1. Cameron JS, Dryer L, Dryer SE b-Neuregulin-1 is required for the in vivo development
of functional Ca2_-activated K_ channels in parasympathetic neurons. Proc Natl Acad
Sci (2001); USA 98:28322836.
2. Fischbach GD, Rosen KM ARIA: a neuromuscular junction neuregulin. Annu Rev
Neurosci (1997); 20:429458.
3. Giglio S, Broman KW, Matsumoto N, Calvari V, Gimelli G,Neumann T, Ohashi H,
Voullaire L, Larizza D, Giorda R,Weber JL, Ledbetter DH, Zuffardi O .Olfactory
receptorgene clusters, genomic-inversion polymorphisms, and common chromosome
rearrangements. Am J Hum Genet (2001); 68:874883.
4. Garcia RA, Vasudevan K, Buonanno A The neuregulin receptor ErbB-4 interacts with
PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci (2000); USA 97:3596
3601.
5. Ozaki M, Sasner M, Yano R, Lu HS Buonanno A .Neuregulin-beta induces expression of
an NMDA-receptor subunit. Nature (1997); 390:691694.
6. Rieff HI, Raetzman LT, Sapp DW, Yeh HH, Siegel RE, Corfas G. Neuregulin induces
GABA(A) receptor subunit expression and neurite outgrowth in cerebellar granule cells.
7. J Neurosci (1999); 19:1075710766
8. Rosenthal D, Wender PH, Kety SS, Welner SS, Schulsinger F.The adopted away offspring of schizophrenics. Am J Psychiatry 1971; 128:397-411.
9. Stefansson H, Sarginson J, Kong A, Yates P, Steinthorsdottir V, Gudfinnsson E, et al.
Association of neuregulin 1 with schizophrenia confirmed in a Scottish population. Am J
Hum Genet 2002; 72:83-7.
10. Yu CE, Dawson G, Munson J, DSouza I, Osterling J, Estes A, Leutenegger AL, Flodman
P, Smith M, Raskind WH, Spence MA, McMahon W, Wijsman EM, Schellenberg
GD.Presence of large deletions in kindreds with autism.Am J Hum Gene t(2002) ;
71:100115.

11. . Corvin AP, Morris DW, McGhee K, Schwaiger S, Scully P, Quinn J, et al. Confirmation
and refinement of an 'at-risk' haplotype for schizophrenia suggests the EST cluster,
Hs.97362, as a potential susceptibility gene at the Neuregulin-1 locus. Mol Psychiatry.
Feb 2004;9(2):208-13.
12. Ekelund J, Hennah W, Hiekkalinna T, Parker A, Meyer J, Lnnqvist J, et al. Replication
of 1q42 linkage in Finnish schizophrenia pedigrees. Mol Psychiatry. Nov
2004;9(11):1037-41.
13. Hennah W, Thomson P, McQuillin A, Bass N, Loukola A, Anjorin A, et al. DISC1
association, heterogeneity and interplay in schizophrenia and bipolar disorder. Mol
Psychiatry. Sep 2009;14(9):865-73.
14. Huffaker SJ, Chen J, Nicodemus KK, Sambataro F, Yang F, Mattay V, et al. A primatespecific, brain isoform of KCNH2 affects cortical physiology, cognition, neuronal
repolarization and risk of schizophrenia.Nat Med. May 2009;15(5):509-18.
15. Kirov G, Ivanov D, Williams NM, Preece A, Nikolov I, Milev R, et al. Strong evidence
for association between the dystrobrevin binding protein 1 gene (DTNBP1) and
schizophrenia in 488 parent-offspring trios from Bulgaria. Biol Psychiatry. May 15
2004;55(10):971-5.
16. Mirnics K, Middleton FA, Stanwood GD, Lewis DA, Levitt P. Disease-specific changes
in regulator of G-protein signaling 4 (RGS4) expression in schizophrenia. Mol
Psychiatry. May 2001;6(3):293-301.
17. Morris DW, Rodgers A, McGhee KA, Schwaiger S, Scully P, Quinn J, et al. Confirming
RGS4 as a susceptibility gene for schizophrenia. Am J Med Genet B Neuropsychiatr
Genet. Feb 15 2004;125B(1):50-3.
18. Schindler KM, Pato MT, Dourado A, Macedo A, Azevedo MH, Kennedy JL, et al.
Association and linkage disequilibrium between a functional polymorphism of the
dopamine-2 receptor gene and schizophrenia in a genetically homogeneous Portuguese
population. Mol Psychiatry. 2002;7(9):1002-5.
19. Shifman S, Bronstein M, Sternfeld M, Pisant-Shalom A, Lev-Lehman E, Weizman A, et
al. A highly significant association between a COMT haplotype and schizophrenia. Am J
Hum Genet. Dec 2002;71(6):1296-302.
20. Steinberg S, Mors O, Brglum AD, Gustafsson O, Werge T, Mortensen PB, et al.
Expanding the range of ZNF804A variants conferring risk of psychosis. Mol Psychiatry.
Jan 2011;16(1):59-66.

21. Tang JX, Chen WY, He G, Zhou J, Gu NF, Feng GY, et al. Polymorphisms within 5' end
of the Neuregulin 1 gene are genetically associated with schizophrenia in the Chinese
population. Mol Psychiatry. Jan 2004;9(1):11-2.
22. Williams HJ, Norton N, Dwyer S, Moskvina V, Nikolov I, Carroll L, et al. Fine mapping
of ZNF804A and genome-wide significant evidence for its involvement in schizophrenia
and bipolar disorder. Mol Psychiatry. Apr 2011;16(4):429-41.

Acknowledgment:
We gratefully acknowledge the help provided by Dr Syed Hani Abidi and Dr. Syed Ali,
Department of Biological and Biomedical Sciences, Aga Khan University, with NRG-1 gene
sequence alignment and analysis. We also thank Dr Syed Ali for his continued guidance
during the project. This work was supported by Pakistan Science Foundation Grant No.
/Project No: PSF/RES/A-AKU/Med (293).

Table 1: Socio-demographic Characteristics: The socio-demographic characteristics of both cases and

controls are shown.

Variables

Cases
N=321(%)

Controls
N=305(%)

6(1.9)
62(19.4)
138(43.1)
87(27.2)
24(7.5)
3(0.9)

14(4.6)
119(39)
95(31.1)
55(18.0)
17(5.6)
5(1.6)

192(59.8)
129(40.2)

238(78.5)
65(21.5)

32(10)
60(18.8)
117(36.7)
70(21.9)
32(10)
8(2.5)

20(6.6)
55(18.1)
72(23.7)
95(31.3)
47(15.5)
15(4.9)

223(69.5)
44(13.7)
39(12.1)
1(0.3)
14(4.4)

76(24.9)
225(73.8)
1(0.3)
3(1.0)
-

267(83.4)
5(1.6)
8(2.5)
13(4.1)
8(2.5)
1(0.3)
15(4.7)
3(1.0)

1(0.3)
11(3.6)
13(4.3)
50(16.4)
120(39.5)
89(29.3)
14(4.6)
6(1.8)

Age (In Years)

< 10
11-20
21-30
31-40
41-50
51-60

61-70
Gender
Male
Female

Education
Illiterate
Primary
Secondary
Intermediate
Graduate
Postgraduate

Marital Status
Single
Married
Divorced
Widowed/er
Separated

Occupation
Unemployed
Businessmen
Housewife
Professional
Skilled laborer
Unskilled laborer
Students

Others

Religion
Islam
Christian
Hindu

319(99.4)
1(0.3)
1(0.3)

259(84.9)
43(14.1)
3(1.0)

154(48.1)
81(25.3)
85(26.6)

3(1.0)

164(51.6)
97(30.5)
21(6.6)
33(10.4)
3(0.9)
-

1(0.3)
49(16.5)
253(82.9)

103(32.2)
89(27.8)
128(40.0)
-

16(5.2)
33(10.1)
3(1.0)
253(82.9)

40(12.5)
90(28.1)
75(23.4)
41(12.8)
25(7.8)
9(2.8)
3(0.9)
37(11.6)

13(28.9)
9(20)
7(15.6)
8(17.8)
2(4.4)
3(6.7)
1(2.2)
1(2.2)
1(2.2)
-

Family History of Mental Health

Yes
No
Dont know

Past Contact
Psychiatrist
General practitioner
Hakim
Faith healer
Other
No Psychiatric visit
Not answer

Family History of Schizophrenia

Yes
No
Dont know

Birth Order
1st
2nd
3rd
4th
5th
6th
7th
8th
10th
11th
Dont know

Table 2: The frequency of SNP SNP8nrg433E1006 in NRG-1 gene in cases and control: The single
SNP G/A was characterized at position 433 in NRG1 gene. The position 433, after aligning the NRG1GGF2 gene reference sequence, corresponded to position 92 in the alignment.

Guanine (%)

Adenine (%)

Thymine (%)

Cytosine (%)

Total (%)

Samples (45)

62(62%)

53(53%)

2(2.%)

2(%)

99

Controls (26)

24(30%)

23(30%)

14(17)

9(12%)

79

Total (71)

86

76

16

11

178

Fig 1: The Gel electrophoresis for microsatellite markers: The gel images show microsatellite

markers A) 420M9-1395 and B) 478B14-848. A and B) Gel was loaded in following order L=
100 BP LADDER, 1=sample1, 2=sample1 (control), 3=sample2, 4=sample2 (control),
5=sample3, 6=sample3 (control), 7=sample4, 8=sample4 (control), 9=sample 5, 10=sample5
(control), 11=positive control.

A)

B)

Fig 2: NRG-1 Gene Sequence alignment: The Neuregulin 1 (NRG1) gene sequences from patients

and controls were aligned with Human NRG1-GGF2 gene sequence (Accession number
NM_013962.2), which served as a reference sequence. The single nucleotide polymorphism
(SNP) G/A has been characterized at position 433 in NRG1 gene. The position 433, after
aligning the NRG1-GGF2 gene, corresponded to position 92 in the alignment. The SNPs at
position 92, in the respective test and control sequences were identified, using position 92 of the
NRG1-GGF2 gene as reference. Black arrow shows position 92 in the alignments.