You are on page 1of 338

www.fullengineeringbook.

net

www.fullengineeringbook.net

Fundamentos y aplicaciones
en las ciencias de la salud

www.fullengineeringbook.net

Adriana Mara Salazar Montes


Instituto de Biologa Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Ana Soledad Sandoval Rodrguez


Instituto de Biologa Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Juan Socorro Armendriz Borunda


Instituto de Biologa Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara
O.P.D. Hospital Civil de Guadalajara Dr. Juan I. Menchaca

.9*$0r#0(05r#6&/04"*3&4r$"3"$"4r(6"5&."-"r."%3*%r/6&7":03,
4"/+6"/r4"/5*"(0r4"01"6-0r"6$,-"/%r-0/%3&4r.*-/r.0/53&"/6&7"%&-)*r4"/'3"/$*4$0r4*/("163r45-06*4r4*%/&:r5030/50

Director editorial: Javier de Len Fraga


Editor sponsor: Emilio Salas Castillo
Editor de desarrollo: Hctor F. Guerrero Aguilar
Supervisor de produccin: Juan Jos Manjarrez de la Vega

NOTA
La medicina es una ciencia en constante desarrollo. Conforme surjan nuevos conocimientos, se requerirn cambios de la
teraputica. El(los) autor(es) y los editores se han esforzado para que los cuadros de dosificacin medicamentosa sean precisos y acordes con lo establecido en la fecha de publicacin. Sin embargo, ante los posibles errores humanos y cambios en la
medicina, ni los editores ni cualquier otra persona que haya participado en la preparacin de la obra garantizan que la informacin contenida en ella sea precisa o completa, tampoco son responsables de errores u omisiones, ni de los resultados que
con dicha informacin se obtengan. Convendra recurrir a otras fuentes de datos, por ejemplo, y de manera particular, habr
que consultar la hoja informativa que se adjunta con cada medicamento, para tener certeza de que la informacin de esta
obra es precisa y no se han introducido cambios en la dosis recomendada o en las contraindicaciones para su administracin.
Esto es de particular importancia con respecto a frmacos nuevos o de uso no frecuente. Tambin deber consultarse a los
laboratorios para recabar informacin sobre los valores normales.

BIOLOGA MOLECULAR

Fundamentos y aplicaciones en las ciencias de la salud

www.fullengineeringbook.net

Prohibida la reproduccin total o parcial de esta obra,


por cualquier medio, sin autorizacin escrita del editor.

DERECHOS RESERVADOS 2013, respecto a la primera edicin en espaol por,


McGRAW-HILL INTERAMERICANA EDITORES, S.A. de C. V.
Prolongacin Paseo de la Reforma 1015, Torre A, Piso 17, Col. Desarrollo Santa Fe,
Delegacin lvaro Obregn
C. P. 01376, Mxico, D. F.
Miembro de la Cmara Nacional de la Industria Editorial Mexicana Reg. No. 736
ISBN: 978-607-15-0912-3

1234567890

2456789013

Impreso en Mxico

Printed in Mexico

Editores

Adriana Mara Salazar Montes

Centro de Investigaciones Mdicas Aplicadas. Es profesora


investigadora del Instituto de Biologa Molecular en Medicina y Terapia Gnica, responsable del rea de Terapia
Celular. Es profesora del Doctorado en Ciencias en Biologa
Molecular en Medicina de la Universidad de Guadalajara.
En la actualidad es editora asociada de la Revista Archivos
de Ciencias, rgano ocial del Centro Universitario de
Ciencias de la Salud.

Licenciada en Biologa. Maestra en Ciencias en Biologa


Celular. Doctorado en Ciencias en Biologa Molecular en
Medicina. Universidad de Guadalajara. Posdoctorado en la
Universidad de Tus, Boston, Estados Unidos.
Obtuvo Doctorado en la Universidad de Guadalajara en
el rea de Biologa Molecular y realiz su estancia posdoctoral en la Universidad de Tus, en Boston, Estados Unidos.
Es profesora investigadora y en este momento encargada
del Instituto de Biologa Molecular en Medicina y Terapia
Gnica. Es profesora del Doctorado en Ciencias en Biologa
Molecular en Medicina y del Doctorado en Farmacologa
de la Universidad de Guadalajara. En la actualidad es editora asociada de la Revista Archivos de Ciencias, rgano ocial del Centro Universitario de Ciencias de la Salud.

Juan Armendriz Borunda


Licenciado en Farmacologa. Maestra y Doctorado en Bioqumica en el Centro de Investigaciones y Estudios Avanzados del Instituto Politcnico Nacional. Posdoctorado en la
Universidad de Tennessee, Memphis, Estados Unidos.
Obtuvo Doctorado en Bioqumica en el Centro de
Investigaciones y Estudios Avanzados del Instituto Politcnico Nacional, y Posdoctoral en la Universidad de Tennessee, Memphis, Estados Unidos. Es profesor investigador del
Instituto de Biologa Molecular en Medicina y Terapia
Gnica y actualmente jefe del Departamento de Biologa
Molecular y Genmica. Es profesor del Doctorado en Ciencias en Biologa Molecular en Medicina, del Doctorado en
Gentica y del Doctorado en Ciencias Biomdicas de la
Universidad de Guadalajara. En la actualidad es editor de la
Revista Archivos de Ciencias, rgano ocial del Centro Universitario de Ciencias de la Salud.

www.fullengineeringbook.net

Ana Soledad Sandoval Rodrguez

Quimicofarmacobiloga de formacin con Doctorado en


Ciencias Biomdicas, con orientacin en Inmunologa.
Universidad de Guadalajara. Posdoctorado en el Centro de
Investigaciones Mdicas Aplicadas de la Universidad de
Navarra, en Espaa.
Obtuvo Doctorado en la Universidad de Guadalajara en
el rea de las Ciencias Biomdicas. Realiz su estancia posdoctoral en la Universidad de Navarra, en Espaa, en el

iii

Colaboradores

Blanca Estela Alcntar Daz

Adriana Daz Rivera

Doctora en Ciencias en Biologa Molecular en Medicina.


Universidad Autnoma de Nayarit.

Licenciatura en Biologa. Doctorado en Ciencias en


Biologa Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara.

Bertha Adriana lvarez Rodrguez


Martha Escoto Delgadillo

Doctora en Gentica. Departamento de Biologa


Molecular y Genmica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Doctora en Ciencias en Biologa Celular. Instituto de


Patologa Infecciosa y Experimental Dr. Francisco Ruiz
Snchez de la Universidad de Guadalajara. Centro de
Investigaciones Biomdicas de Occidente, Instituto
Mexicano del Seguro Social.

Juan Armendriz Borunda


Doctor en Bioqumica. Instituto de Biologa Molecular en
Medicina y Terapia Gnica, Departamento de Biologa
Molecular y Genmica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Luca Flores Contreras

www.fullengineeringbook.net
Licenciatura en Biologa. Doctorado en Gentica. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Blanca Estela Bastidas Ramrez

Doctora en Ciencias en Biologa Molecular en Medicina.


Instituto de Enfermedades Crnico Degenerativas,
Departamento de Biologa Molecular y Genmica,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Jorge Fernando Floresvillar Mosqueda


Licenciatura en Microbiologa. Doctorado en Ciencias
Biomdicas. Orientacin Inmunolgica. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

scar Gabriel Bjar Meja

Jess Javier Garca Bauelos

Licenciatura en Deportes. Especialidad en Natacin.


Consejo Municipal del Deporte de Guadalajara.

Doctor en Ciencias en Biologa Molecular en Medicina.


Instituto de Biologa Molecular y Terapia Gnica,
Departamento de Biologa Molecular y Genmica,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Miriam Ruth Bueno Topete


Doctora en Ciencias en Biologa Molecular en Medicina.
Instituto de Enfermedades Crnico Degenerativas,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Belinda Claudia Gmez Meda


Doctora en Gentica. Instituto de Biologa Molecular en
Medicina y Terapia Gnica, Departamento de Biologa
Molecular y Genmica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Paola B. Castro Garca


Doctora en Neurociencias. Posdoctoral en Division of
Stem Cell Biology. Institute for Genetic Medicine,
Hokkaido University.

iv

Colaboradores

Jaime Gonzlez Cuevas

Selene Guadalupe Huerta Olvera

Doctor en Ciencias en Biologa Molecular en Medicina.


Instituto de Biologa Molecular en Medicina y Terapia
Gnica, Departamento de Biologa Molecular y
Genmica, Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara.

Doctora en Toxicologa. Departamento de Ciencias


Mdicas y de la Vida, Centro Universitario de la
Cinega, Universidad de Guadalajara. OPD Hospital
Civil de Guadalajara Dr. Juan I. Menchaca.

Mara Cristina Islas Carbajal


Anglica Sofa Gonzlez Garibay
Licenciatura en Nutricin. Doctorado en Ciencias en
Biologa Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara.

Doctora en Ciencias en Biologa Molecular en


Medicina. Instituto de Investigacin Cardiovascular,
Departamento de Fisiologa, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Daniela Gordillo Bastidas

David Alejandro Lpez de la Mora

Doctora en Ciencias en Biologa Molecular en Medicina.


Coordinacin de la Carrera de Nutricin, Instituto
Tecnolgico y de Estudios Superiores de Monterrey.

Licenciatura en Quimicofarmacobilogo. Doctorado en


Ciencias en Biologa Molecular en Medicina. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Elizabeth Gordillo Bastidas


Doctora en Ciencias en Biologa Molecular en Medicina.
Departamento de Biologa Molecular y Genmica,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Alfonso Lpez Vzquez


Licenciatura en Mdico Cirujano Partero. Doctorado en
Ciencias en Biologa Molecular en Medicina. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

www.fullengineeringbook.net

Csar Guardado Mora

Licenciatura en Quimicofarmacobilogo. Instituto de


Biologa Molecular en Medicina y Terapia Gnica,
Departamento de Biologa Molecular y Genmica,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Jos Guadalupe Macas Barragn

Doctor en Ciencias Biomdicas. Orientacin


Inmunolgica. Departamento de Ciencias Naturales y
Exactas, Centro Universitario de los Valles, Universidad
de Guadalajara.

Carmen Magdalena Gurrola Daz

Ana Laura Mrquez Aguirre

Doctorado en Ciencias, Patologa Molecular y Biologa


Molecular del Cncer. Instituto de Enfermedades
Crnico Degenerativas, Departamento de Biologa
Molecular y Genmica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Doctorado en Ciencias Biomdicas con Orientacin en


Inmunologa. Centro de Investigacin y Asistencia en
Tecnologa y Diseo del Estado de Jalisco.

Zamira Helena Hernndez Nazar

Doctora en Ciencias Biomdicas. Orientacin


Inmunolgica. Universidad Autnoma de Nayarit.

Doctora en Ciencias en Biologa Molecular en Medicina.


Instituto de Enfermedades Crnico Degenerativas,
Departamento de Biologa Molecular y Genmica,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Abril Bernardette Martnez Rizo

Carlos Mata Mungua


Doctor en Gentica. Centro de Investigaciones Biomdicas
de Occidente, Instituto Mexicano del Seguro Social.

Luis Daniel Hernndez Ortega

Mayra Guadalupe Mena Enrquez

Licenciatura en Quimicofarmacobilogo. Doctorado en


Ciencias en Biologa Molecular en Medicina. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Licenciatura en Biologa. Doctorado en Gentica. Centro


Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

vi

Colaboradores

Alejandra Meza Ros

Mara Guadalupe Snchez Parada

Licenciatura en Quimicofarmacobilogo. Doctorado en


Ciencias en Biologa Molecular en Medicina. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Licenciatura en Mdico Cirujano Partero. Doctorado en


Gentica. Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Ana Soledad Sandoval Rodrguez


Silvia Mora Lee
Doctora en Neurociencias. Laboratorio de Ciencias
Biomdicas y Biotecnologa, Departamento de Ciencias
Naturales y Exactas, Centro Universitario de los Valles,
Universidad de Guadalajara.

Doctora en Ciencias Biomdicas. Orientacin


Inmunolgica. Instituto de Biologa Molecular en
Medicina y Terapia Gnica, Departamento de Biologa
Molecular y Genmica, Centro Universitario de
Ciencias de la Salud, Universidad de Guadalajara.

Jos Navarro Partida

Pablo Manuel Saucedo Galindo

Doctor en Ciencias en Biologa Molecular en Medicina.


Instituto de Biologa Molecular en Medicina y Terapia
Gnica, Departamento de Biologa Molecular y
Genmica, Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara.

Entrenador.

Viviana Carolina Nez Valdez


Licenciatura en Biologa. Doctorado en Ciencias en
Biologa Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara.

Eduardo Vzquez Valls


Maestro en Ciencias en Biologa Celular. Instituto de
Patologa Infecciosa y Experimental Dr. Francisco Ruiz
Snchez de la Universidad de Guadalajara. Centro de
Investigaciones Biomdicas de Occidente, Instituto
Mexicano del Seguro Social.

Jos Mara Vera Cruz

www.fullengineeringbook.net

Ana Rosa Rincn Snchez

Doctora en Farmacologa. Instituto de Investigacin


Cardiovascular, Departamento de Fisiologa, Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Doctor en Ciencias en Biologa Molecular en Medicina.


Instituto de Biologa Molecular en Medicina y Terapia
Gnica, Departamento de Biologa Molecular y
Genmica, Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara.

Ana Lourdes Zamora Prez


Samantha Rivero-Borrel Sandoval
Licenciatura en Mdico Cirujano Partero. Centro
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.

Doctora en Gentica. Instituto de Investigacin en


Odontologa, Departamento de Clnicas Odontolgicas
Integrales, Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Adriana Mara Salazar Montes

Guillermo Moiss Ziga Gonzlez

Doctora en Ciencias en Biologa Molecular en Medicina.


Instituto de Biologa Molecular en Medicina y Terapia
Gnica, Departamento de Biologa Molecular y
Genmica, Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara.

Doctor en Gentica. Laboratorio de Mutagnesis, Divisin


de Medicina Molecular, Centro de Investigacin
Biomdica de Occidente, Instituto Mexicano del Seguro
Social.

Laura Vernica Snchez Orozco


Doctora en Ciencias en Biologa Molecular en Medicina.
Instituto de Enfermedades Crnico Degenerativas,
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara.

Contenido

Captulo 5

Prlogo

Transcripcin

Parte I

44

Zamira Helena Hernndez Nazar

Conceptos bsicos
de biologa molecular

Captulo 6

Traduccin

Captulo 1
Historia de la biologa molecular

52

Jos Mara Vera Cruz


Bertha Adriana lvarez Rodrguez
Belinda Claudia Gmez Meda

Jos Mara Vera Cruz


Adriana Mara Salazar Montes
Csar Guardado Mora
Juan Armendriz Borunda

Captulo 7

www.fullengineeringbook.net
Regulacin de la expresin gnica
Adriana Mara Salazar Montes
Ana Soledad Sandoval Rodrguez
Juan Armendriz Borunda

Captulo 2
Ciclo celular

15

Captulo 8

Blanca Estela Alcntar Daz


Luis Daniel Hernndez Ortega
Adriana Mara Salazar Montes

Mutaciones

Mara Guadalupe Snchez Parada


Belinda Claudia Gmez Meda

Captulo 3
Estructura de cidos nucleicos

25

Captulo 9

Jos Navarro Partida


Mayra Mena Enrquez

Mecanismos de reparacin
del ADN
82

Captulo 4
Replicacin

75

Mayra Guadalupe Mena Enrquez


Luca Flores Contreras
Ana Soledad Sandoval Rodrguez
Juan Armendriz Borunda

36

Jorge Fernando Floresvillar Mosqueda


Jos Guadalupe Macas Barragn

vii

66

viii

Contenido

Parte II

Captulo 16

Metodologa del ADN


recombinante
91

Reaccin en cadena
de la polimerasa
145
Ana Soledad Sandoval Rodrguez
Alejandra Meza Ros
Jorge Fernando Floresvillar Mosqueda

Captulo 10
Manejo de muestras
para estudios moleculares

93

Captulo 17
Secuenciacin del ADN
y microarreglos
160

Jess Javier Garca Bauelos


Blanca Estela Bastidas Ramrez
Elizabeth Gordillo Bastidas
Daniela Gordillo Bastidas

Belinda Claudia Gmez Meda


Guillermo Moiss Ziga Gonzlez
Jos Mara Vera Cruz
Bertha Adriana lvarez Rodrguez

Captulo 11
Mtodos de extracccin de cidos
nucleicos
99
Ana Soledad Sandoval Rodrguez
Abril Bernardette Martnez Rizo
David Alejandro Lpez de la Mora

Captulo 18
Polimorsmos de ADN
y huella gentica
171
Belinda Claudia Gmez Meda
Ana Lourdes Zamora Prez
Mara Guadalupe Snchez Parada

Captulo 12

www.fullengineeringbook.net

Electroforesis

110

David Alejandro Lpez de la Mora


Ana Soledad Sandoval Rodrguez

Bases moleculares
de las enfermedades

Captulo 13
Enzimas de restriccin

Captulo 19
Bases moleculares
de las patologas humanas

Captulo 14

183

Jos Macas Barragn


Selene Guadalupe Huerta Olvera

Vectores de clonacin
y expresin
127

Captulo 20

Ana Soledad Sandoval Rodrguez


Mayra Mena Enrquez
Ana Laura Mrquez Aguirre

Enfermedades monognicas

191

Silvia Mora Lee


Paola B. Castro Garca

Captulo 15
Miriam Ruth Bueno Topete
Jaime Gonzlez Cuevas

181

120

Jaime Gonzlez Cuevas


Miriam Ruth Bueno Topete
Ana Soledad Sandoval Rodrguez

Tcnicas de hibridacin

Parte III

139

Captulo 21
Bases moleculares del cncer
Carmen Magdalena Gurrola Daz

197

Contenido

Captulo 22

Adriana Mara Salazar Montes


Adriana Daz Rivera

Bases moleculares
de la diabetes mellitus

204

Ana Rosa Rincn Snchez


Mara Cristina Islas Carvajal

Captulo 23

Animales transgnicos
y clonacin
268
Jess Javier Garca Bauelos
Blanca Estela Bastidas Ramrez
Juan Armendriz Borunda

Bases moleculares
de la obesidad
218
Blanca Estela Bastidas Ramrez
Anglica Sof a Gonzlez Garibay
Alfonso Lpez Vzquez
Viviana Carolina Nez Valdez

Captulo 24
Bases moleculares
de la hepatitis B

Captulo 28

227

Laura Vernica Snchez Orozco


Miriam Ruth Bueno Topete
Juan Armendriz Borunda

Captulo 29
Nutrigenmica
y nutrigentica

277

Blanca Estela Bastidas Ramrez


Jess Javier Garca Bauelos
Elizabeth Gordillo Bastidas
Daniela Gordillo Bastidas

Captulo 30
Biologa molecular
del deporte
287

www.fullengineeringbook.net

Captulo 25

Bases moleculares
de la hepatitis C

235C

Laura Vernica Snchez Orozco


David A. Fernndez Galindo
Miriam Ruth Bueno Topete
Juan Armendriz Borunda

scar Gabriel Bjar Meja


Ana Soledad Sandoval Rodrguez
Pablo Manuel Saucedo Galindo
Samantha Rivero-Borrel Sandoval

Captulo 31
Dopaje gnico 298

Captulo 26
Bases moleculares del virus de la
inmunodeciencia humana
241
Martha Escoto Delgadillo
Carlos Mata Mungua
Eduardo Vzquez Valls

Ana Soledad Sandoval Rodrguez


scar Gabriel Bjar Meja
Adriana Mara Salazar Montes
Jess Javier Garca Bauelos

Captulo 32
Proyecto del Genoma Humano:
aportaciones a la medicina
305

Parte IV
Tpicos selectos

255

Adriana Mara Salazar Montes


Luis Daniel Hernndez Ortega
Juan Armendriz Borunda

Captulo 27
Terapia gnica

257

Ana Soledad Sandoval Rodrguez


Juan Armendriz Borunda

ndice alfabtico

ix

Agradecimientos

Escribir un libro de texto es tarea muy complicada, pero


si este trabajo se concluye de manera exitosa es en buena
medida gracias a las personas que inuyen en su realizacin. Queremos manifestar nuestro agradecimiento a quienes, de forma directa o indirecta, contribuyeron al resultado
que el lector tiene en sus manos.
En primer lugar, a los miembros del comit editorial,
con cuyos comentarios y nuestras discusiones sobre los
temas y captulos estuvieron siempre solcitos a enriquecer
el contenido con sus puntos de vista, a cualquier hora del
da.
A todos y cada uno de los colaboradores de los captulos que conforman esta obra, por el tiempo dedicado y
el empeo dispuesto para que este libro de texto sea comprensible al alumno de pregrado, donde comparten sus

conocimientos en las diferentes ramas y aplicaciones de la


Biologa Molecular.
A los alumnos de los cursos de Biologa Molecular de
pregrado y posgrado, quienes con sus preguntas, dudas y
comentarios enriquecieron los temas que abarca este libro.
Mucho de lo que aprendimos respecto de la manera de
redactar dichos temas con mayor claridad fue impartiendo
estos cursos. Gracias a todos ellos.
A la editorial McGraw-Hill, que tuvo gran paciencia
con este proyecto y persever en su edicin, correccin y
elaboracin. Por su enorme entusiasmo y dedicacin, nuestro sincero agradecimiento.

Los autores

www.fullengineeringbook.net

Prlogo

El enorme avance de la biologa molecular en los ltimos


sesenta aos ha venido a revolucionar la manera de visualizar la medicina y la biologa en general. En el rea de la biologa molecular, todos los das se publican datos nuevos que
nos permiten una mejor comprensin y un entendimiento
ms amplio de los procesos biolgicos. Aunque la estructura y funcin de los genes en el genoma humano parece
simple, al adentrarnos un poco ms en su estudio nos asombramos de cun complejos son. Los estudios logrados en el
campo de la biologa molecular aplicados a la medicina y a
la ingeniera gentica han generado enormes avances como
consecuencia del entendimiento de las bases moleculares
de los fenmenos biolgicos que suceden en el organismo,
lo que en el campo de la medicina ha permitido ofrecer a los
pacientes diagnsticos y tratamientos ms certeros, logrando as establecer una conexin estrecha antes inexistente
entre las ciencias bsicas y las disciplinas clnicas. Podemos
nalmente entender la importancia que ha cobrado la biologa molecular en el desarrollo de la vida moderna, por
lo cual mltiples universidades la han incluido dentro de
sus planes de estudios como una materia obligatoria. Esta
medida pretende que los estudiantes de las ciencias de la
salud, tanto de licenciatura como de maestra y doctorado, conjunten los conocimientos pasados con los actuales
y sean capaces de entender los mecanismos moleculares
que suceden dentro de las clulas de todos los organismos
vivos, y cmo un agente gentico, un microorganismo o un
factor ambiental puede modicarlos, ocasionando as una
patologa.
Este libro ofrece al lector adentrarse en el campo de la
biologa molecular al presentarle un panorama general y a
la vez profundo de cada uno de los temas planteados, con
un abordaje sencillo y didctico de los eventos moleculares

que ocurren dentro de nuestras clulas, de las principales


tcnicas empleadas en un laboratorio de biologa molecular
para su estudio y aplicadas al diagnstico, y de qu manera,
con ayuda de la biotecnologa y la ingeniera gentica, estos
procesos pueden ser modicados con la nalidad de mejorar o revertir el curso de un proceso siolgico anormal,
con intencin de regresar al organismo a la homeostasis.
El texto est dividido en cuatro partes: la primera se
enfoca a estudiar los aspectos bsicos de la biologa molecular, la estructura y funcin de las principales molculas
que participan en el ujo de la informacin gentica como
lo son el ADN, el ARN y las protenas, as como los mecanismos que controlan su sntesis. Tambin se expone con
detalle aquellos mecanismos involucrados en el control de
la expresin de los genes de manera positiva y negativa. La
segunda parte presenta las principales tcnicas de biologa
molecular e ingeniera gentica aplicadas a la medicina,
con el n de ofrecer a los pacientes diagnsticos ms certeros y oportunos. La tercera seccin muestra un panorama
amplio de las bases moleculares implicadas en el desarrollo
de diversas patologas humanas, y por ltimo, la cuarta parte brinda una revisin actual de temas especializados y de
inters general, como terapia gnica, organismos transgnicos, dopaje gnico, nutrigenmica y proyecto del genoma
humano. Sin lugar a dudas, el presente libro representa una
herramienta muy til para el estudio de la biologa molecular en el rea de las ciencias de la salud, y estamos seguros
de que su lectura desarrollar en los estudiantes el gusto por
esta fascinante rama de la ciencia.

www.fullengineeringbook.net

Rui Prez Tamayo

xi

www.fullengineeringbook.net

www.fullengineeringbook.net

Parte I

Conceptos bsicos
de biologa molecular
Contenido
Captulo 1
Captulo 2
Captulo 3
Captulo 4
Captulo 5
Captulo 6
Captulo 7
Captulo 8
Captulo 9

Historia de la biologa molecular


Ciclo celular
cidos nucleicos
Replicacin
Transcripcin
Traduccin
Regulacin de la expresin gnica
Mutaciones
Mecanismos de reparacin del ADN

www.fullengineeringbook.net

Captulo

Historia de la biologa molecular


Jos Mara Vera Cruz / Adriana Mara Salazar Montes
Csar Guardado Mora / Juan Armendriz Borunda

Introduccin

Friedrich Miescher

La historia de la biologa molecular implica muchas historias


y todas ellas se encuentran entrelazadas. Sera muy complicado tratar de describirlas de manera individual y ms si se
presta atencin a todos los acontecimientos que han tenido
impacto en esta ciencia. Por ello, en este captulo slo se van
a considerar algunos de los sucesos que han dejado huella de
manera signicativa en el desarrollo del rea de la biologa
que hoy se conoce como biologa molecular.

Entre 1868 y 1869, el qumico suizo Friedrich Miescher


(gura 1-3), siendo posdoctorado en el laboratorio de
Hoppe-Seyler (el acuador del trmino biochimie), aisl
los ncleos a partir de clulas presentes en pus de vendajes
quirrgicos, y comprob que los ncleos contenan una
sustancia qumica homognea y no proteica a la que denomin nuclena (el trmino cido nucleico fue acuado
posteriormente, en 1889, por Richard Altman). Segn sus
palabras, la nuclena es una sustancia rica en fsforo localizada exclusivamente en el ncleo celular; as, prepar el
camino para la identicacin de la molcula portadora de la
informacin hereditaria, el ADN. Ese hecho excepcional
hizo que Hoppe-Seyler decidiera demorar hasta 1871 la
publicacin de estos resultados, a la espera de la conrmacin denitiva. Al principio esta investigacin no pareci
relevante, hasta que Albrecht Kossel llev a cabo sus primeras investigaciones sobre la estructura qumica de la
nuclena. En 1888, Kossel demostr que la nuclena de Miescher contena protenas y molculas bsicas ricas en nitrgeno, lo que llev a la identicacin de lo que hoy se conoce
como bases nitrogenadas. Tambin demostr la presencia
de un glcido de cinco tomos de carbono. Por este trabajo
se le otorg el Premio Nobel de Fisiologa en 1910. Su vocacin investigadora le introdujo en el rea de la siologa
celular, donde destac la importancia de las enzimas e intuy el papel de los cidos nucleicos en la herencia.

www.fullengineeringbook.net

Charles Darwin
Esta historia comienza a principios del siglo xix, cuando
Charles Darwin (gura 1-1) propuso la teora del origen de
las especies, en la que se plantea la preservacin de las
caractersticas ms favorables de un organismo como consecuencia de un cambio en la secuencia del ADN, lo que en
la actualidad se conoce como mutacin.

Gregor Mendel
Posteriormente, en 1865, Johann Gregor Mendel, un monje
agustino (gura 1-2), publica sus experimentos con plantas
hbridas, y llama a los resultados de su investigacin Leyes
de la herencia, por lo que se le considera el padre de la
gentica.
Estos experimentos causaron un gran impacto en la
comunidad cientca, y le permitieron deducir que las
caractersticas del organismo estn determinadas por un
par de factores, aportados por cada progenitor. Estas unidades hereditarias (genes) no se mezclan sino que se
transmiten con toda la informacin, y uno de los factores
resulta dominante sobre el otro (recesivo), lo que da origen
a la formulacin de las leyes fundamentales de la herencia.
Sin embargo, nunca se pregunt por la naturaleza qumica
de los genes ni por su localizacin dentro de las clulas.

Thomas Hunt Morgan


En 1909, Thomas Hunt Morgan (gura 1-4), en la Universidad de Columbia, realiz unos experimentos hoy considerados clsicos sobre los rasgos genticos ligados al sexo, lo
que le hizo acreedor del Premio Nobel en 1933. Sus contribuciones cientcas ms importantes se centraron en el
campo de la gentica, y demostr que los cromosomas son
3

PARTE I Conceptos bsicos de biologa molecular

Figura 1-1. Charles Darwin.

portadores de los genes, lo que dio lugar a lo que se conoce


como la teora cromosmica de Sutton y Boveri. Gracias a
su trabajo, la Drosophila melanogaster se convirti en uno
de los principales modelos en gentica.
En 1910 descubri una mosca mutante de ojos blancos
entre individuos de estirpe silvestre de ojos rojos. La progenie del cruzamiento de un macho de ojos blancos con una
hembra de ojos rojos present ojos rojos, lo que indicaba
que el caracter ojos blancos era recesivo. Morgan denomin white al gen correspondiente, e inici as la tradicin de
nombrar a los genes segn el fenotipo causado por sus alelos. Al cruzar estas moscas entre s, se percat de que slo los
machos mostraban el caracter ojos blancos. De sus experimentos, concluy que:

Figura 1-3. Friedrich Miescher.

1. Algunos caracteres se heredan ligados al sexo.


2. El gen responsable del caracter ojos blancos est en el
cromosoma X.
3. Existe la posibilidad de que otros genes tambin residan
en cromosomas especcos.

Hunt y sus estudiantes analizaron las caractersticas de


miles de moscas y estudiaron su herencia. Empleando la
recombinacin de los cromosomas, Morgan y Alfred Sturtevant prepararon un mapa con la localizacin de los genes
en el cromosoma. Los resultados de sus investigaciones les
permitieron escribir el libro El mecanismo de la herencia
mendeliana.
Morgan tambin descubri que algunas enfermedades,
como la alcaptonuria, tienen su origen en una enzima
defectuosa, fenmeno descrito por el f sico ingls Archibald Garrod, que observ que las personas con ciertas
anormalidades genticas (errores innatos del metabolismo)
carecan de ciertas enzimas. Con esta observacin se relacion a las protenas (enzimas) con los cambios genticos.
En 1913, Calvin Bridges demostr que los genes estn en los
cromosomas; asimismo, Alfred Henry Sturtevant (como

Figura 1-2. Gregor Mendel.

Figura 1-4. Thomas Hunt Morgan.

www.fullengineeringbook.net

CAPTULO 1 Historia de la biologa molecular

ADN como material gentico


Frederick Grifth

Figura 1-5. Frederick Grifth.

Bridges, alumno de Morgan), demostr que algunos genes


tienden a heredarse juntos y dedujo que se localizan en el
mismo cromosoma.
En 1915 quedaron denitivamente establecidas las
bases fundamentales de la herencia fenotpica y se public
el libro El mecanismo de la herencia mendeliana, escrito
por Thomas H. Morgan, Alfred Sturtevant, Hermann
Muller y Calvin Bridges, en el que se establecan de forma
denitiva las bases fundamentales de la herencia genotpica, se iniciaba la teora cromosmica de la herencia y se
consolidaba la edad de oro de la gentica clsica.

Ocial mdico y genetista britnico. En 1928 realiz lo que se


conoce como experimento de Grith, en el que descubri
el principio transformante, que hoy se conoce como ADN.
El experimento de Grith (gura 1-6) tuvo lugar mientras investigaba una vacuna para prevenir la neumona
durante la pandemia de gripe que se produjo tras la Primera
Guerra Mundial. Para ello us dos cepas de la bacteria
Streptococcus pneumoniae: la cepa S (virulenta), que contena una cpsula de polisacridos, y la R (no virulenta), que
careca de ella. Cuando se inyectaba a ratones la cepa S causaba neumona y muerte en un da o dos, ya que la cpsula
permita a la bacteria resistir los ataques del sistema inmune del hospedero. Cuando se inyectaba la cepa R no causaba
neumona. Si la cepa S se calentaba para matarla y se inyectaba en ratones perda su virulencia y los ratones no desarrollaban neumona. Sin embargo, si se inyectaban bacterias
muertas de la cepa S mezcladas con bacterias vivas de la
cepa R (S/R), los ratones infectados moran.
Al aislar la bacteria en la sangre de estos ratones se descubri que la cepa R, anteriormente avirulenta, presentaba
cpsula y se transformaba en S. As, Grith hipotetiz que
exista un principio transformante presente en las bacterias
muertas de la cepa S que haca que las bacterias de la cepa R
se transformaran en bacterias de tipo S.

www.fullengineeringbook.net
Bacterias
virulentas (S)
encapsuladas
1

Bacterias
avirulentas (R) no
encapsuladas

S1

William Thomas Astbury

En 1938, sir William Thomas Astbury (gura 1-7) y Florence Bell, de la Universidad de Leeds, en Inglaterra, al realizar

S1

Figura 1-6. Experimento del principio transformante.

S/R

PARTE I Conceptos bsicos de biologa molecular

estudios de difraccin por rayos X, propusieron que el ADN


era una bra compuesta de bases nitrogenadas apiladas a
0.33 nm unas de otras, perpendiculares al eje de la molcula. Astbury sigui trabajando en el estudio de la estructura
de protenas brosas, como las queratinas, en lana. Su perseverancia y dedicacin lograron que en 1945 consiguiera la
primera ctedra de Estructura Biomolecular. Adems, fue
el primer cientco en autodenominarse bilogo molecular,
aprovechando que en 1938, Warren Weaver haba acuado el
trmino biologa molecular. El nombramiento de Astbury
marc el nacimiento de la biologa molecular como un rea
de conocimiento independiente.

George Wells Beadle


y Edward Lawrie Tatum
En 1941, George Wells Beadle y Edward Lawrie Tatum
(gura 1-8), en la Universidad de Stanford, California,
encontraron slidas evidencias de una correlacin entre los
genes y las enzimas en el hongo Neurospora crassa, mediante el estudio de rutas metablicas implicadas en la sntesis
de los aminocidos. Sus experimentos consistan en exponer a Neurospora crassa a rayos X que causaban mutaciones
que originaban cambios en las enzimas implicadas en rutas
metablicas. Sus resultados, publicados en 1941, proponan
un vnculo directo entre los genes y las enzimas, conocido
como la hiptesis Un gen, una enzima. Posteriormente,
en 1943, el mdico italiano Salvador E. Luria, conocido por
el medio de cultivo para E. coli LB (Luria broth), y Max Delbrck demostraron que las mutaciones en E. coli ocurran
de forma espontnea, sin necesidad de exposicin a agentes
mutagnicos, y que stas se transmitan siguiendo las leyes de
la herencia. Estos autores postularon que las mutaciones
son las causantes de la resistencia de las bacterias a frmacos. A Luria, Delbrck y Alfred Day Hershey se les otorg el

Figura 1-8. George Wells Beadle y Edward Lawrie Tatum.

Premio Nobel de Fisiologa en 1963 por sus descubrimientos acerca del mecanismo de replicacin de los virus y su
estructura gentica.

Oswald Theodore Avery, Colin MacLeod


y Maclyn McCarty
En 1944, Avery, MacLeod y McCarty (gura 1-9) demostraron que las cepas inocuas de neumococo estudiadas por
Grith se transformaban en patgenas al adquirir la molcula de ADN y no protenas, como se crey en un principio,
y demostraron as que el principio transformante era ADN.
MacLeod, empleando renadas tcnicas desarrolladas por l
mismo, aisl el principio transformante de muestras de neumococos biolgicamente activo. Este compuesto se trat
con proteasas (enzimas que degradan protenas), lipasas
(enzimas que degradan lpidos) y glucosidasas (enzimas que
degradan carbohidratos), con la nalidad de conocer su
naturaleza qumica. El tratamiento con estas enzimas no
logr inactivar su accin. El anlisis permiti suponer que el
factor transformante podra estar compuesto por cidos
nucleicos, ya que su peso molecular era alto y se precipitaba
en presencia de alcohol. El tratamiento con ribonucleasa
(enzima que degrada el ARN), tampoco produca su inactivacin. Slo cuando el principio se trataba con desoxirribo-

www.fullengineeringbook.net

Figura 1-7. William Thomas Astbury.

Figura 1-9. Oswald Theodore Avery, Colin MacLeod y Maclyn


McCarty.

CAPTULO 1 Historia de la biologa molecular

nucleasa (enzima que degrada el ADN) se perda su accin.


De esta manera se demostr que la naturaleza qumica del
principio transformante era ADN y era el causante de producir los cambios permanentes heredables.

NH

Alfred Hershey y Martha Chase


En 1952, Alfred Hershey y Martha Chase (tambin conocida como Martha C. Epstein; gura 1-12), utilizando bacterifagos (virus que infectan bacterias) marcados con
istopos radiactivos 35S o 32P (el azufre como elemento qumico propio de las protenas y el fsforo del ADN), demostraron que cuando un virus infecta a una bacteria
solamente penetra el ADN viral. La cpside viral no se
introduce a la bacteria y, por lo tanto, no participa en la
formacin de nuevas partculas virales, y concluyeron que
el ADN, y no las protenas, contiene la informacin gentica para la sntesis de nuevos viriones.

NH

CH2
HC

CH

CH2
N

Erwin Chargaff
En 1950, Erwin Charga (gura 1-10) descubre las leyes
que rigen la complementariedad de bases de los cidos
nucleicos. Mediante cromatograf a en papel, Charga
demostr que el ADN aislado de diferentes organismos
contiene la misma proporcin de Adeninas y de Timinas,
as como de citosinas y de guaninas. Asimismo, demostr
que el porcentaje de bases purinas era igual al de bases pirimidinas (vase el captulo 3). Con estos descubrimientos se
fundament el principio de complementariedad de las
bases de los cidos nucleicos (gura 1-11).
Esta regla tuvo sentido slo hasta que James Dewey
Watson y Francis Harry Compton Crick propusieron su
modelo de la estructura del ADN. En ese mismo ao, lord
Alexander Robertus demostr que los nucletidos se
unan al ADN a travs de enlaces fosfodister, por lo que
propuso una estructura lineal para la cadena de ADN.

CH2

CH

H
N

NH

CH

NH

C
CH
Citosina

NH

NH
Guanina

O
H

CH3
H

CH

NH

NH

HC

CH

CH2
N

H
N

NH

CH2

CH
CH

NH

CO
CH2

NH

Timina
Adenina

Figura 1-11. Reglas de Chargaff.

www.fullengineeringbook.net

Figura 1-10. Erwin Chargaff.

Rosalind Franklin

Entre 1950 y 1953, la mayor parte de la comunidad cientca comenzaba a admitir que el material gentico es el ADN.
La quimicof sica Rosalind Elsie Franklin, mediante estudios
de difraccin de rayos X, descubri que el ADN presentaba
los grupos fosfato hacia el exterior y poda hallarse de dos
formas helicoidales distintas: las que hoy conocemos como
ADN-A y ADN-B (vase el captulo 3).

Figura 1-12. Martha Chase y Alfred Hershey.

PARTE I Conceptos bsicos de biologa molecular

Pares de bases

Figura 1-13. Rosalind Franklin.

Adenina

Timina

Guanina

Citosina

Esqueleto de
azcar-fosfatos

James Dewey Watson


y Francis Harry Compton Crick
En 1953, el bioqumico estadounidense Watson y el biof sico ingls Crick (gura 1-14) elaboraron el famoso modelo
de la doble hlice de ADN, que explicaba de manera clara
que el ADN poda duplicarse y transmitirse de una clula a
otra. Su maqueta representaba al ADN formado por dos
cadenas antiparalelas: una que corre en direccin 5-3, y la
otra que lo hace en la direccin opuesta 3-5 (vase el captulo 3). Estas cadenas tienen una estructura de -hlice y se
hallan unidas por dos y tres puentes de hidrgeno entre las
bases A-T y G-C, respectivamente. En cambio, hacia la parte externa de la cadena se localizan las desoxirribosas, unidas por enlaces fosfodister, formando una especie de
barandal o pasamanos de una escalera que deja expuestos a
los grupos fosfato (gura 1-15).

Figura 1-15. Modelo de la doble hlice del ADN.

www.fullengineeringbook.net
Era moderna de la biologa molecular

El hallazgo de la estructura del ADN es uno de los descubrimientos esenciales en las ciencias de la vida y marc el inicio
de la biologa molecular moderna. En 1955, Crick, siguiendo el modelo de la doble hlice, propuso la existencia de la
tautomera y la replicacin semiconservadora del ADN, y
propuso que para la sntesis de protenas debe existir una
molcula mediadora entre las protenas y el ADN, funcin
que hoy se sabe realiza el ARN. En ese mismo ao, propuso
el dogma central de la biologa molecular: El ADN dirige su
propia replicacin y su trascripcin para formar ARN
complementario a su secuencia; el ARN es traducido en
aminocidos para formar una protena (gura 1-16). En
1957 propuso que el cdigo gentico debe leerse en tripletes.

Mathew Stanley Meselson


y Franklin Stahl

Figura 1-14. James Dewey Watson y Francis Harry Compton Crick.

En 1958, Mathew Stanley Meselson y Franklin Stahl (gura


1-17) conrmaron la replicacin semiconservadora propuesta por Crick. En su experimento utilizaron centrifugacin con gradientes de soluciones de cloruro de cesio
(CsCl). Cultivaron bacterias en un medio que contena el
istopo 15N (pesado) para marcar las cadenas de ADN progenitoras. Despus cambiaron el medio por uno que contena 14N (ligero) y se permiti que las clulas se replicaran

CAPTULO 1 Historia de la biologa molecular

ADN

REPLICACIN
ADN polimerasa

TRANSCRIPCIN
ARN polimerasa
ADN

TRADUCCIN
ARNm, ARNt y ARNm
ARN

PROTENA

cADN
RETROTRANSCRIPCIN
Retrotranscriptasa

Figura 1-16. Flujo de la informacin gentica.

una sola vez con la nalidad de que el ADN recin replicado


incorporara este nitrgeno. Si la replicacin del ADN contemplaba la separacin de las dos cadenas, era posible predecir la densidad de las molculas de ADN despus de una
replicacin. Si la replicacin fuera semiconservadora, despus de una replicacin, todas las molculas de ADN resultantes tendran que contener una cadena pesada y una
ligera, y en consecuencia su densidad sera intermedia. Este
resultado fue observado por Meselson y Stahl. Despus de
dos replicaciones en 14N la mitad de las molculas de ADN
eran ligeras y la otra mitad, hbridas, es decir, con densidad
intermedia, justo como lo predice la replicacin semiconservadora. De esta manera se demostr que la replicacin
del ADN es semiconservadora y el nuevo ADN preserva
una de las cadenas originales y se sintetiza una de novo
(gura 1-18).

describi sus genes especcos y, lo que es ms importante,


las funciones que desempean. En 1971, Nathans elabor el
primer mapa de restriccin del ADN que detallaba los genes
de una molcula de ADN. Un ao ms tarde, en 1972, Janet
Mertz y Ron Davis demostraron que un fragmento de restriccin poda insertarse y ligarse a otro ADN cortado por
la misma enzima.
Por las excepcionales contribuciones al nacimiento de
las tcnicas de la ingeniera gentica, Arber, Smith y
Nathans recibieron el Premio Nobel de Fisiologa y Medicina en 1978.

www.fullengineeringbook.net

Hamilton Smith, Daniel Nathans,


Werner Arber
En 1968, Steward Lynn y Werner Arber (gura 1-19) descubrieron los sistemas de restriccin de las bacterias.
Hamilton Smith, a principios de la dcada de 1960, en la
Universidad de Ginebra, Suiza, descubri que las bacterias
infectadas por virus liberaban unas enzimas (enzimas de
restriccin), que los inactivan al cortar sus secuencias
de ADN. Simultneamente a este ataque molecular, la bacteria libera otra enzima que modica qumicamente las
bases de su propio ADN evitando que la enzima de restriccin lo corte, produciendo su autodestruccin. Este proceso
en dos pasos se denomina sistema controlado de restriccin-modicacin del hospedero. En 1970, se asla la primera enzima de restriccin Hind II, a partir de Haemophilus
inuenzae (vase el captulo 13).
El enorme potencial del empleo de las enzimas de restriccin qued demostrado por un colega de Smith, Daniel
Nathans, de la Universidad Johns-Hopkins, que logr cortar el ADN del virus SV40 (que induce la formacin de
tumores cancerosos en los simios) a 11 fragmentos. Nathans

Howard Martin Temin


y David Baltimore

En 1970, Howard Martin Temin, de la Universidad de Wisconsin-Madison, y David Baltimore, del Instituto de Tecnologa de Massachusetts (MIT), de manera independiente
descubrieron una nueva enzima denominada transcriptasa
inversa o retrotranscriptasa, con funcin de ADN polimerasa dependiente de ARN. Temin y Baltimore (gura 1-20)
demostraron que el genoma de ARN de los retrovirus era
copiado a una molcula de ADN de doble cadena por la
accin de la transcriptasa inversa, durante la infeccin de

Figura 1-17. Mathew Stanley Meselson y Franklin Stahl.

10

PARTE I Conceptos bsicos de biologa molecular

Figura 1-18. Replicacin semiconservadora del ADN.

estos virus. Temin y Baltimore, junto con Dulbecco, fueron


galardonados con el Premio Nobel de Fisiologa en 1975.
El principal cuestionamiento acerca de los virus de
ARN era si el genoma de estos virus pasaba de padres a
hijos como ARN o se integraba al ADN de la clula husped
en alguna etapa de su ciclo viral. Las pruebas de infeccin y
de transformacin indicaban que estos virus requeran de la
sntesis de ADN. Temin sugiri que la replicacin de los
virus de ARN ocurra mediante una molcula intermediaria
de ADN (un provirus) que serva como molde para la sntesis de ARN viral. Sin embargo, este molde necesita de una
ADN polimerasa dependiente de ARN que nunca se haba
encontrado en ningn tipo de clulas. Por su parte, Baltimore examin los viriones (partculas virales maduras) de
virus de ARN. Incub el virus en condiciones en que se
indujera la actividad del ADN polimerasa y los cuatro

dNTP (ATP, CTP, GTP, TTP), uno de los cuales (TTP) era
radiactivo. El producto resultante fue una molcula insoluble en cido, que mostraba las propiedades del ADN. Este
producto era degradado por una DNasa pero no se afect
por la RNasa ni por hidrlisis alcalina (a la cual es sensible
el ARN). Sin embargo, si los viriones se trataban con RNasa
antes de la reaccin, la molcula molde se degradaba. Se
observ, tambin, que la enzima que sintetizaba el ADN se
sedimentaba junto con las partculas virales maduras, lo
que sugiere que era parte del virus y no de la clula husped.
Estos resultados reforzaron la idea de que el ARN viral se
copiaba a una molcula de ADN de doble cadena, que a su
vez serva como molde para la sntesis del ARN viral necesario para la infeccin y la transformacin. Estos experimentos no slo sugirieron que la transformacin celular
por los virus de ARN ocurra a travs de un intermediario

Figura 1-19. Hamilton Smith, Daniel Nathans, Werner Arber.

Figura 1-20. Howard Martin Temin y David Baltimore.

www.fullengineeringbook.net

CAPTULO 1 Historia de la biologa molecular

Figura 1-21. Kary Mullis.

de ADN sino que tambin contradijeron el antiguo concepto del dogma de la biologa molecular propuesto por Francis Crick, que postulaba que la informacin de una clula
ua del ADN al ARN y a la protena.

Kary Mullis
Kary Banks Mullis (gura 1-21) desarroll una tcnica innovadora que revolucion la investigacin en biologa molecular: la reaccin en cadena de la polimerasa (polymerase chain
reaction, PCR). En 1985, mientras trabajaba en la compaa
Cetus, desarroll la PCR, que permite la amplicacin de

una secuencia especca de ADN mediante nucletidos trifosfatados y un ADN polimerasa. La idea de multiplicar una
hebra de ADN millones de veces le surgi en 1983 pero no
convenci a sus colegas de la compaa, por lo que tuvo que
desarrollarla solo. La versin de la tcnica propuesta inicialmente por Mullis, aunque efectiva, era poco eciente, hasta
que se le ocurri emplear ADN polimerasas termoestables,
extradas de microorganismos termof licos, como la Taq
polimerasa procedente de Thermus aquaticus (vase el captulo 16, sobre PCR) (gura 1-22).
Por esta invencin, de gran valor en biotecnologa y
como herramienta de investigacin cientca y forense, en
1993 recibi el Premio Japn y el Premio Nobel de Qumica, compartido con el canadiense Michael Smith. Cetus, la
compaa en que trabajaba Mullis, le dio una recompensa
de 10 000 dlares por la invencin de la PCR y luego vendi
la patente por 300 millones de dlares a Roche Molecular
Systems. La PCR tiene mltiples aplicaciones, como la
identicacin de individuos a partir de muestras de sangre
o saliva (utilizada en ciencia forense) y la secuenciacin de
genes de todo tipo de organismos. La secuenciacin gentica era, hasta entonces, un proceso muy complicado, aplicable slo cuando se podan obtener de manera natural
muchas copias del mismo ADN. La PCR convirti en una
rutina la secuenciacin gnica y permiti la lectura completa del genoma humano, as como de muchos organismos
que se toman como modelos de problemas biolgicos en la
investigacin. La tcnica ha permitido tambin investigar
la logenia (historia evolutiva), mediante la comparacin de
las secuencias genticas de distintas especies.

www.fullengineeringbook.net
PRIMER CICLO

94C

60C

72C

SEGUNDO CICLO

94C

60C

11

72C

CICLO 35 = 235 MOLCULAS

Figura 1-22. Reaccin en cadena de la polimerasa (PCR).

12

PARTE I Conceptos bsicos de biologa molecular

Primer tratamiento de terapia gnica


con xito en nios (1989)
En la dcada de 1980 se propici el advenimiento de la terapia gnica, el uso de genes para el tratamiento de enfermedades. Esta estrategia teraputica se consolid en 1989,
cuando se llev a cabo el primer protocolo clnico.
El sndrome de inmunodeciencia combinada grave por
dcit de la enzima adenosn deaminasa (ADA) fue la primera enfermedad tratada con terapia gnica. Las razones
de su eleccin para este tratamiento son las siguientes:
1. La deciencia de ADA es la enfermedad congnita de
inmunodeciencia ms estudiada, ya que la secuencia
del ARNm y del gen que codica para ADA se identicaron tempranamente (1983).
2. La funcin de la enzima est perfectamente dilucidada.
3. La produccin de tan slo el 10% de los niveles normales
de la enzima ADA es suciente para establecer una funcin inmune en el paciente. Por el otro lado, la sobreproduccin de ADA superior a 50 veces los valores normales
slo ocasiona una ligera anemia hemoltica.
4. Se ha demostrado que las clulas genticamente corregidas tienen una ventaja selectiva en cuanto al crecimiento frente a las clulas no modicadas.
En este estudio se incluy a dos pacientes, uno de cuatro
aos y otro de nueve. Antes de incluirse en el ensayo se
haba demostrado que estos nios tenan una respuesta
incompleta al tratamiento con reemplazamiento enzimtico y no haba ningn donante de mdula sea compatible.
Se les realiz una extraccin de sangre y se aislaron por
afresis los linfocitos T perifricos, que se estimularon con
interleucina-2 (IL-2) y anticuerpos anti-CD3 durante 72 h y
se transdujeron con un vector retroviral que contena el gen
ADA. Se cultivaron durante 9 a 12 das y posteriormente se
reincorporaron al paciente (vase captulo de terapia gnica).
Los pacientes recibieron 10 a 12 infusiones durante dos aos.
Como resultado, la funcin inmunolgica de ambos lleg a
niveles mucho ms altos que durante el periodo de tratamiento con sustitucin enzimtica, y se mantuvieron estables
dos aos despus del ltimo tratamiento. Ambos pacientes
tuvieron una respuesta variable a los antgenos, mantuvieron
un crecimiento normal de linfocitos T y tuvieron el mismo
tipo de infecciones que los dems nios de su edad. Los efectos adversos asociados a esta terapia fueron mnimos.

tambin por las tecnologas de vanguardia que podan surgir,


as como porque el conocimiento obtenido podra asegurar
la superioridad tecnolgica y comercial del pas que lo desarrollara. Se nombr responsable del proyecto a James D.
Watson (uno de los dos investigadores que propusieron el
modelo de la doble hlice del ADN en 1953). En 1990 se inaugur denitivamente el PGH y se calcularon 15 aos de trabajo. En una primera etapa, la elaboracin de mapas genticos
exigi el desarrollo de nuevas tcnicas de secuenciacin para
poder abordar todo el genoma. Para su desarrollo se destin
un presupuesto de 3000 millones de dlares y se calcul que
iba a terminar en 2005.
En 2001 se elabor y public el primer borrador del genoma. En abril de 2003 se public la secuencia completa del
genoma humano, dos aos antes de lo previsto. Las conclusiones obtenidas al nalizar este proyecto fueron las siguientes:

El genoma humano est constituido por 3000 millones


de pares de bases.
Existen 25000 genes codicantes.
La homologa en la secuencia de ADN entre individuos
es del 99.99%.
La especie ms cercana logenticamente al ser humano es el chimpanc, con 99.9% de homologa en su
secuencia de ADN.

www.fullengineeringbook.net

Proyecto del Genoma Humano (1990)


El Proyecto del Genoma Humano (PGH) fue un proyecto
internacional de investigacin cientca con el objetivo fundamental de determinar la secuencia de pares de bases que
componen el ADN e identicar los aproximadamente 30 000
genes del genoma humano, desde un punto de vista fsico y
funcional. El debate pblico que suscit la idea capt la atencin de los responsables polticos de muchos pases, no slo
porque el PGH supona un gran reto tcnico-cientco, sino

Clonacin del primer mamfero (1997)

La oveja Dolly, que vivi del 5 de junio de 1996 al 2 de enero


de 2003, fue el primer mamfero clonado a partir de una clula adulta. Sus creadores fueron Ian Wilmut y Keith Campbell,
cientcos del Instituto Roslin de Edimburgo (Escocia). Dolly
fue una oveja resultado de una transferencia nuclear desde
una clula donante diferenciada (de glndula mamaria) a un
vulo no fecundado y anucleado. Cinco meses despus naca
Dolly, la nica cra resultante de 277 fusiones de vulos anucleados con ncleos de clulas mamarias.
Dolly vivi siempre en el Instituto Roslin, donde fue
estudiada conforme envejeca. Demostr ser frtil y tuvo
cras en tres ocasiones. A los cinco aos de edad, Dolly
desarroll enfermedades crnico-degenerativas propias de
individuos seniles, como artritis (gura 1-23).
A pesar de que la expectativa de vida de la raza Finn
Dorset, a la que perteneca Dolly, es de 11 a 12 aos, tuvo
que ser sacricada debido a una enfermedad progresiva pulmonar a los ocho aos de edad. La necropsia demostr que
tena cncer de pulmn, causado por un retrovirus. Los tcnicos de Roslin no han podido certicar si hubo conexin
entre su muerte prematura y el hecho de ser un clon, pues
otras ovejas del mismo rebao sufrieron la misma enfermedad y murieron a causa de ella. Sin embargo, algunos autores
han especulado que haba un factor agravante en la muerte
de Dolly: al nacer tena una edad gentica de seis aos, la
misma edad de la oveja de la cual fue clonada. Esta aseveracin se sustenta en el hallazgo de que los telmeros de su
ADN eran cortos, caracterstica presente en clulas viejas.

CAPTULO 1 Historia de la biologa molecular

Ncleo
donante (2n)

Fusin
mediada por
shock elctrico
Formacin del
embrin

Oveja donante del tejido


mamario Finn Dorset

Ovocito (n) de
otra clula
adulta
Oveja donante del vulo
Scottish (cara negra)

Remocin del
ncleo del
ovocito

Dolly con fenotipo


de la oveja
de donde se obtuvo
la clula mamaria

Embrin con
caracteres de la
oveja donante
Implantacin en
madre sustituta oveja
Scottish (cara negra)

Figura 1-23. Clonacin de la oveja Dolly.

www.fullengineeringbook.net
Ejercicios de integracin

1. Complete la informacin que corresponde en los recuadros vacos.

Nombre

Aporte (experimento)

Gregor Mendel

Leyes fundamentales de la herencia.

Temin y Baltimore

Caractersticas

1865

Se demuestra cmo los virus con ARN como genoma


sintetizan ADN y se replican.

Principio transformante.

Explica cmo una cepa avirulenta puede transformarse en una virulenta.

Erwin Chargaff

Watson y Crick

Ao

1950

Elaboran el modelo de la doble hlice de ADN.

Desarrolla la tcnica de la reaccin en cadena de la


polimerasa (PCR).

Permite la amplicacin de una secuencia especca


de ADN mediante nucletidos trifosfatados y un
ADN polimerasa termoestable.

Con el uso de 14N y 15N comprueban que el ADN se


replica de manera semiconservadora.

1958

13

14

PARTE I Conceptos bsicos de biologa molecular

2. De acuerdo con los experimentos del principio transformante de Grifth, complete la informacin que corresponde en los
recuadros vacos.

Cepa

Experimento

Resultado

Cepa S

El ratn muere.

Inyectada al ratn.

El ratn vive.

Cepa S

Tratada con calor e inyectada al ratn.

Cepa S

Tratada con calor, incubada con cepa R e inyectada al


ratn.

www.fullengineeringbook.net
Bibliografa

Grifth F. The signicance of pneumococcal types. J Hyg,

1928;27:113-159.
Karp G. Biologa celular y molecular, conceptos y experimentos, 4 ed.
Mxico, DF: McGraw-Hill, 2006.
Luque J., Herrez A. Texto ilustrado de Biologa Molecular e Ingeniera Gentica, 1 ed. Madrid: Elsevier, 2001.
Meselson M, Stahl F.W. The replication of DNA in Escherichia coli.
Proc Natl Acad Sci, 1958;44:671-682.

Mullis K.B. Reaccin en cadena de la polimerasa. Investigacin y

Ciencia. 1990;165:30-37.
Venter J.C., Adams M.D., Myer E.W,. et al. The sequence of the

human genome. Science, 2001;291:1304-1351.


Watson J.D. Biologa Molecular del gen, 5 ed. Madrid: Mdica Pana-

mericana, 2006:7-46.
Watson J.D, Crick F.H.C. A structure for deoxyribose nucleics acids.

Nature, 1953;171:737-738.

Captulo

Ciclo celular
Blanca Estela Alcntar Daz / Luis Daniel Hernndez Ortega
Adriana Mara Salazar Montes

Introduccin

sin modicarse el nmero de cromosomas, mientras que la


fase M suele durar aproximadamente 1 h en las clulas de
mamferos (gura 2-1). La interfase puede tener una duracin de das, semanas o incluso ms tiempo, segn el linaje
celular y las condiciones ambientales o siolgicas imperantes (gura 2-2).
De acuerdo con su potencial proliferativo, las clulas
pueden categorizarse en:
Clulas lbiles, que en condiciones normales tienen
una alta actividad mittica. Se encuentran en tejidos que se
renuevan constantemente (por ejemplo, el revestimiento
epitelial de las cavidades y la supercie corporal, los precursores hematopoyticos en la mdula sea y las espermatogonias, que dan origen a los espermatozoides).
Clulas estables, que en condiciones normales no se
dividen, pero cuya divisin puede inducirse mediante el
estmulo apropiado. Estas clulas renuevan de manera lenta
los tejidos menos expuestos, pero pueden aumentar la velocidad de renovacin en caso de prdida tisular, como sucede con el hgado, los tbulos renales proximales y las clulas
endoteliales de vasos sanguneos.
Clulas permanentes, que carecen de la capacidad de
divisin. Son clulas totalmente diferenciadas, muy especializadas, incapaces de entrar nuevamente al ciclo celular;
un ejemplo representativo son los eritrocitos, que se originan de su precursor y pasan por un proceso de maduracin
en el cual pierden su ncleo y con ello su capacidad de divisin.
Una visin global del ciclo celular permite observar
cmo la clula transcurre de manera ordenada y sin discontinuidad por dos grandes etapas bien diferenciadas: la fase
M (mitosis en clulas somticas y meiosis en clulas germinales) y la interfase (comn en ambas).
Durante esta etapa, la clula se prepara para la siguiente
divisin y duplica su material gentico, es decir el ADN, y
todo su contenido (protenas, ARN, organelos, membra-

En 1858, Rudolf Virchow estableci lo que puede considerarse el segundo principio de la teora celular: Toda clula
procede de otra clula preexistente por divisin de sta
(omnis cellula e cellula). Por esto, se considera que la clula
es la unidad de origen de todos los seres vivos.
Para que esta accin pueda llevarse a cabo es necesario
que la clula pase por un proceso denominado divisin
celular. En los organismos unicelulares, como las bacterias
y las levaduras, cada divisin celular produce un organismo
nuevo completo, mientras que para dar origen a un organismo pluricelular como el ser humano, a partir de un cigoto
(originado por la unin de dos gametos sexuales), se necesitar una gran cantidad de divisiones celulares. Sin embargo,
stas no se detienen una vez que el organismo est completo, sino que continan durante toda la vida del individuo y
son necesarias para reponer las clulas muertas o senescentes, as como en situaciones de traumatismo o lesin.

www.fullengineeringbook.net

El ciclo celular
El ciclo celular representa el mecanismo fundamental subyacente a la reproduccin de todos los seres vivos, y se divide en etapas, a travs de las cuales la clula pasa de una
divisin celular a la siguiente. Estos acontecimientos se realizan mediante una secuencia ordenada de procesos en los
que la clula duplica su contenido y luego se divide en dos.
El ciclo celular se divide en dos fases principales: la fase
M, o fase mittica, y la interfase, o periodo preparatorio.
La fase M, a su vez, se subdivide en mitosis, en la cual los
cromosomas duplicados se dividen en dos ncleos, y citocinesis, donde toda la clula se divide en dos clulas hijas.
Por otra parte, la interfase se subdivide en: fase G1, fase S y
fase G2. Durante la interfase vara el grado de condensacin del material gentico as como el contenido de ADN,
15

16

PARTE I Conceptos bsicos de biologa molecular

M
Fa
se

Hepatocito
1 ao

S: replicacin del
ADN y duplicacin
de cromosomas.

G2: la clula
crece y condensa
gradualmente su
cromatina.

Epitelio del pncreas


50 das

or
a

Pr
o
Pr met
ofa af
se ase

1h

s
esi
cin
Cito fase
lo
Te ase
af se
An tafa
e
M

e
fas
er
nt

G1: la clula
crece y realiza
sus actividades
especializadas.

Figura 2-1. Fases del ciclo celular. El ciclo celular se divide en


dos fases: interfase y M. La fase M, a su vez, incluye mitosis
y cariocinesis, mientras que la interfase incluye las fases G1,
S y G2; la fase M tiene una duracin aproximada de una hora
en las clulas de mamferos, mientras que la interfase puede
tener una duracin de das, semanas o incluso ms tiempo.

Espermatogonias
25 das

www.fullengineeringbook.net

nas), de manera que duplica su tamao antes de dividirse en


dos clulas hijas.
La mayor parte de la vida celular, ya sea en la interfase o
en quiescencia (reposo), la molcula de ADN no est presente en la forma extendida de doble hlice ni tampoco en
la forma compacta de cromosomas, sino en un estado parcialmente condensado conocido como cromatina.
El ciclo celular transcurre entre dos divisiones celulares
sucesivas; se divide en cuatro fases, con una duracin desigual, que se exponen a continuacin.

Epitelio intestinal
De 2 a 5 das

Clulas embrionarias
60 minutos

Fase de descompactacin (G1)


Tras la mitosis, la clula entra en la fase G1 (G, de gap,
intervalo), durante la cual se dedica a sus actividades
especializadas. La principal diferencia entre las clulas de
divisin rpida y las de divisin lenta es la duracin de la
fase G1, que proporciona tiempo adicional de crecimiento.
De las tres etapas de la interfase, la G1 es la ms variable.
Con notables excepciones, las clulas que han detenido su
divisin de manera transitoria o permanente, en el cuerpo o
en el medio de cultivo, se encuentran en una etapa previa al
inicio de la sntesis de ADN.
Durante la fase G1, las clulas mantienen un nmero
constante de cromosomas diploides (2n) y su contenido en
el ADN no est duplicado, por lo que se arma que equivale a 2c (dos copias). La cromatina se descondensa de forma
gradual hasta adoptar una conformacin totalmente exten-

Figura 2-2. Duracin del ciclo celular. El ciclo celular tiene


diferente duracin. En la gura puede observarse la duracin
del ciclo celular en diferentes estirpes celulares; en hepatocitos la duracin es de aproximadamente un ao, aunque con
un estmulo (prdida o dao tisular) el tiempo se acorta. Las
clulas embrionarias tienen etapas G1 y G2 muy cortas, por lo
que se dice que pasan de S a M, y viceversa, sin pasar por G1
y G2, lo que acelera la velocidad de divisin.

dida (correspondiente a la doble hlice), necesaria para la


separacin de las dos hebras en la siguiente fase. En este
periodo la clula determina si las condiciones ambientales e
internas son adecuadas para la divisin celular.

CAPTULO 2 Ciclo celular

En el caso de que las condiciones sean favorables, la


clula atraviesa el punto de inicio (start) que compromete
de forma irreversible el comienzo del ciclo celular. Si las
condiciones ambientales vuelven a ser favorables, la clula
puede repetir el ciclo varias veces ms.

Fase de duplicacin o sntesis (S)


En la fase S, o de sntesis, se produce la replicacin del ADN
de los cromosomas individuales. Cada hebra de este ADN sirve de molde para la sntesis o produccin de la hebra nueva,
que permanece asociada por apareamiento de bases. Las dos
molculas de ADN resultantes permanecen unidas por el
centrmero, con lo que dan lugar a cromosomas con cuatro
hebras de ADN. Cada doble hebra constituye una cromtida; de esta forma el nmero de cromosomas es constantemente diploide en el ncleo (2n), pero el contenido de ADN
se duplica de dos copias (2c) hasta cuatro (4c).
Las dos copias de cada cromosoma replicado permanecen ntimamente unidas entre s como cromtidas hermanas idnticas. stas se mantienen juntas debido a complejos
proteicos denominados cohesinas, que se ensamblan a lo
largo de cada una de ellas a medida que el ADN se va replicando. La cohesin de las cromtidas es fundamental para
la segregacin adecuada de los cromosomas, misma que
desaparece en la fase tarda de la mitosis, para permitir la
separacin de las cromtidas hermanas. Al terminar la replicacin, la clula entra en la fase G2.

17

mitosis, que originalmente se deni como el periodo en el


que los cromosomas se condensan visiblemente. La citocinesis se produce en la sexta etapa, que se superpone con el
nal de la mitosis. En conjunto, estas etapas constituyen
una secuencia dinmica en la que varios ciclos independientes se desarrollan de forma coordinada para producir
dos clulas hijas genticamente idnticas y en las que participan los cromosomas: el citoesqueleto y los centrosomas.
Cuando la clula est por ingresar en la fase M, los cromosomas replicados se condensan y se visualizan como
estructuras liformes; un conjunto de complejos proteicos
denominados condensinas ayudan a producir esta condensacin. Las cohesinas y las condensinas estn relacionadas
de forma estructural y trabajan en conjunto para ayudar a
congurar los cromosomas replicados para la mitosis. Las
cohesinas se unen a dos molculas paralelas de ADN (cromtidas hermanas idnticas) y las mantienen juntas, en tanto que las condensinas se unen a una molcula individual de
ADN para ayudar a condensarla.
Antes de que comience la fase M tienen que completarse
dos eventos bsicos: el ADN tiene que replicarse totalmente
y en las clulas animales debe duplicarse el centrosoma. El
centrosoma es el principal centro organizador de los microtbulos, que en las clulas animales debe duplicarse para
poder contribuir a la formacin de los dos polos del huso
mittico, que luego separarn los cromosomas duplicados y
los distribuirn en las dos clulas hijas, que debern tener
su propio centrosoma.
En las clulas animales el centrosoma tambin contiene
un par de centrolos, cada uno constituido por una estructura cilndrica de microtbulos cortos.
Durante la interfase de cada ciclo de una clula animal,
el centrosoma se duplica, y ambas copias permanecen juntas como un complejo nico a un lado del ncleo. Cuando
se inicia la mitosis, los dos centrosomas se separan y cada
uno origina una estructura radial de microtbulos denominada ster. Los dos steres se desplazan en direcciones
opuestas del ncleo para formar los dos polos del huso
mittico; cuando se rompe la envoltura nuclear el huso captura los cromosomas y nalmente los separa en una fase
ms tarda de la mitosis. Cuando la mitosis termina y la
envoltura nuclear se reconstituye alrededor de los cromosomas separados, cada clula hija recibe un centrosoma
junto con sus cromosomas. El proceso de duplicacin y
separacin del centrosoma se conoce como ciclo del centrosoma.

www.fullengineeringbook.net

Fase de preparacin para la divisin


de la cromatina (G2)
En la fase G2 la clula verica si se ha completado la fase S
de forma correcta y decide entre permitir el paso a mitosis,
o en caso contrario, esperar a que se realicen las reparaciones necesarias.
En la fase G2 se inicia la condensacin gradual de la cromatina (proceso inverso a la fase G1 o de descondensacin),
que se completa en las primeras etapas de la mitosis, lo que
da lugar a cromosomas visibles al microscopio, con un
aspecto tpico de dos cromtidas y cuatro brazos. Aunque
puede considerarse que cada molcula de ADN es un cromosoma en cualquier momento del ciclo, el trmino cromosoma corresponde estrictamente a esta forma de mxima
condensacin. En cambio, los trminos cromosoma metafsico y cromosoma interfsico se utilizan para referirse a las
formas de la cromatina condensada y descondensada, respectivamente.

Fase de compactacin o divisin (M)


La fase M es, en s, un proceso continuo, que para su estudio se divide en seis etapas. Las primeras cinco (profase,
prometafase, metafase, anafase y telofase) constituyen la

Mitosis
El eje central de la mitosis consiste en separar y distribuir de
manera equitativa los cromosomas, ya replicados en la fase
S que le precede, con la nalidad de que cada clula hija
reciba una copia idntica del genoma. sta es una etapa del
ciclo celular en la que la clula cesa la mayor parte de sus
actividades metablicas y presenta una falta relativa de respuesta a estmulos externos, debido a que dedica toda su

18

PARTE I Conceptos bsicos de biologa molecular

energa a la separacin cromosmica. La mitosis, a su vez,


se subdivide en cinco fases, llamadas profase, prometafase,
metafase, anafase y telofase, acompaadas de un proceso
denominado citocinesis, en el cual la clula en divisin se
separa en dos.

Profase
1. El material gentico se condensa.
2. El citoesqueleto se desensambla y
el uso mittico se ensambla.
3. La envoltura nuclear se dispersa
Prometafase
1. Los microtbulos cromosmicos
se unen a los cinetocoros.
2. Los cromosomas se alinean al
ecuador del hueso.

Profase
Durante la profase los cromosomas replicados se condensan y se preparan para separarse, y el huso mittico comienza a formarse afuera del ncleo. La envoltura nuclear se
rompe, el citoesqueleto se desensambla, el complejo de
Golgi y el retculo endoplsmico se fragmentan, y la envoltura nuclear se dispersa, lo que marca el inicio de la prometafase.

Metafase
1. Los cromosomas se encuentran
alineados al ecuador en la placa
de la metafase, unidos por
microtbulos cromosmicos por
ambos polos.
Anafase
1. Los centrmeros se dividen.
2. Las cromatides hermanas se separan.
3. Los cromosomas migran a polos
opuestos del huso.

Prometafase
En esta fase se forma el huso mittico denitivo que permite a los microtbulos del huso entrar en contacto con los
cromosomas, mismos que se mueven a una posicin en el
centro de la clula.

Telofase
1. Los cromosomas se aglomeran en
polos opuestos.
2. Los cromosomas se dispersan.
3. La envoltura nuclear se ensambla.
4. Las clulas hijas se forman por citocinesis.

Metafase
En la metafase los cromosomas se encuentran alineados en
el ecuador del huso, con una cromtide de cada cromosoma
conectada a un polo opuesto. El plano de alineacin de los
cromosomas se conoce como placa de la metafase. El huso
mittico de la clula en metafase se encuentra altamente
organizado para separar los cromosomas duplicados. Los
microtbulos del huso en esta fase tienen la misma polaridad pero funcionalmente se dividen en tres grupos:
1) microtbulos astrales, que irradian hacia fuera a partir
del centrosoma en la regin situada por fuera del cuerpo del
huso, y es probable que ayuden en la colocacin del aparato
del huso dentro de las clulas y determinen el plano de la
citocinesis; 2) microtbulos cromosmicos, que se extienden desde el centrosoma hacia una estructura proteica
localizada en el centrmero del cromosoma, que permite el
anclaje de los microtbulos del huso a los cromosomas y se
denomina cinetocoro; este proceso es necesario para el desplazamiento de los cromosomas hacia los polos durante la
anafase, y 3) microtbulos polares (o interpolares), que se
extienden desde el centrosoma hasta pasar los cromosomas
y forman una canastilla estructural que mantiene la integridad del huso.
Las dos cromtides hermanas de cada cromosoma
replicado se comprimen una contra otra a lo largo de las
supercies internas y aparentemente se mantienen juntas
por unas protenas de pegamento no cromosmicas
denominadas cohesinas.

Figura 2-3. Fases de la mitosis. La mitosis est conformada por


varias etapas: profase, prometafase, metafase, anafase y telofase. En este esquema pueden observarse las caractersticas de
cada una de ellas en relacin con los cambios experimentados
por el material gentico y la clula en general.

www.fullengineeringbook.net

Anafase
sta se inicia cuando se separan en forma sincrnica y sbita las cromtides hermanas, y se acompaa de la liberacin
de la protena pegamento dentro del citoplasma; todos los

cromosomas de la placa metafsica se separan de manera


sincronizada, y las cromtides (ahora conocidas como cromosomas, pues ya no se encuentran jas a su duplicado)
inician su migracin hacia los polos. El movimiento de cada
cromosoma hacia un polo se acompaa del acortamiento
de los microtbulos jos al cinetocoro.

Telofase
Durante la telofase los cromosomas se acercan a sus respectivos polos y tienden a reunirse en una sola masa marcando
el inicio de esta etapa nal de la mitosis. La envoltura nuclear
se reconstituye conforme las vesculas membranosas se
unen a la supercie de los cromosomas y luego se fusionan
lateralmente para formar una cubierta de doble membrana
cada vez ms grande. La envoltura nuclear reconstituida se
acomoda alrededor de cada uno de los dos conjuntos de
cromosomas separados para formar dos ncleos (gura
2-3).

Citocinesis o citodiresis
La divisin del citoplasma se inicia al nal de la anafase y
contina durante la telofase.

CAPTULO 2 Ciclo celular

La citocinesis, o citodiresis, es la separacin f sica del


citoplasma en dos clulas hijas durante la divisin celular y
se produce despus de la cariocinesis, al nal de la telofase.
El mecanismo de las clulas animales y el de las vegetales es
distinto. En las clulas animales tiene lugar por estrangulacin de la clula en el ecuador del huso, y se lleva a cabo
mediante la participacin de protenas ligadas a la membrana (actina y miosina), que forman un anillo contrctil.
El primer indicio de citocinesis en animales se observa
durante la anafase tarda como una depresin en la supercie de la clula dentro de una banda estrecha alrededor de
sta. Conforme avanza el tiempo, la indentacin se profundiza y se convierte en un surco que rodea por completo a la
clula. El plano del surco se sita en el mismo plano que
ocupaban previamente los cromosomas de la placa de la
metafase; en otras palabras, el plano del surco es perpendicular al eje del huso mittico, lo que garantiza que los dos
conjuntos de cromosomas se separen nalmente en dos clulas. El surco contina profundizndose hasta que las
supercies opuestas hacen contacto en el centro de la clula
y sta se separa en dos. Este proceso se lleva a cabo por el
impulso de contracciones progresivas causadas por un anillo perifrico contrctil.
Las clulas vegetales tienen un proceso diferente de
divisin que consiste en la acumulacin de vesculas procedentes del aparato de Golgi, que contienen elementos de la
pared celular, en la zona media de la clula. Las vesculas se
fusionan y entran en contacto con las paredes laterales de la
clula. De esta forma se origina el tabique o fragmoplasto,
que har posible la divisin celular (gura 2-4).

19

Filamentos
de actina

Filamentos
de miosina

Formacin del anillo


contrctil

www.fullengineeringbook.net

Fase G0 o de quiescencia

Surco de divisin

Algunas clulas permanecen en reposo tras la fase M, que


puede ser una etapa transitoria, durar largo tiempo o no
dividirse denitivamente, a menos que se estimulen para
ello. En el cuerpo o en un medio de cultivo se encuentran
detenidas, y cuando se produce un estmulo adecuado, o si
las condiciones ambientales son las idneas, pueden proseguir a la fase G1 del ciclo y continuar hasta la mitosis.

Control del ciclo celular


En el control del ciclo celular participan complejos de protenas que actan en cada una de las etapas y permiten, o
no, el avance del ciclo. Estas protenas se denominan ciclinas y cinasas dependientes de ciclinas (Cdk), que se unen
formando complejos de dos subunidades: una posee actividad cinasa y transere grupos fosfato del adenosn trifosfato (ATP) a residuos serina y treonina de protenas diana o
blanco, implicadas en la progresin del ciclo celular, y la
otra acta como una subunidad reguladora llamada ciclina.
Cuando la concentracin de ciclina es baja, la cinasa permanece inactiva, pero si la concentracin de ciclina se ele-

Como resultado se originan


dos clulas hijas

Figura 2-4. Citocinesis. La formacin del anillo contrctil se


produce durante la etapa de citocinesis. Dicho anillo es el encargado de estrangular el citoplasma de la clula hasta dividirla
en dos. La composicin del anillo contrctil es principalmente
de lamentos de actina y miosina.

va, la cinasa se activa y la clula avanza dentro del ciclo


celular. Debido a esto a las enzimas con actividad cinasa se
las denomin Cdk, y se descubri que dirigen diversas actividades durante el ciclo celular.

20

PARTE I Conceptos bsicos de biologa molecular

Puntos de revisin (check points)

Punto de control en G2

Todo el ADN est replicado


La clula es lo suficientemente grande
El medio ambiente es favorable
Entrada
aM

Punto de control en la metafase

Todos los cromosomas estn


alineados adecuadamente
Salida
de M

Ciclina
B/A + Cdk1
M
G2

Ciclina
A + Cdk2

G1

Ciclina
Ds + Cdk4
o Cdk6

Ciclina Entrada
aS
E + Cdk2
La clula es lo suficientemente
grande
El medio ambiente favorable
Punto de control en G1

Figura 2-5. Regulacin del ciclo celular. En este esquema se


presenta la ubicacin de los principales puntos de control que
regulan el ciclo celular. El paso de una etapa a otra est regulado por complejos ciclina-cinasa. La actividad de Cdk en G1
temprana es muy baja, pero se incrementa conforme avanza la
fase. Tambin se observa actividad de Cdk4 y Cdk6 acopladas
a las ciclinas D (D1, D2 y D3). El principal sustrato de estas
Cdk es la protena reguladora Rb; su fosforilacin conlleva la
transcripcin de varios genes como los que codican para
las ciclinas E y A, Cdk1 y varias protenas que participan en
la replicacin. El paso de la fase G1 a S, es impulsada por la
actividad de la Cdk2 con ciclina E y ciclina A. La transicin de
G2 a M comienza con la activacin de la ciclina A y Cdk1, adems de los complejos ciclina B1-Cdk1, los cuales se cree que
fosforilan sustratos como protenas citoesquelticas, histonas y
protenas de la envoltura nuclear.

Los puntos de revisin son mecanismos que detienen la


progresin del ciclo celular en caso de que cualquier ADN
cromosmico se dae o si ciertos procesos no se llevaron a
cabo de manera correcta, como la replicacin del ADN en
la fase S o la alineacin cromosmica durante la fase M.
En estos puntos participan protenas que, a manera de
sensores, reconocen el dao en el ADN y las anormalidades
celulares. Si una de estas protenas detecta un defecto, inicia una respuesta que detiene de forma transitoria el progreso del ciclo celular. Entonces la clula puede reparar el
dao o corregir el defecto antes de ingresar a una nueva
etapa. En caso de que el dao sea mayor y no sea posible
repararlo, el mecanismo de revisin transmite una seal
que conduce a la muerte de la clula daada. Los principales puntos de control se encuentran ubicados en G1 antes de
la sntesis de ADN, en G2 antes de la mitosis y en la mitosis
durante la metafase (gura 2-5).
Dos de las principales protenas que funcionan como
sensores en estos puntos de control son ATM (ataxiatelangiectasia mutada) y ATR (protena relacionada con
ataxia-telangiectasia y Rad3), que son parte de complejos
multiproteicos capaces de unirse al ADN daado. ATM es el
principal mediador de la respuesta a las roturas de ambas
cadenas del ADN, un tipo de dao caracterstico de las
radiaciones ionizantes, mientras que ATR interviene en
respuesta al dao inducido por radiacin ultravioleta (UV).
Una vez unidas pueden fosforilar una variedad de protenas
que participan en los puntos de revisin del ciclo celular.
Otro tipo de protenas con capacidad de regular el ciclo
celular son las conocidas como protenas supresoras de
tumores. Entre las ms importantes se encuentran Rb (protena del retinoblastoma) y p53. Rb se encarga de detener la
clula en la fase G1, contiene pocos aminocidos fosforilados, e impide la entrada a la fase S al unirse al factor de
transcripcin E2F, evitando que ste se asocie a secuencias
potenciadoras en sus genes blanco. A medida que avanza el
ciclo celular, Rb se hiperfosforila de manera progresiva, lo
que provoca que Rb se desprenda de E2F, y le permite
comenzar la sntesis de ADN. Por otra parte, p53 desempea su funcin reguladora en la fase G1. Las lesiones del ADN
nuclear dan lugar a la fosforilacin, la estabilizacin y
la activacin de p53. Al ser activada, esta protena estimula la
transcripcin de la protena p21 que detiene la progresin
del ciclo celular para permitir la reparacin del dao. Si ste
es irreparable, p53 desencadena la apoptosis (gura 2-6).

www.fullengineeringbook.net

Estudios en levaduras permitieron observar que el ciclo


celular en una clula eucariota se regula en distintas etapas.
El primer punto de transicin, denominado START, ocurre
antes del nal de G1. Una vez que la clula ha pasado este
punto, est destinada en forma irrevocable a replicar su
ADN y a completar el ciclo celular. El paso por START
requiere la activacin de Cdk por una o ms ciclinas G1,
cuyos niveles se elevan al nal de G1.
El paso de G2 a la mitosis requiere de la activacin de
Cdk por un grupo diferente de ciclinas, las ciclinas mitticas. A este complejo se lo denomina factor promotor de la
mitosis (MPF), y se encarga de fosforilar los sustratos necesarios para que la clula inicie la mitosis. La salida de la
mitosis y el ingreso a G1 depende de un descenso rpido en
la actividad de Cdk, consecuencia de una cada en la concentracin de ciclinas mitticas.

Meiosis
La meiosis es el proceso durante el cual el nmero de cromosomas se reduce de modo que se forman clulas que slo
contienen un miembro de cada par de cromosomas homlogos. As, la meiosis garantiza la produccin de una fase
haploide en el ciclo de vida, y la fertilizacin asegura una

CAPTULO 2 Ciclo celular

Radiacin
ionizante

21

ATM

Chk2
C

a
Chk2

P P

DP 1/2

p53
p53

Rb
E2F

b
Radiacin
UV

c
A

Ciclina D
Cdk 4/6

P21 gen

I
P P P

p53

P
Rb

p21

ATR

DP 1/2

ARNm p21
d
Activa

E2F

www.fullengineeringbook.net
Inactiva
Chk1

II

Cdk

Chk1

p21

Cdc25

e
DP 1/2

Cdk

Inactiva

Activa

P
2

Cdc25
Inactiva
3

CdK

Paro del ciclo


celular

E2F

Progresin del
ciclo celular

5
Protena
adaptadora
P

Citoplasma
4

Cdc25

Figura 2-6. Control del ciclo celular. En este esquema se muestran tres de las principales vas que controlan la progresin del ciclo celular. En la va A se muestra cmo ATR se activa tras un dao especco; ste, a su vez, fosforila y activa la cinasa del punto
de revisin Chk1 1), que fosforila y desactiva la fosfatasa Cdc25 2), la cual, en condiciones normales, se desplaza entre el ncleo
y el citoplasma 3), pero una vez fosforilada se une a una protena adaptadora en el citoplasma 4) y no puede importarse de nuevo
al ncleo, lo que deja a Cdk en su estado inactivo 5). En la va B se observa cmo ATM, tras activarse por un dao especco, se
activa y fosforila y activa la cinasa del punto de revisin Chk2 a) que fosforila p53 b), el cual activa la transcripcin de P21 c), y
la protena p21 producida inhibe de forma directa la Cdk e) en ambas vas, resultando en el paro del ciclo celular. En la va C se
muestra la protena Rb que, en condiciones normales se encuentra parcialmente fosforilada y unida al factor transcripcional E2F
(I); sta se hiperfosforila por el complejo D-Cdk 4/6, lo que provoca que se desprenda de E2F permitindole a la clula entrar a la
fase S.

22

PARTE I Conceptos bsicos de biologa molecular

fase diploide. Sin meiosis, la reproduccin sexual sera imposible. A diferencia de la mitosis, en la meiosis la duplicacin de los cromosomas va seguida por dos divisiones en
secuencia que distribuyen los cromosomas entre cuatro
ncleos.
Para asegurar que cada ncleo hijo, formado durante la
meiosis, posea un miembro de cada par de cromosomas
homlogos, ocurre un elaborado proceso de formacin de
pares de cromosomas que no tienen contraparte en la mitosis. A medida que se alinean los pares de cromosomas se
desarrolla un proceso de recombinacin gentica entre las
cromtidas hermanas con intercambio de fragmentos de
ADN entre un cromosoma paterno y su correspondiente
cromosoma materno, dando como resultado la produccin
de cromosomas en donde ninguno de ellos es idntico a otro.

Interfase
La clula duplica su material
gentico
Profase I
Entrecruzamiento cromosmico

Metafase I
Alineamiento de los cromosomas
en el plano ecuatorial
Anafase I
Desplazamiento de los
cromosomas hacia polos
opuestos
Telofase I
Se forma la membrana nuclear y
comienza la citocinesis

Fases de la meiosis
Profase I
Se rompe la membrana nuclear
y se forma el nuevo huso

La meiosis es un tipo especial de divisin celular que origina gametos o clulas germinales masculinas y femeninas
(espermatozoides y vulos, respectivamente), cada una de
las cuales contiene la mitad de la dotacin cromosmica
normal. A esta dotacin media de cromosomas de cada
gameto se la conoce como nmero haploide (n). Por lo tanto, esta divisin, tambin conocida como gametognesis,
termina produciendo cuatro clulas hijas (gametos), que
ms tarde se fusionarn para formar cigotos, que ya tienen
el nmero diploide de cromosomas (2n).
La meiosis se divide en dos fases separadas:

Metafase II
Alineacin de los cromosomas
en el plano ecuatorial
Anafase II
Se separan las cromtidas de
cada cromosoma

www.fullengineeringbook.net

Telofase II
Se forma la membrana nuclear y
comienza la citocinesis
Como resultado se obtienen 4
clulas haploides

Meiosis I (o divisin reductora)


En ella tienen lugar algunos sucesos importantes:

A diferencia de la mitosis, no ocurre separacin de cromtidas, sino que cada cromosoma duplicado de cada
par homlogo emigra a cada polo del huso.
Durante esta primera divisin meitica hay un intercambio de alelos (genes alternos que representan el cdigo
para una misma caracterstica) entre las cromtidas de
los pares homlogos de los cromosomas duplicados.
Este intercambio supondr la formacin de cromtidas
con diferente constitucin gentica en la clula madre.

Profase I
sta es la fase ms larga de la meiosis, y en ella los cromosomas homlogos intercambian fragmentos de material gentico. Se divide en cinco subfases:

Leptoteno: los cromosomas individuales, compuestos


por dos cromtidas unidas por el centrmero, empiezan
a condensarse y hacerse visibles, y forman largas tiras en
el ncleo.
Cigoteno: los pares de cromosomas homlogos se
aproximan entre s, y tiene lugar la sinapsis o apareamiento, que suele comenzar por los extremos y se
extiende a lo largo de los cromosomas. Esta sinapsis,

Figura 2-7. Etapas de la meiosis. Esquema general de las fases


involucradas en la meiosis.

que se establece por medio del complejo sinaptonmico, forma una ttrada.
Paquiteno: se completa la sinapsis en todos los cromosomas. Tiene lugar un entrecruzamiento cromosmico
mediante quiasmas, y como consecuencia tiene lugar
una recombinacin gentica. Suelen darse dos o tres de
estos entrecruzamientos por cada par bivalente.
Diploteno: comienza la separacin de los cromosomas
homlogos, y pone an ms de maniesto los quiasmas.
Diacinesis: los cromosomas se condensan al mximo y
desaparecen el ncleo y la membrana nuclear, por lo
que quedan libres en el citoplasma. Se puede apreciar
cmo cada bivalente est unido por cuatro cromtidas
(ttradas).

Metafase I
Durante esta fase los cromosomas homlogos se alinean en
el plano ecuatorial completamente al azar, lo que garantiza
la reunin de los cromosomas maternos y paternos.

CAPTULO 2 Ciclo celular

Anafase I
Es la separacin de cada bivalente, que se desplazan hacia
los polos opuestos de la clula. Cada cromosoma sigue
constituido an por dos cromtidas.
Telofase I
Esta fase es parecida a la de la mitosis: los cromosomas llegan hasta los polos opuestos, se vuelven a formar los
ncleos y comienza la citocinesis. Cada clula hija recibe 23
cromosomas (n), pero como cada cromosoma est compuesto por dos cromtidas, el contenido de ADN todava es
diploide. Cada una de las clulas hijas recin formadas entra
en la meiosis II.

Meiosis II (o divisin ecuatorial)


Tan slo tiene lugar la separacin por el centrmero de
cada cromosoma para liberar las cromtidas que emigran a
cada polo opuesto del huso.
En el hombre, cada uno de los cuatro gametos resultantes sufre una transformacin hasta espermatozoide maduro. En la mujer, el citoplasma se distribuye de manera
desigual entre los cuatro gametos resultantes: uno de ellos
lo gana casi todo (vulo), mientras que los otros tres (cuerpos residuales) degeneran.

23

Esta divisin no va precedida por una fase S; por lo


dems, resulta bastante similar a la mitosis:

Profase II
Es muy corta; se rompe la membrana nuclear y se forma el
nuevo huso.
Metafase II
Los cromosomas, cada uno de ellos formado por dos cromtidas, se alinean en el plano ecuatorial.
Anafase II
Se separan las cromtidas de cada cromosoma.
Telofase II
Se forma la membrana nuclear alrededor de los cuatro
ncleos haploides y comienza la citocinesis.
El resultado nal son cuatro clulas hijas que, a diferencia de lo que ocurre en la mitosis, contienen el nmero
haploide de cromosomas y son distintas desde el punto de
vista de su dotacin gentica. Esto signica que cada gameto
contiene su propio complemento gentico nico (gura 2-7).

www.fullengineeringbook.net
Ejercicios de integracin

1. Complete la imagen colocando el nombre de las etapas


que componen la fase M y su duracin promedio. Asimismo, describa las caractersticas principales de las fases
G1, S y G2 y el nombre con el que se conoce a estas tres
etapas en conjunto.

G1:

2. Seale la ubicacin de los puntos de control dentro del


ciclo celular y qu caractersticas revisan cada uno de
ellos.

S:
G2

Fa

se

G2:

G1

24

PARTE I Conceptos bsicos de biologa molecular

3. Escriba en los cuadros inferiores si el estado de la protena de arriba es activo o inactivo.

P P

P P P
P

p53

p53

Rb

Rb

Cinasa

Ciclina

Ciclina

Cinasa

Cinasa

p21

www.fullengineeringbook.net
Preguntas de repaso

1. En cuanto a las clulas hijas originadas, cul es la diferencia principal entre mitosis y meiosis?
2. Mencione las fases que componen la mitosis en orden de
ejecucin.
3. Cuando se habla de clulas con un nmero haploide y
diploide de cromosomas, a qu se hace referencia?

4. Mencione la ubicacin de los tres principales puntos de


control dentro del ciclo celular y qu es lo que se verica
en cada uno de ellos.
5. Para permitir la progresin del ciclo celular, es necesario
que las Cdk se encuentren en su forma activa o inactiva?
Qu protenas activan e inactivan a las Cdk?

Bibliografa
Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, Raff M, et al. In-

troduccin a la biologa celular, 2 ed. Madrid: Editorial Mdica


Panamericana, 2006:611-671.
Gregory CS, Stephen CW. Patologa estructural. Fundamentos
clnicos patolgicos en medicina, 4 ed. Barcelona: McGraw-Hill
Interamericana, 2000.
Karp G. Biologa celular y molecular. Mxico, DF: McGraw-Hill
Interamericana, 2006:621-669.
Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell
J. Molecular cell biology, 4 ed. Nueva York: Freeman, 2000.

Luque J, Herrez A. Biologa molecular e ingeniera gentica. Ma-

drid: Harcourt Editora, 2006:97-106.


Murray RK, Mayes PA, Granner DK, Rodwell VK. Bioqumica de

Harper, 15 ed. Mxico, DF: El Manual Moderno, 2001.


Rubn E, Gorstein F, Rubn R, Schwarting R, Strayer D. Patologa

estructural. Fundamentos clinicopatolgicos en Medicina, 4 ed.


Madrid: McGraw-Hill Interamericana Aravaca, 2006:99-101.

Captulo

cidos nucleicos
Jos Navarro Partida / Mayra Mena Enrquez

Introduccin

3. Grupo fosfato, causante de las cargas negativas de los


cidos nucleicos y que le brinda caractersticas cidas
(gura 3-1).
Las bases nitrogenadas son molculas formadas de
tomos de carbono y nitrgeno que crean anillos heterocclicos. Se conocen dos tipos de bases nitrogenadas: las purinas y las pirimidinas. Las purinas se componen de dos
anillos condensados, mientras que las pirimidinas estn
formadas por un solo anillo. Los tomos de carbono y nitrgeno de los anillos se identican mediante nmeros naturales: del 1 al 6 para las pirimidinas y del 1 al 9 para las purinas
(gura 3-2). Las purinas se sintetizan de novo en el hgado
como mononucletidos unidos con una molcula de ribosa
5-fosfato; las pirimidinas lo hacen como bases libres y despus se unen a la ribosa 5-fosfato. Es importante mencionar
que el recambio de cidos nucleicos da lugar a la liberacin
de bases libres, tanto de purinas como pirimidinas; estas
bases se reciclan y se unen a una pentosa y un grupo fosfato
para generar de nuevo el nucletido.
Las purinas caractersticas de los cidos nucleicos son
adenina (A) y guanina (G), ambas presentes en los nucletidos del ADN y del ARN. Las pirimidinas caractersticas de
los cidos nucleicos son la citosina (C), la timina (T) y el
uracilo (U). La C est presente en los nucletidos que componen tanto al ADN como al ARN, mientras que la T slo
forma los nucletidos que componen al ADN y el U, nicamente los nucletidos que componen al ARN.
La pentosa que compone el nucletido es la D-ribosa
para el ARN y la D-desoxirribosa en el caso del ADN. Los
nucletidos que contienen ribosa se denominan ribonucletidos, mientras que los que contienen desoxirribosa,
desoxirribonucletidos. Los carbonos de la pentosa se identican en los nucletidos mediante nmeros del 1 al 5, con
una comilla, y se denominan primos. La diferencia entre la
ribosa y la desoxirribosa es que la primera posee un grupo
OH en el carbono dos, mientras que la segunda carece de

Las clulas son las unidades funcionales de cualquier


organismo vivo. Las instrucciones necesarias para dirigir
sus actividades estn contenidas en los cromosomas, que
en el caso de las eucariotas se localizan en el ncleo celular
y son conocidas en su conjunto como informacin gentica.

www.fullengineeringbook.net

cidos nucleicos

Los cidos nucleicos constituyen el material gentico de los


organismos y son necesarios para el almacenamiento y la
expresin de la informacin gentica. Existen dos tipos de
cidos nucleicos qumica y estructuralmente distintos: el
cido desoxirribonucleico (ADN) y el cido ribonucleico
(ARN); ambos se encuentran en todas las clulas procariotas, eucariotas y virus. El ADN funciona como el almacn
de la informacin gentica y se localiza en los cromosomas del ncleo, las mitocondrias y los cloroplastos de
las clulas eucariotas. En las clulas procariotas el ADN se
encuentra en su nico cromosoma y, de manera extracromosmica, en forma de plsmidos. El ARN interviene en la
transferencia de la informacin contenida en el ADN hacia
los compartimientos celulares. Se encuentra en el ncleo, el
citoplasma, la matriz mitocondrial y el estroma de cloroplastos de clulas eucariotas y en el citosol de clulas procariotas.

Composicin de los cidos nucleicos


La unidad bsica de los cidos nucleicos es el nucletido,
una molcula orgnica compuesta por tres componentes:
1. Base nitrogenada, una purina o pirimidina.
2. Pentosa, una ribosa o desoxirribosa segn el cido
nucleico.
25

26

PARTE I Conceptos bsicos de biologa molecular

NH2

OHCH 2

4
3

CH2

OH

H
3

OH

H H

OH

OHCH 2

OH

H H

OH

OH

Desoxirribosa

Ribosa

H H

Figura 3-3. Estructura hemiacetal de la ribosa y desoxirribosa.

segundo y el tercer fosfatos se conectan con el nucletido


mediante un enlace fosfoanhdrido que requiere un gasto
de energa para su formacin. Qumicamente, los nucletidos pueden denirse como steres monofosfato, difosfato o
trifosfato de nuclesidos. Los nucletidos son molculas
cidas, ya que el grupo fosfato se ioniza en medio acuoso.
(Para la nomenclatura completa de las molculas nucleotdicas vase el cuadro 3-1.)

Grupo fosfato + Pentosa + Base nitrogenada

Figura 3-1. Estructura de los nucletidos.

dicho grupo funcional y slo cuenta con un hidrgeno


(gura 3-3).

Cadenas de cidos nucleicos


o polinucletidos

Nuclesidos
La unin de una base nitrogenada y la pentosa produce un
nuclesido, mediante un enlace covalente denominado
N-glucosdico que se forma entre el C-1 de la pentosa y el
N-1 de las pirimidinas o bien el N-9 de las purinas (gura
3-4). Si la base nitrogenada se une a una ribosa da lugar a los
ribonuclesidos, y si, por el contrario, lo hace a una desoxirribosa genera los desoxirribonuclesidos.

Los nucletidos se unen mediante enlaces fosfodister para


dar lugar a cadenas de cidos nucleicos o polinucletidos.
El enlace fosfodister tiene lugar entre el C-5-fosfato de un
nucletido y el C-3-hidroxilo del siguiente nucletido. La
unin sucesiva de nucletidos mediante enlace 3,5-fosfodister genera un polinucletido polarizado; es decir, con
extremos diferentes. Por un lado de la cadena se encuentra
un extremo 5-fosfato y, por el otro, un extremo 3-hidroxilo
(gura 3-5). Si la cadena es de ribonucletidos, se genera un
polirribonucletido o cadena de ARN, mientras que si la
cadena se forma con desoxirribonucletidos se origina un
polidesoxirribonucletido o cadena de ADN.
Los nucletidos que constituyen las cadenas de ADN
contienen las bases A, G, T y C; mientras que los nucletidos que forman las cadenas de ARN estn constituidos por
las bases nitrogenadas A, G, C y U. Por consenso universal,
la secuencia de nucletidos en una cadena de polinucletidos se escribe en direccin 5 3, y el orden exacto de
nucletidos o secuencia de la cadena se considera la estruc-

www.fullengineeringbook.net

Nucletidos
La unin de un grupo fosfato a un nuclesido da lugar a una
molcula de nuclesido monofosfato o nucletido, como
por ejemplo la adenosina monofosfato (AMP). Si se agrega
un segundo o un tercer fosfato al nuclesido monofosfato
se obtiene un nuclesido difosfato (como el ADP) o bien
trifosfato (como el ATP). Los nuclesidos, en su forma de
monofosfato, son los componentes de los cidos nucleicos;
aunque cuando se encuentran libres lo estn en su forma
trifosfatada. El primer fosfato se une al nuclesido mediante un enlace ster con el OH del carbono 5 de la pentosa. El

NH2

7
6

N 1

4
2

N
Adenina

8
9

7
6

N 1
N
H

4
2

N
NH2
Guanina

OH

H O

8
9

NH2
5

N
H

6
1

HN 3

4
3 N
2

O
O

Citosina

Figura 3-2. Bases nitrogenadas.

N
H
Timina

CH3
5

OH

2
1

3
6

Uracilo

4
5

CAPTULO 3 cidos nucleicos

NH2
NH2
5

CH2
5

H H

H H

OH

CH2
5

H H

H H

OH

Pentosa + Base nitrogenada

componen los nucletidos, y si se modica alguna de estas


bases o su orden se alterar la informacin.

4
2

3
2

8
9

N 1

6
1

Pentosa + Base nitrogenada

Figura 3-4. Estructura de los nuclesidos.

tura primaria de los cidos nucleicos. El enlace fosfodister


entre nucletidos puede escindirse por las nucleasas: DNasas para el ADN y RNasas para el ARN.

Estructura del ADN


Estructura primaria del ADN
Corresponde a la secuencia de nucletidos del polinucletido linearizado (gura 3-6). La informacin gentica est
contenida en el orden exacto de las bases nitrogenadas que

Estructura secundaria del ADN


En clulas eucariotas el ADN se encuentra como una cadena doble de polidesoxirribonucletidos (double strand
DNA, dsADN). Las dos cadenas del ADN giran alrededor
de un eje de simetra imaginario y forman una estructura
helicoidal, de aqu su nombre de doble hlice del ADN
descrita por Watson y Crick en 1953. En la hlice del ADN,
la columna hidrof lica de desoxirribosa-fosfato de cada
cadena est en el exterior de la molcula, mientras que las
bases nitrogenadas hidrfobas se orientan hacia el interior.
La relacin espacial que se genera por el giro entre las dos
cadenas de la hlice crea un surco mayor (ancho) y uno
menor (estrecho) (gura 3-7). La doble cadena del ADN
tiene tres caractersticas principales:

Es antiparalela.
Es complementaria.
Forma un giro helicoidal dextrgiro o levgiro.

La asociacin entre las dos cadenas es antiparalela; es


decir, el extremo 5 de una se asocia con el extremo 3 de la
otra. Las dos cadenas son complementarias; esto es, las
bases nitrogenadas de una de las cadenas del ADN se unen
mediante puentes de hidrgeno a las bases nitrogenadas de

www.fullengineeringbook.net

Cuadro 3-1. Nomenclatura de nucletidos.


Base

Nuclesido
Base + ribosa

Adenina

Adenosina

Guanina

Guanosina

Nucletido
Base + ribosa
1 grupo fosfato
cido adenlico

2 grupos fosfato

3 grupos fosfato

Adenosina difosfato (ADP)

Adenosina trifosfato (ATP)

Guanosina difosfato (GDP)

Guanosina trifosfato (GTP)

Citidina bifosfato (CDP)

Citidina trifosfato (CTP)

Uridina difosfato (CDP)

Uridina trifosfato (UTP)

Adenosina monofosfato (AMP)


cido guanlico
Guanosina monofosfato (GMP)
Citosina

Citidina

cido citidlico
Citidina monofosfato (CMP)

Uracilo

Uridina

cido uridlico
Uridina monofosfato (UMP)

Base
Adenina

Desoxinuclesido
Base + desoxirribosa
Desoxiadenosina

Nucletido
Base + desoxirribosa
1 grupo fosfato
cido desoxiadenlico

2 grupos fosfato

3 grupos fosfato

Desoxiadenosina difosfato (ADP)

Desoxiadenosina trifosfato (ATP)

Desoxiguanosina difosfato (GDP)

Desoxiguanosina trifosfato (GTP)

Desoxicitidina difosfato (CDP)

Desoxicitidina trifosfato (CTP)

Desoxiuridina difosfato (UDP)

Desoxiuridina trifosfato (UTP)

Desoxiadenosina monofosfato
(AMP)
Guanina

Desoxiguanosina

cido desoxiguanlico
Desoxiguanosina monofosfato
(GMP)

Citosina

Desoxicitidina

cido desoxicitidlico
Desoxicitidina monofosfato (CMP)

Uracilo

Desoxiuridina

27

cido desoxiuridlico
Desoxiuridina monofosfato (UMP)

28

PARTE I Conceptos bsicos de biologa molecular

Extremo 5
O
O

A
O

P
O
5

H H

H H

O
O

CH2

O
5

CH2
4

H H

H H

O
O

P
O
5

CH2

H H

H H

www.fullengineeringbook.net
3

O
O

P
O
5

H H

H H

Extremo 3

CH2

OH

Figura 3-6. Estructura primaria del ADN.

Figura 3-5. Formacin de un polinucletido o cadena de ADN.

la otra cadena, de manera que A siempre se une a T, y G a


C. Por lo tanto, la secuencia de nucletidos de una cadena
dene y complementa la secuencia de nucletidos en la
otra. As, una cadena de la doble hlice del ADN siempre es
el complemento de la otra. Los pares de bases se mantienen
unidos mediante dos enlaces de hidrgeno entre A y T, y
tres enlaces de hidrgeno entre G y C (gura 3-8). El apareamiento especco de bases entre las cadenas de ADN
sustenta las llamadas reglas de Charga: en cualquier
muestra de ADN de cadena doble, la cantidad de A es igual
a la cantidad de T, la cantidad de G es igual a la de C, y la
cantidad de purinas es igual a la de pirimidinas.

Variantes de la doble cadena de ADN


Se han descrito tres formas estructurales principales del
ADN: la forma B, descrita por Watson y Crick, la forma A y
la forma Z. La forma B es la que adopta el ADN en condiciones siolgicas, por lo que es la estructura predominante en
el ADN cromosmico. La forma A se produce in vitro con la
deshidratacin moderada de la forma B. Es probable que la
conformacin de los hbridos ADN-ARN y del ARN de doble
cadena se asemeje a la forma A. La forma Z del ADN es
caracterstica de regiones donde se encuentra una secuencia
de purinas y pirimidinas alternadas (por ejemplo, zonas de
repeticin de GC). La funcin biolgica del ADN-Z es poco
comprendida, pero puede estar relacionada con la regulacin
de la expresin gnica. Las caractersticas detalladas de cada
una de las variantes se describen en el cuadro 3-2.

CAPTULO 3 cidos nucleicos

Esqueleto de
fosfatopentosa

Extremo 5
O

T=A

O P O
O
5

A=T

HH

Surco
menor

Surco
mayor

Par de bases

C=G

HH

CH2
HH

HH

O P O
O

O P O
O

Figura 3-7. Doble hlice del ADN.

H H

O
5

CH2

HH
G=C

HH

O P O
O
O

CH2

O P O
O

A=T

HH

O
T=A

HH

HH

O P O
O
T
CH2 O

HH

CH2

C=G

4
3

CH2
HH

O P O
O

T=A

O P O
O
5

HH

G=C

CH2

C=G

29

CH2

H H3

HH

HH

www.fullengineeringbook.net

ADN circular

Extremo 3 OH

El ADN mitocondrial y el de clulas procariotas se encuentra en forma de molcula circular, sin extremos, donde no
hay interrupcin de los enlaces fosfodister. Es posible
encontrar al ADN circular como una estructura relajada
(gura 3-9A) o como una estructura superenrollada y ms
compacta, donde la hlice del ADN (ya enrollada) gira sobre
s misma (superenrollada) y genera una superhlice (gura
3-9B). El superenrollamiento se produce debido a la accin

OH

Extremo 5

Figura 3-8. Estructura del ADN.

de las enzimas topoisomerasas, que mediante el corte transitorio de una o ambas hebras introducen un aumento o
una disminucin (superenrollamiento positivo o negativo,
respectivamente) en el nmero de vueltas de hlice. El
ADN circular superenrollado permite la compactacin del

Cuadro 3-2. Caractersticas de los tipos de ADN segn su estructura.


Tipo estructural del ADN
Caractersticas

ADN B
(Watson-Crick)

ADN A (deshidratada)

ADN Z
(Rich-Dickerson)

Sentido de giro de la hlice

Dextrgiro

Dextrgiro

Levgiro

Dimetro de la hlice

2.55 nm (25.5 A)

2.37 nm (23.7 A)

1.84 nm (1.84 A)

Distancia entre pares de bases

0.23 nm (2.3 A)

0.34 nm (3.4 A)

0.38 nm (3.8 A)

Pares de bases por vuelta

11

10.4

12

Inclinacin del plano de los


pares de bases

19 (gran inclinacin)

1.2 (casi perpendicular al eje


de la hlice)

9 (ligera inclinacin)

Surco mayor

Estrecho, profundo

Ancho, profundidad media

Plano, sin profundidad

Surco menor

Amplio, no profundo

Estrecho, profundidad media

Estrecho, profundo

Tipos de estructura secundaria de ADN. La molcula de ADN toma una estructura diferente segn el microambiente en el que se encuentre, con ello el nmero de
bases por giro, la inclinacin y el giro de la molcula vara; estas caractersticas inuyen en su disponibilidad como fuente de informacin gentica

30

PARTE I Conceptos bsicos de biologa molecular

A)

B)

de las histonas puede unirse de manera reversible a grupos


acetilo, metilo o fosfato, lo que se conoce como modicaciones epigenticas; la adicin de estos grupos modica la
unin de las histonas al ADN y, por tanto, regula la disponibilidad de la informacin gnica.

Solenoide
Figura 3-9. Molculas de ADN circular.

ADN para que ocupe menor espacio en la clulas; tambin


permite que posiciones lejanas en la secuencia se aproximen, y adems regula la accesibilidad a la informacin
gentica y la expresin gnica, al mantenerse inaccesible
para los factores de transcripcin.

Los nucleosomas se compactan para formar un polinucleosoma de seis unidades mediante interacciones entre las H1
de cada nucleosoma, lo que genera una estructura ms
compacta. Esta estructura recibe el nombre de solenoide y
forma una hebra de 30 nm, conocida como cromatina, en
este nivel el ADN est compactado unas 100 veces. La cromatina puede encontrarse activa de forma transcripcional,
por lo que se descompacta y entonces recibe el nombre de
eucromatina. La cromatina inactiva se encuentra en su forma compacta y se la conoce como heterocromatina.

Niveles de empaquetamiento del ADN


Debido a la longitud del ADN genmico en las clulas eucariotas (alrededor de 2 metros/clula) es necesaria su compactacin, de manera que permita ocupar menos espacio y
quepa dentro del ncleo de la clula. El ADN se asocia con
nucleoprotenas (histonas y no-histonas) para formar la cromatina y dar origen a los cromosomas; por ello, en el empaquetamiento del ADN se distinguen diferentes niveles de
organizacin, que se describen a continuacin.

Asas cromatnicas
La bra de 30 nm se pliega y condensa an ms, formando
estructuras de asas amplias superenrolladas, las cuales se
anclan sobre protenas de andamiaje y dan lugar una hebra
de 300 nm de grosor.

www.fullengineeringbook.net

Nucleosoma
Las histonas son protenas con carga positiva a pH siolgico, debido a su alto contenido en aminocidos bsicos,
como la lisina y la arginina. Esta propiedad les permite asociarse a la molcula de ADN de carga negativa (conferida
por los grupos fosfato). Existen cinco tipos de histonas: H1,
H2A, H2B, H3 y H4. Dos molculas de histona H2A, H2B,
H3 y H4 se asocian para formar un octmero de histonas.
Un segmento de ADN de doble cadena de aproximadamente 146 pb se enrolla dando 1.6 vueltas al octmero para formar una estructura llamada nucleosoma. Los diferentes
fragmentos de ADN presentes en el ncleo se asocian a
diversos octmeros y forman una cadena de nucleosomas
conocida como cuentas de rosario o cuentas de collar
por su semejanza con estas estructuras al observarse en el
microscopio electrnico. Entre cada nucleosoma queda un
segmento de ADN de aproximadamente 55 pb denominado
ADN enlace o linker (gura 3-10A). La funcin del nucleosoma es condensar el ADN en una bra de 11 nm de ancho
que se asemeja al mencionado collar de perlas, donde cada
nucleosoma sera una perla y el ADN de enlace, el cordn
con el cual estn unidas estas perlas. El ADN linker se asocia, entonces, con otra histona denominada H1 y ayuda al
empaquetamiento del ADN, lo que facilita la formacin de
otra estructura, llamada solenoide, que se describir con
detalle en la siguiente seccin. El extremo aminoterminal

Cromosoma condensado

Las asas cromatnicas se compactan y forman un cromosoma condensado de 700 nm de espesor visible durante la
interfase.

Cromosomas mitticos
Las cromtides hermanas visibles en la mitosis representan
la ltima etapa de la organizacin del ADN y llegan a medir
1 400 nm de grosor.
Los niveles de empaquetamiento del ADN se presentan
esquematizados en la gura 3-10B.

Desnaturalizacin y renaturalizacin del ADN


La desnaturalizacin es la prdida de la estructura helicoidal (estructura secundaria) caracterstica de la molcula de
ADN. El proceso de desnaturalizacin ocurre por la rotura
de los puentes de hidrgeno entre las bases nitrogenadas, lo
que ocasiona la separacin de las dos cadenas antiparalelas
sin que se altere la estructura primaria, ya que los enlaces
fosfodister no resultan afectados.
La desnaturalizacin puede ocurrir por exposicin de
los cidos nucleicos a agentes qumicos o f sicos, cambios
de pH y enzimas.
Los agentes desnaturalizantes, como la urea, la formamida y el formaldehdo, son altamente polares, con grupos
amino y carbonilo que compiten con los grupos amino y
carbonilo de las bases nitrogenadas en la formacin de

CAPTULO 3 cidos nucleicos

31

Doble hlice de ADN


Hebra de 10 nm
Nucleosoma

Histona H1

Solenoide
Fibra de 30 nm

H2B
H2A

H3

H1

H4
ADN
ADN enlace

Octmero de
histonas

Nucleosoma

Cromosoma
en metafase

Asas cromatnicas
300 nm

www.fullengineeringbook.net
Cromosoma
condensado
(700 nm)

Figura 3-10. Niveles de empaquetamiento del ADN.

puentes de hidrgeno y dan lugar a la separacin de las


hebras. Tambin un pH extremadamente alcalino o cido
puede desnaturalizar el ADN; sin embargo, este tratamiento puede dar lugar a la rotura de enlaces fosfodister, y por
lo tanto, a la prdida de la estructura primaria. La temperatura es el agente desnaturalizante ms representativo: el
calentamiento gradual del ADN hasta llegar a 100C debilita las fuerzas estabilizadoras de la doble hlice, de forma
que las dos hebras se desenrollan hasta su separacin total.
La temperatura de fusin (Tm) se dene como la temperatura a la que se ha desnaturalizado el 50% de las molculas
de ADN de la muestra que se est calentando. La Tm representa el punto en que la energa aplicada es suciente para
romper la mitad de los puentes de hidrgeno que mantienen unidas las dos cadenas de la molcula de ADN. Una
muestra de ADN con alto contenido de G y C tiene una
mayor Tm en comparacin con una con alto contenido de A
y T. Esto se debe a que G y C estn unidas con tres puentes
de hidrgeno, a diferencia de A y T, que lo estn por dos
puentes de hidrgeno, por lo que para disociarlas se requiere una temperatura mayor. La prdida de la estructura helicoidal del ADN puede vigilarse con la medicin de su

absorbancia a 260 nm, ya que el ADN de cadena sencilla


tiene una absorbancia relativa mayor que el ADN de cadena
doble en la misma longitud de onda.
Las topoisomerasas, las girasas y las helicasas son enzimas que pueden desenrollar (desnaturalizar) el ADN. Las
topoisomerasas cortan una o ambas hebras del ADN, lo que
provoca la relajacin del superenrollamiento. Las girasas
actan desenrollando el ADN circular presente en las bacterias, y las helicasas se unen al ADN cerca de la horquilla
de replicacin, rompen los puentes de hidrgeno y catalizan la separacin de las hebras mediante la energa liberada
por hidrlisis de ATP.
El ADN desnaturalizado puede renaturalizarse si se
retira gradualmente el agente desnaturalizante. Por ejemplo, si una solucin de ADN desnaturalizada por calentamiento se enfra lentamente, las dos cadenas se vuelven a
asociar por complementariedad de sus bases.

ARN
Es el cido nucleico ms abundante en la clula eucariota,
donde suele ser 10 veces ms abundante que el ADN.

32

PARTE I Conceptos bsicos de biologa molecular

A)

Extremo 5

Estructura secundaria del ARN

La estructura secundaria est dada por el apareamiento de


secuencias complementarias en la misma cadena de ARN
(asociacin intracatenaria parcial) o por asociaciones intercatenarias, en el caso de los ARN de doble cadena de ciertos
virus. La complementariedad ocasional de bases en el ARN
da origen a las estructuras de pasador (hairpin), formaciones tpicas, en las cuales parte de la cadena de ARN es
complementaria y origina puentes de hidrgeno entre sta
y la parte no complementaria da origen a un loop o asa de
bases que no se unen como se aprecia en la gura 3-11B.

O P O
O
C

CH2

H H

HH

O
O P O
O

CH2

Estructura terciaria del ARN

HH

H H

O
O P O
O
5

CH2
4

H H

HH

O P O
O
G

CH2

La estructura terciaria del ARN no siempre se forma, slo


surge cuando las condiciones celulares propician la interaccin entre bases nitrogenadas de diferentes regiones de una
misma molcula de ARN. Los ARN de transferencia (ARNt)
forman una estructura terciaria caracterstica: en disolucin estn plegados en forma de L compacta estabilizada
por apareamientos de bases convencionales y por interacciones entre las bases de ms de dos nucletidos, como los
tripletes de bases (vase el captulo 6). Las bases nitrogenadas pueden interactuar a travs de los tomos de hidrgeno
para unirse al esqueleto fosfodister de la cadena de ARN, o
bien a travs del OH del carbono 2 de la ribosa, que acta
como un importante dador y aceptor de hidrgenos.

www.fullengineeringbook.net
5

H H

Extremo 3

OH

HH

B)

Tipos de ARN

Aunque qumicamente son iguales, los ARN segn la funcin que desempeen en la clula se agrupan en:

ARN heterogneo nuclear


C

G A
UU C U G C C A
U
A
A A G A C G G U
GU
A

Figura 3-11. Estructura primaria y secundaria del ARN.

En cuanto a su estructura tres caractersticas diferencian al ARN del ADN:


1. El ARN suele ser monocatenario (una sola cadena).
2. Contiene uracilo en lugar de timina.
3. La pentosa que constituye a sus nucletidos es la ribosa,
en lugar de la 2-desoxirribosa del ADN (la presencia
del grupo hidroxilo en el C2 de la ribosa provoca que el
ARN sea una molcula qumicamente inestable).

Estructura primaria del ARN


Al igual que en el ADN la estructura primaria del ARN est
determinada por secuencia lineal de sus ribonucletidos,
que se escriben siempre en direccin 5-3 (gura 3-11A).

Es un ARN tambin conocido como trnscrito primario, de


alto peso molecular. Es el producto inicial de la sntesis de la
ARN polimerasa en el proceso de transcripcin. En el
ncleo de las clulas eucariotas acta como precursor de
los dems tipos de ARN que se encuentran en el citoplasma. La fragmentacin del ARNhn para formar otros tipos
de ARN supone la maduracin o el procesamiento del ARN
(vase el captulo 5). En las clulas procariotas, el trnscrito
primario acta directamente como molde para la sntesis
de protenas, sin necesidad de maduracin o modicaciones postranscripcionales.

ARN mensajero (ARNm)


El ARNm sirve de molde para la sntesis de protenas en el
proceso de traduccin, ya que contiene la informacin
gnica para la formacin de uno o varios polipptidos (vase el captulo 6). El ARNm se localiza en el citoplasma, su
longitud es variable segn la protena para la que codique
y contiene, adems, las seales necesarias para el inicio y la
terminacin de la traduccin. En eucariotes el ARNm presenta caractersticas especiales: en su extremo 5 muestra

CAPTULO 3 cidos nucleicos

A)

33

CAP 5 CGACCAUGAACGGAUACUGACAAGUUAUUGAGUGGAGGAUU AAAAAAAAAAAAAA-3


ARNm

Poli A

CH2
N

NH2
6

N 1

8
9

7-metilguanosina
N

N
CH2 O

O P O

OH

H
H
H 3 2 H

O
O P O

B)
Secuencia del ARNm del Factor de crecimiento tipo insulina de humano (IGF1)

O
O P O
O
C

CH2

5
2 4

HH

H H

OH

O
O P O
O

CH2

5
2 4

H H

HH

1 ttttgtagat aaatgtgagg attttctcta aatccctctt ctgtttgcta aatctcactg


61 tcactgctaa attcagagca gatagagcct gcgcaatgga ataaagtcct caaaattgaa
121 atgtgacatt gctctcaaca tctcccatct ctctggattt ctttttgctt cattattcct
181 gctaaccaat tcattttcag actttgtact tcagaagcaa tgggaaaaat cagcagtctt
241 ccaacccaat tatttaagtg ctgcttttgt gatttcttga aggtgaagat gcacaccatg
301 tcctcctcgc atctcttcta cctggcgctg tgcctgctca ccttcaccag ctctgccacg
361 gctggaccgg agacgctctg cggggctgag ctggtggatg ctcttcagtt cgtgtgtgga
421 gacaggggct tttatttcaa caagcccaca gggtatggct ccagcagtcg gagggcgcct
481 cagacaggca tcgtggatga gtgctgcttc cggagctgtg atctaaggag gctggagatg
541 tattgcgcac ccctcaagcc tgccaagtca gctcgctctctg tccgtgccca gcgccacacc
601 gacatgccca agacccagaa gtatcagccc ccatctacca acaagaacac gaagtctcag
661agaaggaaag gttggccaaa gacacatcca ggaggggaac agaaggaggg gacagaagca
721 agtctgcaga tcagaggaaa gaagaaagag cagaggaggg agattggaag tagaaatgct
781 gaatgcagag gcaaaaaagg aaaatgaagg acaggaggat taaacagaca gaggcaagga
841 tgatgagaga ggagcagaca gcaagaatga aaagcagaaa atacaataga ggaaatgaag
901 aaaagtaggc ctgctggagc tagatgatga tgtgatggaa atagaagta

www.fullengineeringbook.net
3

OH

Figura 3-12. Secuencia de un ARN mensajero.

una capucha (cap) y en su extremo 3, una cadena de poliadeninas (cola poliA) de longitud variable (gura 3-12). Estas
modicaciones tienen por objeto aumentar la vida media
de esta molcula en el citoplasma y permitir su disponibilidad en el proceso de traduccin proteica. La presencia de la
cola de poliA en el extremo 3 facilita su puricacin cuando se emplea cromatograf a en columna de anidad, ya que
forma hbridos con residuos de poliuridinas (poli U) unidos
a una resina empaquetada en el interior de la columna.

un aminocido que liberarn en el ribosoma durante el proceso de traduccin. Suelen presentar bases nitrogenadas
inusuales, como la inosina, la dihidrouridina, etc., e incluso
la timina. Su estructura secundaria presenta un plegamiento complejo donde se encuentran zonas con apareamiento
de secuencias complementarias y otras sin apareamiento de
secuencias complementarias, y en donde se pueden distinguir regiones crticas, como la de unin al aminocido y el

ARN ribosomal (ARNr)


El ARNr forma parte de los ribosomas, estructuras intracelulares en que se realiza la sntesis de protenas (gura 3-13).
Sus estructuras secundaria y terciaria presentan un plegamiento complejo que le permite asociarse tanto a las protenas de los ribosomas como a otros ARNr y participar en el
proceso de sntesis proteica.

ARN de transferencia (ARNt)


Las molculas de ARNt tienen entre 75 y 90 nucletidos, y
su peso molecular es de unos 2.5 kDa. Se conocen unos 32
ARNt distintos y se encuentran en todas las clulas. stos
intervienen en la sntesis de protenas, ya que van unidos a

ARNr
28s
5.8 S
5S

18 S

Ribosoma

Figura 3-13. Esquema de un ribosoma donde se observa el ARN


ribosomal.

34

PARTE I Conceptos bsicos de biologa molecular

unen al precursor del ARNm para eliminar los intrones se


forma un complejo ARN-protena de gran tamao, visible
en el microscopio electrnico, y que recibe el nombre de
espliciosoma (spliceosome).

U
G
G
Brazo D
G
G U
C G G G C
D

A
C

Enzimas de ARN (ribozimas)

3 Brazo aceptor
A
C

Brazo T C
C
U
A
G A G G A
U
G
C
A C C
U
G
A C
C
G D
G
A

U
A
A D C

C C G U
A
G
U
A

U
I
A A C
Brazo
anticodn
ARNt

Estos cidos ribonucleicos funcionan como catalizadores


biolgicos. Poseen, al igual que las enzimas, un sitio activo,
uno de unin para el sustrato y uno de unin para un cofactor
que puede ser un ion metlico. Los ARNsn involucrados en
maduracin del ARNhn son un ejemplo clsico de ribozimas.

siARN
Molculas de ARN de doble cadena de 20 a 25 nucletidos
que a travs de la va de interferencia de ARN de clulas
suprimen la expresin de un gen especco. El siARN se une
a una secuencia complementaria del ARNm, la unin del
siARN con el ARNm produce la degradacin enzimtica
del ARNm en clulas eucariotas de mamferos y plantas. Las
descubri el grupo de David Baulcombe en Inglaterra, en
1999, y originalmente los describieron como parte del mecanismo de regulacin gnica postranscripcional en plantas.

Figura 3-14. Estructura secundaria del ARN de transferencia.

miARN
Se trata de molculas de ARN de cadena sencilla de 21-23
nucletidos en longitud encargadas de regular la expresin
gnica. Los miARN se unen a una secuencia complementaria del ARNm y bloquean la traduccin. El miARN no es
totalmente complementario a la secuencia del ARNm; en
este caso, el ARNm no se degrada pero tampoco puede utilizarse para la sntesis de protenas. Originalmente los describi el grupo de Victor Ambros en 1993 como small
ARNs. El trmino micro-ARN fue introducido en 2001 por
Ruvkun por la capacidad de los siARNs y miARNs para
silenciar genes.

www.fullengineeringbook.net

brazo donde se ubica la secuencia del anticodn que reconoce los codones del ARNm (gura 3-14).

ARN pequeo nuclear (ARNsn)


Es el ARN presente en el ncleo eucariote y est implicado
en los procesos de maduracin del ARNhn. En este proceso, el ARNsn se asocia a protenas, formando las ribonucleoprotenas pequeas nucleares (RNPsn) que se encargan
de eliminar intrones (fragmentos de ARNhn que no aparecen en el ARNm) (vase el captulo 5). Cuando las RNPsn se
Ejercicios de integracin
1. Escriba las caractersticas principales de la doble hlice
de ADN.

3
T=A

C=G
A=T
G=C

T=A
C=G

T=A
C=G
A=T

G=C
3

CAPTULO 3 cidos nucleicos

2. Mencione el tipo de enlace que une la pentosa con el


grupo fosfato y el tipo de enlace que une la pentosa con
la base nitrogenada.

35

4. Dibuje la hebra complementaria de ADN con los puentes


de hidrgeno correspondientes para cada base.
Extremo 5
O

NH2
5

CH2

H H

H H

H H

CH2

1
3

P
O

4
3

P
O
5

CH2

H H

H H

3. De acuerdo con la estructura, identique las variantes de


la doble molcula de ADN: A, B y Z.

H
O

P
O

www.fullengineeringbook.net
CH2
5

H H

H H

O
O

H
O

P
O
5

H H

H H

Extremo 3

CH2

OH

Bibliografa
Alberts B., Bray D., Hopkin K., Johnson A., Lewis J., Raff M., et
al. DNA y cromosomas. En: Alberts B., editor. Introduccin a la

Kutter C., Svoboda P. miRNA, SiRNA, piRNA. RNA Biology,

Biologa Celular, 3 ed. Madrid: Editorial Mdica Panamericana,


2010:171-193.
Chandar N., Viselli S. Organizacin del genoma eucaritico y expresin gnica. En: Harvey R., editor. Biologa molecular y celular, 1
ed. Barcelona: Lippincott Williams and Wilkins, 2011:58-126.
Harvey R., Ferrier D. Almacenamiento y expresin de la informacin gentica. En: Harvey R., (ed). Bioqumica, 5 ed. Barcelona:
Lippincott Williams and Wilkins, 2011:395-465.
Karp G. Biologa celular y molecular: conceptos y experimentos, 6 ed.
Mxico: McGraw-Hill, 2011:379-497.

Lodish H., Berk A., Matsudaira P., Kaiser C., Krieger M., Scott M.,
et al. Mecanismos genticos moleculares bsicos. En: Lodish H

2008;5:181-188.

(ed). Biologa celular y molecular, 5 ed. Buenos Aires: Editorial


Mdica Panamericana, 2006:101-123.
Luque J., Herrez A. Texto ilustrado de Biologa Molecular e Ingeniera Gentica: conceptos, tcnicas y aplicaciones en ciencias de la
salud, 1 ed. Madrid: Harcout, 2001:10-88.

Captulo

Replicacin
Jorge Fernando Floresvillar Mosqueda / Jos Guadalupe Macas Barragn

Introduccin

Semiconservadora

Una de las caractersticas ms notables del ADN es su capacidad de replicarse; dicho de otra manera, tiene la capacidad de formar copias de s mismo. La replicacin se lleva a
cabo en la fase de sntesis (S) del ciclo celular. Esta etapa es
un paso obligado para realizar la divisin celular. Por ello,
se determina que la informacin gentica se transere de
una clula a otra mediante el proceso de replicacin del
ADN.
El objetivo de la replicacin es el de conservar la informacin gentica. La representacin estructural del ADN en
doble hlice permite comprender cmo dicha molcula
puede dar lugar a otras idnticas, sin perder su conformacin. En principio, las dos hebras debern separarse
y, despus, mediante la accin de una enzima, aadir desoxirribonucletidos y, segn la complementariedad de
bases, construir ADN a partir de las dos hebras molde iniciales.

Se reere a que en cada replicacin una molcula de ADN


recin sintetizada conserva una de las cadenas originales y
la otra es sintetizada de novo.
Anteriormente existan tres teoras que trataban de
explicar el proceso de la replicacin; se deca que poda
ser: semiconservadora, conservadora y dispersora o dispersante.
Semiconservadora (modelo correcto). En cada una de
las molculas hijas se conserva una de las cadenas originales.
Conservadora. Se sintetiza una molcula totalmente
nueva, copia de la original, por lo que tras la duplicacin
quedan, por un lado, las dos hebras antiguas juntas y,
por otro, las dos hebras nuevas.
Dispersora o dispersante. Las cadenas hijas constan
de fragmentos de la cadena antigua y fragmentos de la
nueva.

www.fullengineeringbook.net

El experimento denitivo para dilucidar cul de estas


tres hiptesis era la correcta lo realizaron Meselson y Stahl
en 1957, y conrm la hiptesis semiconservadora. Este
experimento se basaba en dos premisas fundamentales: por
una parte, el nitrgeno es uno de los principales elementos
del ADN, ya que forma parte de las bases nitrogenadas, y
por la otra, existen dos istopos de este tomo, 14N y 15N,
que pueden distinguirse mediante tcnicas de laboratorio.
Aunque el 14N es el istopo ms abundante en la naturaleza,
el 15N tambin es viable y es ms pesado, caracterstica que
permite diferenciarlos. Este experimento se realiz utilizando bacterias cuyo medio de cultivo contena 15N, por lo
que todo su ADN tambin lo contena. Despus se les cambi el medio de cultivo por uno que contena 14N. Se permiti que las bacterias se replicaran slo una vez y se extrajo el
ADN que se analiz por centrifugacin en gradiente de cloruro de cesio, que permite separar las molculas por tama-

Caractersticas generales
La sntesis de las cadenas de ADN durante la replicacin se
lleva a cabo en direccin 5 3 tanto en eucariotes como
en procariotes. Solamente el carbono de la posicin 3 de la
pentosa posee un radical hidroxilo (OH) libre, con el que
puede formar un nuevo enlace fosfodister con otro desoxirribonucletido y formar as la hebra creciente de ADN;
por esta razn, la cadena de ADN slo puede crecer en
direccin 3. A este proceso se le llama polimerizacin, que
consiste en la unin de un dNTP (desoxirribonucletido)
complementario a la hebra molde segn la Ley de Charga (vase el captulo 1). La replicacin del ADN cuenta
con tres caractersticas que la denen y permiten entender
el proceso: semiconservadora, bidireccional y antiparalela.
36

CAPTULO 4 Replicacin

a)

Modelo
semiconservativo

Modelo
conservativo

Modelo
disperso

Cadena
retardada

origen
Hebra
madre

5 3
3

1
repl.
a

3 5

37

5 3

3 5

3
5

Cebador Fragmento de Cadena


continua
primer
Okazaki

2a
repl.

Figura 4-2. Replicacin del ADN. Esta replicacin es bidireccional.


b)
ADN
pesado 15N

ADN hbrido
15 14
N N

ADN ligero 14N


ADN hbrido

Hebra original

los cromosomas de bacterias y virus existe un origen nico


de replicacin por molcula de ADN; este sitio ORI permite la replicacin de todo el ADN circular, por lo que se arma que la replicacin es monofocal (gura 4-4).

Discontinua
1a
repl.

2a
repl.

La replicacin siempre se produce en sentido 5 3, y el


extremo 3-OH libre es el punto a partir del cual se produce
la elongacin del ADN. Esto plantea un problema: las cadenas tienen que crecer de forma simultnea a pesar de que
son antiparalelas, es decir, cada cadena tiene el extremo 5
enfrentado con el extremo 3 de la otra cadena. Por ello, una
de las cadenas debera sintetizarse en direccin 3 5. Esta
incgnita la resolvieron los cientcos japoneses Reiji Okazaki y Tsuneko Okazaki en la dcada de 1960, al descubrir
que una de las nuevas cadenas del ADN se sintetizaba en
forma de fragmentos cortos que, en su honor, se denominan fragmentos de Okazaki. Su longitud suele variar entre
1 000 y 2 000 nucletidos en las bacterias y entre 100 y 400
nucletidos en eucariotes. La cadena que se sintetiza en el
sentido que avanza la horquilla de replicacin se denomina
hebra adelantada, lder o conductora (leading strand), y se

www.fullengineeringbook.net

Figura 4-1. Teoras de la manera en que se replicaba el ADN.


A, conservadora, semiconservadora y dispersante. B, experimento de Meselson y Stahl. Se concluy en que la replicacin
del ADN era un proceso semiconservador.

o o peso. El resultado mostr una sola banda con un peso


intermedio 14N y 15N, lo que sugiri que la molcula resultante estaba compuesta de 14N y 15N. En la segunda replicacin en medio con 14N se observaron dos bandas, una
correspondiente a 14N (del ADN replicado en esta segunda
divisin celular) y otra intermedia entre 14N y 15N de la
mezcla ADN parental: ADN recin sintetizado. De esta forma, Meselson y Stahl demostraron el mecanismo correcto
de la replicacin del ADN (gura 4-1 A y B).

ori

ori

ori

ori

ori

ori

Bidireccional
La replicacin del ADN en eucariotes es bidireccional, ya
que a partir del sitio de origen (ORI, tambin llamados ARS
en eucariotes), se sintetizan las dos cadenas en ambos sentidos, con dos puntos de crecimiento que forman lo que se
conoce como horquillas de replicacin (gura 4-2).
En organismos eucariotes, debido al gran tamao del
ADN, existen mltiples orgenes de replicacin (sitios ORI),
por lo que a la replicacin se la considera multifocal (gura
4-3). Los sitios ORI son secuencias especcas ricas A y T y
controlan la replicacin de una unidad de ADN llamada
replicn. La presencia de bases A:T facilita la separacin de
las hebras y la formacin de la burbuja de replicacin. En

Figura 4-3. Replicacin multifocal. La replicacin en eucariotes


contiene mltiples sitios ORI, que se replican simultneamente, lo que permite acortar el tiempo en el que se replica todo el
ADN.

38

PARTE I Conceptos bsicos de biologa molecular

Topoisomerasas: son enzimas isomerasas que actan


sobre la topologa del ADN, pueden cortar o formar enlaces
fosfodister ya sea una de las hebras (topoisomerasa I) o en
las dos (topoisomerasa II) que forman el ADN. Esta escisin
selectiva permite al ADN liberar la tensin contorsional,
con lo que se deshace el superenrollamiento, el cual en caso
de persistir detendra la replicacin. De esta manera se permite el acceso a la cadena de ADN a todas las enzimas involucradas en la replicacin.
Primasa: es una enzima que sintetiza pequeos fragmentos de ARN de entre 8 y 10 nucletidos de longitud,
conocidos como cebadores o primers, complementarios a
un fragmento del ADN. La unin de los cebadores al ADN
proporciona un extremo 3 necesario para que la ADN
polimerasa (enzima que sintetiza ADN y que no puede aadir nucletidos si no existe un extremo 3libre) lleve a cabo
su accin. Los cebadores, al ser ARN, luego son degradados
por las nucleasas Rnasa H1 y sustituidos por ADN por
accin de otra ADN polimerasa.
Rnasa H1: enzima encargada de retirar los cebadores
de ARN durante la sntesis de los fragmentos de Okazaki y
en los procesos de reparacin del ADN.
FEN1/RTH1: tambin llamada endonucleasa ap 1
(ap endonuclease 1), se encarga de remover el ribonucleotido 5 del fragmento de Okazaki. El Nick (falta de enlace
fosfodister entre dos nucletidos adyacentes) resultante es
sellado por la ADN ligasa.
Ligasa: enzima que cataliza la formacin del enlace fosfodister entre nucletidos contiguos.
Telomerasa: es una ribonucleoprotena con actividad
de ADN polimerasa dirigida por ARN (transcriptasa inversa) capaz de sintetizar una secuencia determinada de ADN
que permite el alargamiento de los telmeros (extremos de
los cromosomas eucariotes).
Antgeno nuclear de clulas en proliferacin (PCNA):
es un homotrmero que forma una estructura de toroide, la
cual es abierta transitoriamente por accin del factor de
replicacin C (RFC, replication factor C), lo que permite su

ADN viejo
ADN nuevo
ORI

Figura 4-4. Replicacin monofocal. En eucariotes, el nico


cromosoma existente contiene un solo sitio de replicacin ORI.
A este tipo de replicacin se le llama monofocal.

sintetiza de forma continua por la ADN polimerasa, mientras que la que se sintetiza en sentido contrario al avance de
la horquilla se denomina hebra rezagada o retrasada (lagging strand), cuya sntesis se realiza de forma discontinua
o en fragmentos, y para disponer de una cierta longitud de
ADN molde para continuar hay que esperar a que la horquilla de replicacin avance (cuadro 4-1).

Protenas que participan en la replicacin


La maquinaria encargada de la replicacin del ADN es muy
compleja y est formada por un grupo de protenas que
actan en conjunto con una secuencia de ADN especca ya
establecida. A continuacin se describen las enzimas que
intervienen en el proceso de replicacin y enseguida se desarrollar el proceso mencionando las enzimas involucradas.
Helicasa: enzima encargada de separar las dos hebras
del ADN mediante la rotura de los puentes de hidrgeno
que se establecen entre las bases nitrogenadas de las dos
cadenas del ADN. Ocasiona superenrollamientos positivos
a los lados de la burbuja de replicacin.
Protenas de unin a cadena sencilla (SSB, singlestrand ADN binding proteins en procariotes y RPA en
eucariotes): evitan la formacin de los puentes de hidrgeno entre las dos cadenas separadas por la helicasa y permiten que se copien.

www.fullengineeringbook.net

Cuadro 4-1. Diferencias en la replicacin entre procariotes y eucariotes.


Procariotes

Eucariotes

Lugar
Citoplasma

Ncleo y mitocondria
103

Nmero de orgenes de replicacin

Ncleo
a 104
Mitocondria 2

Tiempo de replicacin del genoma (h)

~0.67

Protenas implicadas

~30

Cientos

ADN polimerasas

Inicio

Origen nico

Origen mltiple

Otros materiales

Cebador, dNTPs

Cebador, dNTPs

Formato

Semiconservadora

Semiconservadora

Tasa de replicacin

1 000 nucletidos/s

100 nucletidos/s

CAPTULO 4 Replicacin

39

Cuadro 4-2. Propiedades de la ADN polimerasa de eucariotes.

Compartimiento celular

Ncleo

Ncleo

Mitocondria

Ncleo

Ncleo

Primasa asociada

No

No

No

No

Funcin biolgica

Replicacin hebra
retardada

Reparacin del ADN

Replicacin del ADN


mitocondrial

Replicacin hebra
conductora

Replicacin
adicional

Nm. de subunidades

4 isoformas

Peso molecular
Subunidad cataltica

165 a 185

40

125

125

210 a 230

recircularizacin alrededor de la doble hlice del ADN a la


altura del extremo del primer en la cadena lder. La estructura toroide del PCNA alrededor de la cadena de ADN permite su libre desplazamiento por la misma. PCNA
interacta con la ADN polimerasa, sirviendo como una
pinza que sostiene a la polimerasa en el extremo del primer
y le permite sintetizar la cadena de ADN.
ADN polimerasa: son las principales enzimas en este
proceso. Son capaces de sintetizar nuevas cadenas de ADN a
partir de una hebra patrn o molde y las unidades estructurales correspondientes (desoxirribonucletidos). Una caracterstica importante de esta enzima es que aade los
nucletidos en la direccin 5 3 siempre y cuando haya un
extremo 3 disponible. Como consecuencia de esto, la direccin en la cual leer la cadena molde de ADN ser de 3 5.
En eucariotes se han descrito por lo menos cinco ADN
polimerasas involucradas en la replicacin del ADN, cada
una con una actividad especca: , , , y . La polimerasa
(ADNpol ), tambin llamada primasa, inicia la sntesis
del ADN mediante la formacin de un cebador ARN. Las
polimerasas y (ADNpol y ADNpol ) son responsables
de la mayor parte de la elongacin de ambas hebras del
ADN. La polimerasa (ADNpol ) no interviene en la replicacin y est involucrada en la reparacin de errores o daos
en el ADN. Es importante mencionar que las polimerasas ,

, y estn involucradas en la replicacin del ADN nuclear.


La polimerasa (ADN pol ) lleva a cabo la replicacin del
ADN mitocondrial. Existen otras polimerasas, como las
polimerasas (theta), (eta) y (iota), cuya funcin no es
muy conocida, pero se cree que estn involucradas sobre
todo en mecanismos de reparacin y recombinacin.
De las 5 polimerasas, slo tres tienen la actividad de
exonucleasa-3 (pol , y ), esto es, son capaces de corregir
los errores cometidos al incorporar los nucletidos a la
hebra que se est sintetizando, eliminan el nucletido equivocado y aaden el correcto. Ninguna ADN polimerasa en
eucariotes presenta actividad de exonucleasa-5. En procariotes la ADN pol I presenta este tipo de actividad.
A diferencia de lo observado en eucariotes, en la maquinaria para la replicacin de los procariotes, slo tres enzimas participan en la sntesis del ADN. La polimerasa I es la
nica que tiene actividad de exonucleasa de 5 a 3.
En el cuadro 4-2 se resumen las propiedades de la ADN
polimerasa en eucariotes y en el 4-3, las de procariotes.

www.fullengineeringbook.net
Fases de la replicacin

Para su estudio y mejor comprensin, como la mayora de


los procesos celulares la replicacin se ha dividido en tres
fases: inicio, elongacin y terminacin.

Cuadro 4-3. Caractersticas de la polimerasa de procariotes.


ADN Pol I

ADN Pol II

ADN Pol III

Peso molecular (daltons)

109 000

90 000

900 000

Constitucin

Monmero

Monmero

Multmero asimtrico

Polimerasas /clula

400

Desconocido

10 a 20

Exonucleasa
3 a 5/correctora

Exonucleasa
5 a 3/reparacin

No

No

Actividad / funcin
Polimerasa
5 a 3/elongacin

40

PARTE I Conceptos bsicos de biologa molecular

helicasa

primosoma
hebra
molde

primasa
protenas SSB

5
3
3

in

icac

repl

ADN polimerasa

ARN cebador

Hebra discontinua (fragmentos de Okazaki)

Figura 4-5. Inicio de la replicacin del ADN. Se observan las cadenas continua y discontinua; ambas se replican en direccin
de 5 a 3.

www.fullengineeringbook.net

Inicio

Las zonas en el ADN donde se producen las burbujas de


replicacin no son aleatorias, se sabe que existen secuencias
de aproximadamente 300 pb que indican los lugares precisos donde ha de comenzar la replicacin. Estos sitios son
ricos en A y T y son reconocidos por una serie de protenas
llamadas, en conjunto, protenas de reconocimiento del sitio
de origen. En eucariotes, los orgenes de replicacin se llaman secuencias de replicacin autnoma (SRA).
Cada burbuja de replicacin posee dos horquillas de
replicacin, una de las cuales se desplaza hacia la derecha y
otra hacia la izquierda. El proceso de replicacin necesita,
en primera instancia, que las dos cadenas del ADN se separen. Para esto, la helicasa se unir a la cadena de ADN e
hidrolizar los puentes de hidrgeno. La apertura de la
doble hlice hace que las cadenas simples adquieran inestabilidad, que se compensa por la unin de protenas estabilizadoras RPA. La ADN polimerasa no puede iniciar la
sntesis a partir de los desoxirribonucletidos libres; por lo
tanto, necesita que la primasa sintetice un cebador, a partir del cual la ADN polimerasa incorporar los nucletidos
en forma complementaria a las bases de la cadena patrn
(gura 4-5).

Elongacin
Es el proceso por el cual la ADN polimerasa aade nucletidos uno por uno complementarios a la cadena molde, a
medida que avanza la horquilla, ayudada por PCNA. La

funcin del PCNA es mantener la ADN polimerasa en contacto con la cadena molde, con la nalidad de que la lea y
sintetice la cadena complementaria.
Una vez presente la maquinaria de inicio de la replicacin, la horquilla avanza, aumentando la tensin por delante de la cadena. Para evitar que esta tensin impida el
avance de la horquilla, las topoisomerasas (I y II) cortarn
los enlaces fosfodister de la doble hlice y volvern a unirla, lo que permitir que se desenrolle una vuelta si acta la
topoisomerasa I y dos si lo hace la topoisomerasa II.
Como ya se ha mencionado, la sntesis es diferente
en cada una de las hebras de la horquilla de replicacin; en
la cadena lder, la sntesis se realizar en forma continua, y
por el contrario, en la cadena retrasada, la sntesis se realizar en forma discontinua. Una de las consecuencias de la
sntesis discontinua es que para la sntesis de cada fragmento de Okazaki se requiere de un cebador intercalado entre
estos fragmentos, mientras que en el caso de la cadena continua es necesaria la presencia de un solo cebador. El proceso de elongacin es similar en eucariotes que en procariotes
(gura 4-6).

Terminacin
El nal de la replicacin se produce cuando la ADN polimerasa llega al extremo del fragmento de ADN. Se produce
entonces el desacoplamiento de todo el replisoma y la nalizacin de la replicacin. Uno de los pasos cruciales en el
proceso de terminacin es completar la sntesis de la cadena retardada y unir los fragmentos de Okazaki. A este pro-

CAPTULO 4 Replicacin

Cadena continua
ADN
pol

A G A C A
3

C T A

ADN
pol

A G A C A

Cadena discontinua

Figura 4-6. Elongacin de la replicacin del ADN. La cadena


continua va en sentido de la horquilla, y la discontinua, al lado
contrario y siempre sintetizando en direccin 5 a 3.

ceso se lo denomina maduracin, y requiere la eliminacin


de los cebadores, la elongacin del fragmento de ADN
adyacente para rellenar el espacio que qued por la eliminacin del cebador y la unin de los extremos resultantes para
formar una cadena continua. Para que esta maduracin
suceda, existe un sistema de nucleasas (FEN1/RTH1 +
RNasa H1) encargado de eliminar el cebador de ARN. En
consecuencia la ADNpol , o ADNpol , elonga el extremo

3 del fragmento adyacente y rellena el lugar que antes ocupaba el cebador hasta alcanzar el extremo 5 del fragmento
contiguo. Por ltimo, la ADN ligasa I sella la mella resultante uniendo el 3-P del primer fragmento con el 5-P del
segundo.
Replicacin de los telmeros. La fase nal de la terminacin de la replicacin del ADN consiste en la replicacin de los telmeros de las cadenas de ADN. Los telmeros
son secuencias repetidas de 1-5 unidades T y G en una de
las cadenas, y por lo tanto, C y A en la complementaria
situadas en los extremos de los cromosomas eucariotes
(los procariotes no poseen telmeros porque su ADN es
circular). La dinmica de replicacin que requiere de un
primer para polimerizar no permite completar la copia de
los extremos de la hebra de sntesis retrasada de ADN, al
no poderse situar un cebador ms all del nal de la secuencia. De esta manera, al retirar todos los cebadores de las
cadenas de ADN de sntesis retrasada recin sintetizadas;
en cada una de las dos molculas de ADN uno de los extremos queda ms corto. La telomerasa es una transcriptasa
inversa formada por ARN (9 a 28 nucletidos) y protena
que contiene un fragmento de la secuencia de su ARN
complementario a la secuencia de los telmeros. Por lo
tanto, en la replicacin de los telmeros actan las telomerasas, que se unen por complementariedad de bases a los

www.fullengineeringbook.net
Disquerina

1. Elongacin

TP1

TERC

TTAGGGTTAGGGTTAGGGTTAG
AATCCCAA
CAAUCCCAAUC

Disquerina
TERT

TP1

TERC

TTAGGGTTAGGGTTAGGGTTAG
AATCCCAA
CAAUCCCAAUC
CAAUCCCAAUC

TERT
3

Disquerina
TP1

2. Translocacin
TERC

TTAGGGTTAGGGTTAGGGTTAGGGTTAG
AATCCCAA
CAAUCCCAAUC

41

TERT
3. Elongacin
3

Figura 4-7. Funcin de la telomerasa en sus tres fases: elongacin, translocacin y elongacin.

42

PARTE I Conceptos bsicos de biologa molecular

telmeros y sintetizan los extremos de los cromosomas


ms all de su tamao, tomando como molde el ARN de la
transcriptasa inversa.
La telomerasa slo est presente en clulas somticas,
tejidos fetales y en ciertas clulas madre. En eucariotes la
presencia de la telomerasa en las clulas germinales garantiza la preservacin de las largas secuencias telomricas. La
desaparicin de la enzima en las clulas somticas condiciona la longitud de estas secuencias y puede alterar la divisin celular correcta, el tiempo de vida de una clula y, por
extensin, del organismo. El acortamiento de los telmeros
se ha vinculado con el envejecimiento (gura 4-7).
El mecanismo de accin de la telomerasa se detalla a
continuacin (gura 4-7):
1) La telomerasa se une a su respectiva secuencia complementaria y alarga el extremo saliente 3, una vez que ste
se encuentra alargado. Se produce un apareamiento de
bases entre el ADN telomrico y el ARN de la telomerasa.
2) Con este apareamiento empieza la primera elongacin.
La telomerasa cataliza la elongacin del extremo 3 alargado, aadiendo dNTPs y empleando como molde la
hebra de ARN de la propia telomerasa.
3) Una vez que se estn aadiendo los dNTPs, la telomerasa se desliza sobre el extremo 3 previamente elongado,
conservando la complementariedad gracias a la repeti-

cin de secuencias, lo que se conoce como translocacin.


4) La telomerasa elonga nuevamente el extremo 3 saliente.
5) Se vuelven a repetir los pasos de translocacin y elongacin.
6) En la segunda fase la ADN polimerasa rellena la otra
hebra, y la ligasa sella la mella que queda en la elongacin.

Replicacin mitocondrial
La replicacin del ADN mitocondrial en mamferos se ajusta al modelo del lazo de desplazamiento o lazo D. Las dos
hebras del ADN mitocondrial se pueden diferenciar segn
su densidad, y existe una hebra ligera (L) y otra pesada (H).
En primer lugar, se inicia la replicacin o sntesis de la nueva hebra L, sin que se comience la replicacin de la nueva
hebra H. El origen de replicacin de la hebra L es diferente
al de la hebra H, de forma que existen dos orgenes de replicacin diferentes, uno para cada una. Adems, una vez iniciada la replicacin de la nueva hebra L, la sntesis es
unidireccional y avanza desplazando a la otra hebra. Cuando se han sintetizado aproximadamente dos tercios de la
nueva hebra L, comienza la sntesis de la nueva hebra H, en
una sola direccin, opuesta a la de sntesis de la hebra ligera
L. Por consiguiente, la sntesis de la nueva hebra L termina
antes que la de la nueva hebra H (gura 4-8).

www.fullengineeringbook.net
Hebra pesada
(H)
Hebra ligera
(L)

(H)

(H)

OH

(H)

OH

OH
3

(L)

(L)

OL

Hebra pesada
(H)
Hebra ligera
(L)
OH

(H)

5 OL

OL

Figura 4-8. Replicacin del ADN mitocondrial. (L) hebra ligera; (H) hebra pesada; (OH) origen de hebra pesada; (OL) origen de
hebra ligera.

CAPTULO 4 Replicacin

43

Preguntas de repaso
1. En qu se distingue la sntesis de ADN entre eucariotes
y procariotes?
a) Los procariotes no requieren primasas.
b) Los eucariotes poseen mltiples orgenes de replicacin.
c) Los procariotes poseen extremos telomricos.
d) Las ADN polimerasas eucariotes sintetizan ADN de
3 5.
2. Las ADN polimerasas I y III de E. coli se distinguen entre
s gracias a:
a) Su distinta actividad de exonucleasa 3 5.
b) Su procesividad y la actividad de exonucleasa 5 3.
c) Que una posee actividad de exonucleasa y la otra no.
d) Que una posee actividad de primasa y la otra no.
3. La secuencia en la que las diferentes enzimas actan durante la replicacin del ADN en procariotes en la hebra
retrasada es:
a) ADN ligasa, primasa, ADN polimerasa III, ADN polimerasa I, helicasa.

Bibliografa

b) Helicasa, primasa, ADN polimerasa I, ADN polimerasa III, ADN ligasa.


c) Helicasa, primasa, ADN polimerasa III, ADN polimerasa I, ADN ligasa.
d) Helicasa, ADN polimerasa I, primasa, ADN polimerasa III, ADN.
4. La telomerasa es un complejo formado por:
a) ARN y protena.
b) ADN y protena.
c) Doble cadena de ADN y protena.
d) Doble cadena de ARN y protena.
5. Este tipo de ADN polimerasa est involucrada en la replicacin de la mitocondria:
a)
b)
c)
d)
e)

www.fullengineeringbook.net

Gardner E.J., Simmons M.J., Snustad D.P. Principios de Gentica, 7

ed. Willey Liss, 2002:130-156.

Lewin B. Genes IX, 9 ed. Sudbury: Jones and Bartlett Publishers,

2007:428-456.
Luque J., Herrez . Texto ilustrado de Biologa Molecular e Ingeniera

Gentica. Madrid: Harcourt, 2001:141-160.


Watson J.D., Baker T.A, Bell SP, et al. Biologa molecular del gen, 5

ed. Mxico: Editorial Mdica Panamericana, 2005:23-45.

Captulo

Transcripcin
Zamira Helena Hernndez Nazar

Transcripcin

nas y enzimas como la diversidad y la estructura de los


genes son considerablemente mayores, por lo que se requiere de una regulacin ms precisa. La mayora de los genes
en procariotes estn organizados en operones, esto es, un
conjunto de genes situados en el mismo fragmento de ADN
que se transcriben como una unidad y que generan varios
productos funcionales que participan en una va metablica
comn; aunque tambin pueden existir unidades que codiquen para un solo producto funcional. Por el contrario, en
los eucariotes, se transcribe generalmente un solo producto
gnico (unidades transcripcionales monocistrnicas) con
mayor complejidad en su regulacin.
Los genes eucariotes estn constituidos por secuencias
regulatorias y codicantes. El inicio del sitio de transcripcin se denomina +1, y la numeracin aumenta conforme se
dirige al extremo 3. Esta direccin se conoce como corriente
abajo, donde se encuentran las secuencias codicantes del
gen. Hacia el extremo 5, en la direccin opuesta, conocida
como corriente arriba, la numeracin se indica como 1, y
es all donde se encuentra la mayora de regiones regulatorias del gen (gura 5-3).
La regin codicadora del gen tambin contiene regiones que no sern traducidas, denominadas intrones, y que
son retirados por medio del proceso corte y empalme del
ARNm primario o heterogneo nuclear (ARNhn). Las
regiones que codican para el producto gnico se conocen
como exones. Un solo gen puede sintetizar diferentes protenas mediante el arreglo de los exones por el proceso de
corte y empalme alternativo. El trnscrito primario o ARNhn es el producto inmediato de la transcripcin y consiste
en un ARN que contiene las secuencias intrnicas y exnicas, cuyos extremos 5 y 3 no han sufrido ninguna modicacin. El producto nal, ARN mensajero maduro, ARN
ribosomal (ARNr) y ARN transferencia (ARNt), se produce
cuando sucede una serie de modicaciones en el trnscrito
primario: modicaciones postranscripcionales. En proca-

Una de las funciones de la doble cadena del ADN, representada en el dogma de la Biologa Molecular, es expresar la
informacin contenida en el material gentico. El primer
paso en la expresin gnica es la transcripcin, que consiste en la sntesis de una cadena de ARN complementaria y
antiparalela, a la secuencia de nucletidos de una de las
cadenas de ADN denominada cadena molde, y por lo tanto,
tiene la secuencia de nucletidos idntica a la cadena
opuesta del ADN llamada cadena codicadora, con la premisa de que la timina se sustituye por uracilo en la molcula de ARN (gura 5-1).
La transcripcin es el paso previo y necesario para la
generacin de protenas funcionales que denen el metabolismo y la identidad de las clulas. Las secuencias de ADN
que se copian en cada proceso de transcripcin se denominan genes (gura 5-2). Desde el punto de vista molecular, el
gen es una secuencia lineal de nucletidos en la molcula de
ADN, que contiene la informacin necesaria para la sntesis
de un ARN funcional, que puede ser ARNm, ARNt o ARNr.
Los genes se sitan a lo largo de cada cromosoma en una
posicin determinada llamada locus. Se estima que el nmero de genes que se encuentra en la especie humana es de
aproximadamente 23 000; sin embargo, todava no se tiene
certeza acerca del nmero exacto. La denicin de gen propuesta por Gerstein y colaboradores lo describe como un
conjunto de secuencias que codican para potenciales productos funcionales que se sobreponen entre s y que pueden
estar localizadas en ms de un locus en el ADN.

www.fullengineeringbook.net

Estructura del gen


El mecanismo de transcripcin en clulas eucariotas, aunque transcurre de manera similar que en procariotas, es un
proceso mucho ms complejo; tanto el nmero de prote44

CAPTULO 5 Transcripcin

ADNg

+1 Inicio de la transcripcin
TTAGCTCCCGTTTAAAA

Cadena Codificante, tambin conocida como cadena


informativa, con sentido, hebra no molde, + y que no es
transcripta
AATCGAGGGCAAATTTT

Cadena Molde, tambin conocida como cadena transcripta,


hebra no informativa, no codificante, y antisentido
ADNc

ARNm
5

UUAGCUCCCGUUUAAAA

ARN con sentido +

La copia del ARNm en ADNc puede


ser una cadena o doble cadena

Figura 5-1. Transcripcin: proceso de sntesis de ARN a partir


de ADN. La molcula de ARN formada es complementaria y
antiparalela a la molcula de ADN 5 3 a la que se le llama
molde, y de secuencia idntica a la cadena de ADN 5 3,
denominada codicante.

riotes, el ARN recin sintetizado no sufre modicaciones


postranscripcionales y se utiliza para la traduccin de forma inmediata sin sufrir ningn proceso.
Un tipo de secuencias de ADN regulatorias que no
codican para el producto gnico, pero regulan su expresin, son los promotores. El promotor mnimo es la regin
regulatoria indispensable para la transcripcin del gen. Las

45

secuencias adyacentes a este promotor mnimo forman


parte de l, y pueden modicar la tasa de transcripcin del
gen, pero no son imprescindibles para la unin de la ARN
polimerasa.
El promotor basal es la secuencia mnima requerida
para la unin de la maquinaria basal de transcripcin y para
la ARN pol II (ARN polimerasa II) incluye el Inr y la caja
TATA o el DPE.
A los promotores se les unen protenas reguladoras
conocidas como factores transcripcionales (transcriptional
factors, TF), cuya funcin es regular (aumentar o disminuir)
la tasa de transcripcin. Aunque existe mucha diversidad
entre los promotores reconocidos por la ARN polimerasa II
se pueden denir secuencias consensos comunes entre s.
Una secuencia consenso es la regin conocida como iniciador (Inr) localizada entre las posiciones 3 y +5. La secuencia consenso denominada caja TATA, debido a su
composicin de ocho pb A-T, se encuentra en la mayora de
los promotores y se localiza a 31 a 25 bp hacia el extremo
5 del punto de inicio. ste es el nico elemento que se localiza en una direccin relativamente ja con respecto al punto de inicio. Los promotores que carecen de caja TATA se
denominan TATA menos. Cuando existe una mutacin en
la caja TATA, el sitio de inicio de la transcripcin cambia,
ya que la ARN pol II al ser activada se sita en otro sitio
(gura 5-4). El DPR (downstream promoter element) es un
elemento comn en los promotores TATA menos, se localiza de +28 a +32.

www.fullengineeringbook.net
GEN DE LA INSULINA HUMANA, Localizacin del Gen
dentro del Genoma Cromosoma: 11; Locus: 11p15.5
Ncleo

GEN

ENZIMA

GEN

PROTENA

GEN

POLIPETIDO

GEN

UN ARN

GEN

PRODUCTO
GNICO FUNCIONAL

ADNg
Corriente abajo

Corriente arriba
5

Promotor
basal

Secuencias
reguladoras 3

+1 Inicio de la transcripcin
Intrn

Exn

Figura 5-2. Gen: regin del genoma que contiene la informacin necesaria para la sntesis de una molcula funcional o un rasgo
particular. La localizacin de genes en el cromosoma es el locus (singular), loci (plural). La transcripcin sucede en la interfase del
ciclo celular y slo ocurre sobre la conformacin de 10 nm de ADNg cuando hay mayor acceso de las enzimas a la eucromatina.

46

PARTE I Conceptos bsicos de biologa molecular

Corriente arriba
5

Corriente abajo

ADN

30 pb

+1 inicio de la transcripcin

TATA
ARNhn
5

ARNm
5

POLIA

CAP 7mG

Protena
funcional

Polipptidos

Secuencias reguladoras
Exones
Intrones

Figura 5-3. Procesamiento del ARN. A travs de la transcripcin de un gen se produce un ARNhn, que se procesa para dar lugar a
un ARNm. Este ARNm sale del ncleo y en el citoplasma se traduce para dar lugar a protenas que, a travs de diversos procesos
de maduracin, darn lugar a protenas funcionales.

www.fullengineeringbook.net

Algunos promotores basales son fuertes, como la mayora de los ubicados en los genes procariotes y virales; se les
denomina as ya que la maquinaria de transcripcin basal se
une de forma ecaz y la tasa de transcripcin es elevada.
Otros son dbiles, como la mayora de los promotores de
genes eucariotes, con un inicio de la transcripcin menos
frecuente, por lo que requieren secuencias accesorias contenidas en promotores proximales, localizadas generalmente a menos de 200 pb corriente arriba del sitio de inicio de
la transcripcin. Las cajas GC, CAAT y el octmero son
ejemplos de estos promotores proximales, reconocidos por
los factores transcripcionales especcos para favorecer la
iniciacin. El nmero y la posicin de estos elementos
varan entre los promotores de los diversos genes. La unidad de transcripcin se reere a la interaccin de todas las
secuencias funcionales o estructurales posibles, as como el
complejo proteico formado de enzimas y TF que se requieran durante el proceso de la transcripcin.
Otras regiones regulatorias que ayudan a los promotores dbiles a iniciar la transcripcin son los promotores distales, que generalmente se encuentran a ms de 200 pb ro
arriba (regin 5) del sitio de inicio de la transcripcin, aunque tambin se han localizado hacia el extremo 3 (corriente abajo). Las regiones que controlan la transcripcin de un
gen no necesariamente tienen que estar cerca de la regin
codicadora. Estas regiones son mucho ms complejas y
pueden activar o desactivar genes.

Promotor di
stal
Potenciador
10 kpb Sile
nciador

ADNg

Aisladores

2 Kpb

Promotor
proximal
100 pb

Promotor
Basal Intron
es/Exones Silenciado
r
+1

TFIIB

TBP

TFIID

TFIID

BRE

TATA

Inr

DPE

3 32 31

26

+4

+28

+32

pb

Figura 5-4. Secuencias que regulan la transcripcin. Esquema


del promotor basal y los factores transcripcionales que se unen
a l y los otros elementos involucrados: promotor proximal;
promotor distal; silenciadores; potenciadores y aisladores;
elemento de respuesta para el TFIIB (BRE); caja TATA (TATA);
elemento iniciador (Inr); elemento promotor corriente abajo
(DPE); factor transcripcional IIB (TFIIB); factor de unin a la
caja TATA (TBP), y factor transcripcional IID (TFIID). Pb: pares
de bases.

CAPTULO 5 Transcripcin

Los potenciadores o secuencias amplicadoras (enhancers) son secuencias cortas que potencian o aumentan la
transcripcin del gen de manera cooperativa con otras
secuencias reguladoras y alteran la estructura del ADN, ya
que inducen el superenrollamiento en la zona del promotor
basal y aumentan la unin de TF, lo que implica una aproximacin f sica entre ambos y una exibilidad en la molcula
de ADN, y favorece el inicio de la transcripcin.
Por otra parte, los silenciadores (silencers) son secuencias
cortas de nucletidos de dos tipos: los elementos silenciadores o los elementos de regulacin negativa (negative regulation elements, NRE) y pueden actuar de varias maneras:

funcin es bloquear la transmisin de la seal de un sitio a


otro en el ADN e impedir el silenciamiento. La mayora de
los potenciadores o silenciadores actan sobre el promotor
que se encuentra vecino, sin ser especcos de un determinado gen.

Tipos de ARN polimerasa


La enzima protagonista en este proceso es la ARN pol, que
sintetiza una cadena de ARN en direccin 5 3 al igual
que la ADN pol. Esta enzima acta de manera continua
durante toda la unidad de transcripcin: primero sobre el
sitio de inicio indicado en el promotor basal, contina en la
secuencia codicadora y naliza en una secuencia de terminacin. En las clulas eucariotas los genes nucleares son
transcritos por tres tipos de ARN pol: I, lI y III, que transcriben diferentes tipos de genes en lugares especcos del
ncleo. Cada una reconoce promotores y TF con caractersticas especcas. Las ARN pol de mitocondrias se asemejan ms a la ARN pol bacteriana, dada la menor complejidad
de los genomas de estos organelos (gura 5-5).
La ARN pol I reside en una zona denida del ncleo, el
nucleolo, donde transcribe los genes que codican para los
ARNr. Esta enzima sintetiza un nico trnscrito, el ARNr

1. Modicando la estructura de la cromatina y evitando


que los genes sean activados.
2. Reclutando factores transcripcionales represores y evitando que factores transcripcionales inductores se unan
al ADN.
3. Alterando el proceso de corte y empalme del ARN heterogneo nuclear y evitando su maduracin.
4. Creando seales que bloquean la traduccin, e inactivando as la expresin gnica.
La accin de un potenciador o un silenciador puede
inhibirse por la presencia de secuencias aisladoras, cuya

www.fullengineeringbook.net
Ncleo

GEN ARN
Transferencia

GEN ARN
Mensajero

GEN ARN
Ribosomal

GEN ARN
Pequeo
nuclear

ADN

A
ARNt

Citoplasma

ARNr

ARNhn

47

ARN
Pequeo
nuclear

ARNm

Polimerasa

Producto Gnicos

Localizacin

Factores
transcripcionales

ARN pol-I

ARNr grande: 28S, 18S y 5.8S

Nuclolo

TFI

ARN pol-II

ARN, ARNm, ARNsn

Nucleoplasma

TFII

ARN pol-III

ARN pequeo: 5S, ARNt

Nucleoplasma

TFIII

Figura 5-5. Enzimas productoras de ARN. La sntesis de todos los tipos de ARN se lleva a cabo en el ncleo por enzimas especcas donde la ARN pol I sintetiza el ARNr; la ARN pol II, el ARNm, y la ARN pol III, el ARNt y el ribosomal 5s. Despus de su
maduracin son transportados al citoplasma para su funcin.

48

PARTE I Conceptos bsicos de biologa molecular

45S, precursor de los ARNr 18S, 28S y 5.8S. La ARN pol III
se encuentra en el nucleoplasma y es la encargada de la sntesis de los ARNt, el ARNr 5S y otros pequeos ARN (small
nuclear, ARNsn).
La ARN pol II tambin se encuentra en el nucleoplasma
y sintetiza las molculas de ARNhn, el precursor del ARNm
y algunos ARNsn. Existen tres subunidades comunes para
las tres ARN pol: en primer lugar, una subunidad grande, el
dominio terminal carboxilo (carboxy terminal domain,
CTD), que puede ser altamente fosforilada en los residuos
de serina y treonina, y es muy importante en el inicio de la
transcripcin, en el corte y empalme, en la modicacin de
los extremos del ARN y en la terminacin. Las otras dos
subunidades son las de reconocimiento de la secuencia de
ADN y la del sitio cataltico.

Factores transcripcionales
(generales y especcos)
La produccin de ARNhn por la ARN pol II requiere de una
regulacin mucho ms compleja, donde el nmero y el tipo
de factores de transcripcin involucrados es mayor. Como
se mencion anteriormente, los TF son protenas que se
unen al ADN en el promotor, potenciador o silenciador
para el control de la expresin de los genes. stos se unen al
ADN reconociendo una secuencia especca, aunque una
misma secuencia puede ser reconocida por ms de un TF,
que puede ser activador o represor. Los TF se han clasicado, de acuerdo con su funcin, en factores transcripcionales generales o basales y factores transcripcionales inducibles.

celular y stos son los responsables de la expresin de genes


que se expresan constitutivamente. En cambio, los genes
controlados por TF inducibles requieren de la formacin de
un complejo mediador estimulado de forma aleatoria.

Proceso de transcripcin
La transcripcin tiene lugar en el ncleo. En el sitio de inicio de la transcripcin, la molcula de ADN se separa de
forma transitoria en dos cadenas sencillas y una se utiliza
como molde para la sntesis de ARN, formando una burbuja (burbuja de transcripcin). Conforme la ARN pol avanza
y copia el ADN, el ADN ya copiado se vuelve a unir a su
cadena complementaria y forma nuevamente la doble hlice, liberando el ARN como una cadena sencilla de nucletidos (slo los ltimos 25 nucletidos sintetizados forman
complejo con el ADN). La reaccin de transcripcin se
divide en tres etapas: iniciacin, elongacin y terminacin.
El reconocimiento del promotor basal, o preiniciacin,
de la transcripcin inicia con la unin de la primera protena del complejo del TFIID a la caja TATA, conocida como
protena de unin especca de TATA (TATA binding protein, TBP). La TBP tiene la capacidad inusual de unirse al
ADN por el surco menor donde lo dobla. Esta unin provoca una deformacin en la estructura del ADN sin separar las dos cadenas. Es el componente clave en el
posicionamiento de la ARN pol II y delimita la distancia
desde el punto de inicio hasta la caja TATA. En los promotores que carecen de caja TATA, la TBP puede incorporarse por asociacin a otras protenas que reconocen el ADN.
El TFIID est formado, adems de por la TBP, por 11 TAF
(TBP associated protein). Los TAF son subunidades diferentes y pueden reconocer una variedad de promotores
tanto basales como distales. Estas protenas desempean
un papel fundamental en el nexo entre el aparato basal de
transcripcin y los otros factores 5 y TF reguladores, para
formar el complejo mediador de la unidad transcripcional
(gura 5-6).
El TFIIA controla la capacidad de unin de TBP al ADN
y permite al TFIID reconocer la regin que se extiende hacia el extremo 5. El TFIIB es otro factor que se une de
forma adyacente a TBP, especcamente en la secuencia del
promotor basal BRE y proporciona mayor supercie de
reconocimiento para el anclaje de la ARN pol II. El TFIIF es
el medio de unin de la ARN pol II al complejo de transcripcin.
La protena TFIIH tiene actividad helicasa y contacta
con la ARN pol II, lo que le permite su anclaje a sta. La
burbuja de transcripcin se origina mediante un desenrollamiento local, que se inicia en el sitio de unin de la ARN
pol II. En el caso de promotores dbiles, en este paso tiene
lugar el ensamblaje de todas las protenas necesarias para
iniciar la sntesis.

www.fullengineeringbook.net

Factores transcripcionales (TF)


generales o basales
Son los requeridos para el inicio de la transcripcin en
todos los promotores basales. Se unen a la ARN pol para
formar un complejo que rodea el sitio de inicio, determinando la iniciacin. Los TF toman el nombre de la ARN pol
con la que actan y, junto con sta, forman el aparato bsico
de transcripcin. Por lo tanto, los TF que actan con la
ARN pol I se denominan TF I; los que actan con la ARN
pol II, TF II, y los que actan con la ARN pol III, TF III.

Factores transcripcionales inducibles


El conjunto de TF requerido para la expresin de un determinado gen es particular para cada promotor. Los TF inducibles, o TF de tejido especco, interactan con el ADN de
la misma manera que los TF generales, pero su funcin es
ms bien reguladora y se unen preferentemente a los promotores distales. Se sintetizan o activan bajo un estmulo y
controlan la transcripcin en tiempo y espacio. Un gen con
un promotor que contenga secuencias reconocibles slo
por los TF generales puede transcribirse en cualquier tipo

CAPTULO 5 Transcripcin

Complejo de preiniciacin
TBPTFIID

Iniciacin

TATA +1
TFIIB

TFIIA
B

P-P-P

TBPTFIID
TATA +1

TATA

+1

Guanil
20 - 40
transferasa
+
7mG 5 nucletidos ARN
metilasa
7mG5

TFIIF
ARN pol II

Elongacin
P-TEFb,hSPT5
Corrector de errores
TFIIS

P-P-P
10 nucletidos ARN

Figura 5-6. Iniciacin de la transcripcin. A, en la etapa de


preinicio la protena de unin a la caja TATA, TBP, interacta
con el surco menor del ADN, activando el complejo de preinicio y curvando la doble hlice. TBP forma parte del TFIID. B,
TFIIA controla la capacidad de unin de TBP al ADN y permite
a TFIID reconocer la regin que se extiende hacia el extremo
5. TFIIB proporciona una mayor supercie de reconocimiento
para el anclaje de la ARN pol II. C, formacin del complejo
entre TFIIF y la ARN pol II. La ARN pol queda colocada sobre
el sitio de inicio de la transcripcin. Se une TFIIE que recluta
a TFIIH. TFIIH tiene actividad de helicasa y desnaturaliza al
ADN, exponiendo la secuencia nucleotdica a la ARN pol II.
Inicio D, se reere a la sntesis de los primeros 10 enlaces
nucleotdicos del ARN. El extremo CTD de la ARN pol II es
fosforilado en varias posiciones. La ARN pol II se suelta de
todos los factores de transcripcin, y slo TBP queda unido a
la caja TATA.

49

Terminacin
Corte y Empalme (splicing)
TAT-SF1
CPSF
CstF
AAUAAAAA
200 nucletidos

Figura 5-7. Elongacin: en esta etapa la ARN pol II se libera


del promotor en presencia de TFEII y TFHII, adems de los
factores de elongacin PTEFb y TFIIS, que evitan la terminacin prematura. TFIIS (elonguina) participa en la reparacin
en caso de que un nucletido no sea apareado correctamente.
hSPT5 es un factor de procesamiento del extremo 5. Terminacin: implica la formacin de la seal de poliadenilacin y
terminacin AAUAAAAA y la adicin de la cola de poli-A en
el trnscrito de ARN, as como la separacin del complejo de
transcripcin. Los procesos de elongacin y terminacin son
simultneos. El factor CPSF es especco de la poliadenilacin.
El factor CstF participa en la escisin. El complejo proteico TATSF1 recluta el ayustosoma.

segmento de cadena sencilla de ADN, que fungir como


molde. Los nucletidos se aaden de forma covalente al
extremo 3OH y en la regin desenrollada se forma un
hbrido ADN-ARN (gura 5-7)
3. Terminacin. La terminacin de la transcripcin
implica el reconocimiento de una secuencia que contiene una regin rica en GC, en una serie de seis o ms
adeninas contenidas en el trnscrito de ARN. En la
transcripcin del ARN se leera como la seal de poliadenilacin que determina el nal de la adicin de
nucletidos a la cadena y la desintegracin del complejo
de transcripcin. Se presume que este proceso puede
ser mucho ms complejo. Cuando se aade el ltimo
nucletido a la burbuja de transcripcin se colapsa al
desaparecer el hbrido ADN-ARN, y se libera la ARN
pol II. Es importante mencionar que existe una superposicin de eventos, de tal manera que los procesos de
elongacin, terminacin y maduracin del ARNhn son
simultneos, por lo que cuando termina la transcripcin ya existe un ARNm maduro y listo para transportarse al citoplasma (gura 5-7).

www.fullengineeringbook.net

1. Inicio. El inicio se reere a la sntesis de los primeros


enlaces nucleotdicos de ARN. La ARN pol II permanece
en el promotor mientras sintetiza los primeros nueve
enlaces. La fase de inicio puede retrasarse por la ocurrencia de intentos abortivos, en los que la enzima sintetiza pequeos fragmentos (menos de nueve bases) y los
libera, y vuelve a iniciar nuevamente. El inicio termina
cuando la enzima comienza a alargar la cadena y abandona el promotor con el complejo de iniciacin (gura 5-6).
2. Elongacin. La fase de elongacin requiere de las protenas TFIIE y TFIIH, que se unen corriente arriba de la
ARN pol II; ambas se requieren para iniciar su movimiento a lo largo del ADN y el abandono del promotor
basal. Una vez unida TFIIE, se pueden unir TFIIH, que
excepcionalmente contina unido a la ARN pol II y tiene varias actividades: ATPasa, helicasa y cinasa, que
puede fosforilar el dominio CTD de la ARN pol II. La
fosforilacin del dominio carboxiterminal (CTD) est
implicado en el abandono del promotor basal y el inicio
de la fase de elongacin. En la elongacin, la enzima
ARN pol II se mueve a lo largo del ADN y sintetiza la
cadena naciente de ARN. A medida que la enzima avanza sobre el ADN, lo desenrolla para exponer un nuevo

Procesamiento del ARN


El trnscrito primario, o ARNhn, tiene que procesarse de
diversas formas para su maduracin antes de exportarse del
ncleo y participar en el proceso de traduccin. El proceso
de maduracin incluye la adicin de un capuchn de guanina modicada en el extremo 5, la poliadenilacin del extremo 3, el corte y empalme, adems del proceso de edicin
que sucede slo en algunos genes (guras 5-7 y 5-8).
El extremo 5 se modica cuando el ARN es apenas un
polmero de 20 a 40 ribonucletidos, por la adicin de una

50

PARTE I Conceptos bsicos de biologa molecular

A Modificacin del extremo 5


OH
5

H H

CH2
5

P P P O

H H
B Modificacin del extremo 3
O
CPSF
3 7mG 5
CstF

Guanilil
transferasa
+
2-O-methyltransferasa

C Eliminacin de intrones
y empalme de exones
Exones
Intrones

Corte y empalme (splicing)


OH

ARNsn
U1 U2
U4 U5 U6

AAUAAA

AAAAAAAA3

ADN
5 E1 E2

3
E5 3

E3

E4

ARNm

Figura 5-8. A, adicin de la caperuza o casquete en el extremo 5. La base modicada 7 metilguanosina (7mG) se aade
en 2-OH de la ltima base del Marne, eliminando un grupo
fosfato con la formacin de un enlace entre carbono 5-5 de
las ribosas. B, modicacin del extremo 3 con la adicin de
la cola de Poli A en presencia de los factores CPSF y CstF, al
reconocer la secuencia AAUAAA presente en el ARNm.
C, eliminacin de intrones y empalme de exones (splicing),
con la formacin del ayustosoma con ataque nucleoflico y
transestericacin.

El proceso de corte y empalme (splicing) consiste en la


remocin de los intrones (las secuencias intragnicas no
codicadoras de la regin codicadora) y el empalme de los
exones (bloques de secuencias codicadoras para formar el
ARNm maduro). Los exones y los intrones pueden empalmarse en ms de una forma y generar variantes del ARNm
por corte y empalme alternativo. Las regiones en el ARNhn
reconocidas por la maquinaria de corte y empalme son
secuencias conservadas de nucletidos especcas que
limitan los exones y los intrones, e indican dnde se realizar el corte y el empalme, sitio de empalme 5 y 3 (donante y
receptor, respectivamente); una tercera secuencia, conocida como sitio de ramicacin, se encuentra en la secuencia
del intrn. Las enzimas del proceso tambin conocido
como ayustosoma median dos reacciones de transestericacin sucesivas donde se rompen y se forman dos enlaces
fosfodister nuevos. El ayustosoma est formado por 150
protenas y 5 ARN nucleares pequeos (ARNsn), conocidos
como U1, U2, U4, U5 y U6; por lo tanto, es una riboprotena. Las reacciones se pueden dividir en tres etapas:
1. Identicacin de las secuencias donantes 5 y sitio de
ramicacin por U1 y U2, respectivamente, ayudado
por protenas accesorias.
2. Formacin de un plegamiento del ARN para acercar los
tres sitios de corte y empalme, ayudado por U4, U5 y
U6; en este momento, se produce el ataque nucleof lico
de la adenina conservada en el sitio de ramicacin en
el enlace fosfodister de una guanina conservada del
sitio donante 5, formando un nuevo enlace fosfodister
y una estructura llamada lazo intrnico.
3. Liberacin de U1. Es remplazado por U6. En la segunda
reaccin de transestericacin el sitio donante 5 libre
se convierte en un nuclelo que ataca el sitio receptor
3. Los exones se empalman y liberan el lazo intrnico.
En este momento se libera U4 y entran en contacto U6
y U2, y la unin de los exones es mediada por U5. El
ayustosoma es constantemente reciclado y reclutado
por el CTD de la ARN pol II a travs del TAT-SF1 (gura 5-8C).

www.fullengineeringbook.net

7-metil-guanosina, en tres pasos enzimticos: la eliminacin de un grupo fosfato (enzima ARN trifosfatasa); la adicin
del nucletido guanina (enzima guanilil transferasa), y por
ltimo, su metilacin (enzima metil transferasa). Las tres
enzimas son reclutadas por el factor de elongamiento
hSPT5 unido al CTD de la ARN pol II. La 7-metil guanosina queda unida a travs de un enlace entre carbono 5-5 de
las ribosas (gura 5-8A).
La etapa de la terminacin de la transcripcin y la adicin de la cola de poliadenilacin (poli-A) en el extremo 3
estn ntimamente ligadas. El CTD de la ARN pol II, de
igual manera, participa en el reclutamiento de las enzimas para la poliadenilacin que sucede al encontrar secuencias de reconocimiento en el ARN trnscrito primario en
tres procesos:

1. Los complejos proteicos, el factor estimulante de la escisin (cleavage stimulation factor, CstF) y el factor especco de poliadenilacin y escisin (cleavage and
polyadenylation specicity factor, CPSF), transferidos
desde CTD al ARNhn, lo escinden.
2. Adicin de alrededor de 200 residuos de adenina en el
extremo 3 por la enzima poli-A polimerasa. Es importante mencionar que la cola de poli-A slo se aade a los
ARN generados por la ARN pol II; es decir, los que presentan la seal de poliadenilacin AAUAAA.
3. La ARN pol II contina aadiendo nucletidos antes de
colapsar la burbuja de transcripcin, por lo que la seal
de poliadenilacin es clave para el proceso de terminacin (gura 5-8B).

Edicin del ARN


La edicin es una forma de modicacin postranscripcional del ARNm. En algunos casos genera el cambio de un
aminocido importante por otro o codones de paro de la
traduccin y la generacin de una protena truncada. El
proceso de edicin slo se presenta en ciertos genes, en
algunos tejidos o en algunos tipos celulares. Existen dos
mecanismos que median la edicin: la desaminacin oxidativa de una citosina metilada, que se convierte en uridina
del codn CAA (enzima citidina desaminasa) y genera el
codn de paro UAA, o el cambio de aminocido adenina
por inosina, que preere aparearse con citosina (enzima

CAPTULO 5 Transcripcin

adenosina desaminasa de accin sobre ARN, ADAR),


mecanismo propio de los mamferos, incluido el ser humano. La insercin o delecin de una uridina dirigida por un
ARN gua se ha observado en procariotes, y ha cambiado
los marcos de lectura para la traduccin. El ejemplo ms
representativo del proceso de edicin es en el ARNm de la
apoliprotena B (ApoB). El ARNm sintetizado en el hgado
produce una cadena polipeptdica de 100 aminocidos, por
lo que se lo conoce como ApoB-100. Este mismo gen en el
intestino, al ser trnscrito, sufre un proceso de edicin, en
el que una citosina en la posicin 2152 es desaminada y se
convierte en U, cambiando el codn CAA por UAA, un
codn de terminacin que provoca la formacin de una

51

protena truncada de tan slo 48 aminocidos denominada


ApoB-48.

Regulacin de la transcripcin
Las diferencias fenotpicas que caracterizan a las diferentes
clulas presentes en organismos multicelulares, a pesar de
tener el mismo genotipo, se deben a la expresin diferencial
de sus genes. El desarrollo y el fenotipo de un organismo
pueden regularse por el producto gnico que interacta con
otros genes o con el ambiente en tiempo y espacio. Existen
diversos mecanismos por los cuales se puede controlar la
expresin de los genes (vase el captulo 7).

Preguntas de repaso
1. Cul es la denicin molecular que describe mejor un gen?
a) Locus especco del ADN que contiene informacin y
almacenamiento para la descendencia.
b) Secuencia del ADN que contiene la informacin para
la sntesis de ARN.
c) Secuencia del ADN especca de unin a protenas
necesarias para la funcin celular.
2. Qu diferencias existen en la transcripcin entre eucariotes y procariotes?
a) Mayor complejidad en la regulacin, se realiza en el
ncleo, requiere procesamiento del ARN, son genes
monocistrnicos.
b) Se realiza en el citoplasma, son genes policistrnicos,
no requieren procesamiento del ADN.
c) Menor complejidad en la regulacin, se realizan en el
citoplasma, traduccin y transcripcin de manera simultnea.

3. Esquematiza (dibuja) la secuencia de eventos de la transcripcin.


4. Son funciones del dominio proteico CTD de la ARN pol II:
a) Regulacin negativa, formacin de la burbuja de
transcripcin y sntesis de ribonucletidos.
b) Enzima metiltransferasa, colapso de burbuja de transcripcin y sitio de unin al ADN.
c) Reclutamiento de las enzimas, funcin de ATPasa y
helicasa.
5. Cules son las modicaciones del ARNhn que lo convierten en un ARNm?
a) Superenrollamientos, modicacin del extremo 3 con
una guanina metilada.
b) Poliadenilacion del extremo 3, corte de los intrones y
empalme de los exones.
c) Formacin de estructuras secundarias, corte de los
exones y empalme de los intrones.

www.fullengineeringbook.net

Bibliografa
Aphasizhev R. RNA uridylyltransferases. Cell Mol Life Sci,

Nechaev S., Adelman K. Pol II waiting in the starting gates: Regula-

2005;62:2194-2203.
Armstrong J.A. Negotiating the nucleosome: factors that allow RNA
polymerase II to elongate through chromatin. Biochem Cell Biol,
2007;85:426-434.

ting the transition from transcription initiation into productive


elongation. Biochim Biophys Acta, 2011;1809:34-45.
Pennisi E. Genomics. DNA study forces rethink of what it means to
be a gene. Science, 2007;316:1556-1557.
Phatnani H.P., Greenleaf AL. Phosphorylation and functions of the
RNA polymerase II CTD. Genes Dev, 2006;20:2922-2236.
Pheasant M., Mattick J.S. Raising the estimate of functional human
sequences. Genome Res, 2007;17:1245-1253.
Tarn W.Y. Cellular signals modulate alternative splicing. J Biomed
Sci, 2007;14:517-522.

Gerstein M.B., Bruce C., Rozowsky J.S., Zheng D., Du J., Korbel
J.O., et al. What is a gene, post-ENCODE? History and updated

denition. Genome Research, 2007;17:669-681.


Gu M., Lima C.D. Processing the message: structural insights

into capping and decapping mRNA. Curr Opin Struct Biol,


2005;15:99-106.
Kornblihtt A.R., De la Mata M., Fededa J.P., Muoz M.J., Nogues
G. Multiple links between transcription and splicing. RNA,

2004;10:14891498.

Captulo

Traduccin
Jos Mara Vera Cruz / Bertha Adriana lvarez Rodrguez
Belinda Claudia Gmez Meda

Introduccin

con una secuencia de 64 codones diferentes. El modo de


lectura del ARNm es igual al observado en la transcripcin, el cual tiene como inicio el extremo 5 y naliza en el
extremo 3, de tal manera que permite crecer una cadena
peptdica partiendo de un extremo N-terminal para nalizar en un extremo C-terminal. A la principal reaccin de la
traduccin se la conoce como polimerizacin, que es la
adicin secuencial de aminocidos (segn la informacin
gentica), uno tras otro, mediante la formacin de enlaces
peptdicos.

Se sabe que las caractersticas fsicas son heredadas de nuestros padres (estatura, color de ojos), as como tambin la predisposicin a padecer y/o desarrollar ciertas enfermedades, a
las que se denominan hereditarias (diabetes, diferentes tipos
de cncer, etc.), y esto se logra a travs de la informacin contenida en los genes. Esta informacin se almacena en el cromosoma y se transmite de clula a clula mediante el
mecanismo de replicacin del ADN (til para la perpetuidad
de la informacin gentica) y se expresa a travs de la transcripcin mediante la obtencin del ARN, principalmente el
ARN mensajero (ARNm), necesario para traducir esta informacin para la sntesis de una protena funcional y especca.

www.fullengineeringbook.net
Cdigo gentico

Un gen contiene la informacin necesaria para transcribirse en un ARNm, que a su vez puede expresarse como una
protena. Esta expresin se da debido a que las instrucciones trasladadas del ADN al ARN y en especial del ARNm a
las protenas se transmiten en forma de cdigos.
El ADN est formado por cuatro bases nitrogenadas (A,
C, G, T). Si se representara cada aminocido por un nucletido especco no se podran formar los 20 aminocidos
que estn presentes en las protenas; de igual forma, agrupar nucletidos de dos en dos, permitira formar hasta 16
combinaciones posibles, pero seguira siendo insuciente.
As, la forma en la que se codica la informacin es en grupos de tres nucletidos, lo que conforma un triplete, o
codn, que representar un aminocido o seal especca
que la clula interpreta durante el proceso de traduccin.
De esta manera, ya que se dispone de cuatro bases diferentes, se tienen 64 diferentes combinaciones posibles de tres
nucletidos (43), 61 de los cuales codican para aminocidos y tres marcan la terminacin de la traduccin, lo que
permite asignar de manera adecuada un cdigo de tres
bases (o varios) para la formacin de cada uno de los 20
aminocidos presentes en las protenas y as poder descifrar
el mensaje gentico contenido en el ADN.

Traduccin
Se conoce como traduccin a la sntesis de una protena de
acuerdo con la informacin gentica y se emplea como
molde una molcula de ARNm.
Se llama traduccin porque interpreta la informacin
contenida en el gen utilizando un cdigo gentico a travs
del cual desarrolla una lectura de la secuencia de nucletidos
contenidos en el ARNm. Esta conversin de informacin
se conoce como decodicacin, y se considera extremadamente exacta (con un error de aproximadamente 5 104
por residuo de aminocido) y rpida (incorpora aproximadamente 15 aminocidos por segundo, a 37C de temperatura). Este fenmeno es uno de los procesos ms complejos
que se realizan dentro de la clula; en l participan numerosos factores traduccionales de manera coordinada y consume gran cantidad de energa (aproximadamente el 80%, en
forma de adenosn trifosfato [ATP] y 20% de guanon trifosfato [GTP]) que la clula produce.
La cadena molde que la traduccin requiere para su
inicio es el ARNm, que se codica por el cdigo gentico
52

CAPTULO 6 Traduccin

Segundo nucletido
UUU
U UUC
UUA
UUG
CUU
C CUC
CUA
CUG
AUU
A AUC
AUA
AUG
GUU
G GUC
GUA
GUG

Fenilalanina

Leucina

Leucina

Isoleucina

Metionina

Valina

C
UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG

Serina

Prolina

Treonina

Alanina

UAU
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG

Tirosina

Paro

Histidina

Glutamina

Asparagina

Lisina

Aspartato

Glutamato

G
UGU
UGC
UGA
UGG
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG

U
Cistina

Paro

Triptfano

G
U

Arginina

C
A
G

Serina

Argenina

U
C
A

Tercer nucletido
Extremo 3

Primer nucletido
Extremo 5

la secuencia de nucletidos del ARNm, que a su vez representa la secuencia del ADN, se lee en grupos de tres (CGU,
GAA, etc.), de modo secuencial y sin interrupciones, para
convertirse en una secuencia de aminocidos. Por lo tanto,
la expresin de una protena est dada por el orden en que
se encuentran los nucletidos en el ADN, que determina el
ordenamiento que se tiene al momento de ser transcrito a
un ARNm y, por ende, dene la secuencia de aminocidos
que tendr una protena.

G
U

Glicina

C
A
G

Figura 6-1. Cdigo gentico. Representado por tripletes de


nucletidos que son utilizados para descifrar a cada uno de los
20 aminocidos que se encuentran en las protenas eucariotas.
La columna del lado izquierdo indica el primer nucletido de
cada triplete, la la de la parte superior representa el segundo nucletido y la columna del lado derecho indica el tercer
nucletido de cada triplete. Este cdice del gen es el que se
lee para traducir el mensaje gentico por medio del complejo
traduccional, para expresar una protena.

Este sistema de cdigos se denomina cdigo gentico


(gura 6-1), el cual muestra de manera prctica los 64 codones y su signicado, a n de poder interpretar la informacin de una secuencia dada. La forma de agrupar estas
combinaciones se fundamenta en elegir una de las bases de
cada seccin de la tabla, que se organizan en orden de derecha a izquierda y de arriba abajo; es decir, se lee primero la
base de la columna de la izquierda, despus la base de la la
superior, seguida de la base de la columna de la derecha,
para de esta manera formar cada triplete.
Este cdigo gentico es utilizado por la clula para sintetizar protenas a travs del proceso de traduccin, donde

Caractersticas del cdigo gentico


El cdigo gentico es especco y continuo, ya que cada
codn tiene un signicado nico y los cdigos se leen de
manera continua y lineal; esto es, cada base puede pertenecer slo a un codn, de tal forma que no hay duplicacin ni
omisin de ningn nucletido en la lectura, y por lo tanto
no hay sobreposicionamiento.
El cdigo gentico es redundante pero no ambiguo. Hay
aminocidos codicados por ms de un codn (exceptuando los codones para los aminocidos metionina y triptfano), y en general, en estos casos los codones se parecen
entre s y dieren slo en el tercer nucletido, de manera tal
que este nucletido presenta una baja especicidad, lo que
se denomina degeneracin de la tercera base en la mayora
de los codones. Entonces se dice que una base es cuatro
veces degenerada si, con cualquiera de las bases nitrogenadas presente en una posicin especca, el resultado es que
codique el mismo aminocido, como sera el caso de la
alanina, en la cual los codones que codican para este aminocido deben contener GC como primera y segunda base;
sin embargo, la tercera base puede ser cualquiera de las cuatro bases nitrogenadas, sin cambiar el sentido de la lectura.
Por esta razn, una caracterstica del cdigo gentico es
ser degenerado (cuadro 6-1), debido a que de los 64 codones que se conocen, 61 son utilizados para codicar a los 20

www.fullengineeringbook.net

Cuadro 6-1. Degeneracin del cdigo gentico. Es una caracterstica del cdigo gentico y se reere a que existen
ms codones distintos de los necesarios para guardar la informacin gentica.
Aminocido

53

Nmero de codones que codican


para el aminocido

Aminocido

Nmero de codones que codican


para el aminocido

Metionina

Tirosina

Triptfano

Isoleucina

Asparagina

Alanina

Aspartato

Glicina

Cistena

Prolina

Glutamina

Treonina

Glutamato

Valina

Histidina

Arginina

Lisina

Leucina

Fenilalanina

Serina

54

PARTE I Conceptos bsicos de biologa molecular

Cuadro 6-2. El cdigo gentico es casi universal. Se le considera as, porque es el mismo para todos los organismos existentes,
con excepciones mnimas, observadas en mitocondrias y en algunos protistas.
Organismo

Codn

Cdigo nuclear

Cdigo mitocondrial

Todos

UGA

Paro

Trp

Levadura

CUX

Leu

Tre

Drosophila sp.

AGA

Arg

Ser

Humano y bovino

AUA

Ile

Met

Humano y bovino

AGA y AGC

Arg

Paro

tipos diferentes de aminocidos. Cuando un aminocido


puede ser traducido por dos, tres, cuatro y hasta seis codones diferentes, estos tripletes son conocidos como sinnimos, y no todos pueden ser reconocidos por el mismo
anticodn, por lo que en estos casos se observan dos o tres
ARNt distintos, que pueden transportar el mismo aminocido, pero con diferentes anticodones.
Los tres codones restantes (UAA, UGA y UAG) tienen
la funcin de terminar la traduccin de una secuencia
nucleotdica; esto es, que una vez que se ha agregado el ltimo aminocido que conforma la protena en la cadena polipeptdica, mandan seales de paro para detener el proceso
de traduccin e informar a la clula que la sntesis proteica
ha nalizado. Estos tripletes reciben el nombre de codones
de terminacin, de paro o sin sentido.
Otra caracterstica del cdigo gentico es su universalidad, ya que hasta hace poco se consideraba que desde las
bacterias hasta el hombre, la interpretacin de los codones
por aminocidos era igual en todas las clulas de todas las
especies, es decir, que todas leen los genes de la misma
manera. Hoy por hoy, se conoce que esto no es totalmente
cierto, ya que se han encontrado excepciones en las mitocondrias humanas, en otros mamferos y en ciertas bacterias. Por tanto, es ms correcto armar que el cdigo
gentico es casi universal (cuadro 6-2).

al citoplasma el mensaje contenido en el ADN a los sitios de


sntesis proteica (los ribosomas).
Las molculas de ARNt son de pequeo tamao con
estructura de bucles y son los ARN encargados de transportar al aminocido hasta el ARNr, donde sern unidos, uno
tras otro, mediante enlaces peptdicos. La enzima aminoacil-ARNt-sintetasa es la encargada de dicha unin, en
un proceso que consume ATP. Los ARNt contienen en su
secuencia al anticodn, un triplete de bases que se encuentra en el asa central del ARNt, en las posiciones 34, 35 y 36,
que se une de manera complementaria con el codn del
ARNm, durante la sntesis de una protena, con la nalidad
de introducir un aminocido especco a la cadena polipeptdica naciente.
El dominio del anticodn est implicado de manera
lejana en la discriminacin entre las formas de iniciacin y
elongacin del ARNt y en las funciones alternas del ARNt,
tales como la iniciacin de la transcriptasa inversa en los
retrovirus.
El ARNr es el tipo de ARN ms abundante en las clulas
y forma parte de los ribosomas, que son las estructuras
citoplasmticas responsables de la biosntesis proteica.
Como los otros ARN, el ARNr est formado por una
sola hebra nucleotdica, con bases complementarias en
algunas regiones, lo que le permite adquirir una estructura secundaria especial. Se denomina segn su coeciente de
sedimentacin, medido en Svedbergs (S) y, de esta manera,
en organismos procariotas existen tres ARNr distintos: 5S,
16S y 23S y en organismos eucariotas cuatro: 5S, 5.8S, 18S y
28S.
El ARNr forma parte de los ribosomas, los cuales estn
formados por dos subunidades llamadas subunidad menor
y subunidad mayor (gura 6-2). En el proceso de traduccin
el ribosoma tiene dos funciones:

www.fullengineeringbook.net

Componentes del complejo traduccional


La traduccin ocurre en el citoplasma de la clula, con la
formacin del complejo traduccional, formado por tres
tipos de ARN, mensajero (ARNm), de transferencia (ARNt)
y ribosomal (ARNr).
El ARNm es una molcula de cido nucleico de cadena
sencilla que contiene la informacin gentica almacenada
en el ADN y su secuencia es complementaria a una de las
cadenas del ADN, a la que se la llama cadena molde. Presenta una disposicin de tripletes de nucletidos o codones,
esto es, que estn agrupados de tres en tres de manera
secuencial, los cuales determinan la secuencia de aminocidos en la protena. Dicho de otro modo, esta molcula se
obtiene mediante la transcripcin, en la cual secuencias
especcas de ADN son copiadas a ARNm, que transporta

Permitir la unin del ARNm al ARNt, proporcionando


los sitios donde interactan el codn del ARNm con el
anticodn del ARNt.
Catalizar la transferencia del aminoacil-ARNt (ARNt
unido a su aminocido) al peptidil-ARNt (ARNt unido
a la cadena peptdica naciente o creciente), siguiendo la
secuencia de codones del ARNm, segn las equivalencias del cdigo gentico.

CAPTULO 6 Traduccin

55

codones relacionados reduce al mnimo los efectos de mutaciones. Por ejemplo, una mutacin de CUC por CUG no tiene ningn efecto, puesto que ambos codones codican para
leucina y una mutacin de CUU por AUU reemplaza la leucina por isoleucina, un aminocido relacionado.

Subunidad mayor

Fenmeno de bamboleo
E

Subunidad menor

Figura 6-2. Estructura del ribosoma. Complejo molecular formado


por dos subunidades (mayor y menor). Es el encargado de sintetizar protenas a partir de la informacin contenida en el ARNm.

El ribosoma cuenta con tres sitios llamados A, P y E


(gura 1). Los dos primeros sitios se encuentran en ambas
subunidades del ARNr y participan directamente en la
decodicacin del ARNm. El sitio P (centro P o peptidilo)
es donde se localiza al peptidil-ARNt y, por lo tanto, donde
se observa la elongacin de la cadena peptdica, mientras
que en el sitio A (centro A o aminoacilo) es el lugar por el
cual el aminoacil-ARNt (correspondiente a la lectura del
codn) entra al complejo traduccional, para despus transferir este aminocido al peptidil-ARNt y generar el enlace
peptdico. El centro cataltico donde se genera este enlace se
localiza en la subunidad mayor. En cambio, el sitio E (centro
Eliminacin o salida) es el lugar por donde saldr del complejo ribosomal el ARNt sin aminocido, una vez que lo
dej en la cadena polipeptdica en formacin.

La interaccin codn/anticodn ocurre bsicamente con la


teora de complementariedad de base establecida por Watson y Crick, por lo que debera de existir igual nmero de
anticodones que de codones, es decir 61; sin embargo, se
sabe que existen menos de 61 ARNt, por lo que se deduce
que un ARNt puede complementarse con ms de dos codones diferentes.
El reconocimiento se da entre la complementariedad de
las bases 1, 2 y 3 del codn con las bases 3, 2 y 1 del anticodn,
respectivamente (gura 6-3A). Para explicar este fenmeno
se estableci la hiptesis de bamboleo o uctuacin, que
expresa dos reglas:
1. Las bases tercera y segunda del anticodn forman puentes de hidrgeno con las bases primera y segunda del
codn, lo que determina la especicidad de la interaccin codn/anticodn.
2. La primera base del anticodn puede orientarse o girarse de formas ligeramente distintas (bamboleo o uctuacin), para interaccionar con distintas bases en la
posicin tercera del codn (gura 6-3B). Estas uniones
presentan enlaces de hidrgeno diferentes a los observados en las bases tercera y segunda. Debido a esto, la
interaccin codn/anticodn es ms dbil.

www.fullengineeringbook.net

Interaccin codn/anticodn
La interaccin codn/anticodn permite al ARNm, dirigir el orden de incorporacin de los aminocidos dentro de
la cadena polipeptdica. Estas interacciones ocurren dentro
de la subunidad menor.
La interpretacin de un codn requiere el principio de
complementariedad de bases con el anticodn del aminoacilARNt correspondiente. Los tripletes complementarios se
aparean no slo por acoplamiento de AU y de GC, sino que
tambin el ribosoma controla el ambiente, de manera tal
que el acoplamiento convencional ocurra en las primeras dos
posiciones del codn, pero se permiten reacciones adicionales en la tercera base. En consecuencia, un solo aminoacilARNt puede reconocer ms de un codn. Adems, el
apareamiento de interacciones tambin puede inuir en la
introduccin de bases especiales en ARNt, en especial por
modicaciones en el anticodn o cerca de l. La tendencia
para que los aminocidos similares sean representados por

Dicho de otra manera, esta hiptesis ocurre entre la tercera base del codn y la primera base del anticodn. Las
reglas originales del bamboleo sugirieron que el primer
nucletido del anticodn poda complementarse con ms
de un nucletido en la tercera posicin del codn. As, los
anticodones con un uracilo en la primera posicin podan
unirse con los codones que tenan adenina o guanina en
la tercera posicin. Los que presentaban una guanina en la
posicin 3, podan unirse con los codones que terminaban
con uracilo o citosina. Pero algo ms interesante se observ
cuando el ARNt que presentaba una inosina en la posicin
3 poda reconocer los codones que terminaban con citosina, uracilo o adenina. Por ejemplo, el ARNt-Ala de la levadura, anticodn 5-IGC-3, se puede unir a tres codones:
5-GCC-3, 5-GCU-3 y 5-GCA-3.

Fases de la traduccin
La biosntesis de las protenas se divide en las siguientes
fases o estadios (cuadro 6-3):

Fase de activacin de los aminocidos.


Fase de traduccin, que comprende:
Inicio de la sntesis proteica.

56

PARTE I Conceptos bsicos de biologa molecular

ARNt

ARNt

Anticodn G A G

Anticodn G A U
5

C U A

Codn

e giro
in d
posic ntrico
exc

ARNm

C U CU

Codn

ARNm

Figura 6-3. Hiptesis de bamboleo. Tres de los 64 posibles


codones son reconocidos como codones de terminacin de la
traduccin. Los 61 codones restantes son reconocidos por los
ARNt individuales. Por tanto, es posible que un apareamiento
de bases que no se d por complementariedad, ocurra en la
posicin del tercer codn, esto es, el nucletido 3 del codn
de ARNm y el nucletido 5 del anticodn de ARNt.

Elongacin de la cadena polipeptdica.


Terminacin de la sntesis de protenas.

Activacin de los aminocidos


Los aminocidos son activados mediante la accin de la
enzima aminoacil-ARNt-sintetasa y la hidrlisis de dos
molculas de ATP (gura 6-4A), uno para la remocin del
pirofosfato (PPi) y el segundo para la hidrlisis de PPi a dos
cidos fosfricos inorgnicos (2Pi), esta ltima reaccin,
con la intervencin de la enzima pirofosfatasa, lo que permite que un aminocido pueda unirse a su ARNt especco,
y genera un aminoacil-ARNt cargado (gura 6-4B). En este
proceso se libera un AMP + 2Pi y, tras ellos, la enzima, que
vuelve a utilizarse. Cada tipo de ARNt, al unirse al aminocido, lleva antepuesto el nombre del aminocido que trans-

porta; por ejemplo, leucinil-ARNt para el que transporta


leucina, metionil-ARNt para la metionina, y as para todos
los aminocidos. Por otro lado, el ARNt unido al aminocido compatible con l se designa aminoacil-ARNtAA, en el
que AA corresponde a la sigla del aminocido. Por ejemplo, leucinil-ARNtLeu, metionil-ARNtMet, etctera.

Inicio de la sntesis de protenas


La fase de iniciacin no slo es el reconocimiento del codn
de inicio (codn AUG), sino que tambin incluye todos los
procesos para la formacin del complejo traduccional y la
formacin del primer enlace peptdico (cuadro 6-4). El primer paso que se realiza en el inicio es la unin de la subunidad menor al ARNm (gura 6-5A), con la asistencia de
factores de traduccin llamados factores de iniciacin (IF),
como se observa en la tabla 4. Una vez unido el ribosoma al
ARNm a travs del ARNr, el ARNt iniciador entra al sitio P
y reconoce al codn AUG para iniciar la traduccin (gura
6-5B). La identicacin del sitio P es mediada por la accin
de los IF, slo bajo estas condiciones el ARNt iniciador es el
nico ARNt que puede entrar por el sitio P; los siguientes
entrarn por el sitio A. El ARNt iniciador transportar una
metionina que no llevar a un grupo formilo.
La lectura del codn se lee en direccin 5 a 3 por el
anticodn, que se unir en sentido invertido, de 3 a 5. Ya
formada esta unin, la subunidad mayor forma el complejo
con la subunidad menor (gura 6-5C), con ayuda de los IF.
En el acople de la subunidad menor del ribosoma con el
metionil-ARNt, acta el eIF-4 para eucariotas y el IF-3 para
procariotas. IF-2 se asocia con GTP y se unen al metionilARNt con el complejo ribosomal, si el codn/anticodn son
complementarios, se hidroliza el GTP y la unin se vuelve
estable. La iniciacin termina cuando el complejo ribosomal est completo y formada la unin codn/anticodn.
En las bacterias esta unin se realiza cerca del codn de
inicio en donde una secuencia corta especca del ARNm
llamada secuencia Shine-Dalgarno, se une por complementariedad a una secuencia en el ARNr de la subunidad menor.
Para las clulas eucariotas la secuencia especca en el
ARNm se llama secuencia Kozak.
La secuencia Shine-Dalgarno, encontrada en procariotas, es rica en purinas, localizada ro arriba (extremo 5)
a 6 o 10 pares de base del codn de inicio en el ARNm. El
ARNr de la subunidad menor cuenta en su extremo 3 con
una secuencia que es toda o casi a toda complementaria a la
secuencia Shine-Dalgarno, lo que facilita la unin y la colocacin del aminoacil-ARNt en la subunidad menor del
ribosoma (gura 6-3A).
La secuencia de Kozak, encontrada en eucariotas,
diere de la anterior levemente y en sta se incluye el codn
de inicio. La purina a 3 y la guanina a +4 son los determinantes principales. El mecanismo se inicia cuando el ribosoma se une al extremo 5 del ARNm, para posteriormente
desplazarse hasta encontrar el codn de inicio situado en la
secuencia de Kozak.

www.fullengineeringbook.net

Cuadro 6-3. Estadios y componentes necesarios para la biosntesis de protenas.


Estadio

Componentes esenciales

Activacin de los
aminocidos

20 aminocidos
20 aminocil-ARNt sintetasa
32 o ms ARNt
ATP
Mg+2

Iniciacin

ARNm
N-Formilmetionil-ARNt
ARNr subunidad menor
ARNr subunidad mayor
Factores de Iniciacin
GTP
Mg+2

Elongacin

Complejo de Iniciacin (complejo ribosomal)


aminoacil-ARNt especco para cada codn
Factores de elongacin
GTP
Mg+2

Terminacin

Codn(es) de paro en el ARNm


Factores de liberacin

CAPTULO 6 Traduccin

AA

Aminocido
especfico

A Aminocido

57

AA Aminocido de
alta energa

ATP

AMP

AA

Metionina

2 ATP
Metionina

ARNt especfico

AT
P

2 Pl + AMP

ARNt
Aminoacil
sintetasa

Sitio del aminocido


Sitio del ATP
Sitio de ARNt

AA

AMP
AMP

PNAt

Inicio del ciclo

2 Pl + AMetionill -PNAt
AA

AA

ARNt cargado

Figura 6-4. Activacin de los aminoacil-ARNt. Proceso que requiere de la hidrlisis de ATP en dos reacciones secuenciales, que se
catalizan en la enzima, la aminoacil-AENt sintetasa. Primero, la enzima une el aminocido al fosfato del ATP con la liberacin concomitante de pirofosfato. Esto es llamado un intermediario aminoacil-adenilato. En el segundo paso, la enzima cataliza la transferencia del aminocido a los OH (2 o 3) de la porcin de ribosa del residuo de adenosina 3 terminal del ARNt generando un
aminoacil-ARNt activado. Aunque esta reaccin es libremente reversible, la reaccin hacia delante es favorecida por la hidrlisis
acoplada del PPi.

www.fullengineeringbook.net

Elongacin en la sntesis de protenas


El crecimiento de la cadena polipeptdica implica la incorporacin de nuevos aminocidos, transportados por el aminoacil-ARNt correspondiente y adicionados al extremo
carboxi-terminal de la cadena en crecimiento; en otras
palabras, el radical carboxilo (COOH) del aminocido iniciador se une con el radical amino (NH2) del aminocido

siguiente mediante la formacin de un enlace peptdico


(gura 6-6), catalizada por la enzima peptidiltransferasa.
Es una reaccin cclica, que requiere de tres pasos para
aadir un aminocido.
a) Decodicacin del aminoacil-ARNt en el sitio A.
b) Transferencia del aminocido al peptidil-ARNt.
c) Desplazamiento del ribosoma.

Cuadro 6-4. Maquinaria necesaria para llevar a cabo la traduccin de una protena. Diferencias entre procariotas y eucariotas.
Eucariotas

Procariotas

ARNr

80S

70S

ARNr subunidad pequea

40S

30S

ARNr subunidad mayor

60S

50S

ARNm

Monocistrnico

Mono y policistrnico

Sitio de reconocimiento del ARNm

Secuencia de Kozak

Secuencia Shine-Dalgarno.

ARNt iniciador

Aminoacilacin

Aminoacilacin y formilacin

Factores de iniciacin (IF)

eIF-2,eIF-2B,eIF-3,eIF-4A,eIF-4B,eIF4E y
eIF-4G,eIF-5 y eIF-6

IF-1, IF-2, IF-3

Factores de elongacin (EF)

eEF-1, eEF-1 y eEF-2

EF-Tu, EF-Ts y EF-G

Factores de terminacin (RF)

eRF

RF1, RF2 y RF3

58

PARTE I Conceptos bsicos de biologa molecular

Secuencia de Shine-Dalgarno
3

A G G A G G
A C C UC C

terias) y EF-1a (en eucariotas), asociada al aminoacil-ARNt


y con un GTP para formar un complejo ternario. Cuando el
aminoacil-ARNt se une al codn del ARNm de forma
correcta, se genera una hidrlisis que libera un cido fosfrico del GTP y lo convierte en guanosn difosfato (GDP), lo
que permite que la cadena peptdica que contiene el peptidil-ARNt forme un enlace peptdico con el aminocido que
forma parte del aminoacil-ARNt, que se transforma en un
nuevo peptidil-ARNt. La enzima que cataliza esta unin es
la peptidil-transferasa. Despus de esto existe otra hidrlisis de GTP, pero de un complejo originado por la protena
EF-G (en bacterias) o EF-2 (en eucariotas), lo que permite
que se realice un desplazamiento del ribosoma (tres nucletidos hacia el extremo 3 del ARNm, movimiento conocido
como translocacin). Este desplazamiento se da cuando el
centro P queda ocupado por un ARNt sin aminocido, provocando la translocacin ribosomal y colocando el ARNt
sin aminocido en el centro E, por donde sale del ribosoma
y el peptil-ARNt formado se coloca en el centro P. Se trata
de un fenmeno cclico, por lo que se realizar tantas veces
como aminocidos se aadan a la cadena peptdica en crecimiento.

Codn de inicio
A UC

ARNm

ARNr
Subunidad menor

Ty
r

Met

Met

A
A

E
3

AUG

AUC

AUG

AUC

AUA

Figura 6-5. Biosntesis de protenas (inicio): primera etapa


de la biosntesis proteica. El ARNm se une a la subunidad
menor. A stos se asocia el aminoacil-ARNt, gracias a que el
ARNt tiene en un anticodn y el ARNm un codn. Despus se
une la subunidad ribosmica mayor, formndose el complejo
ribosomal. Todos estos procesos estn catalizados por los llamados factores de iniciacin. El primer codn que se traduce
es generalmente el AUG, que corresponde con el aminocido
metionina en eucariotas y formilmetionina en procariotas.

Terminacin de la sntesis de protenas


La terminacin se observa cuando al sitio A lee alguno de
los codones de paro o tripletes sin sentido del ARNm, los
cuales tienen como caracterstica no codicar para ningn
aminocido. En esta fase, los factores de liberacin (RF)
imitan al ARNt y reconocen directamente el codn de terminacin (cuadro 6-3). Adems, estos RF requieren de una

www.fullengineeringbook.net

La decodicacin requiere forzosamente de dos protenas de unin al GTP, llamados factores de elongacin (EF;
cuadro 6-3). Se utiliza una tercera protena, EF-Tu (en bacEF-Ts
GTP EF-Tu-Ts

TRY

EF-Ts
EF-G
M

EF-Tu-GTP

E
3

GDP+Pi

GTP

Met TRY

EF-TU
GTP

Y
TR

TRY

et

EF-Tu
Met

Sar

et

et

TR
Y

et

TR
Y

M
TR
Y

Figura 6-6. Fase de elongacin: segunda etapa de la biosntesis proteica, requiere protenas especcas llamadas EF. El alargamiento de polipptidos se produce en forma cclica, de tal manera que al nal de un ciclo completo y la formacin de un enlace
peptdico, el sitio A estar libre de aminocidos y se preparar para aceptar el aminoacil-ARNt entrante dictado por el siguiente
codn del ARNm.

CAPTULO 6 Traduccin

Mat
Try
Ts
Pro
Ch
Val
Atm
LB
Tm
Hls

59

Mat
Try
Ts
Pro
Ch
Val
Atm
LB
Tm
Hls

E
GUA
C AU

UGG

RF1
GUA
C AU

UGG

Mat
Try
Ts
Pro
Ch
Val
Atm
LB
Tm
Hls

at
M Try Ts ro
P Ch al m
V At B
L Tm ls
H

E
P
A

A
E
3

RF1

GUA
C AU

UGG

www.fullengineeringbook.net
P

Figura 6-7. Biosntesis de protenas (terminacin): tercera etapa de la biosntesis proteica, requiere de factores de terminacin (RF).
Las seales para la terminacin de la sntesis proteica son las mismas tanto en procariotas como en eucariotas. Estas seales son
codones de terminacin (UAG, UAA y UGA) y se encuentran presentes en el ARNm.

molcula de GTP para permitir que el polipptido recin


sintetizado se libere del complejo traduccional y, al mismo
tiempo, permite que se disocie la unin entre el ARNr y el
ARNm (gura 6-7).
La terminacin de la traduccin requiere de dos RF:
a) Factores clase I, tambin llamados factores de liberacin especcos de codn (RF-1 y RF-2 para procariotas
y eRF-1 para eucariotas).
b) Factores clase II, tambin llamados factores de liberacin no especcos (RF-3 en procariotas y eRF-3 en
eucariotas) que une un nucletido de guanina.
Cuando los RF reconocen correctamente el codn de
paro, el centro de transferencia o de formacin del enlace
peptdico dentro del ARNr (llamado dominio V en la subunidad mayor) cambia el modo cataltico e hidroliza al peptidil-ARNt, lo que permite la liberacin de la cadena
peptdica del ARNt. Ya libre el pptido, el complejo traduccional se disocia por un factor de reciclaje del ribosoma
denominado factor de terminacin (RRF en bacterias), y
permite con esto la reutilizacin del ARNr, de los factores

de liberacin y del ARNt para la siguiente sntesis proteica.


Una vez nalizada la sntesis de una protena, el ARNm
queda libre y puede leerse de nuevo. De hecho, es muy frecuente que antes de que nalice la sntesis de una protena
ya est comenzando otra, con lo cual una misma molcula
de ARNm est siendo utilizada por varios ribosomas de
forma simultnea. Cuando esto se observa, a la estructura
que se forma (como un rosario) se le llama polirribosoma
o polisoma.

Trco o destino de las protenas


Tambin llamado topognesis. Se reere a la ruta que
siguen las protenas en la clula hasta alcanzar su localizacin (intra o extracelular) donde ejercern su funcin. Esta
topognesis se realiza en el citosol, en donde participan
varios organelos (retculo endoplsmico, aparato de Golgi,
mitocondrias, peroxisomas y lisosomas entre los ms destacados).
Las protenas sintetizadas en la clula que son iniciadas
por ribosomas libres del citosol como las protenas nuclea-

60

PARTE I Conceptos bsicos de biologa molecular

Cuadro 6-5. Secuencias tpicas de pptido o etiquetas seal. Un pptido seal es una secuencia de aminocidos que permiten saber
hacia dnde debe ser dirigida la protena o qu funcin debe cumplir la misma. Muchas protenas llevan un pptido seal para
que sean identicadas y transportadas por el aparato de Golgi hacia el lugar que corresponde
Funcin del pptido seal

Ejemplo de pptido seal

Importacin al RE

-H3N-Met-Met-Ser-Fen-Val-Ser-Leu-Leu-Leu-Val-Gli-Ile-Leu-Fen-Trp-AlaTre-Glu-Ala-Glu-Gln-Leu-Tre-Lis-Cis-Glu-Val-Fen-Gln

Retencin en el lumen del RE

-Lis-Asp--Glu-Leu-COO-

Importacin a la mitocondria

-H3N-Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile-Arg-Fen-Fen-Lis-Pro-Ala-Tre-ArgTre-Leu-Cis-Ser-Ser-Arg-Tir-Leu-Leu

Importacin al ncleo

-Pro-Pro-Lis-Lis-Lys-Arg-Lis-Val

Importacin a los peroxisomas

-Ser-Lis-Leu-

Unin a la membrana a travs de la unin covalente del extremo amino


terminal al cido mirstico.

H3N,Gli-Ser-Ser-Lis-Ser-Lis-Pro-Lis-

res, las citoslicas y las que estn destinadas a cloroplastos,


mitocondrias o peroxisomas, concluyen su sntesis en
dichos ribosomas para luego dirigirse al citosol. La clave del
proceso por el que las protenas se dirigen a su sitio son las
seales de clasicacin, conocidas como secuencias seal,
pptido seal o etiqueta seal, entre las que se encuentran
las protenas de membrana, lisosomales y de secrecin,
mientras que las protenas que no presentan secuencias
seal permanecen en el citosol (citoslicas, nucleares, de
mitocondria y de peroxisomas).

naciente hacia el interior del retculo endoplsmico. La


secuencia seal a menudo es eliminada de la protena por
escisin proteoltica de la peptidasa en el interior del retculo endoplsmico. Una vez completa la sntesis, el ribosoma
se disocia de la membrana del retculo endoplsmico y puede volver a comenzar un nuevo ciclo.
Algunas protenas pueden atravesar la membrana del
retculo endoplsmico despus de su sntesis. En este caso,
se necesita la intervencin de una o ms protenas desnaturalizantes que aprovechan la energa de la hidrlisis del ATP
para mantener la protena total o parcialmente desnaturalizada mientras atraviesa la membrana.
El aspecto ms destacable del trco intracelular es el
que corresponde a las protenas de secrecin. Esto ocurre a
travs de la membrana del retculo endoplsmico y el aparato de Golgi.

www.fullengineeringbook.net

Pptido seal o etiqueta seal

El pptido seal y la regin seal determinan el destino celular correcto de las protenas. Los pptidos seales cuentan
con una secuencia corta de aminocidos (13-60 aa), situados con frecuencia cerca del extremo amino (N-terminal) de
la cadena que marcan a la protena recin sintetizada (cuadro 6-5). Esta secuencia se divide en tres secciones: la primera cuenta con uno o ms aminocidos bsicos en el extremo N-terminal; la segunda se encuentra en la parte central y
consta de seis o siete aminocidos hidrofbicos, y la tercera
se encuentra en la parte C-terminal, es hidrla y contiene
la zona reconocida y cortada por la peptidasa del lder.
Mecanismo de accin. La sntesis de protenas de
secrecin se inicia en los ribosomas citoslicos. La secuencia seal sobresale del ribosoma y se une inmediatamente a
la partcula de reconocimiento de la seal (SRP) que se
encuentra en el retculo endoplsmico y se interrumpe
momentneamente la sntesis proteica. La SRP se disocia
del ribosoma y la sntesis se reinicia. Estos procesos requieren la hidrlisis de un GTP.
En cuanto a su estructura, la SRP es una ribonucleoprotena formada por seis polipptidos y un ARN, del grupo de
los ARN citoplasmticos pequeos o scARN.
La protena TRAM (translocacin a travs de la membrana) se une a la secuencia seal y, junto con una familia de
molculas llamadas protenas Sec (SecA, SecY y SecE), forman el complejo de translocacin, que dirige la protena

Modicaciones postraduccionales
La expresin de los genes en todos los organismos procariotas y eucariotas, est controlada por una gran variedad
de mecanismos (cuadro 6-4). La mayora de los procesos
biolgicos son regulados por modicaciones postraduccionales de las protenas, y las condiciones que interrumpen la
regulacin de tales acontecimientos pueden conducir al
desarrollo de una enfermedad.
Diversos aminocidos que forman la cadena polipeptdica sufren modicaciones qumicas en sitios especcos,
que pueden afectar la estructura o la funcin de la protena.
Estas modicaciones se correlacionan con la estabilidad y la
capacidad de presentar giros en la protena y, en un grado
menor, en la funcin.
Muchas cadenas polipeptdicas se modican mientras
estn unidas al complejo ribosomal o cuando naliza su
sntesis. Como las modicaciones se realizan ya iniciada la
traduccin se denominan modicaciones postraduccionales. Tras la traduccin hay protenas enzimticas que ya son
activas y otras que precisan ser modicadas. En estas modi-

CAPTULO 6 Traduccin

caciones participan remociones de aminocidos (generalmente se separa el aminocido metionina o aminocido


iniciador); la adicin de uno o varios grupos qumicos, y la
asociacin de iones o coenzimas (grupo prosttico) en
algunas enzimas. Todas estas modicaciones son necesarias para darle actividad a la protena.
Las protenas pueden estar constituidas por una cadena
polipeptdica o por varias subunidades, y estas ltimas pueden ser iguales o distintas, segn provengan del mismo gen
o de genes diferentes. El control de calidad del plegamiento
de las protenas para adquirir la estructura cuaternaria o conformacin tridimensional se lleva a cabo por chaperonas y
proteasas. Las protenas chaperonas tienen la funcin de plegar o replegar de forma correcta las protenas recin sintetizadas (modicacin postraduccional), y las proteasas deben
degradar aquellas protenas que, a pesar de la accin de las
chaperonas, no se pliegan de forma correcta.
Las modicaciones postraduccionales son importantes
para determinar la funcin y la actividad de la protena. De
las casi 200 modicaciones distintas que se conocen, la fosforilacin es una de las modicaciones ms importantes y
abundantes, con ms del 30% de protenas modicadas por
este proceso. Tales modicaciones tienen un papel importante en la estabilidad, plegamiento y reconocimiento. Las
protenas glucosiladas pueden ser encontradas en los compartimientos intracelulares.
Los principales mecanismos de modicaciones postraduccionales son los producidos en la etiqueta seal, en
algunos residuos de aminocidos (glucosilacin, fosforilacin, hidroxilacin, acetilacin, etctera) y la protelisis.
Dentro de las modicaciones covalentes, se encuentran
las modicaciones a grupos funcionales (R) y cadenas laterales amino y carboxiloterminales. Para el grupo R se han
encontrado ms de 150 modicaciones covalentes diferentes. Estas modicaciones se conocen para los siguientes
aminocidos: Ala, Gli, Ile, Leu, Met y Val. Las modicaciones postraduccionales ms importantes son:

61

Carboxilacin
En los aminocidos de algunas protenas, se aade un grupo
carboxilo a la cadena lateral de un aminocido, como en el
CH+2 del aspartato (-carboxiaspartato), o del glutamato
(-carboxiglutamato). Este ltimo es esencial para la trombina como factor de coagulacin por su accin quelante hacia
el Ca+2. Tambin participan en protenas estructurales del
hueso. La carencia de vitamina K, que participa como cofactor en la carboxilacin del cido glutmico, permite que se
carboxile de manera insuciente durante la biosntesis de
aminocidos, y ocasiona la generacin del sndrome hemorrgico.

Metilacin
La metilacin postraduccional de las protenas ocurre en
los nitrgenos y en los oxgenos; el donador de grupos
metilo activado es la S-adenosilmetionina (SAM). Las metilaciones ms comunes estn en la -amina de los residuos
de lisina, y algunas metilaciones de nitrgeno adicionales se
encuentran en el anillo imidaslico de la histidina, en el
grupo guanino de la arginina y en los grupos R del glutamato y del aspartato. La N metilacin es una modicacin permanente y no se conocen enzimas en los mamferos que
puedan eliminar el grupo metilo. La metilacin del oxgeno
de los grupos R del glutamato y del aspartato tambin puede
formar steres metilados. Las protenas tambin pueden
metilarse en los grupos R-tioles de la cistena. La metilacin
de las histonas en el ADN es un regulador importante de la
estructura de la cromatina y en consecuencia de la actividad
transcripcional. Esta regulacin se da en el Lis-20 de las H4,
en protenas musculares y en el citocromo C; estos dos ltimos contienen monometil y dimetil-lisina.

www.fullengineeringbook.net

Acetilacin
Muchas protenas estn modicadas en su N-terminal. En
la mayora de los casos, la metionina (iniciador) es hidroxilada y un grupo acetilo se agrega al nuevo aminocido
N-terminal; se observa hasta en un 50% en protenas de
eucariotas. Uno de los efectos que presentan esta modicacin es el incremento de la resistencia a su degradacin.
Tambin se observa una acetilacin en la lisina de la histona
H4 de manera reversible, que le hace responsable de la
regulacin de la condensacin de la cromatina.
El Acetil-CoA es el donador del acetilo para estas reacciones. Algunas protenas tienen el grupo de miristoil de 14
carbonos agregado a su N-terminal. El donador para esta
modicacin es el miristoil-CoA. Esta ltima modicacin
permite la asociacin de la protena modicada con las
membranas. La subunidad cataltica de la proteincinasa
dependiente del cAMP (PKA) se encuentra miristoilado.

Fosforilacin
La fosforilacin postraduccional es una de las modicaciones de la protena ms comunes que ocurren en las clulas
animales y acta casi siempre de forma reversible (fosforilacin y desfosforilacin). La gran mayora de fosforilaciones
ocurren como un mecanismo para regular la actividad biolgica de una protena (regulacin por modicacin covalente). En otros trminos, un fosfato (o ms de uno en
muchos casos) se agrega y despus se quita.
Fisiolgicamente, los ejemplos pertinentes son que las
fosforilaciones que ocurren en la sntesis de glucgeno y
fosforilacin del glucgeno en los hepatocitos, en respuesta
al glucagon que libera el pncreas. Las fosforilaciones que
ocurren en la sntesis inhiben su actividad, considerando
que la actividad de la fosforilasa se aumenta.
La versatilidad de la fosforilacin de los grupos fosfato
es un interruptor que, segn donde ocurra, provoca el
encendido o el apagado del proceso de divisin celular. El
proceso de fosforilacin tambin permite entender por qu
una pequea mutacin en el material gentico, que da lugar
a un cambio de un aminocido por otro en una protena

62

PARTE I Conceptos bsicos de biologa molecular

participante en la divisin celular, puede hacer que las clulas proliferen continuamente, al perderse el sitio en el que se
introduce un grupo fosfato para bloquear su actividad.
Las protenas que provocan la fosforilacin son las cinasas y las que eliminan los fosfatos son las fosfatasas. Las
cinasas catalizan la siguiente reaccin:
ATP + protena fosfoprotena + ADP
En clulas animales, la serina, la treonina y la tirosina
estn sujetas a la fosforilacin, que afecta a su grupo OH.
Aunque el nivel de fosforilacin de la tirosina es menor, su
fosforilacin es funcionalmente muy importante. Como un
ejemplo, la actividad de numerosos receptores del factor de
crecimiento es controlada por la fosforilacin de la tirosina.

Sulfatacin
La modicacin del sulfato en algunas protenas ocurre en
los residuos de tirosina, como se observa en el bringeno y
en algunas protenas secretoras. El donador del sulfato universal es el 3-fosfoadenosil-5-fosfosulfato (PAPS). Puesto
que el sulfato es agregado de forma permanente, es necesario para la actividad biolgica y no se utiliza como una
modicacin regulatoria, como sucede en la fosforilacin de
tirosina.

C-terminal. Debido a lo anterior, una mala hidroxilacin del


colgeno podra derivar en el desarrollo de escorbuto,
acompaado con dcit de vitamina C.

Modicacin con lpidos


Acilacin
En general, esta reaccin tiene lugar en protenas citoslicas insolubles, sintetizadas en ribosomas libres. Afecta las
cadenas laterales y/o los extremos del polipptido, incrementando su hidrofobicidad y proporcionando a la protena un punto de anclaje en la membrana. Los principales
cidos grasos que se incorporan por acilacin son: el miristato (14C), el palmitato (16C) y el estearato u oleato
(18C), en las cadenas laterales de serina y treonina, formando un enlace ster con el grupo OH, y en cistena formando
enlace tioster con el SH.

Prenilacin (terpenos)
Se reere a la adicin del grupo geranilo (10C) farnesil
(15C) o el geranilgeranilo (20C) a protenas receptoras, que
son compuestos isoprenoides derivados, los dos primeros,
de la va biosinttica del colesterol. Los grupos isoprenoides
se unen a residuos de cistena en el extremo C-terminal de
las protenas, con la formacin de un enlace tioter (C-SC). Se ha identicado una secuencia consenso comn en el
extremo C-terminal de las protenas preniladas y se compone de CAAX, donde C es cistena, A es cualquier aminocido aliftico (excepto alanina) y X es el aminocido
C-terminal. Para que la reaccin de prenilacin ocurra, los
tres aminocidos C-terminal (AAX) son retirados. Despus
de unirse el grupo prenilado, el carboxilato de la cistena se
metila en una reaccin que utiliza S-adenosilmetionina
como donante de metilenos.
Algunas de las protenas ms importantes, cuyas funciones dependen de la prenilacin, son aquellas que modulan la respuesta inmune. Estas protenas incluyen las
involucradas en la motilidad, la activacin y la proliferacin
de los leucocitos y en las funciones inmunes de las clulas
endoteliales. Otras de las protenas modicadas con farnesilo son la protena ligadora e hidrolizante de GTP, llamada
RAS, y las protenas-G, que se unen e hidrolizan el GTP en
las cascadas de sealizacin intracelular. Estas funciones
modican la respuesta inmune de muchas protenas preniladas, que son la base de las acciones antiinamatorias de
los frmacos que inhiben las sntesis de colesterol, llamadas
estatinas, debido a que disminuyen la sntesis de farnesil
pirofosfato y geranil pirofosfato y, por tanto, reducen los
episodios inamatorios.

www.fullengineeringbook.net

Glicosilacin o glucosilacin

Una de las formas ms comunes de modicacin proteica


est representada por la glucosilacin. Se le da este nombre
debido a que se unen de manera covalente las cadenas de
oligosacridos (glicanos), con algunos aminocidos de la
cadena proteica y en general no desempea un papel en
la regulacin de la actividad de la protena. Sin embargo,
debido al fenmeno hidrof lico de los azcares, mantienen
la solubilidad de las glicoprotenas y aseguran el plegamiento correcto de los dominios, por lo que dan la estabilidad
extracelular de la protena contra la degradacin. Esta
modicacin es frecuente en protenas de membrana, y casi
no se observan en protenas intracelulares; se observa en
eucariotas y virus, pero no en procariotas.

Hidroxilacin
La funcin de un gran nmero de hidroxilasas, presentes en
el RE, es la de catalizar la incorporacin de grupos OH a
algunas protenas. Estas modicaciones que dependen de la
vitamina C como cofactor incluyen hidroxilaciones de prolina, lisina (se observa en 50% de las prolinas presentes en
colgeno) y la amidacin del C-terminal. Las enzimas que
se hidroxilan se identican como prolil hidroxilasa y lisil
hidroxilasa. El donante de la amida para la amidacin del
C-terminal es la glicina. Las protenas hidroxiladas ms
importantes son los colgenos. Varias hormonas peptdicas, como la oxitocina y la vasopresina, tienen amidacin el

Formacin de puentes disulfuro


Los enlaces de disulfuro se forman generalmente en el
lumen del RER, pero no en el citosol, por la enzima protena-disulfuro isomerasa. Esto se debe al ambiente oxidante

CAPTULO 6 Traduccin

63

Cuadro 6-6. Efecto inhibidor en clulas eucariotas. Inhiben la sntesis proteica en organismos eucariotas. Actan interriendo la actividad del peptidiltransferasa al bloquear la elongacin.
Molcula

Etapa

Descripcin

Pactamicina

Iniciacin

Evita la unin del Met-ARNt con la ARNr subunidad menor

Showdomicina

Iniciacin

Impide la creacin del complejo Met-ARNt

Interfern

Iniciacin

Inactiva al eE2 mediante una fosforilacin

Tetraciclinas

Elongacin

Impide la unin del aa-ARNt al nivel del sitio A del ARNr

Ricina

Elongacin

Se une al ARNr subunidad mayor impidiendo la formacin del complejo aa-ARNt:


eEF-1a:GTP y posiblemente tambin al eEF-2

Ciclohexamida

Elongacin

Inhibe a la enzima peptidiltransferasa

Puromicina

Elongacin

Forma una unin con el pptido creciente provocando una nalizacin temprana. Es
un anlogo del aa-ARNt

Esparsomocina

Elongacin

Inhibe la translocacin

cido fusdico

Elongacin

Evita la liberacin del EF-G, unindose al complejo EF-G:GDP e inhibe al eEF-2

Toxina diftrica

Elongacin

Inactiva al EF-2 de manera irreversible

del retculo endoplsmico y al ambiente reductor del citosol. As, los enlaces de disulfuro se encuentran, sobre todo,
en protenas secretoras, lisosomales, y en los dominios exoplasmticos de las protenas de la membrana. Hay excepciones notables a esta regla. Un nmero de protenas
citoslicas tienen residuos de cistena prximos uno contra
el otro, que funcionan como los sensores de la oxidacin;
cuando el potencial reductor de la clula falla, oxidan y
accionan mecanismos celulares de respuesta. Varias protenas forman enlaces covalentes mediante puentes disulfuro
entre la cistena de la misma cadena (intracatenaria) o con
otra de una cadena distinta (intercatenaria). Este tipo de
enlaces se dan en menor cantidad en las protenas intracelulares que en las extracelulares, favorecen un correcto plegamiento y ayudan a la proteccin de la conformacin
nativa de la protena de la desnaturalizacin.

Quimiotripsingeno
Quimiotripsina
Proinsulina (84 residuos) Propptido (corte de 33
residuos) Insulina
En todos los casos, las echas signican corte proteoltico.
A las protenas inactivas, activadas al retirarles segmentos de la cadena, se las denomina proprotenas, y a los segmentos extrados, propptidos.

www.fullengineeringbook.net

Procesamiento proteoltico
Tambin llamada por algunos cientcos recorte, es el
mecanismo ms comn de modicaciones, aunque tambin se presenta la derivacin de aminocidos especcos.
Probablemente la gran mayora de las protenas maduras
deben modicarse de esta manera: a todas se les deben retirar algunas porciones de la cadena [metionina (o-Met)],
despus de emerger del ribosoma. Muchas protenas involucradas en una gama de procesos biolgicos se sintetizan
como precursores inactivos, que se activan en condiciones
adecuadas mediante la protelisis limitada.
Precursores inactivos Protelisis limitada Protena
funcional
Por ejemplo:
Tripsingeno

Tripsina

Inhibidores de la sntesis de protenas


En la actualidad, un sinnmero de molculas actan deteniendo, complicando o evitando la sntesis de una nueva
protena (cuadros 6-6 y 6-7). Esta caracterstica de algunas
molculas se utiliza en el mbito farmacutico, donde se
observa que las principales molculas inhibidoras de la sntesis de protenas son los antibiticos. Ms de la mitad de
los antibiticos actan inhibiendo uno de organelos responsables de la sntesis de protenas, el complejo ribosomal.
Su mecanismo se ve favorecido por la capacidad de diferenciar entre los procesos de traduccin presentes en procariotas y eucariotas, y as inhibe de forma selectiva la sntesis de
protenas en las bacterias sin afectar al husped.
Los antibiticos pueden agruparse segn la fase concreta de la elongacin sobre la que actan en:
a) Inhibicin del reconocimiento de un aminoacil-ARNt
en el sitio A del ribosoma.
b) Induccin de la presencia de errores en la lectura del
ARNm.
c) Inhibicin de la formacin del enlace peptdico.
d) Inhibicin de la translocacin del peptidil-ARNt desde
el sitio A al sitio P.
e) Bloqueo de los factores de elongacin.

64

PARTE I Conceptos bsicos de biologa molecular

Cuadro 6-7. Efecto inhibidor en clulas procariotas. Inhiben la formacin del complejo traduccional principalmente unindose a uno de
los dos ribosomas (mayor o menor)
Molcula

Etapa

Descripcin

Mupirocina

Activacin de los
aminocidos

Impide la unin de IIe, Inhibiendo de manera competitiva a la enzima lle-ARNt


sintetasa.

Estreptomicina

Iniciacin

Se une al ARNr subunidad menor de manera irreversible, modicando la entrada del


fMet-ARNt y puede provocar errores de lectura en el ARNm.

Eritromicina

Iniciacin

Impide la formacin del complejo ribosomal (la unin del ARNr subunidad menor con el
ARNr subunidad mayor) jndose en el ARNr subunidad mayor.

Tetraciclinas

Elongacin

Impide la unin del aa-ARNt al nivel del sitio A del ARNr

Kirromicina

Elongacin

Evita la separacin del EF-Tu del GDP impidiendo la salida del ribosoma

Cloranfenicol

Elongacin

Impide la unin del aa-ARNt con la enzima peptidiltransferasa.

Puromicina

Elongacin

Forma una unin con el pptido creciente provocando una nalizacin temprana. Es un
anlogo del aa-ARNt.

Aminoglucsidos distintos a la
estreptomicina

Elongacin

Impiden la unin del EF-G al ARNr subunidad mayor.

cido fusdico

Elongacin

Evita la liberacin del EF-G, unindose al complejo EF-G:GDP e inhibe al eEF-2.

Nota: Las tetraciclinas, la puromicina y el cido fusdico actan tanto en clulas procariotas como en eucariotas. Actualmente no se conoce alguna molcula que acte a nivel
de la terminacin de la traduccin.

Inhibicin del reconocimiento de


un aminoacil-ARNt al sitio A del ribosoma

cadena peptdica creciente, mediante la formacin de un


enlace peptdico, formando un peptidil-puromicina. Esta
accin permite bloquear la translocacin del complejo
ribosomal, produciendo que se desacople rpidamente este
complejo, evitando la elongacin y causando una terminacin prematura de la sntesis del pptido creciente en clulas tanto procariotas como eucariotas.

www.fullengineeringbook.net

Tetraciclinas: interactan con las subunidades ribosomales pequeas y no permiten la entrada al aminoacil-ARNt al
complejo ribosomal, evitando su unin al complejo ARNmribosoma. In vitro actan tanto en ribosomas 70S como en
80S, pero in vivo no se observa este fenmeno. Esto se debe
a que las bacterias transportan complejos de tetraciclinaMg de forma suicida, cosa que no ocurre en eucariotas.

Inductores de errores en la lectura del ARNm


Aminoglucsidos: principalmente la estreptomicina, que
en concentraciones relativamente bajas se une a los polirribosomas que estn traduciendo el ARNm, provocando
errores en la lectura del ARNm, al distorsionar la estructura
del ribosoma. Por lo tanto, la bacteria comienza a sintetizar
protenas defectuosas, con un efecto nal bactericida. En
concentraciones mayores, se une a la subunidad 30S, modicando su estructura, lo que hace que el inicio no se produzca. Otros aminoglucsidos, como la gentamicina, las
amicacinas, la tobramicina y la kanamicina, evitan la
asociacin ribosmica al nal de la fase de iniciacin y provocan una mala lectura del cdigo gentico.
Neomicina y eritromicina: se unen a la subunidad 50S
bloqueando la translocacin del complejo ribosomal.

Inhibicin de la formacin
del enlace peptdico
Puromicina: en su estructura es similar al aminoacil-ARNt
de la tirosina, por lo cual se puede unir, en el sitio A, a la

Inhibicin de la translocacin
del peptidil-ARNt desde el sitio A
al sitio P
Macrlidos y lincosamidas: se unen a la subunidad ribosomal 70S inhibiendo la reaccin de la peptidil transferasa.
Bloquean el paso de translocacin e intereren especcamente con la liberacin del ARNt desacilado; es decir, impiden que el ARNt recin ingresado, salga del complejo una
vez que ha cumplido su misin al transferirse el aminocido
al pptido naciente. Es decir, el peptidil-ARNt cargado y
situado en el sitio A, no puede translocarse al sitio P, lo que
detiene la sntesis de protenas.

Bloqueo de los factores de elongacin


Cloranfenicol: inhibe a la enzima peptidil transferasa en
procariotas, y bloquea la fase de la transferencia peptdica
de la elongacin en la subunidad ribosmica 50S, y cuando
su concentracin se incrementa puede inhibir la sntesis de
protenas mitocondriales.
En los cuadros 6-6 y 6-7 se enlistan algunas de las molculas con accin sobre la traduccin, tanto en clulas eucariotas como en procariotas.

CAPTULO 6 Traduccin

65

Bibliografa
Apweiler R., Bairoch A., Wu CH., Barker W.C., Boeckmann B., Ferro
S., et al. UniProt: the Universal Protein knowledgebase. Nucleic

Acids Res, 2004;32:D115-D119.


Creighton T.E. Encyclopedia of Molecular Biology. European Molecular Biology Laboratory. Londres: 1999 1-4:4595.
Gonzlez Flecha F.L., Castello P.R., Gagliardino J.J., Rossi
J.P.F.C. La glucosilacin no enzimtica de protenas. Meca-

nismo y papel de la reaccin en la diabetes y el envejecimiento.


Ciencia al Da Internacional, 2000;3(2):1-17.

Nalivaeva N.N., Turner A.J. Post-translational modications of

proteins: Acetylcholinesterase as a model system. Proteomics,


2001;1:735747.
Schweppe R.E., Haydon C.E., Lewis T.S., Resing K.A., Ahn
N.G. The characterization of protein post-translational modi-

cations by mass spectrometry. Acc Chem Res, 2003;36(6):453461.


Xu Y. Regulation of p53 responses by post-translational modications. Cell Death Dier, 2003;10(4):400403.

www.fullengineeringbook.net

Captulo

Regulacin de la expresin gnica


Adriana Mara Salazar Montes / Ana Soledad Sandoval Rodrguez
Juan Armendriz Borunda

Introduccin

de un gen se inicia con el proceso de transcripcin controlado por protenas denominadas factores transcripcionales,
regulados por seales recibidas por las clulas, y concluye
con la produccin de un ARN funcional y, posteriormente,
en el caso de los ARNm, con la traduccin de una protena
madura y activa. Los factores transcripcionales son protenas de unin al ADN que reconocen una secuencia especca y se requieren para el encendido y apagado de los genes.
La expresin de un gen se regula en diferentes niveles, desde su inicio hasta su terminacin.

La informacin gentica de una clula est contenida en su


ADN, el cual contiene la informacin necesaria para crear
miles de molculas diferentes y, con ello, conformar un
individuo completo.
Un organismo procaritico, como una bacteria, consta
de millones de nucletidos, en tanto que uno eucaritico,
como el ser humano, de varios billones. A pesar de contener toda esa informacin, la clula slo expresa una fraccin de sus genes, lo que le otorga un fenotipo caracterstico.
As, cada uno de los 10 000 tipos de clulas que constituyen
los organismos multicelulares expresan genes diferentes.
Aunque los diversos tipos de clulas en un organismo
multicelular contienen la misma informacin gentica, su
estructura y funcin dieren ampliamente. Una neurona y
un linfocito, por ejemplo, son muy diferentes, por lo que es
dif cil pensar que estas dos clulas contienen el mismo
genoma como sucede en realidad. Por esta razn, se crea
que los genes se perdan cuando las clulas se diferenciaban.
Ahora se sabe que las clulas de un organismo multicelular
son distintas porque sintetizan diferentes ARN mensajeros
(ARNm) y, por ende, diferentes protenas a partir del mismo genoma.

www.fullengineeringbook.net
Niveles de control de la expresin gnica

Los niveles del control de la expresin de un gen son los


siguientes:
1.
2.
3.
4.
5.
6.
7.

Pretranscripcin.
Transcripcin.
Procesamiento del trnscrito primario de ARN.
Transporte del ARNm al citoplasma.
Traduccin del ARNm.
Degradacin del ARNm.
Modicaciones postraduccionales.

Nivel pretranscripcional
La estructura de los genes cambia cuando van a ser transcritos; un cambio conformacional en la cromatina es el primer paso en la expresin gnica. En el ncleo de una clula
eucariota, el ADN se encuentra enrollado alrededor de
octmeros de histonas para formar los nucleosomas, lo que
impide la transcripcin de los genes; es necesario que el
ADN se desenrrolle y se separe de las histonas para que
pueda llevarse a cabo la transcripcin. Cada una de las histonas que forman el nucleosoma tiene, en su extremo aminoterminal, una cola que se extiende por fuera de la doble
hlice de ADN (gura 7-1). Se dispone de pruebas de que la

Regulacin de la expresin gnica


Uno de los principios fundamentales de la biologa celular es
que la actividad y las propiedades de cada clula estn determinadas por las protenas que contienen. Pero, qu determina los tipos y la cantidad de protenas que se encuentran en
una clula? Qu determina la frecuencia con que se traducen los ARNm y la estabilidad de las protenas?
El trmino expresin gnica se reere al proceso
mediante el cual la informacin codicada en un gen se
transcribe en uno o varios ARN funcionales. La expresin
66

CAPTULO 7 Regulacin de la expresin gnica

Ac

Ac

Ac
CH3

CH3

Ac
CH3

Ac

CH3

CH3

CH3

Reclutamiento de Me CP2

CH3

CH3

CH3
Me CP2

Ac

HDAC

Ac

Ac

CH3

Histonas acetiladas
ADN metilado
Transcripcin innaccesible

Ac

67

Me CP2

CH3

CH3

CH3

CH3

Reclutamiento de HDAC

Desacetilacin de histonas
Cromatina activa transcripcionalmente

Figura 7-1. Control pretranscripcional de la expresin gnica.

metilacin de la histona H3 promueve la compactacin de


la cromatina e inhibe la transcripcin. Por otra parte, la acetilacin de residuos de lisina en las histonas tiene un efecto
opuesto, es decir, esta acetilacin evita que las bras de cromatina se plieguen dejando expuestos segmentos de ADN,
para ser reconocidos por factores transcripcionales, y se
forme el complejo basal de la transcripcin. Las enzimas
encargadas de agregar residuos de acetilo a las lisinas en las
histonas se denominan acetiltransferasas. La unin de un
factor transcripcional al ADN recluta a una protena, llamada coactivador, a la regin de la cromatina destinada a la
transcripcin. El coactivador acetila, entonces, a las histonas de los nucleosomas, que pierden su carga positiva, liberan el ADN del nucleosoma y dejan libre el promotor, lo que
permite la unin de ms factores transcripcionales, ensamblndose la maquinaria de transcripcin y dando inicio a
este proceso (gura 7-1B).

peo en una clula procariota es muy sencillo y en una


eucariota, mucho ms complejo.
Los factores transcripcionales se unen al ADN en el surco mayor, ya que la conformacin de la protena es complementaria a la supercie espacial de la doble hlice; la
protena interacta con el ADN a travs de enlaces, como
puentes de hidrgeno, enlaces inicos e interacciones
hidrofbicas que, aunque son enlaces dbiles, la gran cantidad permite lograr una unin fuerte y altamente especca
(gura 7-2).

www.fullengineeringbook.net

Nivel transcripcional
En el control de la expresin de un gen a nivel transcripcional intervienen elementos CIS y TRANS. Los elementos
CIS estn constituidos por las secuencias en el ADN (promotor, enhacer, silencer) en donde se unen diversas protenas, entre ellas los factores transcripcionales. Los elementos
TRANS son, precisamente, los factores transcripcionales
unidos al ADN en su secuencia blanco y que desempean
un papel fundamental en este control. Estas protenas se
identicaron por primera vez en 1950 y estn presentes
tanto en clulas eucariotas como en procariotas. Su desem-

Control transcripcional en procariotes


La expresin de los genes de los organismos procariotes,
como las bacterias, est determinada por las condiciones
ambientales en las que se encuentran la disponibilidad de
alimento como uno de los factores ms importantes.
En las bacterias, la mayora de los genes relacionados
con el metabolismo estn agrupados en operones. Los genes
pertenecientes al mismo opern se prenden y se apagan al
mismo tiempo. Un opern se dene como un fragmento de
ADN que contiene los genes de las protenas que participan
en la misma va metablica. El opern ms conocido y ms
estudiado es el opern Lac de Escherichia coli y es uno de
los ejemplos clsicos de regulacin gnica. Este opern se
encarga de metabolizar la lactosa para obtener energa. En
ausencia de lactosa en el medio, los genes del opern Lac se
encuentran apagados, puesto que la bacteria est obteniendo energa de otras fuentes. Sin embargo, cuando la bacteria est expuesta a un medio rico en lactosa, la expresin del

68

PARTE I Conceptos bsicos de biologa molecular

Operador
Represor

Promotor

ADN
1 Transcripcin

Ncleo

Lac
2 Procesamiento de ARNm

Lac
Represor

Lac

Citoplasma

AAAAAAA
AAAAA

Lac

Promotor

Operador

Lac
Lac
Y

3 Transporte ARNm
ARN
polimerasa

6 Actividad de la protena

4 Traduccin

5 Degradacin ARNm
PHE
ARNtphe

Figura 7-3. Opern Lac.


AAA

Ribosoma
A A A
CG GC A U U UUGCACG C
3

El ARNtphe
se une al codn UUU

Codn de la PHe

Figura 7-2. Niveles de regulacin de la transcripcin.

estos promotores. Los factores transcripcionales pueden


dividirse en dos grupos funcionales:
1. Generales: comunes a todos los genes, que se unen al
promotor junto con la ARN polimerasa.
1. Especcos: se unen a sitios reguladores en genes especcos.

www.fullengineeringbook.net

opern Lac se activa. Este opern contiene tres genes, Z, Y


y A (gura 7-3). El gen Y codica para una permeasa de
lactosa que introduce a la lactosa en la clula; el gen Z codica para la -galactosidasa, una enzima que rompe el enlace glicosdico de la lactosa y libera los dos monosacridos
que la constituyen (glucosa y galactosa), y el gen A codica
para la enzima tiogalactsido transacetilasa, que elimina de
la clula los tiogalactsidos transportados a la clula junto
con la lactosa.
En el funcionamiento normal del opern Lac, existe una
protena llamada represor (un factor transcripcional) que
inhibe su expresin. En ausencia de lactosa, este represor
permanece unido al promotor del opern. En presencia de
lactosa en el medio, sta se une al represor y provoca en l
un cambio conformacional e impide que se una al ADN.
Esto permite la transcripcin del opern Lac y, con ello, la
expresin de los tres genes que actan en el metabolismo de
la lactosa (gura 7-3).

Control transcripcional en eucariotes


La transcripcin de los genes la controla el promotor (vase
el captulo 5). Algunos promotores son sencillos y estn
regidos por una sola seal que controla la actividad de los
genes. Otros son complejos, responden a una variedad de
seales y actan como pequeos procesadores que interpretan e integran estas seales, controlando as el encendido y apagado de los genes. La transcripcin es, entonces,
controlada por los factores transcripcionales que se unen a

Un mismo factor transcripcional puede controlar diferentes genes al mismo tiempo, ya que la secuencia que reconocen en el ADN puede estar presente en el promotor de
varios genes.
Los primeros genes en estudiarse fueron los genes virales y aquellos que codican para protenas que participan
en la regulacin del ciclo celular. Todos estos genes contienen una secuencia altamente conservada denominada caja
TATA (timina-adenina-timina-adenina), que se encuentra
25-35 pb corriente arriba del sitio de inicio de la transcripcin (posicin 25, 35) (gura 7-3). Estudios de mutagnesis
dirigida han demostrado que el cambio de un solo nucletido
en esta secuencia disminuye de forma espectacular la transcripcin de los genes controlados por ella. Existen genes
que se transcriben constantemente, denominados genes de
expresin constitutiva, como por ejemplo, el gliceraldehdo
3 fosfato deshidrogenasa (GA3PDH), la -actina y el ARN
ribosomal 18S. Estos genes no contienen caja TATA, pero s
regiones ricas en GC, reconocidas por factores transcripcionales especiales.
Adems del promotor, la transcripcin de la mayora de
los genes eucariticos se regula por otras secuencias en el
ADN, llamadas potenciadores (enhancer) o inhibidores
(silencer), que se localizan a cientos o miles de bases de distancia del sitio de inicio de la transcripcin (gura 7-4).
Mutaciones en los genes que codican para factores transcripcionales pueden ocasionar que stos acten activando
o inactivando genes sin control.

CAPTULO 7 Regulacin de la expresin gnica

Represor

69

TAFs
TBP

Silenciador

Enhancer
or

TATA

ad

v
cti

ARNPol II

TFIIB

TFIID

Promotor

Promotor

TFIIE

TATA

+1

Figura 7-4. Potenciadores y silenciadores en el control de la


expresin gnica.

La regulacin de la transcripcin en eucariotes es


mucho ms compleja que en procariotes, principalmente
por dos razones:
a) Los factores transcripcionales actan a distancia del
sitio de inicio de la transcripcin.
b) La ARN polimerasa eucaritica (ARN polimerasa II)
requiere de la accin conjunta de un grupo de al menos
15 protenas reguladoras denominadas factores generales
de la transcripcin, que se ensamblan de manera coordinada y secuencial en el promotor de los genes y que son
necesarias para la accin de la ARN polimerasa II.

TFIID

TFIIH
TFIIB

TFIIB

TFIIH

Sitio de inicio de la
transcripcin

TFIID

TFIIE

ARN Pol II
p

TFIID

ARN Pol II

Figura 7-5. Maquinaria basal de transcripcin.

los genes, o como represores, si la inhiben. Un solo gen


puede controlarse mediante la unin de varios factores
transcripcionales. Por otro lado, un mismo factor transcripcional puede unirse a los potenciadores de varios genes
y controlar la expresin de todos ellos. Cada tipo celular
tiene un patrn caracterstico de expresin de genes, determinado por el grupo de factores transcripcionales inducibles expresados en esa clula. A esto se le conoce como
expresin clula-especca o tejido-especca.

www.fullengineeringbook.net

Factores generales de transcripcin

El hallazgo de que la ARN polimerasa eucaritica por s sola


no puede iniciar la transcripcin condujo al descubrimiento de protenas accesorias, conocidas como factores generales de la transcripcin.
Estas protenas, TFIIA, TFIIB, TFIID, TFIIE, TFIIF,
TFIIH y TFIIJ (TF, transcriptional factor, y II, por asociarse
a la ARN polimerasa II), se ensamblan de forma coordinada
en el promotor de los genes y asisten la unin y accin de la
ARN polimerasa. El ensamblaje se inicia con la unin del
factor transcripcional TFIID a la secuencia TATA en el promotor (formada por dos protenas diferentes: TBP (TATA
binding protein) y TAF (TBP associated factor). Despus se
incorporan los factores TFIIA y TFIIB, y slo entonces la
ARN polimerasa II, formando complejo con TFIIF se une
al promotor. TFIIE, TFIIH y TFIIJ se acoplan despus a
este complejo. Una vez reunidos todos estos elementos,
TFIIE, con su accin de helicasa, desenrolla el ADN y TFIIH
fosforila la ARN polimerasa II en su dominio CTD, lo que
produce su activacin. En este momento se liberan todos
los componentes del complejo de los factores generales de
transcripcin y se inicia la transcripcin de un gen determinado (gura 7-5).

Factores transcripcionales inducibles


Es un grupo de factores transcripcionales que pueden
actuar como activadores, si estimulan la transcripcin de

Estructura de los factores transcripcionales


Debido a que los factores transcripcionales son protenas,
su anlisis conformacional y cristalogrco ha permitido
conocer que todos ellos presentan dominios con estructura
similar que les permiten unirse al ADN o a otros factores
transcripcionales y formar grandes complejos que regulan
la expresin de los genes. En su regin de contacto con el
ADN, existe una serie de aminocidos bsicos (cargados
positivamente) que le facilitan su unin al ADN, que tiene
carga negativa. Las posibles estructuras que pueden observarse en un factor transcripcional son cuatro: hlice-vueltahlice, hlice-asa-hlice, dedos de cinc y zipper de leucinas.

Hlice-vuelta-hlice
Fueron las primeras protenas de unin al ADN que se
reconocieron; de hecho, la mayora de las protenas que se
unen al ADN tienen esta conformacin. Estas protenas
constan de dos estructuras -hlice, unidas por una cadena
corta de aminocidos, lo que provoca un giro especco en
cada una de las -hlice y facilita su unin al ADN. Un
ejemplo de este tipo de factor transcripcional es el represor
del opern Lac.

70

PARTE I Conceptos bsicos de biologa molecular

Leu
Leu
Leu
Leu
Leu
Leu
Leu
Leu
Leu
Leu
Leu
Leu

Hlice 1

asa

asa

Hlice 3

D
Hi

Zn Hi

Cvs

Cvs

Hi

Zn Hi

Cvs

Cvs

Hlice 4

Hlice 2
Hlice 3

Cvs

Hlice 2

Vuelta

Hi

Zn Hi

Cvs

Vuelta

Hlice 1

Figura 7-6. Estructuras de los factores transcripcionales.

Hlice-asa-hlice
Los factores transcripcionales que presentan esta estructura
constan de una -hlice corta conectada por una horquilla a
otra -hlice igual o ms grande, formando homodmeros o
heterodmeros. El factor transcripcional Oct-1 presenta esta
conformacin.

cionales pueden activarse, que se describen en los siguientes prrafos.


1. Transcripcin. El factor transcripcional se sintetiza
slo cuando se necesita y se degrada rpidamente por
protelisis de tal manera que nunca se acumula.
2. Unin ligando-receptor. Un factor requiere de la unin
de un ligando para activarse. Un ejemplo de este tipo de
factor transcripcional es el receptor de esteroides. El
receptor se encuentra inactivo en el citoplasma. Los esteroides, al ser liposolubles, atraviesan la membrana celular por difusin simple, se unen a su receptor en el
citoplasma y lo activan, propiciando su transporte hacia
el ncleo y su unin al ADN en los promotores de los
genes que contengan la secuencia de reconocimiento.
3. Fosforilacin. Es el mecanismo ms comn para la
activacin de la mayora de los factores transcripcionales y consiste en la adicin de un grupo fosfato por una
cinasa en aminocidos predeterminados, generalmente
serina o treonina del factor transcripcional. El factor
transcripcional AP-1 es un ejemplo caracterstico de
este mecanismo de activacin.
4. Formacin de complejos. El acoplamiento de varias
protenas da como resultado un factor transcripcional
activo con capacidad de migrar al ncleo y unirse al
ADN. El factor transcripcional AP-1, formado por dos
subunidades, Fos y Jun, es un ejemplo caracterstico de
este mecanismo de activacin.
5. Liberacin del inhibidor. El factor transcripcional se
encuentra inactivado por un inhibidor. Cuando ste es
fosforilado sufre un cambio conformacional que libera el
factor transcripcional y permite su traslado al ncleo y su
unin al ADN. El factor transcripcional NF-B se activa
a travs de este mecanismo en donde la protena que funciona como inhibidor es llamada I-B (gura 7-7).

www.fullengineeringbook.net

Dedos de cinc
Un tercer grupo de protenas de unin al ADN est formado por una estructura -hlice y una -plegada, o dos
-hlices unidas por uno o ms tomos de cinc, que adquiere una forma similar a uno o ms dedos. Entre los factores
transcripcionales que presenta esta estructura estn los
receptores de esteroides, los glucocorticoides y estrgenos,
y el factor transcripcional SP1 (de los descritos en primer
lugar).
Zipper de leucinas
La mayora de los factores transcripcionales con esta
estructura forman dmeros para lograr una unin ms fuerte al ADN, que se facilita por la presencia de residuos de
lisina en los dos monmeros alternados cada siete u ocho
aminocidos. Las lisinas les permiten realizar interacciones
hidrofbicas que mantienen unidas a las dos subunidades.
El factor transcripcional AP-1 es un buen ejemplo de
este tipo de estructura. Esta protena es un heterodmero
formado por dos subunidades llamadas Fos y Jun (gura
7-6).

Activacin de los factores transcripcionales


La actividad de los factores transcripcionales se regula en
su mayora por modicaciones postranscripcionales; es
decir, la protena se produce pero permanece inactiva hasta
que no recibe una seal de activacin. Sin embargo, hay
diversos mecanismos por los cuales los factores transcrip-

Regulacin mediante potenciadores (enhancer)


En 1979 se identicaron ciertas secuencias de nucletidos
en los promotores de genes eucariotes a las que se les llam
potenciadores (enhancer). Estas secuencia sirve como sitio
de anclaje de factores transcripcionales inducibles, los cuales, mediante un cambio conformacional y formando una
horquilla, interactan directamente con los factores generales de la transcripcin y la ARN polimerasa, para inducir
la transcripcin.
De esta manera, la regin en el ADN que controla la
expresin de un gen est conformada por el promotor y
uno o ms potenciadores; por lo tanto, la regin reguladora es una secuencia de ADN de tamao variable que controla la velocidad de transcripcin. La mayora de los
factores transcripcionales inducibles actan en complejos,
aunque algunos lo hacen de forma individual. De la misma
manera, la mayora de ellos activan la transcripcin, aunque tambin algunos son protenas represoras que la
suprimen. Aunado a esto, un mismo factor transcripcional

CAPTULO 7 Regulacin de la expresin gnica

INACTIVO
Monmero

Inactivacin
por inhibidor

PROCESO DE
ACTIVACIN
Formacin de dmeros

ACTIVO

Fosforilacin
del inhibidor
P
P

Bloqueo de
entrada al
ncleo

Separacin
del complejo

Receptor

Unin al ligando

Protena
defosforilada

Fosforilacin
de la protena
P

Entrada al
ncleo

71

por lo tanto, la produccin de una molcula de ARNm


completa.
La atenuacin de la transcripcin en eucariotes puede
ocurrir por distintos mecanismos. En clulas infectadas por
adenovirus o retrovirus (por ejemplo, el virus de inmunodeciencia humana, VIH) las protenas que se ensamblan
en el promotor determinan si la ARN polimerasa puede
truncar la transcripcin. Estas protenas pueden ser diferentes en distintas clulas y la clula puede controlar el nivel
de atenuacin de un gen en particular.

Control del procesamiento del ARN


Durante la transcripcin, en organismos eucariotes se producen ARN precursores llamados trnscritos primarios o
pre-ARNm, posteriormente procesados para producir una
molcula de ARNm madura a travs del proceso de corte y
empalme (splicing). El trnscrito primario es aproximadamente 10 veces ms grande que el ARNm maduro. En este
procesamiento, los intrones se eliminan del trnscrito
dejando exclusivamente los exones, para constituir un
ARNm maduro. Un mismo trnscrito primario puede procesarse de diversas formas, lo que da lugar a diferentes
ARNm y, por lo tanto, a diferentes cadenas polipeptdicas.
Algunos genes presentan secuencias ambiguas; es decir,
regiones que en unos tejidos se consideran exones y en
otros, intrones, por lo que en cada tejido se realiza un procesamiento diferente conocido como procesamiento o splicing alternativo, que origina en cada uno de ellos ARNm y
protenas diferentes.

www.fullengineeringbook.net

Figura 7-7. Mecanismos de activacin de los factores transcripcionales.

Edicin del ARN


puede formar parte de complejos que activan o inhiben la
transcripcin.

Control postranscripcional
El control en el inicio de la transcripcin es la forma predominante de regulacin gnica; sin embargo, existen otros
controles menos comunes que modulan la expresin de un
gen en el paso de ARN a protenas conocidos como controles postranscripcionales, descritos a continuacin y que se
enlistan en el cuadro 7-1.

Atenuacin de la transcripcin
En organismos procariticos, como las bacterias, la expresin de ciertos genes es inhibida por la terminacin prematura de la transcripcin, un fenmeno conocido como
atenuacin de la transcripcin. En este proceso la cadena de
ARN recin sintetizada adopta una estructura que interacta con la ARN polimerasa, impide su avance e interrumpe
la transcripcin. Cuando la clula requiere la protena codicada por este gen, algunas protenas reguladoras se unen a
la cadena naciente de ARN y reacomodan su estructura,
con lo que se permite la restauracin de la transcripcin y,

Este tipo de control postranscripcional se reere a la modicacin en una o ms bases en la secuencia del ARNm
maduro que provoca cambios en el mensaje original. La
modicacin ms frecuente es el cambio de citocina por
uracilo, con lo que la secuencia original se altera hasta en
un 50%. El proceso de edicin del ARNm es limitado en
mamferos y slo se ha observado en los genes de ApoB y de
la protena del canal de calcio en el cerebro. En el primer
caso, una citocina se cambia por un uracilo, con lo que se
genera un codn de terminacin prematuro que produce una
versin truncada de la protena. En el segundo caso, se cambia un nucletido a la mitad de la molcula de ARNm; esto
origina el reemplazo de un aminocido por otro, lo que altera
la permeabilidad del canal de calcio.

Control del transporte de ARN


Transporte del ncleo al citoplasma. El ARN, como cualquier otra molcula que sale del ncleo, lo hace a travs del
complejo de poro. Para poder salir del ncleo, el ARN sufre
tres modicaciones importantes: la adicin del nucletido
modicado 7 metilgualnosina en el extremo 5, la adicin de
la cola de PoliA en el extremo 3 y la eliminacin de los
intrones (splicing).

72

PARTE I Conceptos bsicos de biologa molecular

Cuadro 7-1. Mecanismos por los cuales puede ser regulada la expresin de un gen.

Mecanismo

Sitio en la
clula donde
se realiza

Accin

Consecuencia

Pre-transcripcional

Metilacin de histona H3.

Ncleo

Inhibicin de la Transcripcin.

Pre-transcripcional

Acetilacin de histonas.

Ncleo

Induccin de la Transcripcin.

Transcripcin

Unin de factores transcripcionales al ADN.

Ncleo

Dependiendo si el factor transcripcional es


inductor o inhibidor se estimula o se
inhibe la transcripcin.

Atenuacin de la
transcripcin

El ARN naciente adquiere una conformacin


especial que impide que la ARN pol contine su
sntesis.

Ncleo

No hay sntesis completa de la cadena de


ARN.

Procesamiento del ARN

Eliminacin diferencial de intrones y conservacin


de exones.

Ncleo

Un mismo ARNhn da lugar a ARNm


diferentes.

Edicin del ARN

Modicacin de una o ms bases en un ARNm


maduro.

Ncleo

Cambio de uno o ms codones en el ARNm


maduro.

Transporte del ARN

Por seales especcas el ARN es exportado al


citoplasma.

De ncleo a
citoplasma

No sale del ncleo y no se traduce.

Transporte del ARN

El pptido seal induce el transporte del ARN al


RER para la sntesis de protenas de exportacin

Traduccin

Reconocimiento de secuencias especcas en el


ARNm por factores de la traduccin

Citoplasma

La ausencia de estas seales no permite


que se realice la traduccin.

Adicin de grupos
qumicos a protenas

Formacin de protenas compuestas

Citoplasma

Generacin de protenas funcionales y


activas.

Inhibidores de la
traduccin

Unin de protenas inhibidoras al extremo 5 del


ARNm

Citoplasma

Inhibicin de la traduccin.

Degradacin de ARNm

Eliminacin de la cola de poli A.

Citoplasma

Se degrada el ARNm y se detiene su


traduccin.

Interrupcin de la
traduccin

Modicacin del marco de lectura que genera un


codn de paro prematuro.

Citoplasma

Produccin de protenas truncadas.

La falta del pptido seal hace que las


protenas se sinteticen en ribosomas libres
y permanezcan dentro de la clula.

www.fullengineeringbook.net

Cuando una molcula de ARNm cruza por un poro


nuclear y se introduce en el citoplasma, se encuentra con
los ribosomas, que la traducen en una cadena polipeptdica.
Si el ARNm codica para una protena de secrecin o de
membrana, la presencia de un pptido seal en la regin
aminoterminal determina su transporte hacia el retculo
endoplsmico. La clula reconoce este pptido tan pronto
como sale del ribosoma; entonces, el complejo formado
por el ribosoma, el ARNm y la protena naciente se dirige
a la membrana del retculo endoplsmico, donde la cadena
polipeptdica terminar de sintetizarse. En otros casos
la protena entera es sintetizada por ribosomas libres en el
citosol, y seales en su estructura la dirigen al sitio en la
clula en donde se necesita.

Control de la traduccin
La traduccin comienza cuando la subunidad pequea del
ribosoma reconoce el codn de inicio (AUG) en el ARNm.
Los nucletidos vecinos participan en este reconocimiento,
en donde se encuentran la secuencia shine-dalgarno en

ARNm procariotes y la secuencia kozak en eucariotes (vase el captulo 6). Si el reconocimiento es deciente, la subunidad ribosmica ignorar el primer codn AUG y saltar
hasta el segundo o el tercero. Este fenmeno, conocido
como bsqueda de escape, es una estrategia para producir
dos o ms protenas diferentes en su extremo aminoterminal a partir de un mismo ARNm.
En ARNm virales la traduccin se realiza usando este
tipo de mecanismos. Estos ARNm cuentan con secuencias
de nucletidos especcas, llamadas sitios internos, que no
son reconocidas por el ribosoma, y la traduccin se inicia
en el segundo codn AUG.

Modicaciones postraduccionales.
Adicin de grupos qumicos a protenas
Otro mecanismo por el cual se puede regular la expresin
de un gen es la adicin de diferentes grupos qumicos a
cualquiera de los aminocidos que conforman una protena. Sin la adicin de estos compuestos la protena no se
convertir en una protena madura y funcional. Entre las

CAPTULO 7 Regulacin de la expresin gnica

adiciones ms comunes se encuentran las acetilaciones,


las carboxilaciones, las metilaciones, las hidroxilaciones y las
fosforilaciones.

Protenas inhibidoras de la traduccin


La expresin de un gen puede inhibirse si la traduccin se
bloquea mediante la unin de protenas inhibidoras en el
extremo 5 del ARNm cerca del sitio de inicio de la traduccin. Este tipo de mecanismo se llama control negativo de la
traduccin.

Control de degradacin del ARNm


Los ARNm en clulas bacterianas son muy inestables; su
vida media es de pocos minutos. En clulas eucariticas el
ARNm es ms estable, de alrededor de 30 minutos, aunque
existen otros con vidas medias ms largas, por ejemplo el de
la -globina tiene una vida media de 10 horas. Los ARNm
ms inestables a menudo codican para protenas reguladoras cuya sntesis cambia rpidamente ante un estmulo.
La inestabilidad de estos ARNm se debe a que su secuencia
rica en A y U en la regin 3 no traducida (UTR) acelera la
eliminacin de la cola de poli-A y, por ende, la degradacin
del ARNm. Otros ARNm son reconocidos en sus extremos
3 UTR por endonucleasas que cortan el ARNm. Sin embargo, la estabilidad de un ARNm cambia en respuesta a seales extracelulares.
Por ejemplo, el ARNm que codica para las histonas, en
la fase S del ciclo celular, periodo en el que se sintetiza el
ADN y se requiere de nuevas histonas para su empaquetamiento, tiene una vida media de 1 hora; cuando termina la
fase S, los ARNm se degradan en pocos minutos. De igual
forma, si la sntesis de ADN es inhibida con algn frmaco,
la acumulacin de histonas libres induce la degradacin
de su ARNm. Por ello, la degradacin del ARNm depende de
las seales que acten en su extremo 3, donde se encuentra la
cola de poli-A.

ncleo. Su longitud es variada y cuenta con un promedio de


200 nucletidos. Una vez en el citoplasma, esta cola se va
acortando con el tiempo. No se han observado colas de
menos de 30 adeninas, lo que sugiere que ste es el tamao
mnimo requerido para mantener la estabilidad del ARNm.

Interrupcin de la traduccin
El proceso de sntesis de protenas es automtico, esto es,
una vez iniciado debe terminarse. En casos especiales, un
proceso denominado recodicacin traduccional puede
alterar el proceso de traduccin. Los tipos de recodicacin
observados con ms frecuencia son los cambios en el marco
de lectura y se observan sobre todo en virus; los retrovirus lo
hacen de manera ordinaria. Estos virus producen un solo
ARNm del cual se sintetizan tanto las protenas de la cpside
(protenas Gag) como sus enzimas (transcriptasa inversa,
integrasas, proteasa y protenas Pol). Como los virus necesitan ms protenas Gag que Pol provocan un ajuste en su
ARNm e inducen la formacin de un codn de terminacin
al nalizar la regin Gag, asegurando que slo se produzcan
las protenas de esta regin y eliminando temporalmente la
sntesis de las protenas Pol.
Existe un ltimo mecanismo de control de la expresin
de un gen: la presencia de molculas de ARN complementarias al ARNm que, al unirse a l, bloquean su transcripcin. A este tipo de estrategias se le conoce como ARN
antisentido o ARN de interferencia y regulan la expresin
de algunos genes tanto en clulas procariotas como eucariotas (vase el captulo 27, Terapia gnica). Este mecanismo se describi inicialmente en organismos inferiores, pero
ahora se sabe que funciona en la mayora de los organismos.
Los estudios experimentales con este tipo de molculas
administradas exgenamente son de gran inters, ya que el
bloqueo en la sntesis de una determinada protena permite
entender su funcionamiento completo y comprender de
forma ms integral su papel en los procesos evolutivos. Se
cree que las primeras clulas carecan de ADN y protenas y
slo contenan ARN. Estas clulas primitivas utilizaban el
mecanismo antisentido para regular sus funciones (cuadro
7-1).

www.fullengineeringbook.net

Cola de poli-A
La adicin de la cola de poli-A a un ARNm recin sintetizado ocurre en organismos eucariotes y se lleva a cabo en el

73

74

PARTE I Conceptos bsicos de biologa molecular

Ejercicios de integracin
1. La expresin de un gen en eucariotes se regula en diferentes niveles: unos se realizan en el ncleo y otros en el
citoplasma. Indique cules suceden dentro del ncleo y
cules fuera de l.
2. Indique si es falso o verdadero:
Para la expresin de genes procariotes es necesario
que el ARNm salga del ncleo y sufra el proceso de
splicing ______________________________________
La ARN polimerasa fosforila los factores transcripcionales para que induzcan la expresin de los genes
______________________________________________

Eucariotes

En la regulacin pretranscripcional participa la estructura de la cromatina, donde la acetilacin de


las histonas desempea un papel muy importante.
______________________________________________
La temperatura y el medio ambiente son factores clave en la expresin de genes en procariotes.
______________________________________________
Los operones son conjunto de genes presentes exclusivamente en mamferos. ______________________
3. Indique a qu tipo de organismo pertenecen las siguientes
estructuras o procesos:

Procariotes

Opern Lac
Factores generales de la transcripcin
Promotores
ARN polimerasa
Enhancer o potenciadores
Splicing (corte o empalme)
Histonas

www.fullengineeringbook.net
Adicin de la cola de poli A

Bibliografa
Alberts B., Johnson A., Lewis J., Raff M., Roberts K., Walter P. Con-

Watson J., Baker T., Bell S., Gann A., Levine M., Losick R. Regu-

trol of gene expression. Molecular biology of the cell, 4 ed. Nueva


York: Garland Science, 2002:365-465.
Karp G. El ncleo celular y el control de la expresin gnica. Biologa
celular y molecular, 6 ed. Mxico: McGraw-Hill, 2011:455-532.
Watson J., Baker T., Bell S., Gann A., Levine M., Losick R., Expresin del genma Biologa molecular del gen, 5 ed. Mxico, DF:
Editorial Mdica Panamericana, 2006:370-491.
Pabo C.T., Sauer R.T. Transcription factors: structural families and
principles of DNA recognition. Ann Rev Biochem, 1992;61:10531095.

lacin. Biologa molecular del gen, 5 ed. Mxico, DF: Editorial


Mdica Panamericana, 2005:370-491, 513-613.
Lewin B. Regulation of transcription: factors that activate the basal
apparatus. Genes IX, 7 ed. Nueva York: Oxford University Press,
649-684.
Lodish H., Berk A., Zipursky S.L., Matsudaira P., Baltimore D.,
Darnell J. Regulation of transcription initiation. Molecular cell

biology, 4 ed. WH Freeman and Company, 2000:341-403.

Captulo

Mutaciones
Mara Guadalupe Snchez Parada / Belinda Claudia Gmez Meda

Introduccin

de la eciencia de los mecanismos de reparacin contra el


aumento en las lesiones al ADN. Cuando ambos factores
estn incrementados, el resultado ser una mayor generacin de mutaciones o mutagnesis (y carcinognesis).
Un gen tiene un rango de mutacin normal, que se
expresa como el nmero de mutaciones nuevas por locus
por generacin; este rango es de aproximadamente 1 106
mutaciones por locus por generacin.
Las mutaciones ocurren con mucha frecuencia, constituyen la base de muchas enfermedades genticas y hereditarias, e incluso del cncer y de lo que se conoce como
variacin normal.

Todos los organismos estn sujetos a sufrir cambios en su


ADN debido al metabolismo propio o por efecto del medio
ambiente, lo que los hace presentar variabilidad gentica
dentro de una misma especie. Esta variabilidad se debe en
gran parte a los procesos evolutivos a travs del tiempo que
involucran mutaciones estables. Estas mutaciones pueden
ser heredables si suceden en clulas germinales o desaparecer cuando el individuo muere, si se presentan en clulas
somticas. Hugo de Vries, botnico alemn redescubridor
de Mendel, describi por primera vez la presencia de mutaciones en 1901. Posteriormente, Herman Joseph Muller
pudo relacionar la exposicin a los rayos X con el aumento
de la tasa de mutaciones.

www.fullengineeringbook.net
Clasicacin de las mutaciones

Las mutaciones pueden clasicarse desde diferentes enfoques. Pueden ocurrir tanto en los genes como en los cromosomas, en un tejido somtico o en un tejido germinal, lo
que dene una mutacin somtica y germinal, respectivamente.

Mutacin
Aun cuando los procesos de replicacin del material gentico son muy precisos, no son perfectos, por lo que pueden
producirse errores que generan cambios. Una mutacin es
una variacin espontnea o inducida del genoma, un cambio permanente y heredable en la secuencia del ADN, en
nucletidos, o bien en la disposicin del ADN en el genoma.
Estos cambios o mutaciones se deben a alteraciones de
la informacin gentica. Las consecuencias dependen
entonces del nivel de afectacin: desde cambios en la
secuencia nucleotdica, en los genes o los productos gnicos, hasta en los tipos celulares involucrados.
Todos los seres vivos cuentan con sistemas de vericacin y reparacin de los procesos celulares. En el caso de la
replicacin del ADN existen sistemas de reparacin especcos y bien coordinados, pero en ocasiones las lesiones del
ADN que escapan a esta vericacin sern las causantes de
ocasionar mutaciones; por lo tanto, la efectividad de la
lesin depender tanto de la tasa de divisin celular, como

Mutacin germinal
Es aquella que ocurre en la lnea germinal, las clulas sexuales (vulo y espermatozoide). Este tipo de mutaciones se
transmiten a la siguiente generacin si una clula mutada
participa en la fecundacin. Las mutaciones germinales no
daan al individuo en s mismo; esto es, un individuo con
un fenotipo normal y sin antecedentes familiares de alteraciones fenotpicas puede ser portador de clulas germinales
mutadas no detectadas, que slo se detectarn si se incorporan a un cigoto, de tal forma que al ser heredadas podran
desencadenar una enfermedad.

Mutacin somtica
Es aquella que ocurre en cualquier clula del cuerpo, excepto en las clulas germinales, por lo que no se transmiten a la
75

76

PARTE I Conceptos bsicos de biologa molecular

MUTACIN POR SUSTITUCIN DE BASE


SECUENCIA ORIGINAL
3

G A

T G

A C G A

U G

C U

Cis

U A C

Leu

U G C U

Arg

Cis

Leu

SECUENCIA MUTADA
3

C G A

G C

C G

U G
Cis

U U
Leu

A C

Arg

U G
Cis

C A

lle

Figura 8-1. Mutacin por sustitucin de un nucletido.

descendencia, slo a las clulas que se originen a partir de


sta, y desaparece al morir el individuo. Si la mutacin se
produce en un tejido cuyas clulas estn en divisin, existe
la posibilidad de que surja un clon mutante que descontrole
la clula de tal forma que se pueda desencadenar una neoplasia. En cambio, si la mutacin ocurre en una clula que
no volver a dividirse, entonces su efecto ser mnimo o
nulo (el mejor escenario posible).
Las mutaciones que se producen en los casos de cncer
ocurren en aquellos genes denominados protooncogenes y
genes supresores de tumores, que regulan la divisin celular. Si estos genes mutan se induce un estado de divisin
incontrolada que da lugar a un grupo de clulas denominadas tumor.
De acuerdo con la magnitud del material gentico afectado, las mutaciones suelen clasicarse en tres tipos: puntuales o gnicas, cromosmicas y genmicas.

mutacin puntual puede regresar a su secuencia original


mediante una mutacin compensatoria, por medio de un
fenmeno denominado reversin; es decir, la aparicin de
una segunda mutacin que restaura parcial o totalmente el
fenotipo normal. Las mutaciones puntuales no se detectan
con el microscopio, ya que el aspecto es igual en un cromosoma portador de una mutacin puntual que otro que porta
el alelo normal. Este tipo de mutaciones se detecta a nivel
molecular, mediante secuenciacin directa del fragmento
de ADN alterado, que permite detectar cambios en un solo
nucletido (vase el captulo 17, Secuenciacin).
A continuacin se presenta la clasicacin de las mutaciones puntuales.

Mutacin por sustitucin de bases


Se produce cuando en una secuencia de ADN se cambia un
nucletido por otro; por ejemplo, el cambio de un nucletido de citosina por uno de timina. En esta clasicacin se
incluyen las transversiones y transiciones mencionadas
anteriormente (gura 8-1).

Mutacin por prdida de nucletidos o delecin


Se produce cuando en una secuencia de ADN se pierde un
nucletido y no se sustituye por ningn otro, por lo que se
modica el marco de lectura abierto y, a partir de la mutacin, la secuencia de nucletidos (gura 8-2).

www.fullengineeringbook.net

Mutacin puntual o gnica


Ocurre en un par de bases o en un nmero reducido de
bases adyacentes y puede deberse a modicaciones qumicas del ADN que cambian una base nitrogenada por otra
diferente. La frecuencia con la que se ha descrito que suceden estas mutaciones es en el orden de 1 1010/par de
bases/divisin celular y 1 106/locus/generacin. De
acuerdo con las bases sustituidas, las mutaciones puntuales
pueden clasicarse en dos grupos: transicin (cambio de un
nucletido por otro de la misma clase; es decir, purina
por purina o pirimidina por pirimidina), y transversin
(cambio de un nucletido por otro de diferente clase; es
decir, purina por pirimidina o pirimidina por purina). Tambin pueden deberse a alteraciones durante el mecanismo
de replicacin del ADN, lo que provoca la incorporacin de
una base errnea en una cadena sencilla de ADN. Una

Mutacin por insercin de nucletidos

Se produce cuando en una secuencia de ADN se introducen


uno o ms nucletidos que no pertenecen a dicha secuencia
modicando el marco de lectura abierta alterando la
secuencias de aminocidos a partir del sitio de la mutacin
(gura 8-3).

MUTACIN POR DELECIN DE BASE


SECUENCIA ORIGINAL
3

G A

T G

A C G A

U G

C U

U A C

Cis

Leu

U G C U

Arg

Cis

Leu

SECUENCIA MUTADA
3

C G A

G C

C G

A U

U G
Cis

U U
Leu

A C

G
Arg

U G
Cis

Tir

Figura 8-2. Mutacin por delecin de un nucletido.

77

CAPTULO 8 Mutaciones

MUTACIN POR INSERCIN DE BASE

MUTACIN POR INVERSIN DE BASE

SECUENCIA ORIGINAL
3

G A

A C

U A C

U G

U A

U G

Cis

Leu

Arg

Cis

SECUENCIA ORIGINAL
3

G A

T G

A C G A

U G

C U

U A C

U G C U

Leu

Cis

Leu

SECUENCIA MUTADA
5

G A

A C

A T

Cis

U A C
Leu

G
Arg

Leu

U G
Cis

A U

A
3

U G

Cis

SECUENCIA MUTADA

Arg

C G A

G C

U G

Tir

U U A

Cis

Figura 8-3. Mutacin por insercin de un nucletido.

Leu

U G

Arg

Cis

A U
Tir

Figura 8-4. Mutacin por inversin de un nucletido.

Mutacin por translocacin de pares


de nucletidos complementarios

lo que propicia la terminacin prematura de un polipptido, y da como resultado una protena truncada (gura 8-6).

Se produce cuando en una secuencia se da un cambio de


una purina por otra purina o una pirimidina por otra pirimidina (en el caso de la transicin) o de purina a pirimidina,
o viceversa (en el de la transversin).
De acuerdo con el resultado en la secuencia de aminocidos de las protenas, las mutaciones puntuales pueden
ser:

Mutacin de desplazamiento de marco de lectura


Es aqulla en la que se aaden o eliminan (inserciones y
deleciones) un nmero determinado de bases diferente a
tres, por lo que a partir del punto de la mutacin, la lectura
del cdigo gentico se altera y propicia la adicin de aminocidos diferentes a los que estaban codicados originalmente (guras 8-1 y 8-2).

www.fullengineeringbook.net

Mutacin neutra
Es la que no tiene un efecto sobre el fenotipo, debido a que
el cambio en la secuencia de nucletidos genera tripletes
que codican para aminocidos equivalentes como, por
ejemplo, AAA (lis)AGA (arg); ambos, aminocidos bsicos. No hay tanta variacin en las cargas y posibles enlaces
en el pptido resultante, aunque por la diferencia en la
estructura del aminocido existirn ligeras variaciones en
la estructura y la conformacin nal de la protena, pero su
funcin an podra conservarse.

Mutacin de sentido equivocado


Es aquella en la que el cambio de codn que codica para
un aminocido da como resultado uno de familia, grupo o
MUTACIN SILENCIOSA
SECUENCIA ORIGINAL
3

Es aqulla en la que se cambia un codn que codica para


un aminocido por uno de terminacin (UAG, UAA, UGA),

T G

A C G A

T
3

U G

C U

Cis

U A C

Leu

U G C U

Arg

Cis

Leu

SECUENCIA MUTADA
3

C G A

U G

U G

U G

Mutacin sin sentido

G A

Mutacin silenciosa
Es aquella en la que, a pesar de que existe una alteracin en
la secuencia de nucletidos, no provoca cambios en el aminocido que codica. Esto sucede gracias a que el cdigo
gentico es degenerado y a que para algunos aminocidos
existe ms de un codn, por lo que los cambios en los codones no modican el resultado de la traduccin (vase el
captulo 6). (Figura 8-5).

Cis

U U A
Leu

G
Arg

Cis

Figura 8-5. Mutacin silenciosa.

Leu

78

PARTE I Conceptos bsicos de biologa molecular

MUTACIN SIN SENTIDO


SECUENCIA ORIGINAL

DELECIN CROMOSMICA

G A

T G

A C G A

U G

C U

U A C

Cis

Leu

U G C U

Arg

Cis

Leu

C G A

U G
Cis

U U A

Leu

G
Arg

U G

1
2
3

SECUENCIA MUTADA
A

1
2

G A

Cis CODN DE PARO

Figura 8-6. Mutacin sin sentido.

4
5

8
9

Figura 8-8. Delecin cromosmica.

polaridad diferentes que el original. El cambio en el pptido


s ser evidente y drstico en su estructura, y por ende, en
su funcin y actividad nal, e incluso puede inhabilitar la
protena.

se mediante anlisis al microscopia. Su clasicacin es la


siguiente:

www.fullengineeringbook.net

Mutacin cromosmica

Es aquella que involucra el reordenamiento cromosmico


resultado de un cambio en la organizacin de segmentos
cromosmicos, o la prdida o ganancia de cromosomas
completos, y provoca anomalas funcionales tanto celulares
como orgnicas. Este tipo de mutaciones pueden detectar-

INVERSIN CROMOSMICA

1
2

1
2

Figura 8-7. Inversin de un fragmento cromosmico.

Mutacin por inversin


de un fragmento cromosmico
Es aquella que ocurre cuando un segmento del cromosoma
se invierte en su orientacin dentro de ste, al dar un giro de
180, debido a una rotura doble. Un ejemplo de inversin
cromosmica es el sndrome de Ambras o hipertricosis
universal congnita, una variante del sndrome del hombre
lobo, que es una inversin en el cromosoma 8 (p11.2q23.1)
(gura 8-7).
Mutacin por delecin o prdida
de un fragmento cromosmico
Ocurre por la prdida de un fragmento de cromosoma en
uno o varios sitios y se asocia con la ganancia en otro cromosoma. Un ejemplo es el sndrome de Prader-Willi, una
enfermedad que cursa con deciencia mental, hiperglucemia diabtica e hipogenitalismo. Se trata de una delecininsercin en la regin (15q11q13) (gura 8-8).
Mutacin por duplicacin
de un fragmento cromosmico
En esta mutacin se produce una duplicacin de un fragmento cromosmico en uno o varios sitios de ste (gura
8-9).
Mutacin por translocacin
de un fragmento cromosmico
Se da por un cambio en la posicin de un fragmento cromosmico; es decir, existe intercambio de segmentos cro-

CAPTULO 8 Mutaciones

DUPLICACIN CROMOSMICA

TRANSLOCACIN CROMOSMICA

1
2

I
II

1
2

III

IV

VI

II

III

1
2

79

Figura 8-9. Duplicacin de un segmento cromosmico.

Figura 8-10. Translocacin de un segmento cromosmico.

mosmicos, ya sea en el mismo cromosoma, entre


cromosomas homlogos o bien entre cromosomas diferentes. Un ejemplo de translocacin es la que ocurre en aproximadamente 5% de los pacientes con sndrome de Down: la
ms frecuente es t(21q14q) (gura 8-10).

Mutaciones naturales o espontneas

Mutaciones genmicas

Mutaciones inducidas

Son aqullas en las que existe una segregacin cromosmica errnea; es decir, que afectan al nmero de cromosomas
o al genoma en su totalidad. Entre este tipo de mutaciones
se encuentran las siguientes:

Son aquellas provocadas por algn mutgeno (agente exgeno tanto f sico, qumico o biolgico con la capacidad de
provocar mutaciones en una tasa mayor a la basal).

Son aquellas que se producen en condiciones naturales de


crecimiento, inuidas por el medio ambiente. stas representan la base de la evolucin.

www.fullengineeringbook.net

Poliploida
En esta mutacin se produce un aumento en el nmero de
brazos en un cromosoma en particular, y se presentan como
triploidas (3n), tetraploidas (4n), etctera.
Haploida
En esta mutacin se encuentra una disminucin en el
nmero de brazos en un cromosoma.
Aneuploida
Es aquella en que se modica el nmero de copias de un
cromosoma; es decir, en lugar de haber dos copias de cada
tipo de cromosoma (lo normal), hay uno, tres o cuatro cromosomas (monosoma, trisoma y tetrasoma, respectivamente).

Origen de las mutaciones


Las mutaciones pueden deberse a causas naturales (espontneas) o inducidas.

Mutgeno
Un mutgeno es un agente que ocasiona que se incremente
la frecuencia en la que ocurren las mutaciones. Son sustancias o agentes que tienen la capacidad de ocasionar cambios
en el material gentico de las clulas vivas. La efectividad de
una sustancia con capacidad mutagnica se determina por
el aumento en la tasa de mutacin espontnea que provoca.
Se ha descrito que ms de la mitad de los carcingenos son
mutgenos.
La accin de los mutgenos debe entenderse por efecto
directo que producen sobre la molcula de ADN o por las
consecuencias que genera de forma indirecta, cuando se
rebasa la capacidad de los mecanismos de reparacin para
corregir este dao. Un ejemplo de esta accin es el caso de
los rayos ultravioleta, dado que con la exposicin se provoca la formacin de dmeros de timina, lo que no ocasiona
directamente la mutacin, sino que slo la induce, ya que la
mutacin puede generarse en los mecanismos de reparacin, al provocar alguna fractura nucleotdica o sustitucin
de bases (vase el captulo 9).

80

PARTE I Conceptos bsicos de biologa molecular

De acuerdo con su naturaleza, los mutgenos pueden


ser f sicos, qumicos o biolgicos.

Agentes f sicos: los agentes f sicos son radiaciones que


alteran la estructura y la secuencia del ADN. Ejemplos
de ello son: la radiacin ultravioleta, la radiacin ionizante, las partculas alfa, beta y gamma, el choque trmico o las radiaciones electromagnticas.
Agentes qumicos: compuestos que tienen la capacidad de alterar la estructura del ADN al reaccionar directamente con ella o intercalarse entre los nucletidos,
Ejemplos: los colorantes de acridina, la formalina, el
cido nitroso, agentes alquilantes, el benzopireno, el
cido brico, la colchicina, el LSD, la nicotina, el sulfato
de cobre o el cido frmico, entre otros.
Agentes biolgicos: son organismos que tienen la
capacidad de alterar la estructura del material gentico
de su hospedero, al integrarse al ADN de este ltimo,
los virus, las bacterias, los hongos, etctera.

Carcingenos
El cncer es un proceso gentico en el que una serie de
mutaciones en secuencia dirigen a la malignizacin de una
clula en divisin. Se desencadena como consecuencia de
mltiples mutaciones que provocan un crecimiento anormal de las clulas hasta convertirse en masas de tejido
conocidas como tumores o neoplasias.
El proceso inicia cuando se producen alteraciones irreversibles en la informacin gentica que convierten genes
normales en anormales (por ejemplo, protooncogenes en
oncogenes), capaces de inducir la iniciacin del tumor. Posteriormente, factores ambientales hacen que estas clulas
con informacin gentica alterada desarrollen ms mutaciones, y la acumulacin de mutaciones ocasiona que escapen a los mecanismos de reparacin y a las restricciones de
proliferacin, lo que las lleva a multiplicarse sin control.
Existen agentes que incrementan la frecuencia de las
mutaciones en los organismos expuestos. Estos agentes se
denominan carcingenos o cancergenos y pueden ser factores f sicos, qumicos o biolgicos.

tgeno, segn la etapa en la que se produjo la exposicin a


ste.
Los mecanismos conocidos o sugeridos de teratogenicidad son complejos, y se enumeran a continuacin:
Mutacin: cambios en la secuencia nucleotdica en el
ADN.
Aberraciones cromosmicas: alteraciones en la cantidad y estructura del ADN.
Interferencia mittica: trastorno en el ciclo celular.
Alteracin en la sntesis y funcin del ADN: trastornos en
los procesos de replicacin, transcripcin y traduccin.
Falta de precursores, sustratos y coenzimas para la biosntesis.
Alteraciones con las fuentes de energa: interferencia
con el ciclo del cido ctrico o con la terminal del sistema de transporte de electrones.
Inhibicin enzimtica.
Desequilibrio osmolar: alteraciones en la presin de los
uidos, viscosidades y presiones osmticas.
Caractersticas de la membrana alterada: desorganizacin
del transporte a travs de la membrana y su permeabilidad.
Otros mecanismos: se ha sugerido una gran cantidad de
posibles mecanismos de los que se dispone de escasas
pruebas cientcas.
En la organognesis, los teratgenos alteran el desarrollo y pueden producir anomalas congnitas mayores. En el
periodo fetal, pueden causar anormalidades morfolgicas y
funcionales, en particular en el cerebro y los ojos.

www.fullengineeringbook.net

Teratgenos
Existen agentes qumicos presentes en el ambiente con
capacidad de causar dao al ser humano durante el periodo
de vida perinatal denominados teratgenos. Estos compuestos pueden producir efectos adversos, tanto siolgicos
como bioqumicos, en cualquiera de las etapas del desarrollo, y con frecuencia causan muerte en el tero, abortos,
prematurez e intoxicaciones neonatales, entre otros daos.
En particular, los teratgenos (del griego, teratos,
monstruo, y gnesis, produccin) son agentes qumicos
que, si actan cuando tiene lugar la embriognesis, intereren en el desarrollo normal del embrin, de lo que
resultan diversas malformaciones orgnicas. En ocasiones, un mismo compuesto acta como txico y como tera-

Polimorsmos
La presencia de formas allicas diferentes o polimorsmos,
sin ser propiamente una mutacin, ya que muchos loci se
caracterizan por tener cierto nmero de alelos comunes que
permiten caracterizar a una poblacin respecto a fenotipos distintos, es otra situacin en la que puede haber variacin o diversidad gentica. Esta gran diversidad existente
entre los miembros de una poblacin da como resultado el
hecho de que estos individuos puedan sintetizar protenas o
enzimas modicadas, que en ocasiones pueden estar asociadas tambin a susceptibilidades para padecer alguna enfermedad. Cada individuo cuenta con una constitucin nica
genticamente determinada que le permite responder de
manera diferente a la inuencia ambiental, farmacolgica y
de la dieta. Esta individualidad es la base para la medicina
del futuro, desde un punto de vista gentico.

Polimorsmos de un solo nucletido


Existen polimorsmos de un solo nucletido (single nucleotide polymorphisms, SNP), que pueden deberse a la sustitucin de un nucletido por otro, la delecin de un nuclotido
o la insercin de un nucletido en la secuencia de ADN.
Aunque existe modicacin del triplete por alteracin en la
secuencia de nucletidos, slo en algunos casos cambia en
el aminocido que se codica.

CAPTULO 8 Mutaciones

Microsatlites
En el genoma existen regiones con repeticiones de secuencias de 9 a 100 pares de bases conocidas como variable
number of tandem repeats (VNTR), que se utilizan como

81

marcadores moleculares. Las repeticiones de secuencia las


cuales oscilan entre 2 a 9 pares de bases son conocidas
como short tandem repeats (STR).

Preguntas de repaso
1. Explique por qu las mutaciones por insercin o por delecin modican el marco de lectura abierto.
2. Cul es la diferencia entre mutacin y polimorsmo?
3. Explique por qu en clulas germinales una mutacin se
transmite a la descendencia y en clulas somticas no.

4. Qu importancia tienen las mutaciones en la evolucin


de los organismos?
5. Cul es el origen de las mutaciones?

Bibliografa
Alberts B., Johnson A., Lewis J., Raff M., Roberts K., Walter P. Bio-

loga molecular de la clula, 4 ed. Barcelona: Omega, 2004:192234.


Bishop J.B., Witt Kolog, Sloane R.A. Genetic toxicities of human
teratogens. Mutat Res, 1997;396:9-43.
Ferguson L.R., Ford J.H. Overlap between mutagens and teratogens.
Mutat Res, 1997;396:1-8.
Grifths A, Miller J, Suzuki D, Lewontin R, Gelbart W. Gentica, 7
ed. Madrid: McGraw-Hill, 2002:250-320.
Lewin B. Genes IX. Sudbury, MA: Jones & Bartlett Publishers,
2007;545-572.
Lewin B. Genes VI. Nueva York: Oxford University Press, 2000:490590.
Montoya-Cabrera M.A. Toxicologa clnica. Mxico, DF: Ed Francisco
Mndez Cervantes, 1992:225-350.

Moore K.L., Persaud T.V.N. Embriologa clnica. Mxico, DF:

McGraw-Hill Interamericana, 1999:290-320.


Shepard T.H. Catalog of teratogenic agents, 10 ed. Baltimore, Lon-

dres: The Johns-Hopkins University Press, 2001:215-310.


Suzuki D.J., Grifths A.J.F., Miller J.H., Lewontin R.C. Gentica, 4

ed. Madrid: McGraw-Hill Interamericana, 1992:322-430.


Thompson MW, McInnes R.R., Willard H.F. Gentica en medicina, 4

www.fullengineeringbook.net

ed. Barcelona: Thompson & Thompson, Masson, 1996:340-420.

Watson J., Baker T., Bell S., Gann A., Levine M., Losick R. Biolo-

ga molecular del gen, 5 ed. Madrid: Mdica Panamericana,


2006:422-513.

Captulo

Mecanismos de reparacin del ADN


Mayra Guadalupe Mena Enrquez / Luca Flores Contreras
Ana Soledad Sandoval Rodrguez / Juan Armendriz Borunda

Introduccin

se producen en el ADN de forma espontnea. La desaminacin consiste en la prdida de grupos amino. En condiciones normales la desaminacin de la citosina produce
uracilo, base nitrogenada que no forma parte del ADN; esta
base se aparea preferentemente con la adenina en lugar de
hacerlo con la guanina, produciendo as la conversin de un
par de GC en un par de AT (gura 9-1A).
La depurinizacin consiste en la eliminacin del enlace
N-glucosdico entre la base nitrogenada y el azcar, con la
consiguiente prdida de un residuo de adenina o guanina.
Como consecuencia aparecen sitios apurnicos en el ADN
que conducen a un dao gentico importante, ya que durante la replicacin estos sitios no pueden unir una base complementaria a la purina original perdindose un nucletido
en la cadena de ADN recin sintetizada.
En todos los seres vivos el metabolismo normal aerobio
produce especies reactivas de oxgeno como los radicales
superxido (O2), perxido de hidrgeno (H2O2) y radicales
hidroxilo, molculas que causan daos oxidativos en el
ADN. Las principales alteraciones que originan estos radicales libres son la formacin de una 8-oxo guanosina y el
glicol de timina que bloquean la replicacin del ADN si no
se reparan (gura 9-1B).
Agentes alquilantes. Aaden grupos alquilo (etilo o
metilo) a las bases nitrogenadas y alteran su patrn de apareamiento bloqueando la replicacin. Uno de los sitios ms
propensos a la alquilacin es el oxgeno del carbono 6 de la
guanina formndose O6-metilguanina, que se aparea de
modo incorrecto con la timina, provocando transiciones
de un par de bases GC por un par AT.
Agentes intercalantes. Son compuestos que se intercalan entre los nucletidos del ADN y producen adiciones
de un solo par de nucletidos. Entre los componentes qumicos intercalantes se encuentran la proavina, la acridina
y el etidio. Cuando estas adiciones se producen en un gen,
puede producirse consecuencias importantes en la traduc-

El ADN est expuesto constantemente a agentes f sicos,


qumicos o biolgicos que pueden originar mutaciones y
alterar la informacin gentica del individuo. Las modicaciones en el ADN pueden surgir por molculas o mecanismos endgenos del metabolismo celular, errores en el
proceso de la replicacin del ADN, ciertas infecciones virales e incluso por factores ambientales como la luz ultravioleta, agentes qumicos o la radiacin ionizante. Estos factores
intereren en procesos como la transcripcin y la replicacin, e inclusive pueden provocar un descontrol en la divisin celular. La variabilidad gentica tambin es necesaria
para proporcionar adaptabilidad a las especies al cambiante
medio ambiente; no obstante, cierta informacin gentica
es crucial y su modicacin sera incompatible con la supervivencia del organismo. Para preservar la informacin gentica lo ms elmente posible el organismo dispone de
mecanismos complejos de reparacin del ADN. En la mayora de las ocasiones los cambios en el ADN no se maniestan con cambios fenotpicos y no presentan efectos adversos
en el organismo; pero algunas mutaciones s pueden llegar a
ser fatdicas, por lo que su persistencia se trata de evitar
mediante mecanismos de reparacin que implican complejos sistemas enzimticos que buscan corregir las mutaciones. Varias enfermedades humanas, conocidas como
sndromes de inestabilidad cromosmica, y ciertos tipos
de cnceres estn relacionados con fallas en los sistemas de
reparacin del ADN.

www.fullengineeringbook.net

Tipos de dao en el ADN


Las lesiones en el ADN pueden ocurrir espontneamente o
pueden estar causadas por la exposicin a agentes mutagnicos. La desaminacin, la depurinizacin y el dao oxidativo de las bases nitrogenadas son algunos de los daos que
82

83

CAPTULO 9 Mecanismos de reparacin del ADN

A)

A)
H

H
Br

O.... H

O
N

Desaminacin

Adenina

5-BU en forma
cetnica

Uracilo

Citosina

H.... N

B)
O
HN

3
2

O
CH3
6

B)
NH

HN

O-

Br

OH

7
1
N

OH

dR
Glicol de timidina

NH2

dR
8-Oxo-hidroxiguanosina
(8-Oxo-G)

N.... H
N
O.... H

Figura 9-1. Desaminacin y dao oxidativo de las bases.


5-BU en forma
cetnica

cin de su ARNm, ya que altera la secuencia codicadora


en su marco de lectura correcto.
Anlogos de bases. Son compuestos qumicos con
estructura similar a la de las bases nitrogenadas normales y
se pueden incorporar al ADN en lugar de stas. Debido a
que los anlogos de bases presentan diferencias estructurales con las bases convencionales, se aparean de forma incorrecta, lo que provoca errores frecuentes en el proceso de
replicacin. El 5-bromouracilo (5BrU) es anlogo de la timina que contiene un bromo en el carbono 5. En su forma
cetnica, el 5BrU forma un par de base con la adenina,
mientras que en su forma enlica lo hace con la guanina. Si
se incorpora la forma cetnica del bromouracilo, se produce
una transicin AT-GC y si se incorpora la forma enlica
se produce una transicin GC-AT (gura 9-2).
Energa ionizante. La exposicin del ADN a la luz
ultravioleta (UV) produce dmeros de pirimidinas, sobre
todo de timinas, cuando hay dos timinas consecutivas en la
misma cadena de ADN. La luz UV produce que se formen
enlaces covalentes entre dos pirimidinas contiguas, lo que
interere con la unin normal de las bases nitrogenadas con
la cadena complementaria. La radiacin UV induce tambin
transiciones GCAT, transversiones, mutaciones con cambio de marco de lectura, duplicaciones y deleciones (vase el
captulo 8). La radiacin ionizante produce dao directo en
las bases nitrogenadas del ADN e induce la gene-racin de
especies reactivas de oxgeno. Adems, produce roturas del
enlace N-glucosdico que conducen a la formacin de sitios
apurnicos, as como rompimientos en la doble cadena del
ADN, responsables de efectos letales en la clula. Estas lesiones ocasionan cambios permanentes en el ADN que pue-

N
H

Guanina

Figura 9-2. Anlogos de bases.

www.fullengineeringbook.net

den alterar la secuencia codicadora o reguladora de un gen


e impedir el uso del ADN como plantilla para la replicacin
y transcripcin.

Sistemas de reparacin del ADN


Para minimizar el dao del material gentico el organismo
dispone de diversos sistemas de reparacin que se activan
dependiendo del tipo de dao provocado en el genoma.
Estos mecanismos de reparacin se pueden clasicar en
cuatro categoras: reparacin directa, reparacin por escisin, reparacin de emparejamientos errneos (apareamientos incorrectos) y reparacin de roturas de doble
cadena.

Reparacin directa
La reparacin directa involucra sistemas que eliminan
directamente el dao en el ADN inmediatamente despus
de producidos. Este tipo de reparacin no es muy comn,
ya que hay algunos daos en el ADN irreversibles. La fotorreactivacin es el mecanismo de organismos procariotes
mediante la enzima fotoliasa para reconocer los dmeros de
pirimidinas producidos por la luz UV. Esta enzima se une al
dmero de timina y utiliza la energa de la luz para romper
los enlaces covalentes entre las pirimidinas, con lo que logra
que vuelvan a formar complementariedad con la cadena
antiparalela (gura 9-3). Otro tipo de enzimas que partici-

84

PARTE I Conceptos bsicos de biologa molecular

Dmero de T

Luz UV

C A

A C

C A

Fotoliasa

A C

G T

G T

G C

G T

G C

C A

C A

A C

T C A

G C

G T

Figura 9-3. Reparacin de dmeros de timina.

pan en este sistema de reparacin son las alquiltransferasas,


enzimas que eliminan los grupos alquilos de la guanina y
restauran la estructura original, sin la necesidad de alterar el
esqueleto del ADN.

Sistemas de reparacin por escisin:


reparacin por escisin de bases y
reparacin por escisin de nucletidos

UvrA y UvrB se unen para formar un complejo que se


encarga de reconocer las distorsiones en la cadena de ADN.
Una vez que localizan el dao, UvrA se disocia del complejo;
UvrB separa la doble cadena de ADN; a continuacin, UvrC
se une a UvrB, y el complejo corta a siete nucletidos de

Reparacin por escisin de bases


El sistema de reparacin por escisin de bases (base excision
repair, BER) elimina del genoma las bases daadas que se
producen por alquilacin, radiacin ionizante, oxidacin
y desaminacin. En este sistema intervienen las enzimas
denominadas ADN glucosilasas, de las cuales existen por lo
menos ocho tipos distintos especcos para cada lesin. La
reparacin se realiza hidrolizando el enlace glucosdico
entre la base nitrogenada y el azcar, con lo que se elimina la
base daada. Esta rotura genera sitios apurnicos o apirimidnicos reconocidos por una AP endonucleasa 1 (APE-1)
que rompe el enlace fosfodister adyacente. Posteriormente,
la ADN polimerasa adiciona los nucletidos para rellenar
el hueco generado empleando la cadena que no est daada
como molde. El fragmento recin sintetizado forma el enlace fosfodister faltante para su ligacin gracias a la ligasa
(gura 9-4).

www.fullengineeringbook.net

Reparacin por escisin de nucletidos


El sistema de reparacin por escisin de nucletidos
(nucleotide excision repair, NER) reconoce cualquier lesin
que provoque una distorsin importante en la doble cadena
del ADN. Implica en primer lugar el reconocimiento del
dao en la secuencia del ADN; posteriormente, una endonucleasa hidroliza los enlaces fosfodister a cada lado y
varios pares de bases de distancia de la lesin, y se elimina
el fragmento de ADN de cadena sencilla que presenta la
lesin. El hueco que se genera por la rotura se rellena con
ayuda de la ADN polimerasa I y, por ltimo, la ligasa sella la
cadena que se sintetiza. Defectos en las protenas de este
sistema provocan el sndrome xeroderma pigmentosa (XP).
En Escherichia coli esta reparacin la llevan a cabo cuatro protenas: UvrA, UvrB, UvrC y UvrD (UV resistant).

La glucosilasa elimina
la base daada

La endonucleasa corta el ADN


y la exonucleasa elimina los
nucletidos

La polimerasa I rellena el hueco


generado y se liga el fragmento

Figura 9-4. Reparacin por escisin de bases.

CAPTULO 9 Mecanismos de reparacin del ADN

C T A G T T G C A C G

T T

O
d e xid
la aci
gu n
an
in
a

Distorsin en el ADN

C T A G A C G

G A C T G A

G A C T G A

G A T C A A C G T G C A A G A T C T G C
3

C T G A C T

C T G A A T

85

La glucosilasa
restaura la base
incorrecta
G A C T G A
C T G A C T

Unin con la adenina


UvrB

UvrA
5

C T A G T T G C A C G

T T

Figura 9-6. Sistema de reparacin GO.

C T A G A C G

G A T C A A C G T G C A A G A T C T G C
3

Sistema de reparacin de los


apareamientos errneos

Realizan corte
UvrB

UvrC
5

C T A G T T G C A C G

T T

C T A G A C G

G A T C A A C G T G C A A G A T C T G C
3

Liberan nucletidos

C A C G

T T

C T A

C T A G T T G

G A C G

G A T C A A C G T G C A A G A T C T G C
3

ADN polimerasa y ligasa


rellenan hueco

Este sistema se basa en la reparacin de las bases mal apareadas y la correccin de los bucles que se producen en la
cadena de ADN como consecuencia del deslizamiento de
la polimerasa durante la replicacin. El ejemplo ms clsico
de este sistema de reparacin es el que utiliza E. coli, en el
que participan tres protenas: MutS, MutL y MutH. La protena MutS reconoce las bases mal apareadas y se une a
ellas; MutL permitir que se forme el complejo de reparacin y, a su vez, activar MutH, con actividad de endonucleasa; adems producir la rotura de la cadena donde se
localiza la base mal apareada, y MutH tiene la capacidad de
discriminar la cadena que se tiene que reparar por el fenmeno de hemimetilacin. La enzima Dam metilasa (ADN
adenine methylation) se encarga de la metilacin de la
secuencia 5-GATC-3 en las dos cadenas, por lo que despus de que ocurra la replicacin del ADN, la nica cadena
metilada ser la parental, mientras que la cadena de nueva
sntesis no estar metilada y se reconocer como la cadena
que se ha de reparar. Una vez que se elimina el segmento
con la base mal apareada, la polimerasa III aade la base
correcta (gura 9-7). Este sistema de reparacin tambin
puede encontrarse en clulas eucariotas, donde participan
dos protenas: la MSH y MLH, anlogos de MutS y MutL,
respectivamente. Un defecto en este sistema provoca inestabilidad cromosmica asociada a enfermedades como el
cncer de colon.

www.fullengineeringbook.net

C T A G T T G C A C G T T C T A G A C G

G A T C A A C G T G C A A G A T C T G C

Figura 9-5. Reparacin por escisin de nucletidos.

distancia en direccin 5 y cuatro en direccin 3 del sitio de


la lesin. Posteriormente, UvrD, una helicasa, ayuda a liberar el fragmento y, por accin de la ADN polimerasa I y la
ligasa, se rellena el hueco generado con el corte (gura 9-5).

Sistema 8-oxo guanina


La radiacin UV, la radiacin ionizante y algunos agentes
qumicos pueden provocar que las bases del ADN se oxiden. Una base muy susceptible de oxidacin por especies
reactivas de oxgeno (ROS) es la guanina, que como consecuencia se transforma en 8-oxo guanina (GO) u 8-hidroxiguanina, que en lugar de unirse a la citosina se unir a una
adenina y producir un par errneo G-A. Este error ocasionar, despus de la replicacin, una sustitucin de C por A
en el genoma, error que si no se repara se transmitir a la
siguiente generacin como un cambio permanente.
En humanos, una enzima llamada ADN OGG1 reconoce a la adenina unida con la GO, elimina la base incorrecta
(adenina) y la sustituye por la citosina correcta (gura 9-6).
Las enzimas participantes en este sistema en procariotes
son mutM y mutY (metil-directed mismatch repair).

Sistema SOS
Este sistema responde a la acumulacin de ADN de cadena
sencilla cuando el proceso de replicacin se bloquea. Est
integrado por ms de 40 genes, que son activados por la
protena RecA (recombination protein A) en procariotes.
En ausencia de dao, los genes SOS (save our soul) se
encuentran unidos a su represor LexA. El ADN de cadena
sencilla es una seal de activacin para la protena RecA
que se une al ADN de cadena sencilla (ADNss) e interacta
con el represor LexA, lo que facilita su autoprotelisis; esto
induce la transcripcin de los genes que contienen la caja
SOS (gura 9-8). Con ello, aumentan los niveles de las protenas lexA, recA, UvrA, UvrB y UvrD. Por tanto, el primer
mecanismo de reparacin que se activa en respuesta a SOS

86

PARTE I Conceptos bsicos de biologa molecular

La protena MutS reconoce la base mal


apareada, se une la MutL que activa a
MutH para que corte en los sitios
GATC de la cadena hija
5 cadena hija

C
3 cadena molde

(Metilada)
Eliminacin de la base mal apareada y
la polimerasa aade la base correcta

G
5 cadena hija

C
3 cadena molde

La Dam metilasa, metila


ambas cadenas
5 cadena hija

www.fullengineeringbook.net
G

3 cadena molde

Figura 9-7. Reparacin de los apareamientos errneos.

es la reparacin por escisin de nucletidos (NER), que tratar de corregir el dao sin un encendido total de la va
SOS. Si el sistema NER no es suciente para la reparacin
del ADN, las concentraciones de LexA disminuyen y se
expresan genes como sulA, umuD y umuC (UV-induced
mutagenesis). La protena SulA se une a FtsZ (molcula indispensable para el inicio del ciclo celular) y detiene la divisin
celular. Con ello, se induce al sistema de reparacin UmuDC dependiente de mutagnicos.

Reparacin de roturas de doble cadena


Reparacin por recombinacin homloga
Es un sistema de reparacin preciso que acta durante la
fase S del ciclo celular. Durante el proceso de replicacin,
este sistema se induce por la necesidad de tener una copia
de ADN correcta que sirva como molde para restaurar la
informacin perdida en la cadena daada. En este sistema
de reparacin estn involucrados los genes que pertenecen
al grupo de epistasia de RAD52 (radiation sensitive mutant
52), como RAD50, RAD51, RAD52, RAD55, RAD57,
RAD59 y el complejo MRN formado por MRE11 (meitoic

recombination 11), RAD50 y NBS1 (Nijmegen breakage syndrome 1). Adems, intervienen otros genes, como BRCA1 y
BRCA2 (cncer de mama 1 y 2). En humanos, RAD51 desempea un papel primordial en los mecanismos de recombinacin homloga para la reparacin de roturas en la doble
cadena del ADN. La recombinacin homloga implica gasto e hidrolisis de adenosn trifosfato (ATP) para el intercambio de la cadena de ADN, por secuencias homlogas. El
primer paso para la reparacin por recombinacin homloga involucra la activacin del gen de la ataxia-telangiectasia
mutado (ataxia telangiectasia mutated, ATM) que recluta
el complejo MRN para que se una al ADN y, por su actividad de exonucleasa 5-3, procesa los extremos donde ocurri el dao dejando expuestos los extremos 3 en forma de
cadena sencilla. A continuacin, la protena de replicacin
A (RPA) se une al ADN de cadena sencilla e interacta con
RAD52; ste es desplazado por BRCA2, que atrae a RAD51.
Por ltimo, RAD51 se une a la cadena sencilla y forma una
nucleoprotena lamentosa con el ADN. Con ayuda de
RAD54 invade la hlice homloga que sirve como molde
para restaurar el fragmento daado (gura 9-9). Alteraciones en las protenas que participan en este sistema provo-

CAPTULO 9 Mecanismos de reparacin del ADN

ADN
polimerasa

G A

Se bloquea la replicacin
del ADN
A

A G

Inicia la respuesta SOS

G A

proteinas RecA

los mecanismos de reparacin tienden a fallar con ms frecuencia. Sin embargo, tambin existen sndromes de inestabilidad cromosmica cuyo patrn de herencia es autosmico
recesivo, caracterizados por una alta frecuencia de alteraciones cromosmicas en edades tempranas. Estas enfermedades implican defectos en los mecanismos de reparacin
del ADN. Los sndromes clsicos de inestabilidad cromosmica son: sndrome de Bloom, anemia de Fanconi, ataxiatelangiectasia, xeroderma pigmentoso, los cuales presentan
anormalidades estructurales de los cromosomas, como
roturas, puentes intercromosmicos, ttradas, entre otras.
La expresin clnica de cada una de estas entidades es variable y se observa un incremento en la frecuencia de neoplasias.

Sndrome de Bloom

Se activan las protenas


RecA

C C

A A

G A

A G G

87

Repara
el ADN

Figura 9-8. Sistema SOS.

Presenta caractersticas clnicas, como eritema telangiectsico en la cara, antebrazos y el dorso de las manos, fotosensibilidad, enanismo, manchas caf con leche, alteraciones
esquelticas y neoplasias. A nivel celular se presentan intercambios entre cromtidas hermanas, roturas cromosmicas y reordenamientos. Las clulas son hipersensibles a la
luz UV, la hidroxiurea (HU) y agentes alquilantes. El sndrome de Bloom lo causan mutaciones en el gen BLM, que
codica una protena de la subfamilia RecQ de las ADN
helicasas dependientes de ATP. Estas protenas participan
en la reparacin, replicacin y reparacin por recombinacin homloga. BLM es un miembro del complejo BASC y
contiene otros miembros que participan en los procesos de
reparacin, replicacin y recombinacin, como PCNA,
RAD51, BRCA1, ATM y el complejo MRN. Tambin acta
en la respuesta temprana al dao celular y promueve el posterior reclutamiento de protenas de reparacin en las horquillas de replicacin.

www.fullengineeringbook.net

can el sndrome de Bloom, la ataxia-telangiectasia y la


anemia de Fanconi, que se describirn ms adelante.

Unin de extremos no homlogos


Este sistema es uno de los que pueden participar cuando se
producen roturas en la doble cadena de ADN. El componente principal de este sistema es la protena de cinasa
dependiente de ADN (ADN-PKcs), que consta de tres
subunidades: KU70, KU80 y la subunidad cataltica ADNPKcs. Estas subunidades reconocen los cortes en el ADN y
mantienen los extremos en proximidad para su procesamiento y reunin. Para que se lleve a cabo el alineamiento
de los extremos es necesario el complejo ARTEMIS/ADNPKcs, con actividad de nucleasa y el complejo XRCC4/ligasaIV, que se encarga del paso nal de la ligacin (gura
9-10). Este proceso puede tener varios errores, ya que nicamente une los extremos rotos, lo que conlleva la prdida
de nucletidos en el punto de unin. Este proceso se lleva a
cabo principalmente en mamferos; sin embargo, tambin
se ha encontrado en algunas procariotas, lo que sugiere que
est muy conservado evolutivamente.

Enfermedades humanas asociadas


al funcionamiento de los sistemas
de reparacin
Muchas de las anomalas cromosmicas que generan enfermedades en la especie humana aumentan con la edad, pues

Anemia de Fanconi
Es una enfermedad gentica autosmica recesiva ligada al
sexo, caracterizada por un conjunto de malformaciones
congnitas, aplasia medular progresiva, con una prevalencia de 80%, y predisposicin tumoral ms de 60% de los
cnceres son hematolgicos. Entre las alteraciones ms
frecuentes destacan la baja estatura, anomalas esquelticas en antebrazos, dedos, cadera y rodillas, malformaciones renales y cardiacas, manchas caf con leche,
microcefalia, retraso mental leve e hipogonadismo en
varones. La prevalencia de la anemia de Fanconi es de 1 a 5
nacimientos por cada milln de habitantes y se encuentra
con una frecuencia de 0.3 a 1%, aunque estas cifras dependen del grupo tnico de que se trate as como del grado de
consanguinidad.
La anemia de Fanconi es una enfermedad con heterogeneidad no slo clnica sino tambin gentica. Existen al
menos 11 genes diferentes involucrados en la FA (FANCA,
FANCB, FANCC, FANCD o BRCA2, FANCD2, FANCE,

88

PARTE I Conceptos bsicos de biologa molecular

C G

A C

A G

A G

C T

T
5

Doble cadena de ADN

A C

G T

G T

A T

T G

A T

C A

C G

A G

C G

A G

A C

T G

A T

G T

T
G

A T

C G

A G

C
5

A C

C T G

A G

C G

C G

T G

A T

A G

T
A

A
T

C G

A G

Recombinacin homloga

www.fullengineeringbook.net
5

A C G

C G

C G

C T G

A T

A T G

A G

C G

3
5

T G

T A

T G

C G

C G

A G

A T

Reparacin del fragmento


daado

A A

T G

A T

A G

C G

A G

C
5

Figura 9-9. Reparacin por recombinacin homloga.

FANCF, FANCG, FANCI, FANCJ, FANCL). Los defectos en


cualquiera de los genes de anemia de Fanconi conllevan
inestabilidad genmica y un riesgo elevado de presentar
leucemias y carcinomas. El descubrimiento de BRCA2
como uno de los genes de la anemia de Fanconi fortalece el
papel de esta enfermedad en el procesamiento de roturas de
doble cadena mediante recombinacin homloga.

Ataxia-telangiectasia
Es un sndrome gentico con un complejo fenotipo clnico.
Las principales caractersticas clnicas son degeneracin

neuronal progresiva, telangiectasia ocular, inmunodeciencia, hipogonadismo, envejecimiento prematuro, inestabilidad genmica y predisposicin al cncer. A nivel celular, se
presenta inestabilidad cromosmica, hipersensibilidad a las
radiaciones, defectos en los puntos de control del ciclo celular, acortamiento telomrico y alto nivel de especies reactivas de oxgeno.
La ataxia-telangiectasia es causada por defectos en el
gen supresor de tumor ATM. En respuesta a las roturas de
doble cadena, ATM fosforila rpidamente una serie de protenas involucradas en vas de sealizacin, como p53 o

CAPTULO 9 Mecanismos de reparacin del ADN

89

Ruptura de ADN

Se une KU70/80

C
5

KU recluta a
ADN-PKcs
3

Finalmente Xrcc4/ligasa IV
unen los extremos

www.fullengineeringbook.net
5

ADN reparado

Figura 9-10. Unin de extremos no homlogos.

Mdm2, as como otras protenas de reparacin, como


RAD50-MRE11-NBS1 y BRCA1, relacionadas con sndromes de inestabilidad cromosmica.

Xeroderma pigmentoso
Es una enfermedad cutnea multignica caracterizada por
una elevada sensibilidad a todas las fuentes de radiacin
UV. Las personas afectadas presentan envejecimiento prematuro, lesiones oculares, trastornos neurolgicos y una

elevada predisposicin a desarrollar cncer de piel. El xeroderma pigmentoso es causado por defectos en uno o varios
de los ocho genes XPA-XPG, ms una variante, XPV; por lo
tanto, existen nueve subtipos clnicos de la enfermedad, que
incluyen varias manifestaciones cutneas y neurolgicas.
Estos genes codican para las protenas que participan en
los mecanismos de reparacin NER, por lo que las mutaciones en los genes XPA-XPG son las responsables de la inestabilidad genmica presente en los pacientes con xeroderma
pigmentoso.

90

PARTE I Conceptos bsicos de biologa molecular

Ejercicios de integracin
1. Relacione el sistema de reparacin con el tipo de lesin que repara.

Sistema SOS

Roturas de doble cadena.

Reparacin directa

Daos que involucran una sola base.

Reparacin de apareamientos errneos

Daos por acumulacin de ADN de cadena sencilla.

Recombinacin homloga

Dmeros de timina.

Reparacin por escisin de bases (BER)

Bases mal apareadas.

2. Mencione los agentes fsicos y qumicos que producen daos en el ADN.

3. Relacione el sistema de reparacin con las enzimas que participan.

Sistema SOS

ADN glucosilasas

Reparacin directa

Sistema UvrA, B, C, D

Reparacin por escisin de nucletidos (NER)

RAD51,-52-54, RPA, BRCA2

Recombinacin homloga

LexA y RecA

Reparacin por escisin de bases (BER)

Fotolipasa

www.fullengineeringbook.net

4. El xeroderma pigmentoso est causado por defectos en


las protenas que participan en el sistema de reparacin:
a) BER
b) NER
c) Sistema SOS
d) Recombinacin homloga

5. Alteraciones en las protenas que participan en el sistema


por recombinacin homloga provocan:
a) Sndrome de Bloom
b) Sndrome de Down
c) Xeroderma pigmentoso
d) Ninguna de las anteriores

Bibliografa
Alberts B., Johnson A., Lewis J., Raff M., Roberts K., Walter P. Bio-

Rastogi R.P., Richa, Kumar A., Tyagi M.B., Sinha R.P. Molecular

loga molecular de la clula, 4 ed. Barcelona: Omega, 2004.


Grifths A., Miller J., Suzuki D., Lewontin R., Gelbart W. Gentica,
7 ed. Madrid: McGraw-Hill, 2002.
Janion C. Inducible SOS response system of DNA repair and mutagenesis in Escherichia coli. Int J Biol Sci, 2008;4:338-344.
Lewin B. Genes IX. Sudbury: Jones & Bartlett Publishers, 2007.
Martn A.L. Programa de actualizacin continua para mdicos
generales. Academia Nacional de Medicina, 2 ed. Mxico, DF:
Intersistemas, 1999.

mechanisms of ultraviolet radiation-induced DNA damage and


repair. J Nucleic Acids, 2010;2010:592980.
Watson J., Baker T., Bell S., Gann A., Levine M., Losick R. Biologa
molecular del gen, 5 ed. Madrid: Mdica Panamericana, 2006.

www.fullengineeringbook.net

Parte II

Metodologa del ADN


recombinante
Contenido
Captulo 10
Captulo 11
Captulo 12
Captulo 13
Captulo 14
Captulo 15
Captulo 16
Captulo 17
Captulo 18

Manejo de muestras para estudios moleculares


Extraccin de cidos nucleicos
Electroforesis
Enzimas de restriccin
Vectores de clonacin y expresin
Tcnicas de hibridacin
Reaccin en cadena de la polimerasa
Secuenciacin de cidos nucleicos y microarreglos
Polimorsmos y huellas de ADN

www.fullengineeringbook.net

10

Captulo

Manejo de muestras para


estudios moleculares
Jess Javier Garca Bauelos / Blanca Estela Bastidas Ramrez
Elizabeth Gordillo Bastidas / Daniela Gordillo Bastidas

Introduccin

dologa utilizada, bien sea simple o sosticada, econmica o


costosa, no ser conable si no se parte de una muestra
manejada de forma adecuada. En general el personal encargado de la toma, el transporte y del procesamiento de la
muestra no es el mismo, por lo que es importante que cada
uno de los implicados en el proceso conozca los cuidados y
las consideraciones necesarios para evitar resultados errneos. El manejo de muestras implica tres pasos fundamentales: seleccin, toma y preservacin de la muestra.

Los estudios de biologa molecular o tecnologa del ADN


recombinante incluyen los anlisis en que el material de inters son los cidos nucleicos: ADN y ARN. El conocimiento
de las caractersticas y propiedades de estas dos biomolculas ha permitido la implementacin de tcnicas utilizadas en
investigacin y en la prctica mdica. Estas metodologas se
aplican con diversos nes, como la identicacin de individuos, el monitoreo de tratamientos, el establecimiento de
diagnsticos, la deteccin de bacterias y virus, la determinacin de carga viral, y el estudio de mutaciones y polimorsmos gnicos, entre otros.
El anlisis molecular constituye una herramienta indispensable en el rea de ciencias de la salud y establece diagnsticos, pronsticos y tratamientos certeros, especcos y
actuales. Asimismo, estos anlisis permiten profundizar en
el conocimiento de los mecanismos normales y las alteraciones de los procesos celulares que participan en el desarrollo
de una enfermedad, as como proponer nuevas alternativas
teraputicas y preventivas.
Este captulo pretende brindar al lector un panorama
general de los lineamientos bsicos para el manejo de muestras biolgicas que sern sometidas a estudios moleculares.
Se explica cmo seleccionar, obtener y preservar la muestra
para obtener resultados dedignos. Adems, se mencionan
algunos ejemplos especcos y las reas de aplicacin del
anlisis molecular.

www.fullengineeringbook.net
Seleccin de la muestra:
qu muestra debo estudiar?

Debe elegirse la muestra que contenga el cido nucleico de


inters. De aqu surgen dos alternativas: estudio de cidos
nucleicos del individuo o deteccin de cidos nucleicos
exgenos. En la gura 10-1 se sealan algunos casos en los
que pueden aplicarse los anlisis moleculares y el tipo de
muestra adecuado para tal n.

Estudio de cidos nucleicos de un individuo


En un individuo se puede estudiar su estructura genmica
(ADN) o la expresin de sus genes (ARN) en una situacin
u rgano especcos.

Anlisis de la estructura genmica


de un individuo
Para este tipo de estudios la molcula de inters es el ADN
genmico que se encuentra en el ncleo de las clulas.
Todas las clulas de un individuo poseen el mismo genoma,
que no se ve afectado por la edad ni por variables metablicas. Por ello, la muestra para estudiar la estructura genmica
de un individuo puede ser cualquier clula nucleada. Sin
embargo, hay que elegir la muestra que involucre el procedimiento menos invasivo y la menor cantidad de riesgos e
incomodidad para el paciente.

Manejo de muestras
La implementacin y realizacin de las tcnicas moleculares debe llevarse a cabo por personal altamente capacitado
en el rea de biologa molecular. Sin embargo, los resultados
que se obtengan no slo dependern de la prueba molecular que se emplee, sino tambin de la toma y conservacin
de la muestra de manera apropiada. De este modo, la meto93

94

PARTE II Metodologa del ADN recombinante

EXPRESIN
GNICA

ESTRUCTURA
GENMICA
MUTACIONES

FIBROSIS
QUSTICA
HEMOFILIA
DISTROFIA
MUSCULAR

DETECCIN DE
GENOMAS
EXTRAOS

POLIMORFISMOS

DIABETES
CIRROSIS
CNCER
DISTROFIA
MUSCULAR

DIABETES
CIRROSIS
CNCER
OBESIDAD
ARTRITIS

ADN

ARNm

LEUCOCITOS DE
SANGRE
PERIFRICA

LEUCOCITOS
SUERO
BIOPSIA
LQUIDO SINOVIAL

VHB
VHC
VIH
PAPILOMA VIRUS
M. TUBERCULOSIS

ADN/ARN
exgeno

LEUCOCITOS SUERO
EXUDADO VAGINAL
LQUIDO
CEFALORRAQUDEO

Figura 10-1. Seleccin de muestras para estudios moleculares.

La muestra de eleccin para el anlisis de la estructura


genmica de un individuo es sangre perifrica con anticoagulante; sta contiene glbulos blancos, glbulos rojos y
plaquetas. Las nicas clulas de este tejido que poseen
ncleo, y por ende ADN, son los leucocitos, a partir de los
cuales es posible extraer ADN genmico.
El anlisis del ADN de una persona es importante, ya
que permite identicar individuos, detectar polimorsmos
gnicos de predisposicin o proteccin a ciertas enfermedades, analizar mutaciones y establecer el diagnstico de
enfermedades genticas.

miento de la siologa y patologa humanas. Sin embargo,


en la prctica mdica, el estudio de la expresin de genes es
complejo, y an no supone una herramienta de diagnstico
de uso comn, al alcance de todos, que brinde resultados
que dicten o modiquen estrategias de tratamiento clnico
de manera signicativa.
La muestra de eleccin depender del tejido donde se
exprese el gen de inters: si se expresa en leucocitos, la muestra ser sangre perifrica con anticoagulante; si lo hace en el
hgado, una biopsia de hgado, y si se expresa en tejido tumoral, una biopsia del tejido sospechoso; por ejemplo, si se
desea conocer qu tanto se expresa el gen de la telomerasa en
un tumor de cncer de pulmn, la muestra indicada ser la
biopsia del tumor.

www.fullengineeringbook.net

Estudio de la expresin gnica de un individuo


Para este anlisis la molcula de inters es ARN mensajero
(ARNm). El estudio de la expresin gnica de un individuo
revelar los cambios bioqumicos que experimenta el organismo en respuesta a una situacin particular o momento
metablico. La expresin gnica se regula de manera espacial y temporal, y la regulacin espacial representa la base
de la diferenciacin celular. Esto signica que los genes no
se expresan en todos los tejidos, sino que cada tejido u rgano expresa solamente los genes necesarios para llevar a
cabo su funcin; por ejemplo, la insulina se expresa en las
clulas beta del pncreas, la albmina en los hepatocitos, la
mielina en las clulas de Schwann del sistema nervioso central, etc. Por otro lado, la regulacin temporal signica que
la expresin gnica depende del momento metablico en el
que se encuentre el individuo: en un individuo sano o enfermo, en estado de ayuno o posprandial, en un embrin o en
un anciano, o en estado de euforia o tristeza. Por esto, el
individuo, como tal, es el resultado de la expresin de sus
genes en un momento determinado. Estudiar la expresin
gnica resulta elemental en investigacin para evaluar la
respuesta a una variable especca y contribuir al conoci-

Deteccin de cidos nucleicos exgenos


ADN exgenos
Las tcnicas de biologa molecular permiten la deteccin
del ADN procedente de cualquier fuente ajena al paciente,
como bacterias y virus de ADN, por lo que constituyen una
herramienta til para el diagnstico molecular de enfermedades causadas por microorganismos. Mycobacterium
tuberculosis es un buen ejemplo, ya que es una bacteria de
crecimiento lento cuyo diagnstico mediante cultivo
microbiolgico puede requerir hasta cinco semanas; mientras que las tcnicas moleculares permiten su deteccin en
24 a 48 horas. Sin embargo, para la identicacin de otros
microorganismos, el cultivo microbiolgico es una herramienta econmica, sensible, rpida y especca. Por tal
motivo, es recomendable que los estudios moleculares no
se apliquen en forma indiscriminada.
Para la deteccin de genomas exgenos, la muestra
depender de la historia natural del microorganismo infectante; por ejemplo, en la deteccin del virus de la hepatitis B

CAPTULO 10 Manejo de muestras para estudios moleculares

(VHB), se sabe que ste es un virus hepatotrco que al


replicarse produce lisis celular y que los virus se diseminan
por todo el organismo a travs del torrente sanguneo; por
ello, la muestra de eleccin es sangre perifrica sin anticoagulante para la obtencin de suero mediante centrifugacin.

ARN exgenos
La deteccin de ARN exgeno a travs de estudios moleculares es una prctica continua en investigacin, y en algunos
casos especcos de aplicacin clnica. Por ejemplo, la
deteccin y la cuanticacin del ARN del virus de la inmunodeciencia humana (VIH) y del virus de la hepatitis C
(VHC) mediante estudios moleculares suponen una herramienta elemental en el monitoreo de su tratamiento.
La muestra de eleccin depender, al igual que en la
determinacin de ADN, de la historia natural de la partcula viral infectante. Tanto en el caso del VIH como en el del
VHC, su historia natural permite establecer que el espcimen adecuado es suero procedente de una muestra de sangre perifrica sin anticoagulante.

Toma de la muestra: cmo debe tomarse


la muestra?
En la toma de muestras para estudios moleculares deben
considerarse algunos factores y recomendaciones que se
mencionan a continuacin. Si la muestra es sangre perifrica, no es indispensable el estado de ayuno, ya que la ingesta
de alimento no modica la concentracin ni la estructura de
los cidos nucleicos; sin embargo, es recomendable el ayuno para evitar que la alta concentracin de lpidos de la
muestra interera con la extraccin de los cidos nucleicos.

95

to de sodio (DEPC) u otros agentes ofrecidos por diversas


casas comerciales.

Anticoagulantes
Se dispone de diversas sustancias que inhiben la cascada de
la coagulacin y que se utilizan en la toma de muestras. El
cido etilendiaminotetractico (EDTA) es un quelante de
calcio y es el anticoagulante empleado con ms frecuencia.
Otro anticoagulante muy comn es el citrato de sodio.
Ambos pueden utilizarse para toma de muestras de sangre
que se sometern a estudios moleculares. No se recomienda
el uso de heparina, ya que puede interferir en procedimientos posteriores, como la reaccin en cadena de la polimerasa
(PCR).

ADN o ARN de glbulos blancos


Para aislar ADN o ARN a partir de glbulos blancos, debe
tomarse una muestra de sangre perifrica en un tubo nuevo, estril con anticoagulante, EDTA o citrato de sodio. La
cantidad de sangre depender del mtodo de extraccin de
cidos nucleicos que vaya a emplearse y de la cantidad
de stos que se requiera. Para la obtencin de ADN, las
muestras pueden guardarse a 4C hasta por cinco das sin
que afecte de manera signicativa a la cantidad de ADN .
Para la obtencin de ARN el procesamiento debe ser, de
preferencia, de inmediato, para evitar la degradacin por
ARNsas.

www.fullengineeringbook.net

Uso de material libre de nucleasas


Las nucleasas (ADNsas y ARNsas) son enzimas altamente
estables que degradan ARN, por lo que es necesario que se
garantice la ausencia de estas enzimas en el material que se
destine para anlisis molecular, como lo son puntas y tubos
de plstico, que deben ser nuevos, estriles y desechables. El
material de vidrio y de metal puede someterse a temperatura de 230C durante 8 horas para inactivar nucleasas.

Uso de guantes y cubrebocas


Las ADNsas y ARNsas se encuentran en la saliva y en el
sudor, por lo que es obligatorio usar guantes y cubrebocas y
su cambio frecuente cuando se trabaja con cidos nucleicos.

Limpieza total
Las bacterias, los hongos y las clulas muertas de la piel son
fuentes ricas en ARNsas, por lo que se recomienda tomar
las muestras en un ambiente higinico, limpiar las supercies de trabajo con agentes descontaminantes y utilizar
inhibidores de ARNsas, como el fenol, el dietilpirocarbona-

ADN o ARN de suero

Se toman 3 ml de sangre perifrica en un tubo seco. Se deja


a temperatura ambiente el tiempo mnimo necesario para
permitir la formacin del cogulo (mximo, 20 minutos).
Enseguida, la muestra se centrifuga a 3 000 rpm durante 10
minutos; se separa el suero, y se transere a un tubo nuevo
y estril. El suero se somete al proceso de extraccin de cidos nucleicos adecuado, o bien se almacena a 20C hasta
su procesamiento. El paquete globular se desecha de acuerdo con las normas sanitarias de seguridad para desechos de
material biolgico contaminante.

ADN o ARN de biopsias


La expresin gnica constituye el fundamento de la diferenciacin celular, por lo que el estudio de la expresin gnica
de un individuo involucra la toma de una biopsia del tejido de
inters. Tambin puede realizarse la bsqueda de cidos
nucleicos exgenos en un tejido especco. La toma de
biopsia no es un procedimiento simple sistemtico, sino
que debe realizarlo personal mdico experto. Es un mtodo
invasivo que representa un riesgo para el paciente y requiere del uso de equipos costosos; por ejemplo, en el caso
de infeccin por el VHB en estadio no replicativo, una biopsia heptica podra servir tanto para evaluar el grado del
dao heptico mediante el estudio de la expresin de colgena (ARN del husped), como para llevar a cabo la bs-

96

PARTE II Metodologa del ADN recombinante

queda del virus (ADN viral). La toma de la biopsia heptica


debe dirigirse con un equipo de ultrasonido, y el paciente
debe permanecer en reposo total despus del procedimiento, oprimiendo el sitio de la puncin durante por lo menos
12 horas para evitar hemorragias y complicaciones.

Otros uidos biolgicos


En el caso de orina, lquido cefalorraqudeo o lquidos de
puncin, es necesario tomar la muestra en recipientes nuevos, estriles, con las precauciones de limpieza y esterilidad
indicadas en este captulo.

Preservacin. Qu variables afectan


la estabilidad de los cidos nucleicos?
Los cidos nucleicos son susceptibles de degradarse por las
nucleasas existentes en todas las clulas. La preservacin de
los cidos nucleicos est dirigida a la inactivacin de nucleasas, por lo que las principales variables que afectan la integridad del ADN y el ARN aislados o dentro de las muestras
son la temperatura y el tiempo. Debido a las caractersticas
sicoqumicas y estructurales de los cidos nucleicos, el
ARN es una molcula mucho ms sensible a la accin de
nucleasas que el ADN, por lo que los cuidados para su preservacin suelen ser ms estrictos. El ADN aislado puede
mantenerse viable a 4C durante varias semanas, a 20C
durante varios meses y a 70C durante aos. Pueden utilizarse inhibidores de ADNsas, cuando el ADN sea la molcula
en estudio, o bien inhibidores de ARNsas, cuando se tenga
inters en estudiar ARN. Una recomendacin valiosa es colocar la muestra desde el momento de la toma en varias alcuotas para evitar congelamientos y descongelamientos repetidos
que favorezcan la degradacin de los cidos nucleicos.

Fluidos biolgicos
Siempre que la molcula de inters sea ARN, las muestras
deben mantenerse a 70C o en nitrgeno lquido, hasta
que se lleve a cabo la extraccin de ARN.

ADN de leucocitos
Las muestras de sangre para obtencin de leucocitos y la posterior extraccin de ADN pueden mantenerse a temperatura
ambiente entre 15C y 25C, hasta por 48 horas; a 4C por
varios das, o indenidamente a 70C. Sin embargo, para
garantizar la obtencin de ADN en buena cantidad y de buena calidad utilizando mtodos econmicos de extraccin,
debe llevarse a cabo la extraccin lo ms pronto posible.

ARN o ADN en suero


El suero debe mantenerse a 70C o en nitrgeno lquido.

Uso de mtodos comerciales


En la actualidad, el desarrollo de la biologa molecular y la
ingeniera gentica han permitido el diseo de molculas o
sustancias que preservan la integridad de los cidos nucleicos manteniendo las muestras a 20C, 4C y aun a temperatura ambiente. Asimismo, se dispone de mtodos comerciales para la extraccin de cidos nucleicos de muestras no
frescas, que ofrecen un rendimiento aceptable a partir de
muestras no almacenadas de manera adecuada. Obviamente esta diferencia en el rendimiento se reeja tambin en el
costo, ya que un mtodo casero de extraccin de cidos
nucleicos podr tener un costo 100 veces menor que uno
comercial. La cuidadosa preservacin de las muestras
garantizar resultados dedignos y la disponibilidad de
ADN o ARN para llevar a cabo ensayos por triplicado y asegurar resultados libres de errores, al ofrecer una cantidad y
una calidad de cidos nucleicos buenas en la muestra, aun
utilizando mtodos econmicos y sencillos de extraccin.

www.fullengineeringbook.net

Biopsias
Como ya se explic, las biopsias se emplean generalmente
para estudiar la expresin gnica, es decir, ARN; aunque
tambin puede extraerse ADN exgeno o del paciente. Sin
embargo, los cuidados en el manejo de las biopsias estn
dirigidos principalmente a la preservacin de ARN por ser
una molcula fcilmente degradable. Los tejidos contienen
ARNsas endgenas que pueden inactivarse a baja temperatura. Se recomienda el uso de nitrgeno lquido para congelar el tejido inmediatamente despus de su recoleccin, ya
que su temperatura se encuentra por debajo de los 196C,
y transportarlo en l hasta el sitio donde se almacenar o
procesar para la extraccin de cidos nucleicos. Sin embargo, la congelacin con nitrgeno lquido no siempre es una
opcin viable, y existen algunas soluciones en el mercado
para preservar la integridad del ARN en tejidos, almacenando la muestra a 4C hasta por un mes antes de aislar el
ARN. Finalmente, las biopsias pueden mantenerse dentro
de un ultracongelador a 70C, o bien en nitrgeno lquido
por tiempo indenido antes de la extraccin de cidos
nucleicos.

Contaminacin de muestras y degradacin


Pueden obtenerse resultados no dedignos cuando las
muestras no se procesan o conservan de forma adecuada
(gura 10-2), denominados falsos positivos y falsos negativos.

Resultados falsos positivos


Un resultado falso positivo se obtiene cuando una muestra
se contamina con otra, debido a un procesamiento inadecuado y da como resultado la deteccin de ADN o de ARN
ajeno a la muestra problema.

Resultados falsos negativos


Un resultado falso negativo surge cuando el ADN o el ARN
presentes en una muestra se degradan por accin de las
nucleasas, lo que los convierte en indetectables a la sensibilidad del mtodo molecular utilizado.

CAPTULO 10 Manejo de muestras para estudios moleculares

CONTAMINACIN Y DEGRADACIN
DE MUESTRAS

97

dad heptica, diabetes mellitus tipo 2, ARNm de albmina en cirrosis, etctera.

reas de aplicacin de los


estudios moleculares

ACCIN DE NUCLEASAS

FALSO NEGATIVO

CONTAMINACIN DE MUESTRAS

FALSO POSITIVO

Figura 10-2. Contaminacin y degradacin de muestras.

Trastornos o agentes infecciosos


detectados por estudios moleculares
a) Agentes infecciosos: VIH, VHB, VHC, virus del papiloma humano (VPH), Mycobacterium tuberculosis, genotipos del VHB, etctera.
b) Enfermedades genticas: brosis qustica, distroa
muscular de Duchenne, anemia de clulas falciformes,
etctera.
c) Polimorsmos gnicos de predisposicin o proteccin a
enfermedades: apolipoprotena E en la enfermedad de
Alzheimer, receptor -3-adrenrgico en artritis reumatoide, cyp2E1 en cirrosis, etctera.
d) Enfermedades adquiridas, expresin de genes: ARNm
de albmina en cirrosis, ARNm de ApoA1 en enferme-

Los estudios moleculares tienen utilidad en todas las reas


de las ciencias biolgicas. A continuacin se mencionan
algunas de las disciplinas correspondientes a las ciencias de
la salud:
a) Infectologa: los estudios moleculares se utilizan ampliamente en la identicacin de virus y bacterias, por sus
elevadas sensibilidad, especicidad y rapidez.
b) Epidemiologa: la deteccin de polimorsmos gnicos de
susceptibilidad o proteccin en una poblacin mediante
estudios moleculares es de gran utilidad para la implementacin de campaas de prevencin. Asimismo, los
estudios moleculares han permitido la identicacin de
genotipos de microorganismos endmicos de una regin
para establecer tratamientos especcos.
c) Nutrigenmica y nutrigentica: el anlisis molecular
permite evaluar la interaccin de los genes y los nutrimentos para la preservacin y mejoramiento de la salud.
d) Farmacologa: el conocimiento de los procesos siolgicos y patolgicos moleculares ha contribuido al diseo
de nuevos frmacos, con mayor especicidad y menor
cantidad de efectos colaterales.
e) Terapia gnica: los procedimientos moleculares han
hecho posible el surgimiento de nuevas alternativas de
tratamiento a padecimientos genticos o adquiridos
incurables.

www.fullengineeringbook.net
Ejercicios de integracin
1. Describa en los recuadros el tipo de muestra de eleccin
segn la clasicacin del material gentico, indicando
los cuidados especiales que requiere dicha muestra para
obtener un resultado conable en los anlisis de biologa
molecular.

Material gentico
ADN exgeno
ARN exgeno
ADN endgeno
ARN endgeno

Tipo de muestras posibles

Cuidados especiales

98

PARTE II Metodologa del ADN recombinante

2. Describa en los recuadros de la tabla, de acuerdo con la


afeccin que se necesita diagnosticar, el tipo de muestra
que debe seleccionarse y el tipo de cido nucleico que
debe analizarse.
Enfermedad

Muestra biolgica

cido nucleico

Tuberculosis
VIH
VHB
Hemolia
Cirrosis heptica

Preguntas de repaso
a) Enliste las aplicaciones del estudio de la estructura genmica de un individuo.
b) Mencione un ejemplo donde se aplique el estudio de la
expresin gnica de un individuo.
c) Seale tres recomendaciones para la toma y preservacin de muestras para estudios moleculares.

d) Explique la diferencia entre un resultado falso negativo y


un resultado falso positivo.
e) Qu tipo de muestra empleara para detectar una mutacin?

www.fullengineeringbook.net
Bibliografa

Beutler E., Gelbart T., Kuhl W. Interference of heparin with the

Holland N.T., Smith M.T., Eskenazi B., Bastaki M. Biological sample

polymerase chain reaction. Biotechniques, 1990;9:166.


Cohen C.D., Frach K., Schlndorff D., Kretzler M. Quantitative gene
expression analysis in renal biopsies: A novel protocol for a highthroughput multicenter application. Kidney Int, 2002;61:133-140.

collection and processing for molecular epidemiological studies.


Mutat Res, 2003;543:217-234.
Marteau J.B., Mohr S., Michele Pster M., Visvikis-Siest S. Collection and storage of human blood cells for mRNA expression
proling: A 15-month stability study. Clin Chem, 2005;51:12501252.

Guio H., Okayama H., Ashino Y., Saitoh H., Xiao P., Miki M., et al.

Method for ecient storage and transportation of sputum specimens for molecular testing of tuberculosis. Int J Tuberc Lung Dis,
2006;10:906910.
Holland N.T., Peger L., Berger E., Ho A., Bastaki M. Molecular
epidemiology biomarkers - Sample collection and processing
considerations. Toxicol Appl Pharmacol, 2005;206:261-268.

Rockey D.C., Caldwell S.H., Goodman Z.D., Nelson R.C., Smith


A.D. Liver biopsy. Hepatology, 2009;49:1017-1044.
Sambrook J., Russel D.W. Molecular cloning, 3 ed. Nueva York:

Cold Spring Harbor Laboratory Press, 2001;1:6-8.


Vaught J.B. Blood collection, shipment, processing, and storage.

Cancer Epidemiol Biomarkers Prev, 2006;15:1582-1584.

Captulo

11

Extraccin de cidos nucleicos


Ana Soledad Sandoval Rodrguez / Abril Bernardette Martnez Rizo
David Alejandro Lpez de de la Mora

Introduccin

polimerasa (PCR), electroforesis y construccin de bibliotecas genmicas.

Los cidos nucleicos, el ADN y ARN reciben su nombre del


hecho de ser molculas con caractersticas acdicas (como la
carga negativa en soluciones acuosas) y haberse localizado
inicialmente en el ncleo celular, aunque ahora se sabe que
tambin se encuentran en la mitocondria. Para su estudio
los cidos nucleicos deben aislarse del resto de los componentes celulares, como lpidos y protenas, ms abundantes
que los cidos nucleicos. Asimismo, dependiendo del objeto
de estudio debe aislarse de preferencia el ADN o ARN; as,
para estudios de niveles de expresin gnica se extraer
ARN, mientras que para la bsqueda de modicaciones o
alteraciones gnicas, ADN.

Eleccin del mtodo de extraccin


La extraccin de cidos nucleicos es el primer paso para la
mayora de los estudios en biologa molecular y para las tcnicas del ADN recombinante. En la actualidad, se dispone
de mltiples metodologas de extraccin, lo que permite
que los bilogos moleculares puedan seleccionar la tcnica que ms se ajuste a sus necesidades. La eleccin del mtodo
de extraccin suele realizarse en funcin de los siguientes
criterios:

www.fullengineeringbook.net

Consideraciones para la extraccin


de cidos nucleicos

La molcula de ADN con independencia de la estabilidad


qumica dada por su estructura helicoidal, es f sicamente
frgil, por ser larga, tortuosa y con un peso molecular alto,
lo que provoca que se someta a fuerzas hidrodinmicas que
la disgregan. En solucin, el ADN de doble cadena (ADNds)
se comporta como una estructura rgida enrollada de forma
aleatoria, regida por las repulsiones electrostticas de las
pares de bases y el esqueleto de fosfatos cargados negativamente. Al pipetear, agitar o revolver el ADN se genera un
ujo hidrodinmico que puede separar las dos cadenas de
ADN; entre ms larga la molcula, ms dbil la fuerza
requerida para esta rotura. Por ello, obtener fragmentos de
ADN genmico es fcil, pero conforme se requieran tamaos moleculares elevados (> 150 kb) la tcnica se diculta.
Los fragmentos deADN generalmente obtenidos por las
tcnicas de extraccin deADN oscilan entre 100 y 150 kb y
son adecuados para Southern blot, reaccin en cadena de la

Tipo de cido nucleico que se va a extraer: ADN de


cadena sencilla (ADNss), DNAds, ARN total, ARN
mensajero (ARNm) o ARN ribosomal (ARNr).
Organismo origen del cido nucleico: mamferos, plantas, procariotes o virus.
Fuente del cido nucleico: cultivo celular, tejido (generalmente biopsia), sangre (leucocitos), expectoracin,
suero, orina, lquido cefalorraqudeo, etctera.
Tcnica en que se utilizar el cido nucleico extrado:
segn el uso que vaya a tener el cido nucleico los
requerimientos de rendimiento, pureza y tiempo de
extraccin variarn acorde a la metodologa que se vaya
a aplicar, como retrotranscripcin, PCR, clonacin,
Northern blot, Southern blot, etctera).

En el rea mdica, el ADN genmico suele extraerse


para su uso en procesos como una PCR cualitativa o
Southern blot, para diagnstico, determinacin de variantes allicas o clonacin en vectores. En cambio, el ARN se
extrae para realizar una reaccin de retrotranscripcin y,
posteriormente, una PCR que determine los niveles de
expresin gnica en condiciones y momentos determinados. El ADN mitocondrial, por su parte, se extrae para diag-

99

100

PARTE II Metodologa del ADN recombinante

nstico de enfermedades mitocondriales o bien anlisis


evolutivo; pero el aislamiento de este ADN conlleva un proceso especco.

Fuente del cido nucleico


En teora el ADN/ARN puede obtenerse de cualquier clula/virus que lo contenga; solamente los eritrocitos no se
consideran una fuente de ADN/ARN, ya que son anucleados. Las fuentes posibles de material para la extraccin de
los cidos nucleicos son: leucocitos (sangre), suero, plasma,
biopsia, orina, heces, lquido cefalorraqudeo, lquido sinovial, lquido anmitico, esputo, semen, raspado bucal, folculo capilar, etc. Por acuerdos ticos, se preeren las
muestras no invasivas frente a cualquier tipo de biospia o
toma invasiva de lquido. En el cuadro 11-1 se ejemplica el
cido nucleico adecuado, as como la muestra de eleccin
segn el tipo de enfermedad que se desee diagnosticar.
Con independencia del tipo de muestra utilizada para la
extraccin, es una tcnica minuciosa, que involucra lisis de
la clula, separacin, puricacin, precipitacin, lavado y
disolucin. Durante la extraccin de cidos nucleicos, y en
particular en la extraccin del ARN, que es una molcula
ms lbil ya que es de cadena sencilla, debe considerarse el
uso de material nuevo, estril, libre de ADNsas y ARNsas, y

el uso de guantes para impedir la degradacin de la muestra


con nucleasas provenientes del ambiente (pelo, sudor, saliva, polvo), as como para impedir cualquier contaminacin
con cidos nucleicos exgenos. Todo el proceso debe realizarse en fro; esto es, con los reactivos y las muestras a 4C
antes y durante el proceso, conservando la muestra congelada hasta justo antes de iniciar la extraccin.

Extraccin de ADN
Las tcnicas comunes de extraccin de cidos nucleicos son
muy diversas e incluyen procesamientos qumicos y f sicos
que las diferencian; cada una presenta ventajas y desventajas, que se agrupan en el cuadro 11-2.

Extraccin de ADN por la


tcnica fenol-cloroformo
Esta tcnica se fundamenta en la lisis total de las clulas y
sus estructuras subcelulares mediante el empleo de detergentes con la posterior eliminacin de las protenas mediante su extraccin y la de componentes lipdicos con solventes
orgnicos. Esto deja al ADN puro listo para su separacin
por precipitacin en soluciones alcohlicas. Es la tcnica
ms empleada, por la cantidad y la calidad del ADN obteni-

www.fullengineeringbook.net

Cuadro 11-1. Seleccin del cido nucleico a extraer. Se marca con una X la eleccin recomendada del cido nucleico y fuente
del mismo segn la enfermedad de inters. Las patologas se han agrupado en alteraciones genticas, enfermedades multifactoriales y enfermedades adquiridas o infecciosas.

Seleccin de
tipo de muestra

Leucocitos

Enfermedades
adquiridas

Enfermedades
polignicas o
multifactoriales

Alteraciones genticas
monognicas

ADN

ARN

Biopsia
ADN

ARN

Suero, plasma
ADN

ARN

Mucosa
bucal

Suero,
biopsia

Suero,
biopsia

LCR, suero,
biopsia, orina,
expectoracin

ADN

ADN oral

ARN viral

ADN
bacteriano

Distroa musc.
Duchenne

Anemia celular
falciforme

Hipercolesterole
mia

Def. de
alfaaminotripsina

Diabetes

*X

**X

Cirrosis

*X

**X

Cncer

*X

**X

Artritis
reumatoide

*X

**X

VHB

VHC

VIH

Tuberculosis

Aspergillus

*Si se busca la mutacin gnica implicada en el desarrollo de la patologa, se recomienda la extraccin de ADN de leucocitos.
**Si se investiga los niveles de expresin gnica en determinado momento se optara por una biopsia como fuente del ARNm.

CAPTULO 11 Extraccin de cidos nucleicos

101

Cuadro 11-2. Ventajas y desventajas de diversos mtodos de extraccin de cidos nucleicos. De las diversas tcnicas disponibles
para la extraccin de cidos nucleicos, algunas como la extraccin por cloruro de cesio se consideran ideales para ADN plasmdico. Algunas otras, como la extraccin fenol-cloroformo, se emplean para cualquiera de los cidos nucleicos (se realizan ligeras
modicaciones para la extraccin de ARN).
Mtodo

Ventajas

Desventajas

Fenol/cloroformo (ADN) e isotiacianato


de guanidina/fenol-cloroformo (ADN)

Buen rendimiento.
Permite el aislamiento de todo tipo de cido
nucleico.

El producto puricado requiere ser precipitado con


alcaloides.
El fenol es txico y castico.

Cloruro de cesio ADN plasmdico

Excelente mtodo para obtencin de ADN


plasmdico.
Alta pureza de los cidos nucleicos.
Requiere muy pocas manipulaciones, lo que
elimina el riesgo de contaminaciones
espordicas con rinasas.

Cromatografa por exclusin de tamao


(ADN o ARN)

Tiempos de separacin cortos y bien denidos.


Alta sensibilidad.
Reproducible.

La recuperacin del cido nucleico puricado es


ineciente (prdida de muestra).

Salting-out (ADN)

Reactivos inocuos.
Material barato.

Requiere una cantidad grande de muestra para


obtener cantidades adecuadas de ADN.

Chelex (ADN)

Previene la degradacin del ADN por sus


agentes quelantes.
No hay prdidas considerables de ADN.

Se obtiene ADNes, el cual no puede usarse para


RFLPs.

do. A continuacin se describen los pasos que implica esta


metodologa, esquematizados en la gura 11-1.

Laborioso y prolongado.
BrEf es cancergeno.
Requiere eliminacin de CsCl.
Indispensable el uso de material especializado.

nan la muestra. La lisis de eritrocitos suele realizarse por


adicin de una solucin hipotnica a base de cloruro de
amonio. Los procedimientos comunes de lisis celular y su
fundamento se incluyen en el cuadro 11-3.
La inactivacin de nucleasas intracelulares previene la
digestin enzimtica de los cidos nucleicos, lo que permite
lograr la obtencin de fragmentos relativamente largos de
ADN y ARN. La lisis celular y la inactivacin de las nucleasas intracelulares en general se llevan a cabo en el mismo
paso, ya que la solucin de lisis est compuesta por sales
caotrpicas, como el EDTA, que secuestra cationes divalentes y, por lo tanto, inactiva las ADNasas.

www.fullengineeringbook.net

Lisis de las clulas y liberacin del ADN

El primer paso en la extraccin es la homogeneizacin del


tejido y la lisis con detergentes (Triton o docedil sulfato
sdico, SDS) capaces de romper las membranas celular y
nuclear, y liberar el cido nucleico de las clulas de donde se
extraer el ADN. El procedimiento de lisis celular es crtico
y debe ser lo sucientemente agresivo como para lograr la
fragmentacin del tejido y la rotura de la membrana celular,
sin daar el cido nucleico. La disgregacin del tejido y su
homogeneizacin se llevan a cabo en un buer de lisis, que
contiene sales, un detergente y proteinasa K, que libera el
ADN de las histonas con las que se encuentra empaquetado
y proteoliza protenas celulares. La incubacin con la enzima se realiza por 2 horas a 65C. En el caso del ADN, la
homogeneizacin se lleva a cabo con un homogeneizador
manual para evitar la rotura mecnica de la molcula; para
el ARN se emplea un homogeneizador elctrico que gira a
unas 200 a 1000 rpm. En el caso de clulas con pared celular, como las clulas vegetales, se preere el empleo de sonicadores, los cuales, mediante ondas de sonido, rompen la
pared celular y la membrana celular y nuclear, para liberar el
ADN. Cuando la extraccin se lleva a cabo a partir de clulas
de sangre perifrica, se recomienda el empleo de tubos con
cido etilendiaminotetraactico (EDTA) como anticoagulante (EDTA 0.1 M al 0.02% V/V), ya que la heparina interere con enzimas como las polimerasas o las enzimas de
restriccin, que se emplearn en pasos subsiguientes. Tambin es necesario retirar los eritrocitos, ya que por su alto
contenido de hemoglobina y carencia de ncleo contami-

Extraccin de protenas y lpidos


con solventes orgnicos
Al concluir la lisis celular y la inactivacin de nucleasas, se
retiran los restos celulares, proceso conocido como puricacin. Los mtodos de puricacin de cidos nucleicos
combinan estrategias tan diversas como la extraccin/precipitacin, la cromatograf a, la centrifugacin, la electroforesis y la separacin por anidad. Para la extraccin por la
tcnica del fenol-cloroformo, se utiliza una solucin que
tiene una relacin 25:24:1 v/v para el fenol:cloroformo:alcohol
isoamlico; generalmente se aade hidroxiquinolina al 0.1%,
que funciona como antioxidante del fenol, un inhibidor
parcial de ARNsas, quelante dbil de iones metlicos, y que
ayuda a identicar la fase orgnica por el color amarillo que
le conere. El alcohol isoamlico se emplea para reducir la
espuma que puede generarse al agitar esta solucin. Esta
solucin desnaturaliza las protenas (entre ellas las nucleasas) y mantiene la separacin de la fase orgnica y acuosa
tras la centrifugacin de la muestra. La eliminacin de las

102

PARTE II Metodologa del ADN recombinante

Homogenizar

Proteinasa K

Centrifugar
4 C/8

Vrtex

Incubar 65C
2 hrs

Centrifugar
4C/15

Aadir fenol
cloroformo

Vrtex

Colectar
sobrenadante

Fase acuosa
Protenas
Fase fenlica

Vrtex

Aadir OH
absoluto

Reposar toda la
noche 20C

www.fullengineeringbook.net
Colectar
sobrenadante

Centrifugar
4C/25

Vrtex

Lavar con OH
70%

Decantar

Botn ADN

Centrifugar
4C/25

Leer en
espectrofotmetro

Decantar

Resuspender
en H2O

Figura 11-1. Extraccin de ADN por la tcnica fenol-cloroformo. Esta tcnica es ampliamente usada por su economa y facilidad, lo
que permite el aislamiento de ADN de buena calidad para su uso en diversas tcnicas moleculares. Es importante considerar que
el procedimiento se debe realizar en fro (4C) despus de la digestin enzimtica. Una vez extrado se almacena a temperatura
de 80C para su preservacin adecuada por varios aos.

protenas y componentes no hidrosolubles del homogenado celular se efecta con la formacin de dos fases con propiedades de solubilidad particulares a) una fase orgnica
(fenlica) en la parte inferior del tubo de precipitado que
contiene lpidos, protenas y debris celulares, y b) una fase

acuosa en la parte superior (menos densa), que contiene los


cidos nucleicos y otras pequeas molculas hidrosolubles.
En la interfase se ubican la mayor parte de las protenas
debido a su contenido en aminocidos hidrofbicos e hidroflicos, como se aprecia en la gura 11-2.

CAPTULO 11 Extraccin de cidos nucleicos

103

Cuadro 11-3. Procedimientos de lisis celular. La nalidad de la lisis celular es romper las membranas para liberar los cidos nucleicos para su solubilizacin en solventes adecuados. En el caso de clulas con pared celular (ciertas bacterias y clulas vegetales),
se requieren mtodos ms agresivos que destruyan tambin la pared celular.
Tcnica/ejemplo

Mecanismo

Fuente

Homogenizacin
Procedimientos mecnicos suaves/mortero
Sonicacin/aplicacin de ondas ultrasnicas

Utiliza la fuerza fsica para romper las membranas.


Ruptura de las membranas por ultrasonido.

Detergentes/SDS

Solubiliza las membranas celular y nuclear. El SDS tambin participa


en la desnaturalizacin de nucleadas y la disociacin de complejos
nucleoproteicos.

Bacterias

Soluciones/soluciones hipotnicas

Producen un ambiente hipotnico, lo cual rompe la membrana celular.

Disrupcin enzimtica/ lisozimas

Debilita la pared celular al romper los enlaces que hay entre las
molculas del cido N-acetilmurmico y la N-acetil glucosamina.

Bacterias

El ADN es poco soluble en fenol, por lo que previamente suele estabilizarse con una solucin amortiguadora de
Tris que lo mantiene en un pH de 8.0 a 8.5, lo que hace que
el ADN permanezca en la fase acuosa. La modicacin del
pH de 8.5 a 5.2 en esta solucin puede favorecer la extraccin de ARN frente a la de ADN.

Tejido animal y vegetal


Cultivo celular
Biopsias
Bacterias
Cultivo celular

Bacterias
Tejido animal y vegetal
Cultivo celular
Biopsias

Cuando se emplea etanol (EtOH), la cantidad que se requiere para la precipitacin es dos veces el volumen de la fase
acuosa, mientras que con isopropanol (IprOH) se demanda
solamente 0.7 veces el volumen de fase acuosa. Por otro
lado, al emplear IprOH puede acelerarse el proceso, con un
tiempo de incubacin menor, y la precipitacin puede realizarse a temperatura ambiente. Sin embargo, se ha reportado una mayor dicultad para disolver cidos nucleicos precipitados con IprOH que con EtOH.
Para facilitar la precipitacin tambin suelen aadirse
cationes monovalentes (K+, Na+, NH4+) a la solucin de
cidos nucleicos cargados negativamente, con el n de
generar sales insolubles en alcohol de fcil precipitacin. Si
la cantidad del cido nucleico en la muestra es baja, es posible incrementar sus agregados utilizando algn compuesto
inerte que se asocie a los cidos nucleicos y aumente su precipitacin, sin interferir en futuras reacciones, como por
ejemplo el glucgeno, que por su gran tamao molecular
forma una red que arrastra al ADN y facilita su precipitacin. La precipitacin se favorece incubando a bajas temperaturas (20C); una centrifugacin posterior permite la
obtencin de una pastilla o botn del cido nucleico en el
fondo del tubo, al decantar el alcohol.

www.fullengineeringbook.net

Precipitacin de ADN

El ADN disuelto en la solucin acuosa se precipita aadiendo alcohol absoluto (isopropanol o etlico), ya que los cidos nucleicos son insolubles en soluciones alcohlicas.

Fase acuosa
Protenas

Fase fenlica

Figura 11-2. Fases en la puricacin de cidos nucleicos. En la


extraccin de cidos nucleicos que involucra solventes orgnicos, una vez que estos ltimos son aadidos se forman dos
fases: la fase fenlica, ubicada en la parte inferior de tubo, la
cual contiene protenas y lpidos. A su vez, la fase superior es
la acuosa, donde se ubica el ADN o ARN, segn sea el caso.
En la interfase entre ambas se localiza un acmulo slido de
protenas. La separacin de la fase acuosa sin tocar la fase
fenlica o la capa de protenas es un paso crtico en el proceso
de extraccin del cido nucleico que determina la pureza con
que se asla, y por lo tanto es determinante del ndice 260/280 que
se obtenga.

Lavado del ADN


El botn de ADN obtenido en la precipitacin se lava con
etanol al 70% por, al menos, dos ocasiones. El contenido de
alcohol de esta solucin (70%) mantiene al ADN precipitado, y el H2O (30%) permite la disolucin de las sales presentes. Despus de los lavados, se seca el botn, lo que permite
la evaporacin del alcohol (espontnea o acelerada en un
desecador).

Disolucin del ADN y adicin de ARNsa


Inmediatamente despus de la evaporacin del alcohol, el
botn de ADN se disuelve en soluciones que aseguren su

104

PARTE II Metodologa del ADN recombinante

preservacin, como agua estril y libre de ADNsas, o bien


soluciones amortiguadoras, como el buer Tris EDTA (TE).
La cantidad de solucin para disolver el ADN debe ser mnima para mantener una concentracin adecuada del cido
nucleico que permita su empleo en tcnicas posteriores, pero
suciente para lograr una disolucin total del ADN. El ADN
se disuelve por pipeteo constante del botn hasta lograr una
solucin homognea. Los estudios indican que la disolucin
del ADN en buer TE preserva por mayor tiempo y en mejores condiciones que cuando se disuelve en agua estril; sin
embargo, se preere disolver el ARN en agua-dietil pirocarbonato (DEPC) al 0.1%, lo que evita cualquier interferencia
de las sales de las soluciones amortiguadoras y lo preserva de
las ARNsas. Para eliminar el ARN contaminante proveniente
de la extraccin, la solucin de ADN se incuba por una hora
a 37C con ARNsas para, as, evitar que el ARN interera en
la cuanticacin y en posteriores tcnicas.

Cuanticacin de los cidos nucleicos


Existen diversos mtodos de cuanticacin de cidos
nucleicos; los ms usados son la espectrofotometra y la
uorometra.

Espectrofotometra

Dilucin: como se requieren volmenes relativamente


grandes de solucin para cubrir la capacidad de las celdas
de los espectrofotmetros, suelen manejarse diluciones
1:100 a 1:1000 del stock de ADN, en una solucin en fosfato
de sodio dibsico, 1.5 M a pH 5.2 (Na2HPO4), que permite
leer los nucletidos sin interferencia. Algunos equipos permiten la lectura directa del cido nucleico, como el espectrofotmetro NanoDrop, usando volmenes micromtricos (1 a 2 M), donde la muestra no se diluye sino que se
aplica directamente en el aparato.
Constante: proveniente del valor terico de OD para
cada cido nucleico: a) 50 para el ADNds; b) 40 para ARN;
c) 33 para oligonucletidos, y d) 37 para ADNss.

Valoracin de la pureza del


cido nucleico extrado
A pesar de que la tcnica de extraccin de cidos nucleicos
est bien realizada, es prcticamente imposible eliminar la
totalidad de las protenas celulares que acompaan al ADN,
as como solventes u otros componentes orgnicos empleados en la extraccin, los cuales se presentan como contaminantes de la solucin de cido nucleico, lo que puede repercutir en las tcnicas en que se pretenda emplear el cido
nucleico. Debido a que el espectro de absorcin de luz de
estas molculas es caracterstico, la absorcin en otras longitudes de onda de la muestra de cidos nucleicos se compara con la absorcin a 260 nm, con el n de valorar la pureza del cido nucleico extrado. As, para el clculo de estos
ndices se procede a dividir la OD obtenida para la muestra
de cidos nucleicos a 260 nm entre la OD de inters.

www.fullengineeringbook.net

El fundamento de la espectrofotometra es que cualquier


solucin que contenga molculas suspendidas permite el
paso de un haz de luz a travs de ella en proporcin inversa
a la cantidad de molculas que contiene. Los nucletidos de
ADN y ARN presentan la absorcin mxima a una longitud
de onda de 260 nm (luz ultravioleta, UV); por lo tanto, los
espectrofotmetros son los aparatos ms utilizados para
determinar la concentracin de cidos nucleicos en solucin. En la celda del espectrofotmetro un haz de luz atraviesa la solucin de cidos nucleicos y, cuando ha pasado
por la muestra, un fotodetector mide la intensidad de luz
absorbida. Mientras ms luz absorba la muestra (absorbancia) mayor ser la concentracin de cidos nucleicos. En la
gura 11-4 se esquematiza el fundamento de la medicin de
concentracin de molculas en un espectrofotmetro.
La densidad ptica (OD) es la unidad de absorbancia y
tiene valores particulares para cada molcula especca en
una determinada longitud de onda por unidad de distancia.
En el caso de los cidos nucleicos, una OD de 1 a 260 nm
equivale a 50 g/ml de ADNds, 37 g/ml de ADNss, 40 g/
ml de ARN o 33 g/ml de oligonucletidos. Segn estos
valores, se estableci la siguiente frmula para el clculo de
la concentracin de los cidos nucleicos:
g/l de AN = OD a 260 nm Dilucin constante / 1 000
En donde:
OD a 260 nm: absorbancia del cido nucleico a 260 nm
de longitud de onda.

Contaminacin con protenas: ndice 260280


Dado que las protenas (en particular los aminocidos aromticos) absorben luz a una longitud de onda de 280 nm,
por lo comn el ndice de absorcin 260280 nm se utiliza
para valorar la pureza de los cidos nucleicos con respecto
a la contaminacin con protenas. Cuando ste se encuentra entre 1.8 y 2.0, se considera ptimo, ya que valores cercanos a 1.8 indican que la muestra contiene casi exclusivamente ADN; para el ARN el ndice ptimo es de 2.0. La
presencia de protenas har disminuir este cociente, por lo
que si la relacin 260280 es menor que 1.8 la cantidad de
protena en la muestra es alta y es conveniente realizar un
nuevo proceso de extraccin. Un ndice mayor que valores
de 2.0 indica una rotura de las cadenas de los cidos nucleicos, y se considera que es un cido nucleico de calidad insuciente, por lo que en este caso tambin se recomienda una
nueva extraccin. Sin embargo, este ndice no es infalible y
puede modicarse si el pH del medio se modica; la acidez
puede hacer disminuir hasta 0.2 a 0.3 unidades el ndice,
mientras que la basicidad puede aumentarlo. Por otro lado,
la composicin de nucletidos libres afecta tambin esta
relacin, ya que si se calculase el ndice 260280 para cada
nucletido se obtendra: guanina: 1.15, adenina: 4.50, cito-

CAPTULO 11 Extraccin de cidos nucleicos

Homogenizar
con Trizol

Vrtex

Cloroformo fro

Reposar toda la
noche 20C

105

Incubar en hielo

Aadir
isopropanol

Centrifugar
4C/15

Vrtex
Colectar
sobrenadante

Centrifugar
4C/25
Decantar

Vrtex

www.fullengineeringbook.net
Lavar con OH
70%

Resuspender
con H2O

Desecador
2-3

Secar sin
tocar botn

Decantar

Botn ADN

Centrifugar
4C/15

Leer en
Espectrofotmetro

Homogenizar

Figura 11-3. Fundamento del funcionamiento del espectrofotmetro. La luz UV o visible es emitida por una lmpara que a travs
de un condensador dirige los rayos hacia la muestra, ubicada dentro de una celda de cuarzo (material que no interere con la
absorcin de la muestra). La luz ser absorbida de manera proporcional de acuerdo a la concentracin de la muestra. La luz que
no es absorbida por la muestra se mide por el detector, restndola a la luz inicial emitida y generando as una lectura en unidades
de absorbancia que oscila entre 0.001 a 1.000.

sina: 1.51, uracilo: 4.00 y timina: 1.47; por ello, el ARN tendr tpicamente valores mayores que el ndice 260280, por
su contenido de uracilos, que dieren notablemente del
ndice que producen las timinas.

Contaminacin con fenol: ndice 260270


El fenol tiene un pico de absorbancia de 270 nm, por lo que
a 260 nm todava absorbe gran cantidad de luz. Debido a

106

PARTE II Metodologa del ADN recombinante

este efecto solapante, la contaminacin con fenol (utilizado


en la extraccin) sobreestima de forma signicativa la concentracin de cidos nucleicos. Las preparaciones de cidos
nucleicos sin contaminacin fenlica presentan un ndice
260270 de alrededor de 1.2.

Contaminacin con fenol y sales: ndice 260230


La absorcin de luz UV a una longitud de onda de 230 nm
signica que la muestra est contaminada con iones fenolatos o tiocianatos, pptidos, compuestos aromticos u otras
sustancias. Para muestras puras de cidos nucleicos el ndice 260230 se espera en el rango 2.0-2.2; muestras con un
ndice menor indican la presencia de contaminantes que
absorben a 230 nm, como EDTA, carbohidratos y fenol. El
TriZol, empleado para la extraccin de ARN, es una solucin
fenlica que absorbe luz UV tanto a 230 nm como a 270 nm.

Fluorometra
La cuanticacin de ADN o ARN por uorometra es 1000
veces ms sensible que la espectrofotomtrica, y menos susceptible a las interferencias por protenas y contaminantes
presentes en la solucin. Esta metodologa se basa en la unin
especca de colorantes uorescentes al cido nucleico, que
absorbe luz de una determinada longitud de onda y emite luz
de una longitud de onda superior (de menor energa). La
relacin entre la concentracin del cido nucleico y la intensidad de emisin uorescente es directamente proporcional.
Esta tcnica requiere de estndares de concentracin conocida, contra el cual interpolar los valores de la muestra.
Los colorantes ms empleados son el Hoechst 33258,
una bis-benzimida que se intercala en la doble cadena de
ADN en regiones ricas en AT, que se excita en el espectro
UV (350 nm) y emite en el visible a 450 nm. Su sensibilidad
es de aproximadamente 10 ng/ml. Para la cuanticacin de
ARN, se realiza un pretratamiento con ADNsas, y suele
emplearse RiboGreen, un colorante que absorbe a ~500 nm
y emite a ~525 nm. Su sensibilidad es de 1 pg/l. La desventaja principal de esta tcnica es que no proporciona informacin de la pureza (como el ndice A260:A280), ni de la
posible degradacin del ARN o ADN, por lo que se requiere
realizar una electroforesis para comprobar la integridad del
cido nucleico. En los uormetros, la seal electrnica
para la misma concentracin de una sustancia vara de un
instrumento a otro, por lo que mediciones hechas en equipos diferentes no pueden compararse. Se recomienda medir
la uorescencia en soluciones diluidas, pues se corre riesgo
de no iluminar por igual todas las partes de la solucin y
cuanticar de forma inadecuada las distintas capas de la
solucin.

como que mltiples descongelaciones ocasionan una degradacin progresiva en los cidos nucleicos, por lo que se
recomienda hacer alcuotas. Tambin se dispone de mtodos comerciales para la preservacin del ADN, como son
los tubos GenTegra ADN, que contienen una matriz qumica inerte que permite el almacenamiento del ADN seco y
a temperatura ambiente por das o meses sin hidrlisis u
oxidacin.

Extraccin de ADN por


la tcnica de salting OUT
Si bien muchos pasos y soluciones son comunes al mtodo
de extraccin por fenol-cloroformo, la principal diferencia
en esta metodologa radica en el empleo de una solucin
concentrada de sales en lugar de solventes orgnicos para la
lisis celular y la extraccin de protenas. La adicin de una
solucin saturada de sales provoca la agregacin de protenas y debris celular, lo que permite su separacin de los cidos nucleicos. Generalmente, estas soluciones se preparan
a saturacin con NaCl. Una centrifugacin posterior a la
adicin de la solucin concentrada de sales precipita el
debris y las protenas, y deja libre el ADN en el lquido del
sobrenadante, que se traspasa a un nuevo tubo para su lavado y precipitado.

www.fullengineeringbook.net

Preservacin del ADN


El cido nucleico se mantiene en congelacin (80C es la
temperatura recomendada) hasta su empleo. Es bien sabido
que a menor temperatura la preservacin se prolonga, as

Extraccin de ARN

La extraccin de ARN de clulas eucariotas se lleva a cabo


para desarrollar estudios de expresin gnica (anlisis de los
niveles de ARNm), para el diagnstico de enfermedades
ocasionadas por virus de ARN o, en el caso de bacterias,
para anlisis de expresin de genes o validar la clonacin del
ADN complementario (ADNc) en un vector. Al realizar la
extraccin de ARN de clulas eucariotas existen dos posibilidades: extraccin de ARN total (ARNm, ARNr y ARN de
transferencia, ARNt) y extraccin oclusiva de ARNm. Es
menos complejo y generalmente ms barato la extraccin de
ARN total, y a menos que el ARNm sea sumamente escaso
se opta por esta opcin. Tambin se dispone de kits comerciales basados en cromatograf a de intercambio aninico en
fase slida, que permiten puricar ARN total. Las clulas o
tejidos se disgregan en una solucin de tiocianato de guanidina para lisar las clulas e inactivar las ribonucleasas endgenas. El lisado celular se diluye con una solucin alcohlica
y se coloca en una columna de resinas de intercambio aninico. La resina consiste en cuentas de slica con supercie
hidrof lica con tamao de partcula reducido, hechas con
cantidades elevadas de grupos dietil-amino-etil (DEAE). La
puricacin se basa en la interaccin de estos grupos DEAE
cargados positivamente con los grupos fosfatos (cargados
negativamente) del ARN. Las protenas y otros contaminantes son retirados con lavados. El pH y la concentracin de
sales de las soluciones amortiguadoras usadas en cada paso
controlan la unin del ARN a la columna, la astringencia

CAPTULO 11 Extraccin de cidos nucleicos

107

Cuadro 11-4. Diferencias entre extraccin de ADN y ARN. El uso de inhibidores de ARNsas y el pH es crtico para favorecer la extraccin de ARN, especialmente en la tcnica fenol cloroformo.
Diferencias entre mtodos

ARN

ADN

Temperatura pH de solucin fenol/cloroformo

Estrictamente 4C 5 a 6

Preferentemente 4C 8.2

Uso de inhibidores de ARNsas

Tiocianato de guanidina

N/A

Agua libre de ARNsas para las soluciones de


trabajo

DEPC 0.1%

N/A

Proteinasa K

N/A

10 g/ml

Homogeneizador

Elctrico

Manual

del lavado y la elucin del cido nucleico. El ARN unido a la


columna se eluye con soluciones inicas acuosas. El proceso
es rpido, aunque la cantidad de ARN suele ser limitada; sin
embargo, la calidad del ARN obtenido de la cual se dice es
la equivalente a dos rondas de puricacin con gradientes de
CsCl es mayor, ya que no hay arrastre de fenol. Esto hace
que la puricacin por columna sea ideal para el ARN
empleado en aplicaciones como la transfeccin, la microinyeccin, la clonacin y la secuenciacin.

Consideraciones especiales
al trabajar con ARN
La molcula de ARN es sumamente lbil, por lo que la clave
en la extraccin es evitar su degradacin por accin de
ribonucleasas propias de la clula. Los protocolos existentes
se basan en una rpida inactivacin de ARNsas endgenas,
muy estables y que no requieren de cofactores para funcionar. Es muy importante tomar precauciones para evitar la
contaminacin con ARNsas exgenas, por ejemplo, tratar
el agua y soluciones salinas con inhibidores de ARNsas
como el DEPC al 0.1% , que inactiva las ribonucleasas
por modicaciones covalentes. Si es posible, se recomienda
el empleo de pipetas, puntillas y soluciones exclusivas para
trabajar con ARN. El material de vidrio debe esterilizarse
por calor seco por 4 horas a 150C, mientras que el material
plstico debe ser nuevo y estril, o bien debe enjuagarse con
cloroformo, ya que la esterilizacin por autoclave no inactiva por completo las ARNsas.
Para la lisis celular suele optarse por la lisis mecnica o
enzimtica. La disrupcin mecnica se emplea con ms frecuencia para tejidos frescos o clulas, usando un homogeneizador mecnico. La disrupcin de tejido congelado es
ms laboriosa y se recomienda el uso de un homogeneizador elctrico. La homogeneizacin del tejido se realiza
habitualmente en una solucin comercial fenlica con tiocionato de guanidina, llamada Trizol.
En el mercado se encuentran disponibles soluciones
comerciales estabilizadoras para el ARN (RNAlater,
Ambion), que permiten preservar la muestra sin congelarla.
Estas soluciones mantienen el ARN estable en el tejido a
37C por un da, a 25C por una semana, a 4C por un mes
y a temperaturas bajo cero por tiempo indenido.

Por otro lado, la disrupcin enzimtica se utiliza con


ms frecuencia para lisar clulas que contienen envoltura o
cpsula, como bacterias y levaduras. La digestin con lisozima, zimoliasa o lisostana suele seguirse de una sonicacin, homogeneizacin o vrtex vigoroso en un buer de
lisis que contiene hidrocloruro de guanidina. Los mtodos
enzimticos tambin pueden emplearse para tejidos eucariotes ricos en colgena, con la nalidad de digerirla antes
de la lisis celular.
Las principales diferencias entre la extraccin de ADN
y de ARN se resumen en el cuadro 11-4.

Tcnica de isotiocianato
de guanidina/fenol-cloroformo para
extraccin de ARN total

www.fullengineeringbook.net
El isotiocianato de guanidina y el fenol se utilizan como
componentes de la solucin de lisis. El isotiocianato de guanidina es un potente desnaturalizante de protenas con
capacidad de inhibir ARNsas, por lo que es ampliamente
utilizado en la extraccin de ARN. El fenol y el cloroformo
se utilizan en la extraccin del ARN con los mismos nes
que en la extraccin del ADN (formar las fases orgnica y
acuosa, desnaturalizar protenas e inactivar nucleasas). La
solucin fenlica empleada en la extraccin del ARN es cida (pH 5 a 6), para favorecer la extraccin del ARN sobre la
del ADN, ya que a pH cido, el ADN es retenido en la fase
orgnica y en la interfase, dejando el ARN en la fase acuosa.
Posteriormente, el ARN es puricado a partir de la fase
acuosa mediante precipitacin a baja temperatura con isopropanol y con ayuda de una centrifugacin de manera
similar a como se hace con ADN. Este proceso se esquematiza en la gura 11-3.

Otros mtodos de extraccin


Los mtodos comerciales para la extraccin de cidos
nucleicos suelen basarse en cromatograf a de intercambio
aninico, y emplean algn tipo de columna. Los kits son
rpidos y proporcionan una buena calidad del cido nucleico; sin embargo, son costosos respecto a los mtodos con-

108

PARTE II Metodologa del ADN recombinante

Celda con
muestra

400-750 nm

Luz blanca

Detector

MONOCROMADOR
UV <400 nm

Lente
Lmpara

0000.00 nm

ABSORBANCIA

Amplificador

Lectura

Figura 11-4. Extraccin de ARN con fenol-cloroformo. La extraccin de ARN es una modicacin de la extraccin de ADN por fenolcloroformo. La principal diferencia es el empleo de inhibidores de ARNsas con la idea de impedir la degradacin del ARN por las
endonucleasas intracelulares de la muestra o presentes en el material. Es importante mencionar que la extraccin de ARN debe
realizarse en todo momento en fro (4C) para inhibir la accin de las ARNsas, cuidando que los reactivos estn en refrigeracin
antes y durante su empleo.

vencionales de extraccin. En esta seccin se describen los


fundamentos de algunos mtodos alternativos de extraccin empleados, entre los que se encuentran los mtodos
comerciales.

Gradiente con cloruro de cesio

sobre todo en la clonacin de vectores. Es una metodologa


rpida y reproducible.

Cromatografa
de intercambio inico

www.fullengineeringbook.net

La centrifugacin en gradientes de CsCl sirve para la puricacin de ambos cidos nucleicos, aunque su uso principal es
el aislamiento del ADN genmico y plasmdico. Es una tcnica laboriosa, prolongada y que requiere de un equipo especializado, como una ultracentrfuga. Este mtodo es el preferido para la elaboracin de genotecas de ADNc, en las que se
requiere ARN alta pureza e integridad o para aislar ARN de
tejidos con altos niveles de ARNsa endgena, como el pncreas.

Cromatografa por
exclusin de tamao
Esta tcnica se fundamenta en la separacin de cidos
nucleicos de acuerdo con su peso molecular, empleando
una columna empaquetada con una matriz de gel conformada por partculas polimricas orgnicas o de slice;
ambos materiales, mecnica y qumicamente estables y con
un contenido bajo en grupos inicos, originan una red de
poros hidrof licos uniformes. Las molculas de gran tamao no penetrarn en los poros del polmero, por lo que
migran ms rpidamente que las de menor tamao, que s
son capaces de penetrar por los poros de la matriz. Esta
tcnica es el fundamento de la puricacin en gel de agarosa de un cido nucleico de determinado tamao, usado

Empleada por lo comn para separar protenas, se ha convertido en un mtodo alternativo que permite la concentracin y la puricacin de ADN de calidad, de manera rpida
y con la misma ecacia que la extraccin por gradientes
de CsCl. Los cidos nucleicos interactan con la resinas de
carga positiva de las columnas de intercambio inico, por lo
que el cido nucleico cargado negativamente se retiene y
permite que otras molculas, como protenas o lpidos, se
eluyan primero, dejando los cidos nucleicos retenidos en la
columna, los cuales se eluirn empleando condiciones que
rompan su enlace con los compuestos inicos de la resina
puricados.

Cromatografa de absorcin
Los cidos nucleicos en solucin se jan de forma selectiva
en slice o vidrio, en presencia de sales caotrpicas, mientras que protenas, metabolitos y otros contaminantes se
eliminan mediante lavados. Posteriormente, los cidos
nucleicos se recuperan con una solucin hiposalina.
La importancia de la calidad del cido nucleico extrado
es crucial para su uso posterior en tcnicas moleculares,
por lo que el personal que realice estos procedimientos
debe estar capacitado para observar las buenas prcticas de
laboratorio, condicin indispensable para obtener una cantidad y una calidad adecuadas de ARN o ADN

CAPTULO 11 Extraccin de cidos nucleicos

109

Ejercicios de integracin
1. Calcular la concentracin de ARN en g/l obtenida de una
muestra diluida 1:25 que arroj una absorbancia de 0.185
leda a 260 nm.
2. Valorar la pureza de la preparacin de cidos nucleicos
obtenida de una muestra cuya absorbancia a 260 nm fue
de 0.57; mientras que a 280 nm fue de 0.31. Segn el
ndice 260280, qu pureza tiene la muestra? Explique
la interpretacin del resultado.
3. Calcule la cantidad de ADN por gramo de tejido si la concentracin de ADN fue de 350 ng/l, partiendo de 100
mg de muestra.

4. Dibuje el espectro de luz infrarrojo, visible y ultravioleta


e indique en su esquema en qu longitud absorben los
cidos nucleicos y las protenas; adems, explique por
qu estas molculas, a esos nanmetros, presentan un
mximo de absorcin.
5. Qu funcin tiene el detergente SDS frente a las membranas y las protenas de la clula en la tcnica de extraccin de cidos nucleicos?
6. Investigue y explique cules propiedades tiene el fenol
que favorecen que los cidos nucleicos se queden en la
fase acuosa y no en la fenlica

Bibliografa
Chomczynski P., Sacchi N. Single-step method of RNA isolation by

acid guanidinium thiocyanate-phenol-chloroform extraction.


Anal Biochem, 1987;162:156159.
Miller D.D., Dykes H.F., Polesky S.A. A simple salting out procedure for extracting DNA from human cell. Nucleic Acids Res,
1988;16:1215.

Quiagen. Sample and assay technologies. RNeasy MicroKit English

(pdf ). Disponible en: http://www.qiagen.com/products/.


Sambrock J., Russell D., Molecular cloning: A laboratory manual,

Vol 1, 3 ed. Nueva York: Cold Spring Harbor, 2001.

www.fullengineeringbook.net

Captulo

12

Electroforesis
David Alejandro Lpez de la Mora / Ana Soledad Sandoval Rodrguez

Introduccin

de se depositan las muestras. Este campo se genera dentro de


una solucin amortiguadora en la que se encuentra sumergido el gel que contiene las muestras; el alto contenido de
electrolitos permite la transmisin de la corriente elctrica,
manteniendo el pH estable al paso de la corriente. La cmara cuenta con dos polos que se conectan a una fuente de
energa. En las cmaras de electroforesis vertical el polo
positivo se encuentra en la parte inferior de la cmara (gura 12-2A) y en las horizontales, en uno de los extremos
(gura 12-2B). En ambos tipos de cmaras el polo positivo
se distingue con color rojo y el negativo con negro.

En biologa molecular, una gran cantidad de tcnicas que se


realizan comnmente requieren el uso de la electroforesis,
por lo que supone una parte importante del procedimiento
sistemtico del anlisis (separacin, puricacin, preparacin) de los cidos nucleicos y las protenas. La mayora de
las biomolculas poseen una carga elctrica cuya magnitud
depende del pH del medio en el que se encuentran; como
consecuencia, pueden desplazarse cuando se ven sometidas
a un campo elctrico hacia el polo de carga opuesta al de la
molcula. A diferencia de las protenas, que pueden tener
una carga positiva o negativa, los cidos nucleicos slo
poseen carga negativa, debido a su esqueleto de fosfatos.
Por lo tanto, en una electroforesis, los cidos nucleicos
migrarn hacia el polo positivo; es decir, el nodo. En el
caso de las protenas se realiza pretratamiento con detergentes, como el dodecilsulfato de sodio (SDS), que les conere carga negativa; con ello se homogenizan las protenas
de la muestra y todas migrarn hacia el polo positivo, y slo
se separarn por tamao.
El principio de la electroforesis consiste en la migracin
proporcional de las molculas a travs de un gel u otro tipo
de matriz porosa, segn su peso molecular o tamao; movimiento generado por el campo elctrico.

www.fullengineeringbook.net
Gel

La muestra debe colocarse sobre un medio de soporte, con la


nalidad de evitar perturbaciones mecnicas durante la separacin. El soporte idneo es un gel semislido o gelatinoso,
compuesto por polmeros que forman una especie de malla o
microporos tridimensionales a travs de los cuales avanzan
las molculas, segn el peso molecular, lo que permite la separacin por tamao de los diferentes componentes de la muestra. Los geles pueden ser de agarosa o poliacrilamida. Para la
separacin de cidos nucleicos se usan geles de agarosa o acrilamida y para protenas, slo de acrilamida.

Geles de agarosa
La agarosa es un polisacrido extrado de algas marinas que
tiene la propiedad de mantenerse en estado slido a temperatura ambiente, que se disuelve fcilmente en temperatura
de 50 a 60C, se torna lquida y se solidica cuando se enfra
formando un gel altamente poroso. Para elaborar el gel se
pesa la cantidad de agarosa requerida, se disuelve en una
solucin amortiguadora adecuada de la misma composicin y concentracin que el buer de corrimiento y se calienta hasta formar una solucin. Sin dejar enfriar se vaca
inmediatamente sobre un molde de forma rectangular y en

Elementos necesarios para una electroforesis


Para realizar una electroforesis se requiere de una serie de
elementos que se describen a continuacin, que se enlistan
en la gura 12-1.

Cmara de electroforesis
La cmara de electroforesis es un dispositivo que permite la
generacin de un campo elctrico alrededor de un gel don110

CAPTULO 12 Electroforesis

Cmara de
electroforesis

A)

MIGRACIN DE LA MUESTRA

Peine para pocillos

111

Gel
Transiluminador

Fuente de poder

B)

100

Buffer

Buffer de carga

1KB

BUFFER

Marcador de peso
molecular

Buffer de corrimiento

MIGRACIN DE LA MUESTRA

Figura 12-2. Cmaras de electroforesis. A) En las cmaras de


electroforesis vertical el corrimiento de la muestra sigue la gravedad, ya que el polo positivo de encuentra en la parte inferior
de la cmara. B) En la electroforesis horizontal debe cuidarse
que el nodo se coloque hacia el extremo del gel donde corren
las muestras, de lo contrario las muestras se salen del gel.

www.fullengineeringbook.net
Figura 12-1. Elementos necesarios para una electroforesis. En
la imagen se aprecian los elementos que se requieren para el
corrimiento electrofortico y visualizacin del gel.

uno de los extremos se coloca un aditamento en forma de


peine con la nalidad de generar los pocillos u oricios
donde se colocarn las muestras (gura 12-3). La agarosa
posee ventajas sobre la acrilamida, ya que no es un compuesto txico y permite realizar el anlisis de cidos nucleicos con pesos moleculares variados, segn la concentracin
de agarosa que se emplee. Sin embargo, su poder de resolucin es menor que el de los geles de poliacrilamida. La concentracin de agarosa se escoge segn el tamao del cido
nucleico que se vaya a analizar (cuadro 12-1). El tamao de
los poros de la matriz del gel depende de la concentracin
de agarosa utilizada y la concentracin de agarosa es inversamente proporcional al tamao del poro obtenido; esto es,
a mayor concentracin, menor tamao de los poros, y viceversa, si los poros son pequeos la migracin del cido
nucleico es ms lenta. La gura 12-4 representa la migracin de las molculas de ADN en un gel de agarosa. Durante la electroforesis, los cidos nucleicos lineales con un peso
molecular alto migran al nodo ms lentamente que los de
menor peso molecular. Esto se debe a que los cidos nucleicos de peso elevado tardan ms tiempo en atravesar los

poros de agarosa. En el caso de cidos nucleicos no linearizados, como plsmidos circulares (conformacin nativa),
ARN con estructuras secundarias o ADN de gran longitud,
la migracin no slo depende del peso molecular sino tambin del grado de empaquetamiento que presenten. En la
electroforesis de un plsmido, por ejemplo, se visualizan
tres conformaciones distintas de la misma molcula: la forma superenrrollada, la semirrelajada y una relajada. Esto se
reeja en tres bandas de tamao diferente, aunque se trate
del mismo plsmido (gura 12-5). Por ello, antes de una
electroforesis es importante la linearizacin y la eliminacin de estructuras secundarias por desnaturalizacin de la
muestra. La concentracin de agarosa ms utilizada para
electroforesis de cidos nucleicos es de 0.5 a 2%.

Geles de acrilamida
La acrilamida es un polmero sinttico, termoestable, incoloro y qumicamente inerte, con el que se pueden generar
geles con un amplio intervalo de tamaos de poro. El gel de
poliacrilamida es el resultado de la polimerizacin qumica
de una mezcla de acrilamida y bisacrilamida. El tamao de
poro de un gel de acrilamida est determinado por la concentracin total de acrilamida presente (acrilamida + bisacrilamida), que generalmente se maneja en proporcin de
19:1. Regulando la concentracin de ambas y su proporcin

112

PARTE II Metodologa del ADN recombinante

AGAROSA

Figura 12-3. Preparacin de un gel de agarosa. La agarosa


es un polvo que para disolverse requiere calentarse hasta la
ebullicin del solvente. Una vez obtenido el lquido de agarosa, antes de que se enfri a menos de 50C se coloca en una
cmara para formar el gel. El gel se coloca de manera que los
pocillos queden en el extremo donde se localiza en polo negativo de la cmara de electroforesis, para permitir que la muestra
corra a lo largo del gel.

se consiguen distintas porosidades, siempre menores que la


de los geles de agarosa. Cuando la acrilamida se encuentra
en disolucin acuosa experimenta autopolimerizacin de
forma espontnea y lenta, con el resultado de que las molculas de acrilamida se unen cabeza con cola. En presencia
de un sistema generador de radicales libres se da una polimerizacin vinlica en la cual se activan los monmeros de
acrilamida, quedan en estado de radical libre y reaccionan

Figura 12-5. Perl electrofortico de un plsmido. Aunque la


molcula de ADN (en este caso un plsmido) tenga la misma
longitud en pb, puede demostrar diversos patrones de corrimiento electrofortico segn la conformacin de la estructura.
A) Plsmido superenrrollado. B) Plsmido circular. C) Plsmido
linearizado.

rpidamente para formar polmeros de cadena larga. El


polmero en disolucin no forma un gel, sino que se encuentra en estado viscoso debido a que las cadenas pueden deslizarse unas sobre otras; la formacin del gel requiere que
varias cadenas queden trabadas (lo que se consigue con la
bisacrilamida). La acrilamida es una neurotoxina, por lo
que debe manejarse con precaucin. Tambin es esencial
almacenarla en un lugar refrigerado, seco y oscuro para
reducir la autopolimerizacin y la hidrlisis. La bisacrilamida, o N,N-metilenbisacrilamida, est compuesta por dos
molculas de poliacrilamida enlazadas por sus grupos amino, no reactivos. Este compuesto polimeriza conjuntamente con la acrilamida y establece puentes entre las cadenas
lineales de poliacrilamida, con lo que se evita su deslizamiento y conduce a la formacin del gel. El gel de acrilami-

www.fullengineeringbook.net

Patrn o
Ladder

Migracin

Muestra

Cuadro 12-1. Concentraciones de agarosa para geles de cidos


nucleicos. El cuadro indica las concentraciones de agarosa
recomendadas segn el peso molecular que se espera encontrar en las muestras. Al aumentar la concentracin de agarosa
se reduce el poro del gel, lo que permite la discriminacin de
fragmentos de menor tamao.
Agarosa (%)

Banda de cido
nucleico

Gel

Figura 12-4. Electroforesis de cidos nucleicos. Se representa


un gel de agarosa en el cual se visualiza un marcador de peso
molecular junto a las muestras para ayudar en la determinacin del peso molecular de los fragmentos. La muestra se
carga en los pocillos y se deja correr hacia el polo negativo.

Tamao de banda

0.3

> 700 pb

0.5

700 pb a 25 kb

0.8

500 pb a 15 kb

1.0

250 pb a 12 kb

1.2

150 pb a 6 kb

1.5

80 pb a 4 kb

2.0

100 pb a 3 kb

3.0

500 pb a 1 kb

4.0

100 pb a 500 pb

6.0

10 pb a 100 pb

CAPTULO 12 Electroforesis

Muestra

Patrn o
Ladder

Migracin

da es capaz de soportar mayores voltajes que la agarosa y es


susceptible de teirse por varios procedimientos, y tambin
puede desteirse en caso necesario. Los geles de acrilamida
pueden digerirse para extraer fracciones separadas (bandas) o desecados para su exposicin radiogrca y registro
permanente. La electroforesis con geles de acrilamida siempre se realiza en cmaras verticales. La electroforesis de
protenas emplea geles de acrilamida de dos capas de gel a
diferente concentracin de acrilamida, un gel superior o
concentrador y un gel inferior de separacin o de resolucin. El gel de concentracin tiene un tamao de poro grande
y se prepara con un amortiguador de Tris/HCl con pH
de 6.8, dos unidades de pH menor que el buer de corrimiento hecho de Tris/SDS/glicina. Estas condiciones proporcionan un ambiente para que las protenas recubiertas
con SDS se concentren. El tamao del gel de apilamiento
debe ser del doble de la altura del pozo donde se va aplicar
la muestra. Este gel se coloca sobre el gel de resolucin, un
gel de poliacrilamida de poro pequeo hecho de un amortiguador de Tris/HCl, con un pH de 8.8. En el gel de resolucin es donde las protenas se separan de acuerdo con su
tamao, de manera dependiente del porcentaje de acrilamida utilizado para su preparacin, como se describe en el
cuadro 12-2. La adicin de SDS a los geles de poliacrilamida
es opcional; cuando se hace, mantiene a las protenas en
estado extendido, lo que facilita la movilidad electrofortica
de la protena mediante el gel y permite que la movilidad
dependa exclusivamente de su masa molecular. En la gura
12-6 se representa la electroforesis de protenas en gel de
acrilamida.

113

Gel de
empacamiento

Banda
de cido
nucleico

Gel de
resolucin

Figura 12-6. Electroforesis de protenas. Las protenas se


corren en geles de acrilamida formados por dos fases. Una
fase superior donde las molculas se concentran y una inferior
donde la muestra se separa en sus componentes segn su
peso molecular. Al estar pretratadas con SDS, las protenas se
rodean de cargas negativas, lo que les permite migrar hacia el
polo positivo con independencia de su carga inicial.

www.fullengineeringbook.net

Buffer de corrimiento
El buer de corrimiento es de la misma composicin y pH
que el buer con el que se prepara el gel de resolucin, ya
sea de agarosa o de acrilamida. ste proporciona el medio
para la transmisin de la corriente elctrica y mantiene
el pH sin variaciones mientras se realiza el corrimiento. En el
caso de los cidos nucleicos, pueden emplearse TBE o TAE

Cuadro 12-2. Concentraciones de acrilamida para geles de


cidos nucleicos. El cuadro indica las concentraciones de acrilamida recomendadas segn el peso molecular que se espera
encontrar en las muestras. Al aumentar la concentracin de
acrilamida se reduce el poro del gel, lo que permite la discriminacin de fragmentos de menor tamao.
Acrilamida (%)

Pares de bases

3.5

1 000 a 2 000

5.0

80 a 500

8.0

60 a 400

12.0

40 a 200

15.0

25 a 150

20.0

6 a 100

como buer de corrimiento. El buer TBE contiene Tris


base, cido brico y EDTA, y se maneja a un pH de 7.2. El
buer TAE contiene Tris base, cido actico y EDTA, ajustado a pH 8.5. El buer de corrimiento de electroforesis de
protenas lleva Tris, 25 mM, SDS al 1% y glicina, 192 mM, a
un pH 8.3.

Marcador de peso molecular


Son molculas de ADN o de protenas que permiten determinar por comparacin el tamao de los fragmentos de cidos nucleicos o protenas contenidos en las muestras sometidas a electroforesis. Los marcadores de peso molecular
estn disponibles comercialmente en amplia variedad. En el
caso de marcadores de peso molecular de cidos nucleicos,
stos pueden ser fagos o plsmidos sometidos a corte con
enzimas de restriccin que generan fragmentos de tamao;
tambin puede tratarse de molculas de ADN sintticas
denominadas escaleras, porque contienen fragmentos con
incrementos de tamao gradual. En la gura 12-7 se pueden ver las bandas que se obtienen de los fragmentos con
un marcador de uso comn, como es el fago Phi X174/Hae
III y una escalera denominada 1 Kbase plus ladder. Los
marcadores de peso molecular de protenas suelen ser una
serie de protenas de peso molecular conocido (que van

114

PARTE II Metodologa del ADN recombinante

12,000
1,353
1,078
872

5,000

603

contiene Tris, azul de bromofenol, azul de xileno y glicerol.


Mientras que el buer de carga para protenas contiene
Tris-HCl, pH 6.8, ditiotritiol (DTT), SDS, glicerol y azul de
bromofenol. En el caso de que se deseen condiciones desnaturalizantes y reductoras, deber aadirse beta-mercaptoetanol a este buer y habr que calentar las muestras a 95C
por 5 minutos.

Transiluminador ultravioleta
310
271,281
234

2,000
1,650

194

1,000
188
850
650
72
500
400
300
200

El transiluminador transmite luz del espectro ultravioleta a


travs de la muestra, excitando la molcula cromognica
que emite energa uorescente que permite visualizarla. El
transiluminador es el sistema empleado con ms frecuencia por ser simple y efectivo. En general emiten energa a
una longitud de onda a 302 nm, aunque tambin existen
para 254 y 365 nm; y suelen contar con un botn para baja/
alta intensidades por si se requiere una menor exposicin
de la muestra a la luz ultravioleta. Algunos tambin permiten la seleccin de entre dos longitudes de onda, lo que los
hace ms exibles. Los epitransiluminadores (365, 480 nm)
generan la emisin visible por uorescencia igual que el
transiluminador pero, a diferencia de ste, la fuente de
energa se encuentra reejada y no pasa a travs de la muestra. El epi-iluminador es efectivo en geles muy densos.
Una vez que se tienen los materiales necesarios existen
dos maneras de realizar la electroforesis: de forma horizontal y vertical.

www.fullengineeringbook.net
100

Figura 12-7. Marcadores de peso molecular para ADN. En la


imagen el primer carril corresponde a las bandas que se obtienen de los fragmentos con un marcador como es el fago Phi
X174 digerido por la enzima Hae III, mientras el segundo carril
muestra los fragmentos de una escalera formada por segmentos sintticos de ADN.

desde 10 hasta 300 kDa), las cuales pueden estar teidas o


coloreadas. En los casos en que la electroforesis sea un paso
previo para la tcnica de Western blot, tambin se dispone
de marcadores de peso molecular de protenas recombinantes que contienen un sitio de unin a inmunoglobulina
(Ig) G. El sitio de unin a IgG puede ser reconocido por un
anticuerpo primario o secundario empleado para la deteccin de la protena buscada por Western blot. Este sistema
es compatible con quimioluminiscencia, el marcaje cromognico y la uorescencia.

Buffer de carga
Este amortiguador tiene como n brindar peso, densidad y
color a la muestra, lo que facilita su depsito en el pocillo
y evita su salida del gel; permite, adems, monitorear el
corrimiento de la muestra en el gel. Se emplea en relacin
1:3 para cidos nucleicos o 1:6 para protenas, respecto a la
cantidad de muestra. El buer de carga de cidos nucleicos

Electroforesis horizontal
Se lleva a cabo con gel de agarosa para cidos nucleicos.
Para el corrimiento el buer debe cubrir el gel, con la nalidad de evitar que se seque por el calentamiento inducido
por el paso de la corriente elctrica. Al momento de cargar
las muestras en los pocillos, se puede optar por hacerlo en
seco; esto es, llenar parcialmente la cmara con lquido de
corrimiento de tal manera que la parte superior del gel no
se cubra de buer para que los pocillos puedan llenarse sin
la interferencia del lquido. Una vez cargada la muestra, se
corre por unos minutos a bajo voltaje hasta que la muestra
entre en el gel y entonces se cubre del todo con el buer de
corrimiento. Tambin existe la tcnica denominada electroforesis submarina, en la que la totalidad del gel se cubre con
buer de corrimiento, desde el momento de cargar las
muestras en los pocillos como se ejemplica en la gura
12-8. En esta tcnica el buer siempre debe cubrir el gel, y
se llama submarina cuando la muestra se coloca con el gel
sumergido en el buer.

Electroforesis vertical
Empleada exclusivamente con gel de poliacrilamida, se utiliza para protenas o cidos nucleicos de pequeo tamao.
El gel debe estar contenido entre dos placas rectangulares

CAPTULO 12 Electroforesis

115

3. Cargar las muestras en el gel.


4. Realizar la corrida electrofortica al voltaje pertinente.
5. Visualizar los cidos nucleicos
Pocillo

Electroforesis de cidos nucleicos

Buffer de
corrimiento
Gel
Cmara de
electroforesis

Figura 12-8. Ejemplicacin de electroforesis submarina. La


muestra se coloca despus de haber vertido el buffer de corrimiento y retirado el peine que sirve de molde para la formacin
de los pocillos.

de vidrio donde la corriente elctrica se genera gracias al


buer en el que se encuentra embebido el gel y llena las
cubetas o compartimientos del nodo y el ctodo como se
aprecia en la gura 12-9.

El mtodo ms comn para la electroforesis de ADN es elaborar un gel horizontal de agarosa, con una concentracin de
0.5 a 2%. La carga elctrica de la molcula de ADN la otorgan
sus grupos fosfato, de carga negativa, y cuyo nmero es igual
al doble del nmero de pares de bases. Dado que la forma de
la molcula de ADN siempre es la misma, la movilidad de la
electroforesis depender nicamente de la longitud del ADN
(pb) y se representar en bandas (gura 12-10). El corrimiento se realiza a voltajes de entre 25 y 100 V; a mayor voltaje
mayor velocidad de corrimiento. El avance electrofortico se
monitorea a travs de la visualizacin de los colorantes (azul
de bromofenol y azul de xileno) contenidos en el buer de
carga con el que se mezcl con la muestra previa a su colocacin en el pocillo. Si los fragmentos de ADN son pequeos
(menos de 50 pb) o bien se requiere discernir entre fragmentos de cidos nucleicos con una diferencia de longitud de 1 a
20 pb, se recomienda utilizar un gel de poliacrilamida que
permita esta resolucin. Las agarosas con un punto de fusin
bajo permiten la preparacin de geles a elevadas concentraciones y se aconseja para obtener una buena separacin de
molculas de ADN con < 1000 pb. Son ideales para preparar
geles analticos de productos procedentes de tcnicas de
reaccin en cadena de la polimerasa (PCR) u otras. Algunas
son capaces de separar fragmentos que dieren entre 10 y 20
pb. Para la preparacin del gel debe estandarizarse primero
qu concentracin de agarosa es la ms adecuada, segn la
muestra que se desee separar.
El volumen de agarosa depende del tamao de la cmara
de electroforesis; 20 a 25 ml son sucientes para las dimen-

www.fullengineeringbook.net

Procedimiento general de una electroforesis

A continuacin, se exponen los pasos de los que consta una


electroforesis tpica.
1. Preparar un gel de agarosa o acrilamida a la concentracin requerida.
2. Mezclar las muestras a analizar con un buer de carga
adecuado.

Buffer interno
Buffe
B
Buffer externo

Figura 12-9. Electroforesis vertical. En esta cmara se aprecia cmo el gel de acrilamida ha quedado embebido en buffer de
corrimiento en su extremo superior gracias a la colocacin de amortiguador en la parte interna de la cmara. El buffer de la parte
externa permite que el polo positivo cuente con la misma solucin buffer que transmita la corriente a la parte inferior del gel.

116

PARTE II Metodologa del ADN recombinante

Mayor intensidad

Mayor tamao
Menor intensidad

Menor tamao

Figura 12-10. Movilidad de fragmentos de ADN. La imagen


muestra fragmentos de ADN de mayor a menor tamao (parte
superior hacia parte inferior) visualizados con un agente intercalante. Se aprecia cmo la intensidad de la banda observada es variable, lo que indica groso modo cul fragmento se
encuentra en mayor cantidad y cul en menor.

cia una fuente de energa, con su pantalla, que indica el


amperaje. Es importante que se estandarice el tiempo de
electroforesis a n de conseguir la mejor resolucin posible.
Durante el corrimiento se monitorea la migracin de la
muestra con colores que contiene el buer de carga, donde
se observa el color azul y el verde correspondientes a los
colorantes azul de bromofenol y azul de xileno, respectivamente. En geles de agarosa, dentro del rango de 0.5 y 1.5%,
el azul de xileno migra de manera similar a un fragmento de
ADN de 4 kb, mientras que el azul de bromofenol se comporta como un fragmento de 300 pb. La electroforesis se
detiene cuando se considera que la muestra se localiza en la
posicin deseada, o bien cuando la muestra ha corrido por
lo menos tres cuartas partes del gel.
Hay mltiples factores que pueden afectar la migracin
del ADN, como la concentracin del gel utilizado, el tamao de la molcula de ADN muestra, el empaquetamiento
del ADN, el voltaje, la temperatura del buer de corrimiento (que puede aumentar demasiado si el voltaje es muy
alto), la contaminacin con agentes intercalantes en la
muestra, la composicin del buer de corrimiento, etctera.

Visualizacin de las muestras


Para la visualizacin de los cidos nucleicos se utiliza un
colorante uorescente, el bromuro de etidio, que tiene la
propiedad de intercalarse entre las bases nitrogenadas del
ADN y el ARN. Debido a esta propiedad es un agente mutagnico y debe manipularse con cuidado. El bromuro de etidio, por lo general, se incorpora a la agarosa (0.5 mg/ml)
antes de permitir la solidicacin, o puede incorporarse luego del corrimiento, incubando el gel en una solucin que lo
contenga a 0.5 mg/ml. El bromuro de etidio uorece de color
naranja cuando se expone a la luz ultravioleta (longitud de

www.fullengineeringbook.net

siones ms comunes del gel: 8 6 0.5 cm (L A A).


Inmediatamente despus de vaciar la agarosa a la cmara,
debe insertarse el o los peines necesarios. La agarosa tarda
en solidicar alrededor de 20 minutos, mientras que la
poliacrilamida, unos 30 minutos. Una vez solidicado el gel,
se aade el buer de corrimiento (TAE o TBE) a concentracin 1, cubriendo perfectamente el gel (0.5 a 1 cm por encima del gel) y se retiran los peines. Las muestras se mezclan
con el buer de carga y se depositan cuidadosamente en los
pocillos, evitando que se salgan y puedan entrar en otros
pozos contaminando el pocillo contiguo. Debe considerarse
el uso de un marcador de peso molecular en, por lo menos,
uno de los carriles, para la determinacin del peso molecular de la muestra. Este marcador tambin debe mezclarse
con un buer de carga, excepto cuando ya viene preparado
para su uso de la casa comercial en que se obtuvo.
Una vez depositadas las muestras en los pocillos se procede a la transmisin de la corriente elctrica. Se conectan
los cables de la fuente de energa de cada polo elctrico a la
cmara de electroforesis en el electrodo que le corresponda
y se aplica un voltaje de acuerdo con el peso molecular
de las molculas de ADN que se va a separar. Para el caso de
productos de PCR (entre 100 pb y 1.5 kb), se recomienda
usar voltajes comprendidos entre 75 y 100 V. Para muestras
de ADN genmico y plasmdico (> 2 kb) se recomienda
aplicar valores de entre 25 y 75 V. En la gura 12-11 se apre-

V
mA

V/A
STOP

RUN/PAUSE

VOLTS/AMPER

Figura 12-11. Fuente de poder. La imagen muestra una tpica


fuente de poder donde se indica el miliamperaje a que est
siendo corrida la muestra. La seleccin de las condiciones de
corrimiento puede ser con un amperaje constante o bien a
voltaje constante, como en este caso.

CAPTULO 12 Electroforesis

A)

117

B)

Figura 12-12. Visualizacin de fragmentos de ADN. Estas fotografas son de un gel de agarosa donde la muestra fue visualizada
por A) bromuro de etidio, y B) Syber-Green.

absorcin de 254 nm, con longitud de emisin de 366 nm).


La seal uorescente es proporcional a la cantidad de producto, como puede observarse en la gura 12-10. Su sensibilidad permite detectar aproximadamente 30 pg de cido
nucleico por banda (segn el grosor del gel). El bromuro de
etidio es teratognico, mutagnico y cancergeno, por lo que
para este procedimiento se recomienda el uso de guantes.
En la actualidad, el bromuro de etidio se ha sustituido por
un compuesto comercial, SYBR Safe, que se une de manera
no covalente a los cidos nucleicos. Este colorante tiene una
uorescencia a 280, una excitacin mxima a 502 nm y
una emisin mxima a 530 nm. Con este colorante, el ADN
puede visualizarse con una luz ultravioleta en el rango de
470 a 530 nm. Por otro lado, el SYBR-Green es un uorforo que se une con gran anidad al surco menor del ADN
bicatenario, y es unas 25 veces ms uorescente que el bromuro de etidio. SYBR-Green con epiiluminacin de 254nm
puede detectar 60 pg de dsADN/banda; 12 ng de oligonucletidos, y 100 a 300 pg de ARN o ssADN/banda. Para los
geles de acrilamida una alternativa al bromuro de etidio es el
nitrato de plata; sin embargo, ste utiliza reactivos peligrosos, como el formaldehdo. Por otro lado, la tincin con plata es ms sensible que el bromuro de etidio, ms barata a
largo plazo y menos txica. En la gura 12-12 se aprecia una
muestra visualizada por bromuro de etidio y otra por SYBR
Safe.

y otro de compactamiento), que dieren en su concentracin, composicin y pH. Los geles estn unidos pero limitados por una fase de separacin visible a contra luz; para
lograrlo deben prepararse por separado esperando la polimerizacin total del primero, para continuar con la del
segundo; de lo contrario, en estado lquido, se mezclaran.
Cabe recordar que en el caso de los geles de acrilamida
para cidos nucleicos slo se tiene una fase, conformada por
el gel de resolucin, donde las molculas de ADN migrarn,
generando un patrn electrofortico, segn su tamao.
Para electroforesis de protenas, la acrilamida se prepara a partir de una solucin al 30% de acrilamida-bisacrilamida 19:1. sta se mezcla con el buer correspondiente y
una solucin de SDS; adems, se aade persulfato de amonio (APS) y N,N,N,N-tetrametiletilenodiamina (TEMED)
como polimerizadores en concentraciones del orden de 1 a
10 mM. El APS genera radicales libres, por lo que es un
iniciador de la reaccin de polimerizacin que nalmente
forma el gel. El TEMED funciona como otro iniciador de
polimerizacin. Las propiedades del gel resultante dependen de la concentracin de APS y TEMED, ya que un
aumento en su concentracin disminuye la longitud media
de la cadena de polmero y, por lo tanto, disminuye su elasticidad y le resta transparencia al gel. Por ello, debe utilizarse la menor concentracin posible de catalizadores que permita la polimerizacin en un tiempo ptimo.
El gel de acrilamida se forma entre dos vidrios, y el sistema completo se sumerge en el buer de corrimiento dentro
de la cmara vertical de electroforesis. En el momento de
sumergir los geles en el tanque, se debe de asegurar que los
pocillos del gel estn totalmente cubiertos por el buer. Es

www.fullengineeringbook.net

Electroforesis de protenas
El mtodo ms empleado para electroforesis de protenas se
lleva a cabo en un sistema discontinuo; es decir, un gel conformado por dos geles de poliacrilamida (uno de resolucin

118

PARTE II Metodologa del ADN recombinante

comn en los geles de acrilamida realizar un precorrimiento


de unos 10 a 30 minutos a voltajes bajos, con el cual se asegura que los pocillos se limpien antes de cargar las muestras.
Para la preparacin de la muestra de protena, se realiza
una reaccin sicoqumica, en la que se rompen enlaces peptdicos y puentes disulfuro por accin de detergentes inicos
(SDS), reactivos reductores (beta-mercaptoetanol) y temperaturas elevadas (95C), que al nal consigue desnaturalizar
la protena hasta su estructura primaria. La muestra mezclada con el buer de carga se deposita con cuidado en los pocillos, evitando la contaminacin del pocillo contiguo. Hay que
considerar el uso de un marcador estndar de protenas para
la medicin del peso molecular de la muestra, que debe
someterse a los mismos tratamientos que la protena, excepto cuando se trate de un marcador previamente teido, en
que el que se obviar el uso del buer de carga.
Una vez colocadas las muestras de protenas en cada
pocillo del gel, se conectan los cables correspondientes de
los electrodos a la fuente de energa, con la seleccin de voltaje o amperaje adecuados. Para el clculo del voltaje es
importante conocer la distancia en centmetros del gel desde la parte superior hasta la parte inferior. La distancia multiplicada por 8-15 V permitir determinar el voltaje del
corrimiento. El voltaje ptimo depender de la molcula
que se piensa separar; en consecuencia, se recomienda
estandarizar este procedimiento. El valor del amperaje o
corriente elctrica (medida en amperios o miliamperios)
depender de la fuerza inica del buer. En el caso de trabajar con buer Tris-SDS-glicina, el valor recomendado es de
25 a 30 mA. La electroforesis se realiza hasta que el colorante, visualizado como una lnea azul, haya llegado a los lmites de la parte inferior del gel.

Muchas variables pueden inuir en la intensidad del


color y todas las protenas tienen caractersticas distintas de
tincin.
Algunas veces, el gel se seca para conservarlo. Para ello,
primero se deshidrata en glicerol-metanol y, posteriormente, se coloca en una lmina de celofn hidrof lico y no plasticado que cubra totalmente el gel. Se cubre el gel con un
segundo celofn previamente remojado en agua y se sella
con calor. Aqu se deja secar en condiciones ambientales
por aproximadamente dos das o se acelera el proceso con
el uso de desecadores de geles.
Algunas protenas pueden migrar anmalamente y aparecer con un peso molecular mayor que el esperado; esto
puede deberse a que presentan modicaciones postraduccionales en su estructura, como residuos de glicosilacin,
fosforilacin y acetilacin, que podran retardar la migracin de las muestras. Asimismo, si existe desnaturalizacin
de las protenas, se considera que la protena est degradada
y suelen aparecer manchas difusas en todo el carril.

Aplicaciones de la electroforesis
Algunos de los usos de la electroforesis para cidos nucleicos en geles de agarosa son determinar los tamaos moleculares de los cidos nucleicos, analizar los fragmentos
cortados con enzimas de restriccin (mapa de restriccin),
comparar los tamaos de distintos tipos de ADN, aislar y
recuperar fragmentos de ADN puricados para clonaciones moleculares, y analizar productos de PCR, entre otros.
Asimismo, la electroforesis puede ser un proceso previo a
las tcnicas de hibridacin, como el Southern blot (ADN) o
el Northern blot (ARN), donde la presencia de determinada
secuencia del cido nucleico en una mezcla de molculas se
distingue por su tamao, la cual se conrma por hibridacin con una sonda especca. En el caso de las protenas, la
electroforesis se aplica para la identicacin de fracciones
proteicas o protenas particulares por tamao, como es el
caso de la electroforesis de globulinas, o protenas sricas;
pero, sobre todo, para la identicacin de molculas particulares empleando posteriormente una reaccin antgenoanticuerpo especca en la tcnica de Western blot. Asimismo, la electroforesis es crucial en tcnicas como la
secuenciacin, donde tras un corrimiento electrofortico
de las cuatro reacciones de elongacin con los dideoxinucletidos (vase el captulo 17, Secuenciacin), se puede
deducir la secuencia del segmento de cido nucleico. Inclusive, los secuenciadores automticos modernos emplean
una electroforesis capilar para el discernimiento de la
secuencia. Tambin, los termocicladores en tiempo real
basan la deteccin de los fragmentos amplicados en una
electroforesis capilar, donde es posible la deteccin inmediata de los segmentos amplicados y su lectura por el lser
correspondiente al urocromo con que el producto est
marcado.

www.fullengineeringbook.net

Visualizacin de las muestras


Si se requiere, el gel se sumerge en un recipiente conteniendo el colorante azul brillante de Coomasie y se incuba por
unos minutos, lo que permitir la visualizacin de las bandas de protenas. El proceso de coloracin se basa en la
atraccin electrosttica del enlace peptdico de las protenas sobre grupos de cido sulfnico, que tien la protena
de color azul. Asimismo, las fuerzas de Van der Waals y las
interacciones hidrofbicas participan en este proceso de
unin mecnica. La tincin de Coomassie Blue clsica, normalmente puede detectar bandas de protena de 50 ng,
mientras que la tincin con plata incrementa este lmite de
sensibilidad unas 50 veces. La tincin con plata consiste en
desarrollar el color en el gel por incubacin en soluciones
de metano al l40%: cido actico al 10%, luego metanolal
40%, seguido de agua y posteriormente tiosulfato de sodio
al 0.01%. Despus de este proceso se lava y se procede a la
incubacin en fro (4C) en cloruro de plata al 0.1%; posteriormente, se lava e incuba con carbonato de sodio al 2% en
formalina al 0.04% (llamada tambin formol al 35%), que
acta como revelador. Por ltimo, se incuba con soluciones
de cido actico antes de fotograar o escanear.

CAPTULO 12 Electroforesis

119

1650 pb

1000 pb

500 pb

300 pb
200 pb

100 pb

Figura 12-13.

www.fullengineeringbook.net
Ejercicios de integracin
Basndose en la imagen de una electroforesis de agarosa
para fragmentos de ADN representada en la imagen, indique:
1. De qu peso molecular es la banda de menor tamao
del carril C.
2. De qu peso molecular es la banda de mayor tamao del
carril D.
3. En qu carril y qu peso molecular presenta la banda que
tiene mayor concentracin.

4. En qu carril y qu peso tiene la banda de menor concentracin.


5. Suponiendo que son muestras de ADN digeridas por
enzimas de restriccin, qu carriles contienen aparentemente la misma muestra. Explique su respuesta.
6. En qu carril se localiza el marcador de peso molecular.
7. El sentido de corrimiento de las muestras con una echa.
8. La polaridad correspondiente a cada extremo del gel.

Bibliografa
Guo Y., Li X., Fang Y. The eects of electroendosmosis in agarose

electrophoresis. Electrophoresis, 1998;19:1311-1213.


Sambrook J., Russell D.W. Gel electrophoresis of DNA and pulsedeld agarose gel electrophoresis. En: Molecular cloning a labora-

tory manual, 3 ed. Nueva York: Cold Spring Harbor Laboratory


Press, 2001.

Captulo

13

Enzimas de restriccin
Jaime Gonzlez Cuevas / Miriam Ruth Bueno Topete

Introduccin

secuencia diana. El uso de estas enzimas como herramienta


biotecnolgica surgi de la necesidad de cortar las largas
cadenas de ADN genmico para manipularse y analizarse
en fragmentos ms pequeos. El empleo de las enzimas de
restriccin y otras enzimas que modican cidos nucleicos,
como la ligasa, permiti desarrollar la metodologa del
ADN recombinante.
En 1960, Stewart Linny y Werner Arber aislaron, en E.
coli, enzimas que metilaban molculas de ADN y que ademas cortaban un enlace fosfodister del ADN no metilado.
Ms tarde, en 1970, se caracteriz la primera nucleasa de
restriccin por Daniel Nathans Hamilton Smith, aislada
de Haemophilus inuenzae, denominada Hind I. En la
actualidad, se sabe que todas las especies de bacterias sintetizan uno o ms tipos de endonucleasas capaces de hacer
cortes en secuencias especcas de nucletidos de una
doble cadena de ADN exgeno; generalmente, este ADN
extrao es el proveniente de los bacterifagos, virus con
capacidad de infectar a dichas bacterias.
Estas endonucleasas se denominan enzimas de restriccin debido a que restringen la permanencia de un ADN
exgeno en la clula bacteriana que produce dicha enzima.
Las enzimas de restriccin empleadas con ms frecuencia
en la metodologa del ADN recombinante suelen reconocer
una secuencia nica de 4 a 8 nucletidos, donde realizan el
corte.

El descubrimiento, la caracterizacin y el aislamiento de los


diferentes tipos de enzimas ha facilitado en la investigacin
las tareas del estudio de los genomas as como su expresin,
su regulacin y su posterior correlacin con el desarrollo de
diversas enfermedades. Hoy por hoy es comn la aplicacin
de tcnicas de biologa molecular en diversas reas, y en
particular en las ciencias de la salud, ya que han revolucionado los mtodos analticos generando gran impacto en la
investigacin bsica y la clnica, especialmente en el diagnstico de enfermedades.
Las enzimas de restriccin son una herramienta primordial para la ejecucin de diversos ensayos tiles en investigacin clnica, desde la determinacin de polimorsmos de
longitud de fragmentos de restriccin (restriction fragment
length polymorphism, RFLP), as como en la construccin de
vectores con ADN recombinante y clonacin de secuencias
de ADN provenientes de humano, virus, bacterias y dems
microorganismos de inters para la generacin de conocimiento o para su aplicacin en el rea de la medicina. Entre
las enzimas que modican los cidos nucleicos se encuentran las nucleasas, es decir, aquellas capaces de cortar los
enlaces fosfodister que unen los nucletidos de una cadena
de cidos nucleicos. Las nucleasas se denominan endonucleasas si son capaces de cortar el enlace fosfodister en
nucletidos localizados dentro de la cadena del cido nucleico, y reciben el nombre de exonucleasas si cortan los enlaces
fosfodister de los nucletidos en los extremos de las cadenas. As, existen 3exonucleasas las que escinden enlaces en
el extremo 3 de la cadena, y 5exonucleasas que rompen
enlaces fosfodister en el extremo 5 de la cadena.
Las enzimas de restriccin presentan actividad endonucleasa, son de origen bacteriano y cortan los enlaces fosfodister del ADN en una secuencia especca denominada

www.fullengineeringbook.net

Origen de las enzimas de restriccin


Las endonucleasas de restriccin forman parte de la maquinaria con la que cuenta la bacteria para defenderse de infecciones virales. El ADN de la bacteria que produce la enzima
de restriccin no se ve afectado por su propia enzima, ya
que las bacterias metilan determinadas secuencias a su propio ADN para diferenciarlo del ADN viral por medio de
120

CAPTULO 13 Enzimas de restriccin

121

Cuadro 13-1. Caractersticas de las enzimas de restriccin tipo III.


Tipo de enzima

Gasto energtico

ATP

Sitio de corte en el ADN


Aleatorio, fuera de la secuencia diana.

II

Especco, en la secuencia diana.

No

III

ATP

Aleatorio, 25 a 27 pares de bases


corriente abajo de la secuencia diana.

una enzima metiltransferasa en bases especcas, que generalmente son las reconocidas por sus propias enzimas de
restriccin.

Nomenclatura
Por acuerdo internacional, la nomenclatura de las enzimas
de restriccin se asigna segn su origen bacteriano y se
dene basndose en las siguientes reglas:
1. Tres letras en cursiva que corresponden al nombre
cientco de la bacteria de donde fue atrada (p. ej.,
Escherichia coli (Eco); Haemophilus inuenzae (Hin),
etc.). La primera letra, en mayscula, corresponde al
gnero; las otras dos, a la especie.
2. La cepa o estirpe, si la hubiese (p. ej., EcoR, aislada de la
cepa RY13 de E. coli).
3. En nmeros romanos, un nmero para distinguir si hay
ms de una endonucleasa aislada de esa misma especie
(p. ej., EcoRI, EcoRV).
4. Todas deberan indicar con una R por restriccin o
una M por metilasa, segn la funcin de la enzima,
pero generalmente se omite.

Actividad de metilasa

lo largo de la molcula de ADN desde el lugar de reconocimiento hasta el sitio de corte.

Tipo II
Son enzimas que reconocen secuencias especcas y hacen
el corte de la doble cadena de ADN en el mismo sitio de
reconocimiento. Estas enzimas slo tienen actividad de restriccin no de metilacin y son las utilizadas en ingeniera
gentica, ya que cortan el ADN en secuencias especcas
reconocidas. Requieren Mg2+ como cofactor y no requieren
de ADN. Las secuencias de reconocimiento de estas enzimas son palindrmicas, es decir, son secuencias que se leen
igual en las dos cadenas de ADN. Por ejemplo: Por ejemplo:
5 GGATCC 3GATCC 3
3 CCTAGG 5CCTAGG 5

www.fullengineeringbook.net

Por ejemplo:
Hind III:
H = genero Haemophilus.
in = especie inuenzae.
d = cepa DSM 11121.
III = tercera endonucleasa aislada en este organismo.
Eco RI:
E = gnero Escherichia.
co = especie coli.
R = cepa RV 13.
I = primera endonucleasa aislada de esta cepa.

Clasicacin de enzimas de restriccin


De acuerdo a su funcin las enzimas de restriccin se han
clasicado en tipo I, II, III.

Tipo I
Las enzimas que pertenecen a este grupo reconocen una
secuencia especca de nucletidos y hacen un corte aleatorio en la doble cadena en cualquier secuencia del ADN y a
una distancia aproximada de 1000 pb del sitio de corte; adems tienen la funcin de metilar su propio genoma. Estas
enzimas necesitan adenosn trifosfato (ATP) para moverse a

Tipo III

Estas enzimas reconocen una secuencia especca y cortan el


ADN de doble cadena fuera de la secuencia diana (aproximadamente de 25 a 27 pares de bases corriente abajo del sitio de
reconocimiento). Tienen, al igual de las de tipo I, actividad de
metilasa y requieren de ATP para desplazarse a lo largo de la
molcula de ADN. Las caractersticas de los diferentes tipos
de enzimas, de restriccion se resumen en el cuadro 13-1.

Aplicaciones de las enzimas de restriccin


Las enzimas de restriccin son una herramienta bsica en
clonacin e ingeniera gentica; se utilizan, entre otros
nes, para hacer mapas de restriccin de plsmidos o genomas. Un mapa de restriccin se dene como la serie de fragmentos que se generan por el corte con determinada(s)
enzima(s), especcos en tamao (y secuencia) y que permiten emplearlos para la caracterizacin de dicho ADN.
Esta herramienta es sumamente importante para la clonacin con vectores. Tambin, en estudios de determinacin
de polimorsmos, como la tcnica de RFLP , segn se presente o no el sitio de corte de una enzima de restriccin, se
puede establecer la variante allica, ya que el peso molecular del fragmento o fragmentos de ADN generado(s) permitir la caracterizacin de la secuencia. Asimismo, la construccin de molculas de ADN recombinante implica el
obvio empleo de las enzimas de restriccin para denir y
delimitar las secuencias que se insertarn en el constructo
recombinante. De la misma manera, el corte de ADN gen-

122

PARTE II Metodologa del ADN recombinante

Cuadro 13-2. Cortes cohesivos.


Enzima

Bacteria origen

Secuencia de reconocimiento

Productos del corte

EcoRI

Escherichia coli

5GAATTC
3CTTAAG

5---G AATTC---3
3---CTTAA G---5

BamHI

Bacillus amyloliquefaciens

5GGATCC
3CCTAGG

5---G GATCC---3
3---CCTAG G---5

HindIII

Haemophilus inuenzae

5AAGCTT
3TTCGAA

5---A AGCTT---3
3---TTCGA A---5

TaqI

Thermus aquaticus

5TCGA
3AGCT

5---T CGA---3
3---AGC T---5

NotI

Nocardia otitidis

5GCGGCCGC
3CGCCGGCG

5---GC GGCCGC---3
3---CGCCGG CG---5

HinfI

Haemophilus inuenzae

5GANTC
3CTNAG

5---G ANTC---3
3---CTNA G---5

Sau3A

Staphylococcus aureus

5GATC
3CTAG

5--- GATC---3
3---CTAG ---5

PovII

Proteus vulgaris

5CAGCTG
3GTCGAC

5---CAG CTG---3
3---GTC GAC---5

SmaI

Serratia marcescens

5CCCGGG
3GGGCCC

5---CCC GGG---3
3---GGG CCC---5

HaeIII

Haemophilus egytius

5GGCC
3CCGG

5---GG CC---3
3---CC GG---5

AluI

Arthrobacter luteus

5AGCT
3TCGA

5---AG CT---3
3---TC GA---5

EcoRV

Escherichia coli

5GATATC
3CTATAG

5---GAT ATC---3
3---CTA TAG---5

KpnI

Klebsiella pneumonia

5GGTACC
3CCATGG

5---GGTAC C---3
3---C CATGG---5

www.fullengineeringbook.net

PstI

Providencia stuartii

5CTGCAG
3GACGTC

5---CTGCA G---3
3---G ACGTC---5

SacI

Streptomyces achromogenes

5GAGCTC
3CTCGAG

5---GAGCT C---3
3---C TCGAG---5

SalI

Streptomyces albue

5GTCGAC
3CAGCTG

5---G TCGAC---3
3---CAGCT G---5

SphI

Streptomyces phaeochromogenes

5GCATGC
3CGTACG

5---G CATGC---3
3---CGTAC G---5

XbaI

Xanthomonas badrii

5TCTAGA
3AGATCT

5---T CTAGA---3
3---AGATC T---5

mico que suele ser, segn el organismo, del orden de millones de pb, es ms manipulable cuando es digerido por estas
enzimas en fragmentos ms pequeos. Esto permite un
manejo adecuados sin el riesgo de degradaciny manipulacin lacin para la construccin de bibliotecas genmicas,
que se discuten en el captulo de vectores de clonacin.

Tipos de cortes producidos por


las enzimas de restriccin
Los cortes que realizan las enzimas de restriccin sobre la
cadena de ADN pueden generar dos estructuras o formas:
cohesivas o romas. Los cortes cohesivos, tambin llamados
pegajosos, se generan porque la enzima corta en cada cadena de ADN entre nucletidos localizados en posiciones diferentes respecto al eje de simetra de la secuencia de diana.

Estos cortes generan extremos monocatenarios en un segmento de 3 a 5 bases de longitud, por lo que en esta fraccin
la falta de cadena complementaria facilita su interaccin con
otro fragmento en monocadena con secuencia complementaria, como se muestra en el cuadro 13-2. Los extremos as
generados propician la unin especca entre segmentos
diferentes de ADN, pero cortados por la misma enzima, lo
que origina condiciones idneas de unin especca para la
produccin de ADN recombinante. Los extremos romos se
generan porque la enzima corta en ambas cadenas de ADN
sobre un mismo eje, por lo que dichos extremos son de
doble cadena, y la unin entre fragmentos de ADN con
extremos romos es ms inespecca, ya que no depende de
la complementariedad de regiones monocadena. En la gura 13-1 se muestran las enzimas que generan extremos
cohesivos o pegajosos (EcoRI, BamHI, HindIII), y en la gura
13-2 las enzimas que generan extremos romos (SspI, SmaI).

123

CAPTULO 13 Enzimas de restriccin

Isoesquizomeros

Cortes cohesivos o pegajosos

G A A T T C

Asp718

EcoRI
C T T A A G

C C A T
C T T A A

G G A T C C

G T A C

A A T T C

G A T C C

G G T A

BamHI
C C T A G G

Kpnl
C C T A G

Figura 13-3. Isoesquizomeros.

Figura 13-1. Cortes cohesivos o pegajosos.

Isoesquizmeros
Se denomina isoesquizmeros a las enzimas de restriccin
obtenidas de diferente especie bacteriana pero que reconocen la misma secuencia diana de ADN y cortan entre diferentes nucletidos de dicha secuencia (por ejemplo, Asp718
y KpnI). Ambas reconocen la secuencia 5GGTAC3 pero
ASp718 corta el enlace entre GG mientras KpnI corta entre
los nucletidos AC, como se describe en la gura 13-3.

C A T G

ejemplo de familia es: BamHI y BclII, que reconocen las


secuencias diana 5GGATCC3 y 5AGATCT3, respectivamente, pero que generan extremos cohesivos idnticos:
5GATC3.
BamH I:

5---G
3---CCTAG

GATCC---3
G---5

Bgl II:

5---A
3---TCTAG

GATCT---3
C---5

www.fullengineeringbook.net

Familias de enzimas de restriccin


Una familia de enzimas de restriccin est formada por
aquellas que no necesariamente reconocen la misma secuencia diana, pero producen extremos cohesivos similares. Un

Esta caracterstica favorece que dos fragmentos cortados con estas enzimas puedan recombinarse de manera
especca gracias a la complementariedad de sus bases en
los extremos cohesivos generados, como se muestra en la
gura 13-4.

Bgl II

A A T A T T

A A T

A T T

T T A

T A A

Bam HI

G A T C T

G A T C C

SspI
T T A T A A

C C C G G G

C C C

G G G

G G G

C C C

T A

G A T C

Smal
G G G C C C

Figura 13-2. Cortes romos.

T A G

Figura 13-4. Familias de enzimas.

124

PARTE II Metodologa del ADN recombinante

Factores que afectan la actividad de las


enzimas de restriccin
Entre los factores que ms afectan la actividad de las enzimas de restriccin se encuentran:

La pureza biolgica del ADN. Contaminacin de la


muestra con otros ADN impide el buen funcionamiento
de las enzimas.
Los contaminantes como detergentes y estabilizadores
(docedil sulfato de sodio SDS, cido etilendiaminotetraactico EDTA), ya que concentraciones elevadas
de sales y detergentes inhiben la actividad enzimtica.
Modicaciones en el pH y temperatura de incubacin.
Variaciones leves en estos parmetros inhiben enormemente la actividad de las enzimas.
El grado de metilacin del ADN, ya que algunas enzimas son inhibidas por metilacin en ciertas secuencias.

Condiciones de almacenamiento y
conservacin de las enzimas de restriccin
Las enzimas de restriccin, al igual que muchas otras protenas, pueden disminuir su vida media y en consecuencia
su actividad, al ser conservadas y manejadas de forma
inadecuada fuera de su rango ideal de temperatura; deben
conservarse a -20C, as que para evitar su congelamiento y
su consecuente prdida de actividad son diluidas en un
volumen determinado de glicerol. Para usarlas se requiere
un contenedor que asegure la menor variacin de temperatura posible.

tipo de corte, as como el nmero y tamao de cada fragmento generado. En el caso del ADN genmico es necesario conocer la secuencia completa con la que se va a trabajar
para conocer los sitios de corte y predecir el nmero y
tamao de los fragmentos. Se realiza ingresando dicha
secuencia a una base de datos especializada para estudios
de restriccin y, de esta manera, se obtiene un listado de las
posibles enzimas que reconocen la secuencia diana. Se elige
la enzima tomando en cuenta las caractersticas experimentales ajustndose al objetivo perseguido.

Eciencia en el uso de las enzimas de


restriccin
Las hojas de instrucciones o insertos que facilita el proveedor incluyen las caractersticas y descripcin de las condiciones ptimas de actividad de las enzimas de restriccin
disponibles comercialmente. Dichas condiciones estn
ajustadas para el volumen de reaccin requerido, de acuerdo a la tecnologa que se requiere aplicar. Se debe tener en
cuenta la temperatura ptima de accin, presentacin
comercial de la enzima (unidades de enzima por microlitro), tiempo de incubacin, as como los posibles requerimientos de aditivos, como albmina, ATP, etctera.

www.fullengineeringbook.net

Seleccin de la enzima de restriccin


adecuada
Todos los organismos cuentan con un mapa de restriccin
que indica la posicin donde se encuentran los sitios de
corte para muchas de las enzimas conocidas. Cuando se
pretende realizar el corte en un plsmido conocido o
comercial, por ejemplo, se revisa el mapa de restriccin, el
cual ofrece un listado en orden alfabtico de las enzimas
que son capaces de cortar dicho ADN, el sitio de corte, el

Cantidad de enzima adecuada para un


ensayo

La cantidad de enzima utilizada en una reaccin depender


de la concentracin de ADN en la muestra a digerir. La concentracin de la enzima est descrita en la hoja de instrucciones del proveedor, como unidades por microlitro (u/l).
Una unidad de enzima se dene como la cantidad de enzima requerida para producir la digestin completa de un
microgramo de ADN sustrato en 60 minutos a la temperatura ptima de accin de la enzima. El tiempo de incubacin de la reaccin puede ser incrementado si la enzima
utilizada est cerca de su fecha de caducidad y su actividad
est mermando. Sin embargo, el tiempo no debe incrementarse demasiado, pues aunque el ADN es una molcula
resistente, se corre el riesgo de su degradacin.

Preguntas de repaso
1. Cules son las condiciones de almacn y conservacin
de las enzimas de restriccin?
2. Cmo se determina la enzima de restriccin ideal para
realizar un corte en una secuencia especca de ADN?
3. Cmo se logra la mayor eciencia en la actividad de las
enzimas de restriccin?

4. Cmo se determina la cantidad de enzima de restriccin


para un ensayo?
5. Aumenta la eciencia de la actividad de restriccin si se
rebasa el tiempo recomendado de incubacin?

CAPTULO 13 Enzimas de restriccin

125

Ejercicios de integracin
Instrucciones: A continuacin se presenta la secuencia de
ADN de un plsmido que consta de 4650 pares de bases.
1. Identique los sitios de restriccin en la cadena en base a
la secuencia de nucletidos de las siguientes enzimas de
restriccin.
AatII: 5 G A C G T--C 3
BspHI: 5 T--C A T G A 3
1 CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG
51 CCCGGGCGTC GGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC
101 GCGCAGAGAG GGAGTGGCCA ACTCCATCAC TAGGGGTTCC TGCGGCCGCA
151 CGCGTGGAGC TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT
201 AGCCCATATA TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC
251 TGGCTGACCG CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG
301 TTCCCATAGT AACGTCAATA GGGACTTTCC ATTGACGTCA ATGGGTGGAG
351 TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC
401 AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT
451 ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC
501 GTATTAGTCA TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA
551 TGGGCGTGGA TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA
601 TTGACGTCAA TGGGAGTTTG TTTTGCACCA AAATCAACGG GACTTTCCAA
651 AATGTCGTAA CAACTCCGCC CCATTGACGC AAATGGGCGG TAGGCGTGTA
701 CGGTGGGAGG TCTATATAAG CAGAGCTCGT TTAGTGAACC GTCAGATCGC

2151 AGCGCGGCGG GTGTGGTGGT TACGCGCAGC GTGACCGCTA CACTTGCCAG


2201 CGCCCTAGCG CCCGCTCCTT TCGCTTTCTT CCCTTCCTTT CTCGCCACGT
2251 TCGCCGGCTT TCCCCGTCAA GCTCTAAATC GGGGGCTCCC TTTAGGGTTC
2301 CGATTTAGTG CTTTACGGCA CCTCGACCCC AAAAAACTTG ATTTGGGTGA
2351 TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTTTT CGCCCTTTGA
2401 CGTTGGAGTC CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGGAACA
2451 ACACTCAACC CTATCTCGGG CTATTCTTTT GATTTATAAG GGATTTTGCC
2501 GATTTCGGCC TATTGGTTAA AAAATGAGCT GATTTAACAA AAATTTAACG
2551 CGAATTTTAA CAAAATATTA ACGTTTACAA TTTTATGGTG CACTCTCAGT
2601 ACAATCTGCT CTGATGCCGC ATAGTTAAGC CAGCCCCGAC ACCCGCCAAC
2651 ACCCGCTGAC GCGCCCTGAC GGGCTTGTCT GCTCCCGGCA TCCGCTTACA
2701 GACAAGCTGT GACCGTCTCC GGGAGCTGCA TGTGTCAGAG GTTTTCACCG
2751 TCATCACCGA AACGCGCGAG ACGAAAGGGC CTCGTGATAC GCCTATTTTT
2801 ATAGGTTAAT GTCATGATAA TAATGGTTTC TTAGACGTCA GGTGGCACTT
2851 TTCGGGGAAA TGTGCGCGGA ACCCCTATTT GTTTATTTTT CTAAATACAT
2901 TCAAATATGT ATCCGCTCAT GAGACAATAA CCCTGATAAA TGCTTCAATA
2951 ATATTGAAAA AGGAAGAGTA TGAGTATTCA ACATTTCCGT GTCGCCCTTA
3001 TTCCCTTTTT TGCGGCATTT TGCCTTCCTG TTTTTGCTCA CCCAGAAACG
3051 CTGGTGAAAG TAAAAGATGC TGAAGATCAG TTGGGTGCAC GAGTGGGTTA
3101 CATCGAACTG GATCTCAACA GCGGTAAGAT CCTTGAGAGT TTTCGCCCCG
3151 AAGAACGTTT TCCAATGATG AGCACTTTTA AAGTTCTGCT ATGTGGCGCG
3201 GTATTATCCC GTATTGACGC CGGGCAAGAG CAACTCGGTC GCCGCATACA
3251 CTATTCTCAG AATGACTTGG TTGAGTACTC ACCAGTCACA GAAAAGCATC

www.fullengineeringbook.net
751 CTGGAGACGC CATCCACGCT GTTTTGACCT CCATAGAAGA CACCGGGACC

801 GATCCAGCCT CCGCGGATTC GAATCCCGGC CGGGAACGGT GCATTGGAAC

851 GCGGATTCCC CGTGCCAAGA GTGACGTAAG TACCGCCTAT AGAGTCTATA


901 GGCCCACAAA AAATGCTTTC TTCTTTTAAT ATACTTTTTT GTTTATCTTA
951 TTTCTAATAC TTTCCCTAAT CTCTTTCTTT CAGGGCAATA ATGATACAAT

1001 GTATCATGCC TCTTTGCACC ATTCTAAAGA ATAACAGTGA TAATTTCTGG


1051 GTTAAGGCAA TAGCAATATT TCTGCATATA AATATTTCTG CATATAAATT
1101 GTAACTGATG TAAGAGGTTT CATATTGCTA ATAGCAGCTA CAATCCAGCT
1151 ACCATTCTGC TTTTATTTTA TGGTTGGGAT AAGGCTGGAT TATTCTGAGT
1201 CCAAGCTAGG CCCTTTTGCT AATCATGTTC ATACCTCTTA TCTTCCTCCC
1251 ACAGCTCCTG GGCAACGTGC TGGTCTGTGT GCTGGCCCAT CACTTTGGCA
1301 AAGAATTGGG ATTCGAACAT CGATTGAATT CCCCGGGGAT CCTCTAGAGT
1351 CGACCTGCAG AAGCTTGCCT CGAGCAGCGC TGCTCGAGAG ATCTACGGGT
1401 GGCATCCCTG TGACCCCTCC CCAGTGCCTC TCCTGGCCCT GGAAGTTGCC
1451 ACTCCAGTGC CCACCAGCCT TGTCCTAATA AAATTAAGTT GCATCATTTT
1501 GTCTGACTAG GTGTCCTTCT ATAATATTAT GGGGTGGAGG GGGGTGGTAT
1551 GGAGCAAGGG GCAAGTTGGG AAGACAACCT GTAGGGCCTG CGGGGTCTAT
1601 TGGGAACCAA GCTGGAGTGC AGTGGCACAA TCTTGGCTCA CTGCAATCTC
1651 CGCCTCCTGG GTTCAAGCGA TTCTCCTGCC TCAGCCTCCC GAGTTGTTGG
1701 GATTCCAGGC ATGCATGACC AGGCTCAGCT AATTTTTGTT TTTTTGGTAG
1751 AGACGGGGTT TCACCATATT GGCCAGGCTG GTCTCCAACT CCTAATCTCA
1801 GGTGATCTAC CCACCTTGGC CTCCCAAATT GCTGGGATTA CAGGCGTGAA
1851 CCACTGCTCC CTTCCCTGTC CTTCTGATTT TGTAGGTAAC CACGTGCGGA
1901 CCGAGCGGCC GCAGGAACCC CTAGTGATGG AGTTGGCCAC TCCCTCTCTG
1951 CGCGCTCGCT CGCTCACTGA GGCCGGGCGA CCAAAGGTCG CCCGACGCCC
2001 GGGCTTTGCC CGGGCGGCCT CAGTGAGCGA GCGAGCGCGC AGCTGCCTGC
2051 AGGGGCGCCT GATGCGGTAT TTTCTCCTTA CGCATCTGTG CGGTATTTCA
2101 CACCGCATAC GTCAAAGCAA CCATAGTACG CGCCCTGTAG CGGCGCATTA

3301 TTACGGATGG CATGACAGTA AGAGAATTAT GCAGTGCTGC CATAACCATG

3351 AGTGATAACA CTGCGGCCAA CTTACTTCTG ACAACGATCG GAGGACCGAA

3401 GGAGCTAACC GCTTTTTTGC ACAACATGGG GGATCATGTA ACTCGCCTTG

3451 ATCGTTGGGA ACCGGAGCTG AATGAAGCCA TACCAAACGA CGAGCGTGAC


3501 ACCACGATGC CTGTAGCAAT GGCAACAACG TTGCGCAAAC TATTAACTGG
3551 CGAACTACTT ACTCTAGCTT CCCGGCAACA ATTAATAGAC TGGATGGAGG
3601 CGGATAAAGT TGCAGGACCA CTTCTGCGCT CGGCCCTTCC GGCTGGCTGG
3651 TTTATTGCTG ATAAATCTGG AGCCGGTGAG CGTGGGTCTC GCGGTATCAT
3701 TGCAGCACTG GGGCCAGATG GTAAGCCCTC CCGTATCGTA GTTATCTACA
3751 CGACGGGGAG TCAGGCAACT ATGGATGAAC GAAATAGACA GATCGCTGAG
3801 ATAGGTGCCT CACTGATTAA GCATTGGTAA CTGTCAGACC AAGTTTACTC
3851 ATATATACTT TAGATTGATT TAAAACTTCA TTTTTAATTT AAAAGGATCT
3901 AGGTGAAGAT CCTTTTTGAT AATCTCATGA CCAAAATCCC TTAACGTGAG
3951 TTTTCGTTCC ACTGAGCGTC AGACCCCGTA GAAAAGATCA AAGGATCTTC
4001 TTGAGATCCT TTTTTTCTGC GCGTAATCTG CTGCTTGCAA ACAAAAAAAC
4051 CACCGCTACC AGCGGTGGTT TGTTTGCCGG ATCAAGAGCT ACCAACTCTT
4101 TTTCCGAAGG TAACTGGCTT CAGCAGAGCG CAGATACCAA ATACTGTCCT
4151 TCTAGTGTAG CCGTAGTTAG GCCACCACTT CAAGAACTCT GTAGCACCGC
4201 CTACATACCT CGCTCTGCTA ATCCTGTTAC CAGTGGCTGC TGCCAGTGGC
4251 GATAAGTCGT GTCTTACCGG GTTGGACTCA AGACGATAGT TACCGGATAA
4301 GGCGCAGCGG TCGGGCTGAA CGGGGGGTTC GTGCACACAG CCCAGCTTGG
4351 AGCGAACGAC CTACACCGAA CTGAGATACC TACAGCGTGA GCTATGAGAA
4401 AGCGCCACGC TTCCCGAAGG GAGAAAGGCG GACAGGTATC CGGTAAGCGG
4451 CAGGGTCGGA ACAGGAGAGC GCACGAGGGA GCTTCCAGGG GGAAACGCCT
4501 GGTATCTTTA TAGTCCTGTC GGGTTTCGCC ACCTCTGACT TGAGCGTCGA
4551 TTTTTGTGAT GCTCGTCAGG GGGGCGGAGC CTATGGAAAA ACGCCAGCAA
4601 CGCGGCCTTT TTACGGTTCC TGGCCTTTTG CTGGCCTTTT GCTCACATGT

126

PARTE II Metodologa del ADN recombinante

2. En el siguiente esquema, determine los pares de bases de los fragmentos resultantes despus del corte y complete el mapa
de restriccin del plsmido.

4650 bp
e

3. El corte con las siguientes enzimas de restriccin genera fragmentos de ADN los cuales sern analizados mediante electroforesis en gel. Indique de manera aproximada de acuerdo a su peso molecular las bandas que estos segmentos de ADN
generaran.

Marcador

AatII

BsphI

AatII +
BsphI

4000 p.b.

www.fullengineeringbook.net
3000 p.b.

2000 p.b.
1000 p.b.
500 p.b.

250 p.b.
100 p.b.

Bibliografa
Glick B.R., Pasternak J.J. Molecular biotechnology, principles and

applications of recombinant ADN, 2 ed. Washington: ASM


Press, 1998.
Lewin B. Genes VIII, 8 ed. Upper Saddle River, Nueva Jersey: Pearson/Prentice-Hall, 2004.

Nelson D., Cox M. Lehninger Principles of Biochemistry, 4 ed. Nueva

York: Freeman, 2005.


Smith C.A., Wood E.J. Biologa molecular y biotecnologa. Mxico,

DF: Addison Wesley Longman, 1998.

Captulo

14

Vectores de clonacin
y expresin
Ana Soledad Sandoval Rodrguez / Mayra Mena Enrquez
Ana Laura Mrquez Aguirre

Introduccin

dentro de una molcula de ADN denominada vector, que


puede replicarse de manera autnoma e independiente del
genoma de la clula hospedera. El resultado es la obtencin
de millones de copias de una molcula recombinante o
clona molecular compuesta por ADN proveniente del
inserto y del vector.
El inserto puede ser ADN obtenido de cualquier organismo y puede permanecer como ADN genmico (ADNg),
ADN complementario (ADNc), producto de la retrotranscipcin del ARN, un producto de PCR o un ARN obtenido
por transcripcin in vitro.

Hasta la dcada de 1970, el ADN era una molcula cuyo anlisis era sumamente problemtico, ya que era demasiado larga y estaba formada slo por cuatro monmeros. En esa
poca la secuencia de nucletidos del ADN slo haba podido estudiarse indirectamente a travs de la secuencia de aminocidos en las protenas o por su expresin en el ARN. Por
ello, el descubrimiento de las enzimas de restriccin facilit
el estudio del ADN, ya que gracias a ellas fue posible seccionar molculas grandes de ADN y separarlas en fragmentos.
Cada uno de esos fragmentos se analizaba por separado y fue
posible multiplicarlos a travs de la tcnica de reaccin en
cadena de la polimerasa (PCR; vase el captulo de PCR), e
incluso determinar la secuencia de sus nucletidos por
secuenciacin. Los procesos tcnicos que forman parte de la
metodologa del ADN recombinante son, en gran parte,
adaptaciones de procesos naturales de la gentica microbiana o eucariota, mezclados con tcnicas novedosas e ingeniosas. Gracias a la especicidad del reconocimiento de las
secuencias que pueden ser cortadas por las enzimas de restriccin ha sido posible la identicacin, el aislamiento y la
clonacin de fragmentos de ADN provenientes de diferentes
organismos, para producir molculas de ADN recombinante. El termino clonacin, per se, indica el acto de producir
muchas copias idnticas de una molcula de ADN, y antes
del advenimiento de la tcnica de PCR era la manera usual de
multiplicar una secuencia especca. En la actualidad, la clonacin se emplea para la produccin de molculas recombinantes y para determinar sus funciones en el organismo. La
clula que capta el cido nucleico se denomina clula transformada y esta variacin en su genoma es hereditaria.

www.fullengineeringbook.net
Vectores de clonacin

Un vector se dene como una molcula de ADN de doble


cadena (DNAds), con capacidad de albergar un fragmento
de ADN exgeno (de otro origen).

Clasicacin de vectores
De acuerdo con su uso, los vectores se clasican en vectores
de clonacin y vectores de expresin.

Vectores de clonacin
Los vectores son de clonacin si su nalidad es el almacenamiento de secuencias y la obtencin de grandes cantidades
del ADN insertado o de la molcula recombinante. Los vectores de clonacin suelen ser plsmidos, fagos, fagmidos,
csmidos y cromosomas articiales bacterianos o de levadura.

Vectores de expresin
Los vectores de expresin son aquellos cuyo objetivo es producir un trnscrito (ARN) o la protena producto de ese
trnscrito. Los vectores de expresin pueden ser plsmidos
o fagos (gura 14-1).

Clonacin
La clonacin de ADN, o clonacin molecular, es la introduccin de un fragmento de ADN denominado inserto
127

O
re rige
pl n
ica d
ci e
n
Or
i

Ori
Hind III

Bam HI

Sitio mltiple
de clonacin
p

Marcador de
seleccin

EcoRI

Am

Xba I

Am
Marcador de p
seleccin

CMV

SMC

SMC

Xho I

Promotor

GGGATCCTCTAGAGTCGACCTGCAGAAGCTT

Origen de
replicacin

A
Poli
Cola de
Poli A

Vector de clonacin

Bam HI
Xba I
Sal I

Hind III

Sitio mltiple de clonacin

PARTE II Metodologa del ADN recombinante

ES
IR

128

Vector de Expresin

Figura 14-1. Vector de clonacin y expresin. Un vector de clonacin contiene elementos como el origen de replicacin, un sitio
mltiple de clonacin (SMC), que es una secuencia especca reconocida por diversas enzimas de restriccin para poder insertar
el ADNc del gen de inters y un marcador de seleccin. Un vector de expresin se utiliza para producir una protena recombinante y contiene, adems de los elementos mencionados, un promotor y un sitio IRES (sitio de entrada interna al ribosoma), as como
una secuencia de poliadenilacin.

Elementos que forman un vector de clonacin

s, con una amplia gama de posibilidades de insertar


cualquier fragmento de ADN. Los sitios de restriccin
ms comunes presentes en el sitio de clonacin mltiple
de la mayora de los vectores son para las enzimas EcoR
I, Hind III, BamH I, Xho I y Kpn I (ver la gura 14-1).

Todos los vectores de clonacin poseen, como parte de su


estructura, los siguientes elementos bsicos comunes:
a) Origen de replicacin: es una secuencia en el ADN del
vector que provee un sitio nico de reconocimiento a
las protenas que identican el sitio de inicio de la replicacin (ORI). Los plsmidos se caracterizan por tener
un solo sitio ORI en su genoma y realizar una replicacin unidireccional.
b) Marcador de seleccin: es un gen que generalmente
conere resistencia a un antibitico o genera un fenotipo particular con el cual puede seleccionarse la clula
que incorpor el vector. En general, los marcadores de
seleccin son nicos en los vectores, aunque existen
algunos plsmidos que contienen dos. Entre los genes
de seleccin ms comunes se encuentran los de resistencia a ampicilina y kanamicina. Algunos vectores
plasmdicos poseen un segundo marcador de seleccin,
el gen lacZ, que se encuentra en el opern Lac de E. coli
y codica la enzima -galactosidasa. As, cuando el vector se replica dentro de la clula hospedera, la
-galactosidasa puede expresarse y generar una enzima
funcional. Si la clula que contiene el vector se pone en
contacto con un sustrato de la enzima, como el compuesto denominado X-gal (5-bromo-4-cloro-3-indolyl-D-galactopiransido), es degradada por la enzima, lo
que produce un color azul que permite identicar a las
clulas que introdujeron el vector. Tambin existen
marcadores, como el gen de la protena verde uorescente (green uorescente protein, GFP) que permite que
la clula transformada emita uorescencia cuando se
expone a luz ultravioleta (gura 14-2).
c) Sitio de clonacin mltiple: es un fragmento de ADN
que contiene una serie de sitios nicos de reconocimiento para enzimas de restriccin, muy cercanos entre

www.fullengineeringbook.net
Ori

SMC
Z

tac

Amp

Amp
Gen

Ori

B)

SMC

A)

Gen

GF

Replicacin del vector en clulas

Replicacin del vector en clulas

Clula en contacto con X-gal

Clula en expuestas a luz ultravioleta

Clulas azules

Clulas fluorescentes

Figura 14-2. Marcadores de seleccin. A) El gen LacZ es un marcador de seleccin que codica para la enzima -galactosidasa.
Cuando la clula que contiene el plsmido se pone en contacto
con el reactivo x-gal, las colonias de clulas transformadas
se tien de color azul. B) Otro marcador de seleccin es el
gen GFP, que expresa la protena verde uorescente que
proporciona uorescencia a la colonia celular cuando es
expuesta a la luz ultravioleta.

CAPTULO 14 Vectores de clonacin y expresin

129

Cuadro 14-1. Caractersticas de los vectores de clonacin.


Vectores de clonacin utilizados
Tipo de vector

Mtodo de introduccin

Tamao del inserto


que se puede clonar

Plsmidos

Transformacin qumica o por electroporacin. Las clulas se vuelven


competentes para incorporar el plsmido recombinante.

15 000 pb

Bacterifagos

Infeccin con fagos. Despus del empaquetamiento in vitro del factor


recombinante en partculas del fago.

23 000 pb

Csmidos y cromosomas articiales

Dependiendo del tamao del inserto de ADN se puede utilizar cualquiera de los
mtodos anteriores. Fragmentos largos necesitan empaquetamiento en fagos I.

45 000 pb

Los vectores de clonacin tienen caractersticas especcas que los hacen ideales para la clonacin. Una de las caractersticas que se utilizan para la seleccin
del vector de clonacin es el tamao del inserto que se quiera clonar. Los plsmidos aceptan insertos de 15000 pb, el bacterifago lambda 23000 pb, los
csmidos 45000 pb y los cromosomas articiales ms de 45000 pb.

A continuacin se detallan los vectores de clonacin


ms utilizados, esquematizados en la gura 14-3; sus caractersticas se resumen en el cuadro 14-1.

Plsmidos
Los plsmidos son pequeas molculas circulares de ADN
que se replican y se transmiten con independencia del cromosoma bacteriano. De manera natural constituyen el
material gentico mvil de las bacterias, donde funcionan
como medio de transporte de genes a otras bacterias, como
la resistencia a antibiticos. Los plsmidos permanecen de
manera episomal en la bacteria, esto es, sin incorporarse en
su genoma, y en ella puede haber mltiples copias del mismo plsmido. Cuando una bacteria se reproduce, estos
plsmidos se transmiten a las clulas descendientes por distribucin equitativa del citoplasma bacteriano durante la
divisin celular. Sin embargo, tambin pueden transmitirse
a travs de los pili entre las bacterias. La replicacin y transcripcin plasmdica depende de la maquinaria enzimtica
de la clula husped.
Los plsmidos han sido manipulados genticamente en
el laboratorio con la nalidad de preservar slo las caractersticas deseables, eliminar el ADN innecesario y aadirle
otras que no poseen de forma natural. Los plsmidos usados
como vector en general estn formados por de 2 a 5 kb de
ADN, lo que facilita el anlisis de los insertos incorporados a
l. Existen cientos de plsmidos disponibles comercialmente
que ofrecen una amplia variedad de posibilidades en cuanto
a las enzimas de restriccin que se van a emplear para la
clonacin, la longitud del producto que se va a insertar y los
marcadores de seleccin de las clonas transformadas. Entre
los plsmidos ms utilizados se encuentran pBlueescript,
pUC19, pBR322 y pGLO.

bacterifagos se replican de forma autnoma, portan informacin gentica y pueden conferirle a la bacteria nuevas
propiedades o desarrollarle procesos patolgicos.
Para convertirlo en un vector, el bacterifago silvestre
(virus natural) es modicado genticamente. Dichas modicaciones consisten en la adicin de sitios de restriccin
especcos y la eliminacin de aquellos genes que no se
requieren para la replicacin, lo que permite la incorporacin de fragmentos de ADN de mayor longitud que los
plsmidos (de hasta 23 kb).
El bacterifago lambda es el fago ms utilizado como
vector de clonacin, y su genoma consiste de una molcula
lineal de aproximadamente 45000 pb, cuyos extremos son
12 nucletidos, que contienen secuencias complementarias
entre s, denominados sitios cos, que utiliza para circularizar su genoma a travs de la accin de una ligasa de la clula husped (ver la gura 14-3).

www.fullengineeringbook.net

Bacterifagos
Los bacterifagos son virus que infectan naturalmente bacterias y se comportan como parsitos intracelulares obligados que se multiplican haciendo uso de la maquinaria
biosinttica de las bacterias. Al igual que los plsmidos, los

Csmidos
Algunos estudios de anlisis de ADN genmico requieren
de la clonacin de fragmentos de ADN grandes. En estos
casos, es recomendable utilizar los csmidos ya que pueden
aceptar insertos de hasta 45 kb.
Los csmidos son vectores hbridos del ADN de un
plsmido (proporciona la resistencia a los antibiticos) y los
sitios cos del bacterifago (le permiten empaquetar el
ADN). Los csmidos derivados del fago P1 pueden admitir
85 kb de ADN exgeno. Adems, contienen los genes de
seleccin y un sitio ORI del plsmido, por lo que se replican
de manera independiente del genoma bacteriano, como lo
hacen los plsmidos.

Cromosomas articiales
Fragmentos de ADN de mayor tamao (cientos de kilobases) pueden clonarse en cromosomas articiales de bacterias (BAC) o levadura (YAC), que se replican como un
cromosoma independiente dentro de bacterias o levaduras,
respectivamente. Este tipo de vectores son particularmente
tiles para estudios de mapeo de cromosomas, por su capa-

PARTE II Metodologa del ADN recombinante

D)

EcoRI Hind III

Amp

Tet

4363pb

nes par

Ori
Origen de replicacin
Corte con enzimas de
restriccin

A)
pBR322

Gen de
resistencia a
cloranfenicol

CmR

Factor F

Sitio mltiple de clonacin


SMC

Ge

130

Fragmento grande
de ADN

Ori
Plsmido
Ligacin

BAC
recombinante

ADN Fago

B)

Sall
5
3

Eco RI
3
5

Transformacin

Corte con enzimas

5
3

3
5

ADN exgeno
Ligacin
5
3

3
5

Colonias recombinantes

ADN
recombinante
Empaquetamiento

www.fullengineeringbook.net
Agar con cloranfenicol

E)

Origen de
replicacin ORI

CEN Centrmero

Amp

Amp

Te
l

T
m EL
er
o

Bacterifago

C)

Marcador de
seleccin

TE

Corte con enzimas de restriccin


ADN recombinate
TEL

Amp

ORI

CEN

Amp

TEL

TEL

Amp

ORI

CEN

Amp

TEL

Inserto de ADN
Ligacin del gen de inters en el YAC

cosL

cosL

cosR

5GGGCGGCGACCT----3
3----AGGTCGCCGCCC5
cosR

TEL

Amp

ORI

CEN

Gen

Amp

TEL

YAC
Transformacin

Csmido
YAC
recombinante

Figura 14-3. Vectores de clonacin. Los vectores de clonacin se han creado con la nalidad de contener y permitir la amplicacin
de fragmentos de cidos nucleicos. A) Un plsmido consta de componentes bsicos como el sitio de clonacin mltiple, un gene de
resistencia y un sitio ORI. B) Los fagos provienen de la modicacin del genoma ADNds lineal de virus bacterianos. C) Los csmidos, como su nombre indica, combinan propiedades de los plsmidos con la presencia de los sitios COS del fago. D) Un BAC, o
cromosoma bacteriano, permite la ligacin de fragmentos grandes de ADN que contienen secuencias de resistencia a antibiticos,
y sitio de clonacin mltiple. E) Los YAC se construyen a partir de la ligacin de fragmentos de ADN de gran tamao con genomas
de levadura modicados que contienen genes de resistencia a antibiticos, secuencias telomricas y de codicacin para centrmeros.

CAPTULO 14 Vectores de clonacin y expresin

cidad para almacenar fragmentos de gran tamao. Un BAC


es un constructo derivado del plsmido F (functional fertility plasmid) capaz de regular la distribucin equitativa de
plsmidos despus de la divisin bacteriana. Usualmente,
acepta insertos de 150 a 350 Kb, pero se han clonado segmentos de hasta 700 kb. Un sistema similar denominado
PAC, derivado del plsmido bacterial P1, tiene capacidad de
insertar hasta 300 kb.
Los YAC son cromosomas articiales que contienen
telmeros, origen de replicacin, un centrmero de levadura y un marcador de seleccin para su identicacin en las
clulas que los contengan. Su capacidad de clonacin es de
100 a 1 000 kb.

Vectores de expresin
Los vectores de expresin se emplean con dos nalidades:
generar el ARN producto de la transcripcin o bien producir la protena codicada en la secuencia gnica que portan
(protena recombinante). Los vectores de expresin son
plsmidos o bien bacterifagos.

Componentes de los vectores de expresin


En su estructura los vectores de expresin poseen los elementos bsicos presentes en los vectores de clonacin (origen de replicacin, marcador de seleccin y sitio de
clonacin mltiple), adems de contar en su secuencia con
por lo menos un promotor fuerte. Se caracterizan por constituir un sistema de induccin simple y efectivo, tener una
baja expresin basal y ser fcilmente transferible a otras
cepas. Tambin debe incluir secuencias de terminacin de
la transcripcin y de adicin de cola de poliadelinacin,
pues con ello el trnscrito estar protegido de la degradacin de nucleasas, con lo que su vida media se extender.
Otro factor importante presente en un vector de expresin
es el sitio de unin al ribosoma (internal robosome entry site,
IRES), que es la secuencia Shine-Dalgarno que precede el
codn de inicio AUG de la traduccin en los ARNm procariotes. Dicha secuencia es complementaria con el extremo
3 del ARNr 16S, cuya hibridacin permite el ensamblaje de
la maquinaria de inicio de la traduccin. Adems, debe considerarse la expresin basal del plsmido, lo que se conoce
como nmero de copias del plsmido, caracterstica determinada por la fuerza del sitio de origen de replicacin, que
origina plsmidos con un elevado nmero de copias per se.
Tambin debe considerarse que la presencia de promotores
fuertes en plsmidos con un alto nmero de copias origina
interferencias en la viabilidad celular. Algunos ejemplos de
vectores de expresin son los de la serie pcADN3.1, pET161
y pDEST10, entre otros.

introduccin de un vector a una clula eucariota se le denomina transfeccin y si el vector es un virus, transduccin.
La introduccin del ADN recombinante tiene como
propsito la transformacin celular, es decir, que el material
gentico se incorpore de manera extracromosmica y se
replique, transcriba y traduzca empleando la maquinaria
enzimtica de la clula husped.
La clonacin de cualquier fragmento de ADN involucra
los siguientes pasos, los cuales se esquematizan en la gura
14-4.
1.
2.
3.
4.
5.
6.

Preparacin del inserto de ADN que se va a clonar.


Preparacin del vector para la clonacin.
Ligacin del inserto y el vector.
Preparacin de clulas competentes.
Transformacin celular.
Identicacin de las colonias celulares que contienen el
vector recombinante.

1. Preparacin del inserto de ADN que se va a clonar.


Involucra la digestin con enzimas de restriccin para
liberar el fragmento de inters de la molcula de ADN
completa. La seleccin de la(s) enzima(s) que corten el
ADN es un punto crtico que determina la facilidad y la
eciencia de la metodologa. Para facilitar la clonacin
se preere el uso de enzimas de restriccin cuyos sitios
de corte estn presentes en el sitio de clonacin mltiple del vector, con lo que se evita la necesidad de una
posible modicacin posrestriccin del inserto. Asimismo, el inserto deber cortarse con la(s) misma(s)
enzima(s) o con unas que dejen los mismos extremos,
de manera tal que la complementariedad de los extremos generados en el inserto coincida con los extremos
del vector (gura 14-5). Debe tomarse en cuenta que la
incorporacin de un inserto con extremos romos (vase captulo de enzimas de restriccin) implica una eciencia de 50% en la clonacin, ya que en la mitad de las
ocasiones el inserto va en el sentido apropiado (5-3),
pero en el otro 50% de las ocasiones la insercin ser en
el sentido opuesto (3-5). El inserto, producto de la
digestin enzimtica, se purica y separa de la molcula de ADN de donde proviene, mediante una electroforesis en gel de agarosa (vase captulo de electroforesis).
La banda correspondiente al inserto (que se verica por
el tamao que presenta) se escinde del gel y se extrae
y purica mediante tcnicas convencionales (gura
14-6).
2. Preparacin del vector para clonacin. Consiste en:
a) Corte con la(s) misma(s) enzima(s) de restriccin
con que se digiri el inserto y obtener un ADN lineal.
La estrategia de clonacin debe disearse para que el
corte genere extremos con secuencias complementarias a los extremos del inserto a clonar.
b) Desfosforilacin del vector con la nalidad de impedir la autoligacin del vector. Se realiza usando la fosfatasa alcalina bovina de origen intestinal (CIP) o la

www.fullengineeringbook.net

Clonacin molecular
Usualmente, la clula hospedera del vector es una bacteria
(E. coli), pero tambin puede ser una clula eucariota. A la

131

132

PARTE II Metodologa del ADN recombinante

1. Fragmentacin enzimtica
del gen a clonar

Vector de clonacin

ADN fuente

2. Linearizacin enzimtica
del vector

ADN del vector


Inserto de ADN

3. Unin del vector de clonacin


y el inserto de ADNcc
del bacterifago T4
4. Preparacin de clulas
competentes

5 y 6. Transformacin y
seleccin de la clona
recombinante

ADN recombinante
Bacteria E. colli

www.fullengineeringbook.net
Produccin de la protena
del gen clonado

Almacenar ADN

Medio LB con agar


+ Ampicilina

Figura 14-4. Estrategia general de clonacin. El procedimiento esquematizado consta de los siguientes pasos: preparacin del vector
para clonacin, preparacin del inserto de ADN a clonar, ligacin del inserto de ADN con el vector, la transformacin de bacterias
y la identicacin de las colonias que contienen el vector recombinante. Una vez que se obtiene el vector recombinante, puede
utilizarse para producir protenas recombinantes o para almacenar el ADN.

fosfatasa bacteriana (BAP) que elimina los grupos


fosfato 5 de una cadena de ADN.
c) Puricacin del vector. Consiste en eliminar las partculas de agarosa, los restos de enzimas inactivadas
y las sales provenientes de la reaccin de digestin.
En general, se realiza empleando columnas de resinas con alta anidad al ADN en presencia de altas
concentraciones de sales caotrpicas. Esto permite
una elucin de la muestra en volmenes pequeos
de agua o buer con baja concentracin de sales.
Tambin existe la posibilidad de puricar por la tcnica fenol:cloroformo modicada, para obtener
ADN plasmdico (evitando la extraccin del ADN
genmico); sin embargo, presenta el inconveniente
de que para su realizacin consume mucho tiempo y
que en general se obtiene un ADN plasmdico de

menor calidad (vase el captulo de mtodos de


extraccin de cidos nucleicos).
Otra estrategia de ligacin consiste en el uso del fragmento largo de la polimerasa (fragmento Klenow), que
rellena los extremos cohesivos generados por cualquier enzima y los convierte en romos. Sin embargo, los
extremos romos en el vector no dirigen la insercin, por
lo que la eciencia de clonacin disminuye, como se
mencion previamente (ver la gura 14-5).
3. Ligacin del inserto con el vector. La ligacin de un segmento de ADN exgeno a un vector involucra la formacin de enlaces fosfodister entre los residuos fosfato
que se localizan en los extremos 5 de la cadena de ADN
y los residuos hidroxilo 3. Esta unin la cataliza in vitro
una enzima denominada ligasa. Las ms utilizadas son
la ligasa de E. coli y la T4 ligasa de bacterifagos. Para la

CAPTULO 14 Vectores de clonacin y expresin

A)

ADN del plsmido

ADN del inserto de inters

ADN del plsmido


ADN del inserto de inters
B)
Se utilizan enzimas de restriccin que generan extremos cohesivos

Se utilizan enzimas de restriccin que generan extremos romos


5 TGCCG GTCTTAGCCC GTCTA 3 5 AACAC CTCATGACAC GGGAT 3
3 ACGGC CAGAATGGGG CAGAT 5 3 TTGTG GAGTACTGTG CCCAT 5

Se lineariza el plsmido
GTCTA 3
CAGAT 5

Se lineariza el plsmido
TCGAGC 3
CG 5

TGAC AC
CTCA
GA G

TAC TGT G

AG
GT
CA C

Se libera el gen de inters


5 AGCTTAACTTGAC 3
3 ATTCAACTGAGCT 5

5 TA
3 ATTCGAA

CT

TA
AT
T

AG

CT

TC

GC C G

ADN del plsmido

TGAC

ATTCAACTG

GA

C)

CT
TAA

Se realiza la ligacin gen de inters con


AA
el plsmido
CG

TA T
GA

TG
AC C
G

Se realiza la ligacin gen de inters con


el plsmido
CG C

5 TA AGCTTCGCCATC TCGAGC 3 5 CA AGCTTAACTTGAC TCGAGC 3


3 ATTCGAA GCGGTAGAGCT CG 5 3 GTTCGA ATTCAACTGAGCT CG 5

Se libera el gen de inters


5 CTCATGACAC 3
3 GAGTACTGTG 5

5 TGCCG
3 ACGGC

133

ADN del inserto de inters

Se utiliza una enzima que genera extremos cohesivos y otra romos


5 TAAA AGCTTCCATCAA TGCA 3
3 ATTTTCGA ACCTAGTT ACGT 5

5 TAAA AGCTTCCATCAA TGCA 3


3 ATTTTCGA ACCTAGTT ACGT 5

Se lineariza el plsmido
TGCA 3
ACGT 5

Se libera el gen de inters


5 AGCTTCCATCAA TGCA 3
3 ACCTAGTT ACGT 5

5 TAAA
3 ATTTTCGA

AG

Se realiza la ligacin gen de inters con


el plsmido

CT

ATCAA
TCC CCTAGT
A
T

GA

TG
AC CA
G

A
AT
T

TAA

www.fullengineeringbook.net
TC

Figura 14-5. Estrategias de clonacin. Segn el tipo de extremos que se generan con el corte por las enzimas de restriccin del vector
e inserto que se va a clonar, se pueden tener las siguientes opciones: clonacin de extremos romos con romos A), cohesivos con
cohesivos B), o cohesivos con romos C).

reaccin de ligacin existen diferentes protocolos, que


dependen del tipo de extremos generados por las enzimas de restriccin. Los requerimientos generales que
deben considerarse para las ligaciones se describen en el
cuadro 14-2.
4. Preparacin de clulas competentes. Para su replicacin,
los vectores requieren encontrarse dentro de una clula,
que debe prepararse para hacerla permeable a la entrada del vector recombinante, proceso denominado generacin de clulas competentes. Las clulas competentes
generalmente son clulas procariotas. La bacteria ms
utilizada para este procedimiento es E. coli, que carece
de un mecanismo natural para la incorporacin de
ADN exgeno. El estado de competencia puede inducirse por diferentes mtodos de laboratorio, y la eleccin
del mtodo depender del procedimiento de transformacin seleccionado.
Uno de los mtodos de competencia ms utilizados
consiste en tratar las bacterias con una solucin de
CaCl2. Se desconoce el mecanismo exacto por el cual

este compuesto induce la competencia. Sin embargo,


una explicacin sostiene que la membrana bacteriana es
permeable a los iones cloro, mas no a los iones calcio,
de manera que los iones Ca++ se rodean de molculas de
agua para entrar a la clula, lo que provoca que la clula
se abulte, lo que facilita la formacin de poros y la entrada del ADN. Este procedimiento se preere para clulas
que se van a transformar usando precipitados de ClCa2.
Para lograr el estado de competencia por cualquiera de
las tcnicas se requiere que las clulas se encuentren en
la fase logartmica de crecimiento (OD entre 0.5 y 0.7),
que corresponde a una densidad celular de 5 107 cel/
ml). Otro mtodo para conferir competencia a las bacterias es someterlas a lavados consecutivos por 4-5
veces con una solucin de glicerol a 10%, para obtener
clulas libres de iones y proteger a la membrana celular
del dao que ocasionar la electroporacin por la cual
se transformarn.
Con independencia del procedimiento empleado
para inducir el estado de competencia, las clulas pue-

134

PARTE II Metodologa del ADN recombinante

1. Electroforesis de un inserto escindido con las


enzimas Hind III y Xba I

MPM Hind III y Xba I

Hind III y Xba I

Fragmento sin digerir


2. Se corta la banda del
inserto digerido

Fragmento digerido

3. Purificacin del fragmento

Lisis de la agarosa

Unin a columnas
Lavados

www.fullengineeringbook.net
Elucin

4. Inserto escindido

Figura 14-6. Puricacin del inserto a clonar. Despus de la digestin enzimtica con que es escindido el inserto del ADN de origen,
el inserto se purica del resto de la molcula de ADN de donde proviene, mediante una electroforesis en gel. En la imagen, un
inserto es liberado empleando las enzimas Hind III y Xho I, y en la electroforesis se visualiza el fragmento digerido. Un corte de la
agarosa a la altura de la banda del inserto digerido lo asla del resto de la molcula de origen que no haya liberado el inserto. Para
extraer el inserto de la agarosa, se purica el cido nucleico empleando tcnicas comerciales de extraccin y puricacin de ADN
por columnas inicas.

Cuadro 14-2. Requerimientos para la clonacin de insertos de ADN.


Extremos acarreados por el inserto de ADN

Requerimientos para la clonacin

Comentarios

Extremos romos

Alta concentracin de ADN.

Los plsmidos recombinantes pueden acarrear copias en


tndem del inserto de ADN.

Extremos cohesivos diferentes

Para una mxima eciencia se


requiere la puricacin del vector
despus de la digestin con las dos
enzimas de restriccin.

Los sitios de restriccin de las uniones entre el vector y


el inserto de ADN son usualmente conservados.
El nmero de clonas no recombinantes es bajo.
El fragmento de ADN es insertado en una sola
orientacin en el vector recombinante.

Extremos iguales

Tratamiento con fosfatasa del vector


linearizado.

Los sitios de restriccin de las uniones entre el vector y


el inserto de ADN son usualmente conservados.
El fragmento de ADN es insertado en cualquier
orientacin en el vector recombinante.
Los plsmidos recombinantes pueden acarrear copias
en tndem del inserto de ADN.

Los requerimientos para la ligacin del inserto de ADN con el vector de clonacin sern particulares, segn los tipos de extremos generados por las enzimas de
restriccin que se emplean para el corte del inserto y vector.

CAPTULO 14 Vectores de clonacin y expresin

den almacenarse de forma indenida sin perder su competencia en una solucin acuosa con glicerol a 10%, para
impedir que al descongelarse se lisen.
5. Transformacin en bacterias. La transformacin bacteriana consiste en la adquisicin de ADN exgeno, que le
conere un nuevo fenotipo a la clula husped. Entre los
mtodos ms comunes se encuentran la transformacin
qumica y la transformacin por electroporacin.
Cabe resaltar que el termino transformacin se
reere a la introduccin de material gentico a travs de
vectores a las bacterias; el trmino transduccin describe la introduccin del cido nucleico exgeno en una
clula por medio de un vector viral, y el trmino transfeccin implica la introduccin del material gentico en
las clulas empleando agentes qumicos o f sicos.
a) Transformacin qumica: esta tcnica est basada en
estudios realizados por Mandel e Higa en 1970, en los
que observaron que la incorporacin de ADN del fago
por clulas bacterianas se incrementaba sustancialmente en presencia de cloruro de calcio. Posteriormente, este mtodo se aplic para la introduccin de
ADN plasmdico a clulas bacterianas. En este procedimiento las clulas y el ADN plasmdico se incuban
en una solucin hipotnica de CaCl2, que forma un
complejo con el ADN que facilita su entrada por
endocitosis a una clula competente; adems, se aplica
un breve choque trmico a 42C por 90 segundos que
incrementa la permeabilidad de la membrana celular.
La eciencia de este mtodo es de 1 104 a 1 106
clulas transformadas/g de plsmido, misma que
vara dependiendo de la longitud del plsmido y la
cepa de bacterias utilizadas. Es un mtodo sencillo y
proporciona una buena eciencia de transformacin
para muchos de los procedimientos de rutina, aunque
puede incrementarse utilizando otros cationes divalentes, como el rubidio y el manganeso.
b) Transformacin por electroporacin: consiste en la
aplicacin de breves pulsos elctricos de alto voltaje
(> 1500 V/5 ms) a las clulas receptoras, para formar
poros en la membrana plasmtica en clulas eucariotas y/o la pared celular en bacterias. Los componentes de la membrana se desestabilizan, lo que permite
la entrada del vector al citoplasma de la clula. Esta
es la tcnica de transformacin bacteriana ms eciente, ya que se obtienen alrededor de 1 108 clulas
transformadas/g de plsmido. Por otro lado, este
mtodo es la mejor opcin para plsmidos grandes de
hasta 50 kb. La electroporacin no es exclusiva de las
bacterias, ya que puede utilizarse en clulas eucariotas. Adems, es el mtodo de eleccin cuando las
clulas son resistentes a los mtodos tradicionales de
transfeccin y transformacin. Ambos procesos se
esquematizan en la gura 14-7.
Debe considerarse que factores como la longitud
del vector inuyen de forma signicativa en la e-

135

ciencia de transformacin, con independencia del


mtodo empleado para la misma.
6. Identicacin de las colonias que contienen el vector
recombinante. Para identicar las bacterias transformadas se utilizan marcadores de seleccin proporcionados
por los vectores. Los ms utilizados son los genes de
resistencia a antibiticos, como la ampicilina, la tetraciclina, el cloramfenicol y la kanamicina. Despus de la
transformacin, las bacterias se siembran en cajas petri
con agar suplementado con el antibitico, para el cual el
plsmido es resistente. Si la transformacin ha sido exitosa las bacterias sern capaces de metabolizar el antibitico y vivirn, lo que indicar que incorporaron el
vector (ver la gura 14-2); cada colonia representa un
solo evento de transformacin. Otros marcadores de
seleccin se basan en la produccin de molculas uorescentes o bien en la produccin de enzimas que, al
reaccionar con un sustrato, producen coloracin en la
colonia de clulas transformadas.

Aplicaciones de la clonacin molecular


La clonacin gnica tiene mltiples aplicaciones y ha sido el
principal impulsor de la biotecnologa y la metodologa del
ADN recombinante. Este proceso puede emplearse para la
produccin de protenas eucariotas en bacterias (protenas
recombinantes), como hormonas, antibiticos, vacunas,
generacin de cultivos transgnicos resistentes a plagas o
sequas, produccin de animales transgnicos capaces de
producir en su leche protenas recombinantes (vase captulo de organismos transgnicos), as como para el establecimiento de libreras genmicas o genotecas, que han
permitido secuenciar por completo el genoma humano y el
de otros organismos.

www.fullengineeringbook.net
Genotecas

Una biblioteca genmica o genoteca es una coleccin de


fragmentos de ADN, provenientes del genoma de un organismo, clonados en vectores para facilitar su estudio. Se
pueden construir genotecas de ADN o de ADN.

Genotecas de ADNc
Los bancos de ADNc se construyen a partir de secuencias de
ARNm mediante una reaccin in vitro que sintetiza una primera cadena de ADNc utilizando una ADN polimerasa con
actividad de transcriptasa inversa. El ARNm que no se copia
a ADNc se elimina con la adicin de la enzima ARNasa H. La
segunda cadena de ADNc, complementaria a la obtenida de
la retrotranscripcin, se sintetiza en una reaccin de PCR
(vase captulo de reaccin en cadena de la polimerasa) o
empleando una DNAc polimerasa que utilice la cadena sencilla del ADNc como templado. Posteriormente, este ADNc
de doble cadena se clona en un vector. La produccin de una
biblioteca de ADNc se esquematiza en la gura 14-8.

136

PARTE II Metodologa del ADN recombinante

Transformacin qumica

A)

Choque trmico
a 42C

Adicionar medio LB
Centrifugar
Sembrar e incubar
toda la noche a 37C

Clonas recombinantes

Eliminar medio

www.fullengineeringbook.net
B)

Transformacin por electroporacin

Plsmido

Clulas
competentes

Clonas recombinantes

Incubar
en hielo

Electroporacin

Adicionar medio LB
Centrifugar

Agar con ampicilina

Sembrar e incubar
toda la noche a 37 C

Eliminar medio

Figura 14-7. Transformacin de bacterias. A) Transformacin qumica. Para la transformacin qumica se aade el plsmido deseado a
las clulas qumicamente competentes que se encuentran en una solucin con CaCl2, que junto con el vector forma un complejo
insoluble. Un choque trmico a 42 C facilita la entrada del complejo ADN-CaCl2 a la clula. Se aade medio LB para que las
clulas crezcan y se reproduzcan con el plsmido insertado. Posteriormente, se siembran en agar con antibitico del gen de resistencia que contiene el plsmido y se seleccionan las colonias resistentes que contienen el vector recombinante. B) Transformacin
por electroporacin. En la transformacin por electroporacin la diferencia estriba en que en lugar de un choque trmico se aplican
pulsos elctricos que desestabilizan la membrana celular y permiten la entrada del vector.

CAPTULO 14 Vectores de clonacin y expresin

Corte con enzimas


de restriccin
Genoma

Promotor

ARNm 5
ARNm 5
3

ADNc de cadena 3
sencilla
Doble cadena 5
3
de ADNc

E1

E2

E3

E4

AAAAA
Sntesis
de ADN
complementario
Degradacin del ARNm
TTTTT
AAAAA
TTTTT

AAAAA
TTTTT

Plsmido
recombinante
con el ADNc

Figura 14-8. Produccin de una genoteca de ADN complementario. Las


genotecas de ADNc se construyen a partir de la secuencia de
ARNm, de los cuales se sintetiza el ADNc por retrotranscripcin.
El ARNm remanente es degradado, y la cadena complementaria
del ADN de cadena sencilla para formar un ADN de doble cadena
se sintetiza con ayuda de una ADN polimerasa. Los fragmentos de
ADNc de doble cadena se clonan en el vector de eleccin.

Produccin de protenas recombinantes


La clonacin molecular ha permitido determinar la funcin
de mltiples protenas y generar protenas recombinantes,
que han reducido los costos de produccin de hormonas o
protenas requeridas en la teraputica, de las cuales previamente slo se dispona de pequeas cantidades por la escasez de fuentes, y la dicultad en su aislamiento o puricacin.
La facilidad en la produccin de las protenas recombinantes ha revolucionado el rea biotecnolgica, que ahora es
un mercado dominante en el mundo de la biologa molecular y cubre ms de 10% de toda la industria farmacutica.
Las protenas recombinantes se producen en bacterias
(E. coli, B. subtilis), levaduras (Saccharomyces cereviceae,
Pichia pastoris), clulas de insecto (Spodoptera frugiperda-9) y clulas de mamfero (clulas de ovario de hmster
chino CHO, lnea celular de rion de hmster beb
BHK y HEK293 de rin de embrin humano). Para
maximizar la expresin de las protenas se emplean promotores fuertes que aseguren la expresin por arriba de 10%
del total de las protenas celulares, aunque esto impone una
carga metablica a las clulas bajando la velocidad de su
crecimiento, por lo que ciertas protenas recombinantes
pueden resultar txicas para las clulas que las producen.
Tambin puede alterarse la secuencia del gen de inters sustituyendo codones para los que hay ARNt poco frecuentes
y reemplazarlos por aquellos que codican para el mismo
aminocido, pero que se usan ms en el organismo husped. Asimismo, la produccin de protenas recombinantes
en plantas presenta la ventaja de que su disponibilidad es
prcticamente ilimitada de biomasa, y los costos de produccin son bajos, pues una vez establecido el cultivo no se
requiere personal especializado, no presenta riesgos de
contaminacin con patgenos animales, endotoxinas bacterianas o secuencias de ADN oncognicas. Una ventaja
adicional es que las plantas permiten el almacenamiento
estable de la protena recombinante en semillas y tubrculos, lo que facilita su conservacin, transporte y distribucin. Esto permite el abaratamiento de costos respecto a
otros sistemas de produccin. As, existen ya biorreactores
vegetales que producen vacunas comestibles, en tubrculos
u hojas de lechuga, como por ejemplo para el antgeno de
supercie del virus de la hepatitis B humana.
La clonacin molecular ha incrementado las perspectivas iniciales de la metodologa del ADN recombinante y, de
cierta manera, sent las bases para la clonacin de organismos e impuls el desarrollo de la biotecnologa, que ha
tomado un papel protagnico en las ciencias de la salud.

www.fullengineeringbook.net

Genotecas de ADNg
Para construir bancos de ADN es necesario aislar el ADNg
del organismo de inters. Este ADNg se corta con enzimas
de restriccin para generar fragmentos con extremos complementarios a los del vector de clonacin. Una vez que se
ha construido la genoteca, se rastrea el clon o clones que
portan el ADN con el gen de inters. Los mtodos ms frecuentes de identicacin de clones recombinantes en una
genoteca son la hibridacin usando alguna sonda marcada
(vase captulo de tcnicas de hibridacin), el uso de anticuerpos frente a la protena de inters o la seleccin de clonas por la actividad biolgica de la protena. En la actualidad,
gracias a los adelantos de la metodologa del ADN recombinante, es posible separar regiones determinadas de ADN,
secuenciarlas, alterar la secuencia e introducir ese ADN exgeno a las clulas de un organismo, y aun a clulas germinales, para la produccin de organismos transgnicos (vanse
detalles en el captulo de organismos transgnicos).

137

138

PARTE II Metodologa del ADN recombinante

Ejercicios de integracin
1. Correlacione las columnas eligiendo el vector ms indicado para cada uno de los siguientes insertos.
Inserto
Vector
Genoma de M. tuberculosis
pcADN 3.1
ADNc de insulina
pGLO
Gen de colgena
Fago
Genoma de M. musculus
YAC
ADNc de miostatina
BAC
2. Ordene cada paso necesario para la produccin de una
protena recombinante, colocando el nmero del 1 al 10
que corresponda.
Corte del inserto con enzima(s) de restriccin
Puricacin del vector
Transformacin celular
Ligacin inserto/vector
Seleccin del ARNm
Seleccin de la clona celular transformada
Puricacin de la protena recombinante
Expresin de la protena recombinante
Conversin del ARNm a ADNc
Corte del vector con enzima(s) de restriccin
Puricacin del inserto
3.
a) Dibuje la estructura de un extremo de un fragmento
de ADN lineal producido por una digestin con XhoI.
b) Dibuje la estructura resultante si la estructura derivada de la pregunta anterior se trata con una nucleasa
que slo degrada ADN monohebra.
c) Dibuje la estructura de un extremo de un fragmento
de ADN lineal producido por una digestin con PvuII.
d) Dibuje la estructura producida al ligar el extremo de la
parte (b) con el de la (c).
Pregunta. Cuntos sitios de reconocimiento para la enzima EcoRI existen en el plsmido pX si al analizar mediante electroforesis en geles de agarosa el producto de
la digestin produce 4 fragmentos de ADN de diferentes
tamaos?

Pregunta. Es aconsejable preparar el inserto que se va a


clonar en dos enzimas de restriccin diferentes, las cuales tambin se emplean para cortar el vector al cual se
unir el inserto? Es la nica forma posible? Comentar.
4. En la imagen que se presenta inserte los siguientes trminos donde crea conveniente: ADN recombinante, inserto,
ADN genmico, vector, corte con enzima de restriccin,
ligacin, transformacin celular, E. coli, linearizacin del
vector.

www.fullengineeringbook.net

Bibliografa
Berger S.L., Kimmel A.R. Guide to molecular cloning techniques.

methods in enzymology, Vol. 152. Londres: Academic Press,


1987:161-522.
Orozco G. Gentica y biomedicina molecular. Noriega Limusa, Coleccin de Textos Politcnicos, Serie Biotecnologas.
Sambrook J., Fritsch E.F., Maniatis T. Molecular cloning: a laboratory manual, 3 ed. Vol 1. Nueva York: CSHL Press, 2001.

Surzycki S. Basic techniques in molecular biology. DNA Cloning

general considerations, Captulo 13; DNA cloning experimental


procedures, Captulo 14. Berln, Heidelberg: Springer-Verlag,
2000:298-319, 339-347, 352-373.

Captulo

15

Tcnicas de hibridacin
Miriam Ruth Bueno Topete / Jaime Gonzlez Cuevas

Introduccin

co es como tratar de encontrar la proverbial aguja en el


pajar. Para localizar fragmentos especcos se utiliza la tcnica de hibridacin de cidos nucleicos. Entre las tcnicas
de hibridacin ms comunes se encuentran Southern blot,
Northern blot, Slot blot, Dot blot e hibridacin in situ.
Antes de abordar cada metodologa es importante mencionar algunos aspectos bsicos que facilitarn el entendimiento tcnico de estas herramientas de la biologa molecular, como son la electroforesis de cidos nucleicos y la
denicin de sondas.

Al revelar los numerosos mtodos mediante los cuales las


clulas procesan, aaden, eliminan y transeren informacin gentica, los bilogos moleculares abrieron el camino
para el desarrollo de sus propias manipulaciones genticas.
En los ltimos aos, se han desarrollado tcnicas que han
permitido abordar el anlisis y la manipulacin del ADN de
una forma antes inimaginada. La tecnologa del ADN
recombinante ha hecho posible investigar ms a fondo la
estructura y la funcin de los genes, en especial de los genes
eucariticos, inaccesibles por otros mtodos. Cuando los
investigadores se enfrentaron por primera vez con el gran
tamao y la complejidad del ADN, incluso el del virus ms
simple, la posibilidad de descifrar la informacin gentica
codicada pareca estar ms all de toda esperanza. Se hizo
evidente que para estudiar un gen individual, se lo deba
aislar del resto del genoma ya que, cada gen representa una
pequea seccin dentro de un cromosoma y, en ese contexto, no puede individualizarse. Para el aislamiento de un gen
o de fragmentos ms pequeos, el ADN debe fragmentarse.
Si bien la rotura del ADN puede realizarse mecnicamente,
por este medio la fragmentacin se produce al azar. La
obtencin de fragmentos especcos de ADN fue posible
mediante un mtodo desarrollado a partir de herramientas
propias de ciertos organismos. Para avanzar hacia un estudio ms detallado del ADN fue necesaria una metodologa
que permitiera obtener grandes cantidades de fragmentos
especcos de ADN. Estos fragmentos podan ser ADN
genmico, ADN complementario (ADNc) o ADN obtenidos a partir de oligonucletidos sintticos. A menudo, antes
de que un determinado fragmento de ADN o de ARN mensajero (ARNm) pueda manipularse de cualquier modo, primero debe localizarse. Los cromosomas, incluso los de las
clulas eucariticas ms simples, contienen una enorme
cantidad de ADN, por lo que localizar un segmento espec-

www.fullengineeringbook.net
Electroforesis de cidos nucleicos

La electroforesis es una tcnica analtica de separacin de


macromolculas. La separacin tiene lugar debido a la diferente movilidad que presentan las macromolculas cargadas
cuando se someten a la inuencia de un campo elctrico
como consecuencia de su relacin carga/masa. Los cidos
nucleicos son molculas cargadas negativamente, debido a la
presencia de grupos fosfato en su estructura. La naturaleza
del enlace fosfodister de las cadenas polinucleotdicas condiciona la carga de un cido nucleico, que es aproximadamente igual al nmero de grupos fosfato. La electroforesis en
geles de agarosa se lleva a cabo en aparatos apropiados,
cmaras generalmente horizontales, y requiere de dos elementos indispensables: la fase mvil y la fase estacionaria. La
fase mvil es el medio amortiguado que permite la movilidad
de las molculas cargadas hacia los electrodos correspondientes cuando se genera un campo elctrico. La fase estacionaria, o soporte, es un polmero de naturaleza gelatinosa
conocida como agarosa (originalmente obtenido de algas,
como el agar-agar, pero de composicin ms homognea).
Dependiendo de su concentracin genera poros de cierto
tamao a travs de los cuales migran los fragmentos de ADN
o ARN. Normalmente la concentracin es de 0.5 a 2%. La
agarosa posee la propiedad de permanecer lquida a ms de
139

140

PARTE II Metodologa del ADN recombinante

50 C y de formar un gel al enfriarse. Los fragmentos de cidos nucleicos separados por electroforesis se visualizan
mediante su tincin con bromuro de etidio, un colorante que
se intercala entre las bases del ADN y que emite uorescencia cuando se irradia con luz ultravioleta.

el diagnstico de mutaciones en enfermedades genticas o


la identicacin de un polimorsmo).

Southern blot
Fundamento

Sondas
Las sondas son segmentos de ADN o ARN de cadena sencilla marcados con molculas reporteras, como enzimas o
radioistopos, que permiten su fcil deteccin. El diseo de
la sonda, es decir, su secuencia nucleotdica, es lo que le
permitir, entre miles de fragmentos que forman parte del
genoma de un ser humano, identicar un solo gen o el
fragmento de un gen. Gran parte del xito de este tipo de
estrategias moleculares depende de la especicidad de la
sonda. La longitud de las sondas puede ir de 15 a 30 bases,
conocidas tambin como oligonucletidos, hasta miles de
bases de nucletidos. Pueden sintetizarse y puricarse con
relativa facilidad por instrumentos comerciales disponibles
en la actualidad. En trminos generales las sondas se obtienen a partir de sntesis qumica o de plsmidos, que se clonan con la sonda de inters. La especicidad de la sntesis
de la sonda depender del objetivo de estudio (por ejemplo,

La tcnica de Southern blot la desarroll, en 1975, Edwin


Southern y es una estrategia estndar para analizar ADN
previamente digerido con enzimas de restriccin.
Esta tcnica se utiliza para determinar la presencia de
un gen o fragmentos del ADN especcos en una mezcla
de cidos nucleicos previamente extrados.
Se basa en la aplicacin de dos procesos fundamentales:
la desnaturalizacin o separacin de las cadenas complementarias del ADN y la hibridacin o unin de dos cadenas
complementarias. Este fundamento es compartido por
todas las tcnicas de hibridacin.

Procedimiento tcnico
En este procedimiento, primero se asla el ADN de cualquier clula del organismo excepto de glbulos rojos, ya que
carecen de ncleo. Para el anlisis molecular de un pacien-

www.fullengineeringbook.net
Corte con enzimas
de restriccin

ADN genmico

Electroforesis

Fragmentos
separados

Fragmentos de ADN
Pelcula

Papel absorbente
Membrana
Membrana

Autorradiografa

Deteccin de la secuencia
de inters

Gel
Amortiguador

Hibridacin con la
sonda marcada

Figura 15-1. Esquema representativo de cada uno de los pasos involucrados en la tcnica de Southern blot. Obtencin del ADN
genmico y digestin con enzimas de restriccin, electroforesis, transferencia, hibridacin especca con una sonda y deteccin
de la secuencia de inters.

141

CAPTULO 15 Tcnicas de hibridacin

te, el ADN puede obtenerse de linfocitos. Sin embargo, la


extraccin puede hacerse tambin de otras fuentes: cultivos
celulares, clulas de lquido amnitico, vellosidades corinicas o cualquier rgano biopsiado. Una vez extrado el ADN,
se digiere con enzimas de restriccin y los fragmentos se
separan por electroforesis en geles de agarosa, de acuerdo
con su carga/masa. En algunas ocasiones se utilizan geles
de acrilamida cuando los fragmentos que se van a separar
son muy pequeos. En este procedimiento electrofortico,
como ya se mencion, las muestras se someten a un campo
elctrico; como los fragmentos de ADN tienen carga negativa (por sus grupos fosfato) todos se mueven en la misma
direccin hacia el electrodo positivo, y los fragmentos ms
pequeos migran ms rpidamente.
Las molculas de ADN separadas pueden visualizarse
mediante su tincin con bromuro de etidio. En este momento el procedimiento no es informativo, debido a que el fragmento de inters se encuentra inmerso en millones de
fragmentos creados por las enzimas de restriccin. Posteriormente, el ADN se desnaturaliza para obtener cadenas
sencillas, mediante un proceso qumico, generalmente por
tratamiento con lcalis. A continuacin, los fragmentos se
transeren del gel a un soporte slido, como membranas de
nitrocelulosa o de nailon. Existen diferentes mtodos para
la transferencia, como la capilaridad, el vaco o la electrotransferencia. Es importante sealar que la nalidad de
la transferencia es crear una rplica de lo que se tena en el
gel, ahora en un soporte mucho ms slido, como es una
membrana. Por ltimo, para identicar uno o ms fragmentos entre millones de fragmentos, se utiliza una sonda
especca marcada con alguna molcula reportera (por
ejemplo, radiactividad, 32P-dCTP). La sonda se pone en
contacto con la membrana de nitrocelulosa y en aquellos
lugares en donde la sonda encuentre su secuencia complementaria se pegar, proceso conocido como hibridacin. La
sonda emitir radiactividad, la cual se detectar mediante
un proceso de revelado con placas de rayos X. La emisin
de la sonda corresponder nicamente al fragmento de
inters. En la gura 15-1 se observa un esquema de cada
uno de los pasos involucrados en la tcnica de Southern
blot.

la sonda) o la enzima transferasa terminal (que introduce


varios nucletidos marcados en el extremo 3 de la sonda).
El marcaje en toda la sonda se realiza por el procedimiento de nick traslation (gura 15-2). En este mtodo se
combinan dos actividades enzimticas:
1. Actividad ADNsa 1, que suprime un nucletido al azar
de una de las dos cadenas de la sonda.
2. Actividad de ADN polimerasa, que, a partir del hueco
dejado en la cadena deADN por la ADNsa 1, va incorporando nuevos nucletidos por complementariedad
(entre los que estn marcados), tomando como molde la
otra cadena de ADN intacta.

G G T C C A T G C T

C C A G G T A C G A
Actividad ADN sal
OH
A
T

T C C A T G C T
C*

C C A G G T A C G A
A

www.fullengineeringbook.net
Actividad ADNp

G*

A G G* C C A T G C T

C C A G G T A C G A

OH
A G G* T

C A T G C T

C C A G G T A C G A

A G G* T C* C* A T G* C* T

Marcaje de las sondas


Las sondas pueden marcarse radiactivamente (en general
con 32P) o enzimticamente (biotina, digoxigenina, etc.).
Una ventaja de los sistemas enzimticos es que, una vez
marcada la sonda, su vida media es muy larga (meses), mientras que el marcaje radiactivo es ms corto (para 32P, de 15
das). Sin embargo, la sensibilidad vara: las radiactivas
detectan hasta 0.1 pg de cido nucleico y las enzimticas,
entre 1 y 10 pg. Las sondas pueden marcarse en un extremo
o a lo largo de toda la cadena. Para marcar en un extremo puede utilizarse la enzima polinucletido cinasa (que
introduce un nico nucletido marcado en el extremo 5 de

T C

C A G

T A C G A

Figura 15-2. Marcaje de una sonda del ADN por nick translation. En el primer paso de la reaccin la enzima ADNsa 1
produce una pequea rotura (nick) en una de las cadenas del
ADN. A partir de sta, la ADN polimerasa 1 aade nucletidos
al extremo 3 OH generados. Dicha enzima tiene, adems, actividad de exonucleasa 5-3, que libera nucletidos del 5 del
nick. La eliminacin de nucletidos del extremo 5 y la adicin
de nuevos nucletidos al extremo 3 provoca el movimiento del
nick a lo largo del ADN (nick translation). La sustitucin de uno
o ms de los nucletidos que van a ser incorporados de nuevo
por nucletidos marcados radiactivamente origina la formacin
de molculas marcadas (sondas).

142

PARTE II Metodologa del ADN recombinante

Otro mtodo para marcar sondas es el de random primers (secuencias cortas de oligonucletidos, normalmente
hexmeros, que por su pequeo tamao hibridan al azar a
lo largo de toda la cadena). Al aadir la enzima ADN polimerasa 1 desde el lugar donde se unen los primers, van
incorporndose nucletidos en donde algunos van marcados radiactivamente hasta que nalmente se completa la
cadena.

ya que las molculas de ARN son ms pequeas y para su


anlisis no requieren su fraccionamiento. Sin embargo,
prcticamente comparten todos los dems pasos, como son
la electroforesis, la desnaturalizacin (aunque el ARN es de
cadena sencilla, puede formar estructuras secundarias), la
transferencia y la hibridacin con una sonda.

Aplicaciones

Es una herramienta muy til para el estudio de los productos de la transcripcin gnica (ARNm) y de su regulacin,
ya que se pueden estudiar las potenciales variaciones en la
abundancia de especies del ARN en diferentes condiciones
experimentales o comparar condiciones clnicas normales
o patolgicas.

La tcnica de Southern blot ha sido de gran utilidad para


identicar genes asociados con enfermedades de transmisin gentica, e identicar mutaciones, como rearreglos,
deleciones y dosis gnica en caso de portadores (gura
15-3).
Tambin se utiliza para detectar polimorsmos en los
fragmentos de restriccin de diversos genes.

Northern blot
Diferencias con Southern blot
Es la contraparte del Southern blot y como cido nucleico
se utiliza ARN en lugar de ADN. A diferencia del Southern
blot, con esta tcnica no se utilizan enzimas de restriccin,

Aplicaciones

Dot/slot blot
Tras el aislamiento y separacin de los cidos nucleicos,
stos se aplican directamente a la membrana sin separarlos,
segn su peso molecular; es decir, no se realiza electroforesis. La jacin se hace generalmente con vaco y en un molde cuyo pocillo puede tener forma de punto (dot blot) o ser
lineal (slot blot) (gura 15-4). Es posible realizar detecciones no slo cualitativas (positivo o negativo) sino tambin
cuantitativas, utilizando como patrn diluciones seriadas

www.fullengineeringbook.net
Gel de electroforesis teido

Membrana de hibridacin
Normal portador afectado

Kb
20

9
6
4
2

Figura 15-3. Southern blot para el diagnstico de anemia falciforme. El esquema de la izquierda representa el ADN digerido con
enzimas de restriccin, separado por electroforesis y teido con bromuro de etidio. Al extremo del gel, se observa un marcador de
peso molecular como referencia, expresado en kilobases (Kb). El esquema de la derecha muestra el resultado de la hibridacin,
donde se observan las bandas que son reconocidas por la sonda. En este caso el diagnstico fue dirigido hacia una hemoglobinopata (anemia falciforme), una enfermedad autosmica recesiva. Por el mtodo de Southern blot se observa claramente la
dotacin gnica en caso de sujetos portadores y afectados por la enfermedad.

CAPTULO 15 Tcnicas de hibridacin

A) Dot blot

dots

B) Slot blot

143

Laboratorio de Gentica - INEN

slots
HER-2/neu

Figura 15-4. Esquema de la visualizacin del dot blot y slot blot.


El tipo de soporte que se utiliza durante el proceso de jacin
de los cidos nucleicos en una membrana o ltro es lo que
determina la forma en que se visualiza esta tcnica molecular.
A) Soporte que se utiliza para realizar un dot blot, donde los
oricios estn en forma de puntos. B) Soporte que se utiliza
para realizar un slot blot, donde los oricios se encuentran en
forma de lneas.

de concentraciones conocidas del genoma que se est


determinando.

CEP 17

Figura 15-5. Tcnica de FISH. Identicacin del gen HER2/NEU


en cncer de mama por la tcnica de FISH. El gen HER2/NEU
se encuentra localizado en el cromosoma 17q, y su amplicacin est presente en 25 a 30% de las neoplasias de mama;
se relaciona estrechamente con los estadios avanzados, metastsicos, que implican mal pronstico. En la actualidad existe
un tratamiento con anticuerpos monoclonales humanizados
dirigidos especcamente contra el producto del gen HER2/
NEU que mejora el pronstico y la sobrevida del paciente.

www.fullengineeringbook.net

Hibridacin in situ

Es un mtodo histoqumico que emplea a la biologa molecular de la misma manera que la inmunohistoqumica utiliza los mtodos de la inmunologa. Los principios de ambos
mtodos son semejantes y el resultado nal es el mismo: la
identicacin de componentes tisulares que pueden observarse al microscopio. La especicidad de la inmunohistoqumica se basa en la unin antgeno/anticuerpo, mientras
que la especicidad de la hibridacin in situ se basa en la
unin de una sonda con una secuencia complementaria de
ADN o ARN dentro de un tejido. A diferencia de Southern
blot y Northern blot, la hibridacin in situ no requiere de la
extraccin de cidos nucleicos, sino que en el mismo tejido
se lleva a cabo el procedimiento de deteccin e hibridacin;
de ah el nombre de in situ (en el mismo lugar). Las sondas
que se utilizan para la hibridacin in situ pueden ser radiactivas y no radiactivas. En la actualidad, las ms relevantes
son las marcadas con uorescencia, modalidad conocida
como hibridacin in situ acoplada a un sistema de uorocromos (FISH) (gura 15-5), o con biotina, ya que el detalle
morfolgico no se pierde, a diferencia de lo que ocurre con
las modalidades radiactivas.

Aspectos tcnicos
El primer paso para la hibridacin es la preparacin y jacin del tejido, en el cual deben conservarse los cidos
nucleicos lo ms ntegramente posibles, mantener la mor-

fologa del tejido y permitir una accesibilidad suciente


para que la sonda penetre. La jacin con formalina, seguida de una inclusin con parana es el procedimiento ms
usado. Despus de la jacin las secciones de tejido deben
adherirse al portaobjetos y no deben desprenderse durante
el procedimiento de hibridacin. Normalmente se utiliza
gelatina crmica, polilisina o Vectabond (producto comercial). Antes de la hibridacin, los tejidos se pretratan con
HCl (que extrae protenas e hidroliza parcialmente las
secuencias diana) y proteinasa K (que incrementa la penetracin y la accesibilidad de la sonda) y se someten a una posjacin con paraformaldehdo (incrementa la especicidad
de la seal). El procedimiento es muy complejo, por lo que
nicamente se han mencionado algunos de los aspectos
ms relevantes.

Aplicaciones
La hibridacin in situ tiene un alto grado de resolucin, que
permite la localizacin de secuencias gnicas a nivel cromosmico, con lo que se pueden detectar translocaciones y
otras alteraciones cromosmicas, as como el estudio de
expresin de genes (ARNm) a nivel celular y subcelular. Las
principales aplicaciones son la identicacin de infecciones
virales en tejidos, as como el mapeo cromosmico.

144

PARTE II Metodologa del ADN recombinante

Ejercicios de integracin
1. Consulte la secuencia nmero del ARNm de NFkB
(NM_001077494.1) del banco de genes (http://www.
ncbi.nlm.nih.gov). Segn la informacin all reportada,
responda lo siguiente:
En qu posicin del ARNm se unen las siguientes sondas?
a) 5agctctgctggatcggcatggag3
b) 5acgcggacccgcgggcgtctaaaatt 3
En qu exn se localizan estas secuencias?
Cul es la secuencia complementaria de cada sonda?
Segn lo mencionado en este captulo, cul tcnica de
hibridacin es la ms adecuada para detectar el ARNm?
2. Cul de los siguientes enunciados es verdadero para la
tcnica Southern blot?
a) Se extrae ARN celular, separado por electroforesis y
transferido a una membrana, se hibrida con una sonda marcada especca para un gen.
b) Se extrae ADN, se digiere con enzimas de restriccin,
los fragmentos generados son marcados con radiactividad, se separan por electroforesis y se transeren a
una membrana, donde hibridan con una sonda marcada especca para un gen.
c) Se utilizan fragmentos de ADN cortados con enzimas
de restriccin, que se separan por electroforesis y se
transeren a una membrana, donde se hibridan con
una sonda marcada especca para un gen.

4. La siguiente fotografa muestra la hibridacin de una sonda en el ARNm del virus del papiloma humano en pacientes con sospecha de presentar la infeccin. Puede
identicar cules individuos estn infectados?

D
1

5. Cul frase es correcta para describir la hibridacin in


situ?
a) La tcnica permite localizar un segmento concreto de
ADN en una posicin determinada de un cromosoma
eucaritico.
b) Si el marcaje es de tipo quimioluminiscente la tcnica
se denomina FISH.
c) Consiste en detectar determinados ARNm marcados
con uorescencia, utilizando sondas de ADN marcadas procedentes del cromosoma deseado.

www.fullengineeringbook.net

3. La siguiente fotografa muestra la hibridacin de una sonda en el ADN digerido con enzimas de restriccin de los
miembros de una familia con alteraciones en el gen de
distrona. Puede identicar cules individuos presentan
el gen alterado?

Bibliografa
Aussubel F., Brent R.E., Kingston R.E., Moore D.D., Seidman J.G.,
Smith J.A., et al., editores. Short protocols in molecular biology,

Ross J. Nucleic acid hybridization. Essential techniques. Londres:

4 ed. Nueva York: John Wiley and Sons, 2000.


Carreo V., Castillo I. Principios de biologa molecular, 1 ed. Madrid:
Springer, 2001.
Peters PM. Biotechnology: A guide to genetic engineering, 1 ed.
Dubuque: William C. Brown Publishers, 1993.

Sambrook J., Russell D. The condensed protocols. From molecular

John Wiley & Sons, 1998.


cloning: a laboratory manual. Nueva York: CSHL Press, 2006.

Captulo

16

Reaccin en cadena
de la polimerasa
Ana Soledad Sandoval Rodrguez / Jorge Fernando Floresvillar Mosqueda
Alejandra Meza Ros

Introduccin

polimerasa, cofactores necesarios para la actividad correcta


de la ADN polimerasa, desoxinucletidos (dNTP) para la
sntesis del producto de PCR y oligonucletidos o primers.
La funcin de cada uno de estos elementos en la reaccin se
describe a continuacin y se enlistan en la gura 16-1.

La reaccin en cadena de la polimerasa (PCR) se considera


una de las tcnicas ms sensibles y especcas de las pruebas moleculares. Fue desarrollada en 1986 por el Dr. Kary
Mullis, en los laboratorios de CETUR Corporation, en Estados Unidos, lo que le hizo valedor del premio Nobel
en 1993. La idea se fundament en la necesidad de obtener
un gran nmero de copias de fragmentos especcos de
ADN de manera rpida y econmica, los cuales no podan
obtenerse por otros mtodos hasta ese momento. Esta tcnica se basa en una replicacin exponencial in vitro de una
molcula de ADN genmico (ADNg) o ADN complementario (ADNc), mediante ciclos repetitivos, que constan de
tres temperaturas. En cada uno de los ciclos las molculas
se duplican hasta que los reactivos se agotan.
La longitud del producto amplicado la delimitan los
iniciadores, tambin llamados primers u oligonucletidos,
de cuyo diseo adecuado depende el xito de la PCR. Los
iniciadores deben ser especcos, no formar estructuras
secundarias entre ellos ni hibridaciones inespeccas entre
ellos u otra parte de la cadena.

ADN polimerasa

www.fullengineeringbook.net

En la actualidad, la Taq ADN polimerasa es la enzima ms


empleada para la PCR; tiene como funcin polimerizar una
nueva cadena de ADN tomando como molde otra ya existente. Debido a que en cada ciclo de la PCR se lleva la mezcla
de reaccin a temperaturas de 95C, se requiere de una ADN
polimerasa capaz de soportar dichas temperaturas. Anteriormente, esta necesidad se supla con la adicin de E. coli
en cada ciclo de la ADN polimerasa, que se inactivaba con la
temperatura de 95C, por lo que deba suplementarse de
nuevo despus de cada paso de desnaturalizacin (95C). Sin
embargo, el descubrimiento de bacterias habitantes de los
giser, que viven a temperaturas alrededor del punto de ebullicin del agua, permiti el aislamiento de la Taq polimerasa
de la bacteria Thermophilus aquaticus. Con ello, la tcnica
pudo hacerse ms eciente, pues dicha enzima soporta los
95C, y la cantidad inicial de enzima aadida a la reaccin es
suciente como para suplementar los 25 a 40 ciclos de amplicacin. La concentracin de Taq polimerasa que se recomienda es de 1 a 2.5 U/reaccin de PCR, y su tasa de error en
la incorporacin de bases es de 4 10-4. Esta enzima es capaz
de polimerizar un promedio de 1000 nt/minuto.

Caractersticas de la amplicacin in vitro


y requerimientos necesarios para la PCR
La amplicacin in vitro de la PCR se apega a las mismas
reglas de la replicacin; esto es, se basa en una secuencia
que le sirve de molde y, por complementariedad, sintetiza la
cadena antiparalela. Tambin, la sntesis de la cadena sigue
la direccin 5-3, ya que requiere de un nucletido con el
extremo 3 libre que proporcione el grupo OH para la adicin del siguiente nucletido, con lo que se forma el enlace
fosfodister.
Para que se lleve a cabo la PCR se requiere una cadena
de ADNg o ADNc que sirva de molde, una enzima ADN

ADN molde
Para la PCR tericamente se requiere de una sola molcula,
cuya secuencia sirva de molde para la amplicacin, ya sea
de ADN o de ADNg. El ADN se puede obtener de cualquier
muestra biolgica, y la mayora de las tcnicas de extraccin
de cidos nucleicos proveen de molculas de calidad adecua145

146

PARTE II Metodologa del ADN recombinante

COMPONENTES PARA UNA REACCIN DE PCR


Molde
ADNds o ADNc
Primers u oligonucletidos
Enzima ADN polimerasa

menores de 50 M se consideran insucientes para una sntesis adecuada.

Amortiguador
La solucin amortiguadora proporciona el pH y concentraciones de sales adecuadas para la correcta funcin de la
ADN polimerasa. Este buer maneja un pH de 8.4 y est
compuesto por Tris-HCl y KCl.

Cofactores (MgCl2)
O
O

P
O

base
A, T, G,C

O
O

O P O P O CH
O

dNTPs
Termociclador

Figura 16-1. Componentes de la reaccin de PCR. Para que se


lleve a cabo la reaccin en cadena de la polimerasa se requiere
una cadena de ADNg o ADNc que sirva de molde, una enzima
ADN polimerasa, Mn+2 o Mg+2 necesarios como cofactores para
la enzima, dNTPs o desoxinucletidos y oligonucletidos para el
inicio de la sntesis. Estos reactivos se mezclan y se someten en
el termociclador a los ciclos de amplicacin.

da para realizar la PCR. Si se quiere amplicar ARN, antes de


la PCR se requiere realizar una reaccin previa: la retrotranscripcin, que permite convertir el ARN en ADNc,
menos lbil que una cadena de ARN (cabe recordar que la
inestabilidad molecular del ARN es elevada por la presencia
del grupo OH en el carbono 2 de la ribosa). El ADNc puede
manejarse, entonces, con mayor facilidad. Las tcnicas
actuales empleadas en la PCR permiten realizar la amplicacin a partir de 300 ng de ADN genmico, o bien desde 25 a
100 ng en el caso de ADNc o ADN proveniente de genes
clonados en vectores. Es importante aclarar que en el caso de
la amplicacin de ADNc obtenido por retrotranscripcin a
partir de ARN, durante los primeros ciclos de la PCR se realiza la sntesis de la cadena complementaria del ADNc, lo
que permitir la amplicacin de la secuencia como ADN de
doble cadena (ADNds) en los ciclos posteriores de la PCR.

Cloruro de magnesio
El magnesio acta como cofactor de la ADN polimerasa y
se suplementa a una concentracin de entre 1.0 y 2.5 mM.
Esta concentracin debe optimizarse de manera experimental para cada PCR, ya que un exceso de magnesio produce una amplicacin inespecca de productos de PCR,
mientras que una baja concentracin disminuye la produccin del amplicado.

Iniciadores
El diseo adecuado de los iniciadores es la clave del xito de
una PCR. Estos oligonucletidos, con secuencia especca,
se utilizan para reconocer por complementariedad secuencias blanco en el ADN molde. En la PCR convencional, se
usa un par de iniciadores para delimitar los extremos del
producto que se desea amplicar. Su funcin radica en proporcionar un extremo 3 libre al que se han de aadir los
nucletidos consecutivos mediante enlace fosfodister, ya
que la ADN polimerasa requiere iniciar la sntesis partiendo
de un 3OH preexistente. A partir de ellos, la ADN polimerasa inicia la polimerizacin en direccin 5-3. Los iniciadores reciben el nombre de sentido y antisentido, segn la
secuencia a la que dan origen. El iniciador sentido es complementario y antiparalelo a la cadena 3-5 del ADN molde,
por lo que la polimerasa, al adicionar nucletidos en l, origina una cadena sentido (5-3). En cambio, el PRIMER
antisentido es complementario y antiparalelo a la cadena
5-3, por lo que su polimerizacin originar la cadena 3-5
(gura 16-2). En la PCR la concentracin ptima de los iniciadores es de 0.3 a 1 M/reaccin, ya que un exceso favorecera la formacin de dmeros entre dos primers
parcialmente complementarios, o bien de estructuras
secundarias por complementariedad parcial de un primer
con el mismo, como se aprecia en la gura 16-3.

www.fullengineeringbook.net

Desoxinucletidos
Para que la polimerasa lleve a cabo su funcin necesita que
existan desoxinucletidos (dNTP: dATP, dCTP, dGTP,
dTTP) en la mezcla de reaccin para poder sintetizar la
nueva hebra del ADN. Los desoxinucletidos libres, cuando
no forman cadenas de cidos nucleicos, se encuentran en su
forma trifosfatada, estructura molecular necesaria para su
estabilidad y para proporcionar el grupo fosfato con el que
se formar el enlace fosfodister en la unin nucletidonucletido. Los desoxinucletidos trifosfatados deben adicionarse en una concentracin ptima de entre 50 y 200
M, cantidad suciente para sintetizar de 6.5 a 25 g de
ADN. Cantidades mayores de 200 M pueden producir
incorporaciones errneas, mientras que concentraciones

Diseo de iniciadores y su papel


en la especicidad de la PCR
Los iniciadores denen el tamao del fragmento que se ha
de amplicar. El tamao de los productos a amplicar se
encuentra entre 100 y 1000 pb, aunque se recomienda que
sea entre 200 y 500 pb. En caso de que se desee analizar la
expresin de un ARN mensajero (ARNm) convertido a
ADNc, los primers se disean de tal forma que uno de stos
hibride en una secuencia exnica y el otro oligonucletido

147

CAPTULO 16 Reaccin en cadena de la polimerasa

ADN de inters
PCR

5
3

Desnaturalizacin

95C

5
3

Alineacin de primers

50C

Primer
Primer

sentido

antisentido

72C

www.fullengineeringbook.net
Extensin

Figura 16-2. Esquema convencional de un PCR. Los ciclos del PCR constan de los pasos de desnaturalizacin, alineacin y extensin. Estos pasos se realizan mediante el cambio automtico de temperaturas en un termociclador. La temperatura de desnaturalizacin permite el rompimiento de los puentes de hidrgeno entre las cadenas del ADN, mientras la temperatura de alineamiento
proporciona las condiciones cinticas favorables para la unin de los iniciadores con su secuencia complementaria. En la temperatura de extensin la enzima polimeriza los dNTPs y forma la cadena complementaria basndose en el molde al cual hibrid el
primer correspondiente.

a) Estructura secundaria en 3
5

TGTACCGTTCCGTATGGCCC
3

AAGGCATACCGGA

Iniciadores de PCR
no adecuados
b) Complementariedad de bases
5

TGTACCGTTCCGTATGGCCC
3

CAAGGCATACCGGGATCGATT

Figura 16-3. Posible secuestro del extremo 3 en los iniciadores


de PCR. a) Estructura secundaria en 3: generada por complementariedad intrainiciador, generando una estructura plegada
de doble cadena que interere con el correcto alineamiento
del iniciador. b) Complementariedad de bases: producida por
complementariedad interiniciadores, generando dmeros que
afectan la disponibilidad de los mismos en el PCR.

lo haga en otra secuencia exnica; de esta manera, la amplicacin del producto del tamao esperado asegura que slo
los ARNm se han amplicado. En caso deque se haya amplicado tambin una secuencia de ADNg, (proveniente de
contaminacin de la muestra de ARN con ADN durante el
proceso de extraccin), el producto ser de un tamao diferente, ya que tiene secuencias intrnicas de por medio,
como se aprecia en la gura 16-4.
La secuencia de los iniciadores debe ser altamente especca para el gen de inters, y procurar un contenido de
nucletidos G-C de 40 a 60% y una longitud ptima entre los
18 y los 30 nt. Tambin debe evitarse un diseo que permita
la complementariedad o la formacin de estructuras secundarias inter e intra-primers, sobre todo cuando estas estructuras secuestran el extremo 3, indispensable para la adicin
de nucletidos como se ejemplic en la gura 16-3.
La secuencia y la longitud de los iniciadores es determinante para su temperatura de fusin (Tm), la cual se dene
como aqulla a la que el 50% de los iniciadores se encuentra
en estructura de cadena lineal. Se procura un diseo tal que

148

PARTE II Metodologa del ADN recombinante

Exn 2

Intrn

Exn 3

Exn 2

Intrn

Exn 3

Primer antisentido
5

Corte

y Empalme

Exn 2

Exn 3
Primer antisentido

Primer sentido

MOLDE ADNg

Primer sentido
MOLDE ADNc

Exn 2

MPM

Exn 3

ADNg

ADNc

1000 pb
500 pb

Exn 2

Exn 3

300 pb

www.fullengineeringbook.net
100 pb

Figura 16-4. Diseo de iniciadores para la discriminacin de ARNm y ADNg. Los iniciadores denen el tamao del fragmento que se
ha de amplicar, por lo que si stos se disean para que hibriden en dos exones diferentes, el tamao que genere el producto de
amplicacin ser mayor cuando el molde sea la molcula de ADNg que contiene la secuencia interexnica, es decir un intrn.
Cuando el molde de la reaccin de PCR sea el ARNm (ADNc correspondiente), el amplicn ser de menor longitud por carecer
de la secuencia intrnica.

la Tm de ambos primers sea muy similar y no presente ms


de 5C de diferencia con la Tm del producto que se va a
amplicar, lo cual garantiza temperaturas de alineamiento
similares para ambos primers y una eciencia de amplicacin adecuada. La Tm aumenta segn la longitud del iniciador, por lo que un iniciador por debajo de las 18 nt hibridara
de forma inespecca en la cadena molde y originara productos inespeccos. Por otro lado, iniciadores muy largos
requieren de Tm superiores a 65C; por esto, la longitud
ptima est entre los 20 y 30 nucletidos para que se obtenga
una Tm entre 55 y 65C, compatible con la amplicacin de
la generalidad de los fragmentos. Existen muchos mtodos
para calcular la Tm de los iniciadores, pero todos toman en
consideracin el contenido de nucletidos, sobre todo G y C,
la longitud del primer y la concentracin de Na+ en el tubo
de la PCR. En la actualidad, muchos programas computacionales permiten el diseo semiautomatizado de los primers,
tomando en cuenta los parmetros mencionados. Algunos
de los programas utilizados son Oligo 6.0, Primer Express,
Primer Desing, etc. Una vez diseados, los oligonucletidos deben vericarse contra alineaciones inespeccas en la

misma secuencia blanco o bien en otras secuencias, empleando el programa BLAST (Basic Local Alignment Search Tool,
http://blast.ncbi.nlm.nih.gov/Blast.cgi). Este software coteja
una posible hibridacin, total o parcial, con alguna secuencia
reportada en el Gene Bank que pudiera interferir con la
especicidad de los primers y su empleo correcto. En caso de
hibridacin con otras secuencias (ARNm o gnicas) reportadas en el banco de genes su diseo debe replantearse.

Esquema de la PCR
En la gura 16-2 se presenta el esquema convencional de
una PCR, que incluye los siguientes pasos:
1. Inicio de la desnaturalizacin.
2. Ciclos de amplicacin.
Temperatura de desnaturalizacin.
Temperatura de alineamiento.
Temperatura de extensin.
3. Amplicacin nal.
4. Almacenamiento temporal.

CAPTULO 16 Reaccin en cadena de la polimerasa

Estos pasos se llevan a cabo mediante el cambio automtico de temperaturas en un equipo diseado para este n
denominado termociclador.

Termociclador
Es el equipo en el cual se realiza la PCR. Es capaz de cambiar la temperatura de la muestra en cuestin de segundos,
lo que por lo general se logra mediante calentamiento/
enfriamiento por resistencia elctrica de una placa metlica, que distribuye la temperatura de manera homognea
durante tiempos programados en el rango de segundos a
minutos. Normalmente los rangos de temperatura que
abarca el equipo van de 4 a 96C. Dado que las PCR que se
incuban son soluciones acuosas, los equipos cuentan con
una placa metlica a manera de tapa, la cual se mantiene a
103C para evitar la condensacin del agua en las tapas de
los tubos donde ocurre la reaccin. De esta manera, se evita
que la concentracin de los solutos se modique, lo que
alterara las condiciones ptimas para la ADN polimerasa y
la termodinmica de hibridacin de los primers. Para el
enfriamiento se generan ujos de aire fro, lo que permite
descensos de temperatura relativamente rpidos.

149

es, se genera la energa cintica necesaria para que los iniciadores busquen en las cadenas de ADN su secuencia complementaria y formen los puentes de hidrgeno con la cadena
molde, dejando el extremo 3OH disponible y listo para la adicin de los nucletidos consecutivos por la ADN polimerasa.

Extensin
Se produce a la temperatura ptima para el funcionamiento
de la ADN polimerasa empleada, por lo que depender sta
para la PCR. En el caso de la Taq polimerasa, la ms utilizada es de 72C.

Amplicacin nal
Una vez terminados los ciclos designados para la PCR, la
temperatura de extensin (72C) se mantiene por cinco
minutos, lo que permite que la polimerasa termine la extensin de los productos a los cuales se encuentra unida.

Almacenamiento temporal
Durante la programacin de los ciclos de la PCR se programa tambin un ciclo nal de 4C por varias horas, lo que
permite conservar los productos de PCR hasta que se retiren los tubos de reaccin del equipo.

Inicio de la desnaturalizacin
Es necesaria una temperatura de 95C para la desnaturalizacin de la doble cadena de ADN, en el caso del ADN genmico, o el rompimiento de estructuras secundarias, en el
ADNc. Esta temperatura se mantiene por cinco minutos al
inicio de la PCR.

Cantidad del producto de PCR:


nmero de copias por cada ciclo
segn la expresin p = (2)nT

www.fullengineeringbook.net

Ciclos de amplicacin
Un ciclo tpico de PCR convencional consta de las tres temperaturas siguientes:

95C: desnaturalizacin por unos 30 segundos.


55 a 60C: alineacin por 30 a 40 segundos.
72C extensin, segn la longitud del producto que se va
a amplicar, considerando la adicin de 1 000 nucletidos en 60 segundos.

Este ciclaje de temperatura se repite continuamente por


30 a 35 ocasiones. Cada temperatura cumple con una funcin especca.

Desnaturalizacin
Se realiza a 95C y tiene como objetivo desnaturalizar la
doble cadena de ADN y/o destruir las estructuras secundarias del ADN, lo que permite el acceso de los primers a la
cadena molde en sus secuencias complementarias. Esta
temperatura se mantiene por 30 segundos.

Alineacin
En esta fase, la temperatura se encuentra en un rango entre 55
y 60C, en el cual la mayora de los iniciadores hibridan; esto

Tericamente, en cada uno de los ciclos de amplicacin se


duplica la cantidad de producto inicial. As, el producto
de PCR aumenta exponencialmente conforme al nmero de
ciclos de PCR (n). Sin embargo, el producto de PCR depende del nmero inicial de copias del molde de ADN (T), por
lo que se aplica la frmula que indica que si se parte del
doble de molculas iniciales de ADN se obtendr el doble
de producto:
P = (2)nT
donde:
P = nmero de molculas producto de PCR;
n = nmero de ciclos;
T = nmero de copias inicial de la molcula molde.
Por ejemplo, una PCR de 25 ciclos, partiendo de 10
copias de ADN molde, producir la cantidad de P = (2)25 10;
o sea, 2250, o lo que es lo mismo, 1.8 1075 molculas.
En la gura 16-5 se presenta un esquema de esta amplicacin exponencial.

Sensibilidad de la tcnica de PCR


La PCR es una tcnica altamente sensible y especca, al
alcance de la mayora de los laboratorios de biologa molecular. Bajo las condiciones y diseo de oligonucletidos apro-

150

PARTE II Metodologa del ADN recombinante


Amplificacin exponencial 2n

ADN molde
Primer ciclo - 22 4 copias
Segundo ciclo - 23 8 copias

Tercer ciclo - 24 16 copias


Cuarto ciclo - 25 32 copias
P = 2nT= 230 - 1 073 741 824 copias

Figura 16-5. Amplicacin exponencial del producto de PCR. La amplicacin del producto de PCR sigue la frmula P = (2)nT,
donde: P = nmero de molculas producto del PCR; n = nmero de ciclos; T = nmero de copias inicial de la molcula molde. En
cada ciclo se duplica la cantidad de producto inicial, por lo que el nmero de molculas producto del PCR aumenta exponencialmente conforme avance la reaccin.

piados se puede obtener una sensibilidad y una especicidad


de 100%. Sin embargo, en experimentacin es dif cil obtener
estos resultados, ya que mltiples factores inuyen de manera crucial en el desarrollo de una PCR, como la seleccin de
un sistema adecuado de deteccin del producto amplicado,
el diseo correcto de primers y sondas, la calidad de la muestra que se va a amplicar, el control de los inhibidores de la
reaccin, la contaminacin ambiental, la contaminacin con
otros productos de PCR, la optimizacin de las condiciones
de reaccin, la concentracin de reactivos, el termociclador
empleado, etc. El control y el manejo correcto de cada uno
de estos factores inuirn en la calidad de la PCR. Esta sensibilidad es su principal caracterstica y desventaja: una PCR
puede proporcionar un diagnstico temprano, pues tan slo
con pocas copias del genoma de un patgeno puede determinarse su presencia. Sin embargo, esta misma caracterstica hace que la realizacin de una PCR sea una tarea para el
especialista y que siempre deba tenerse cuidado de evitar un
acarreamiento de material que pueda contaminar la reaccin y producir falsos positivos.

(ver el captulo 12 Electroforesis). La intensidad de la banda se considera proporcional a la cantidad de producto


amplicado y su longitud se verica interpolando contra un
marcador de peso molecular comercial de longitudes conocidas como se aprecia en la gura 16-6. El anlisis de imagen
de la banda del producto de PCR permite medir su intensidad mediante software y realizar una medicin semicuantitativa de las bandas de los productos de PCR obtenidos en
diversas muestras. La semicuanticacin puede ser respecto
a cualquiera de las muestras contenidas en el gel, como se
observa en la gura 16-7A, en la que el carril 3 muestra una
banda tres veces ms intensa que la banda del carril 1, pero
la mitad de intensa que la banda de la muestra 2. O bien una
semicuanticacin de las muestras respecto a un gen constitutivo, como se observa en la gura 16-7B. Para este tipo de
anlisis se mide la intensidad relativa de la banda del producto de PCR del gen de inters y de un gen constitutivo. Se
considera un gen constitutivo aquel que tiene una expresin
constante, ya que es indispensable para la viabilidad de la
clula y esta expresin no se altera por la presencia de alguna
enfermedad o variaciones en la condicin siolgica, no
vara entre los individuos ni durante el desarrollo (edad) y
no se ve afectado por las condiciones del experimento.
GAPDH (gliceraldehido 3 fosfato deshidrogenasa), HPRT
(hipoxanthine guanine phosphoribosyltransferase), -actina
(beta-actina) y ARNr 18S (ARN ribosomal 18S) son los
genes constitutivos ms empleados para este tipo de anlisis
Con el valor de intensidad relativa de los genes, los
datos se normalizan respecto al gen constituido y se calcula
un ndice:
Intensidad relativa del gen de inters
intensidad relativa del gen constitutivo
Ya que la expresin del gen constitutivo permanecer
relativamente constante, esta relacin indica directamente

www.fullengineeringbook.net

Modalidades de la tcnica de PCR


Esta tcnica ha evolucionado desde su invencin. En la
actualidad, gracias a los mltiples sistemas de deteccin, a
variantes en los iniciadores y a la cantidad de pares de primers empleada se dispone de diversas variantes de la tcnica, que se enlistan a continuacin:

PCR convencional
Se basa en la deteccin del producto de amplicacin
mediante una electroforesis en gel de agarosa o acrilamida.
El producto amplicado se visualiza mediante una banda

CAPTULO 16 Reaccin en cadena de la polimerasa

Preparar agarosa o
acrilamida

RY

BATTE

Pipetear muestras
y marcador de PM

Agregar gel a la
cmara y buffer de
corrimiento

(negativo)
4

151

5
muestra

M PM

pb

12,000

Marcador de PM

Afluente de energa

5,000

2,000
1,650
1,000
850
650
500
400
300
200
100

300

Comparar bandas de muestras


vs marcador PM

(positivo)
Corrimiento

Figura 16-6. Visualizacin del producto de PCR mediante electroforesis en gel. La deteccin del producto de amplicacin mediante
una electroforesis en gel de agarosa se observa como una banda. La intensidad de la banda se considera proporcional a la cantidad de producto amplicado y su longitud se verica interpolando contra un marcador de peso molecular comercial de longitudes
conocidas. En este gel el carril marcado MPM corresponde al marcador de peso molecular de 1 Kb plus ADN ladder; los valores
correspondientes a las bandas se observan en la columna pb (pares de bases). La muestra corresponde a un producto de aproximadamente 300 pb, como se puede apreciar en el carril de muestra.

www.fullengineeringbook.net
C1

C2

C3

MPM

C1

C2

C3

B)
1000 pb

100 pb
MPM

Muestra C2: 6 veces ms que la muestra C1


Muestra C3: 3 veces ms que la muestra C1

Gen constructivo

3 URA

6 URA

1 URA

100 pb

3 URA

300 pb

C1

C2

C3

0-95 URA

300 pb

500 pb

6 URA

500 pb

1.1 URA

Gen de inters

1000 pb

1 URA

MPM

1.2 URA

A)

Muestra C1: 1/1.2 = 0.83


Muestra C2: 6/1.1 = 5.45
Muestra C2: 3/095 = 3.15

1000 pb
500 pb
300 pb

100 pb

Figura 16-7. Anlisis de imagen de la banda del producto de PCR. La intensidad de la banda del producto de PCR se mide mediante
un software. A) Anlisis semicuantitativo respecto a una muestra, en el cual las bandas de los productos de PCR obtenidos de
varias muestras se comparan respecto a cualquiera de las muestras contenidas en el gel, como en la imagen donde el carril 3
muestra una banda tres veces ms intensa que la banda del carril 1, pero la mitad de intensa que la banda de la muestra del
carril 2. B) Semicuanticacin respecto a un gen constitutivo; es aquella en la cual se mide la intensidad relativa de la banda
del producto de PCR del gen de inters y de un gen constitutivo para cada una de las muestras, se determina la relacin gen de
inters/gen constitutivo para cada muestra, y dicha relacin se compara entre muestras indicando cul de ellas expresa ms o
menos el gen de inters normalizado contra el gen constitutivo.

152

PARTE II Metodologa del ADN recombinante

la variacin entre muestras del gen de inters. Esta forma de


semicuanticacin es tambin posible realizarla con la tecnologa de deteccin en tiempo real empleando los mtodos
2Ct, o el mtodo 2Ct, que se describen ms adelante.

lizar una relacin entre la expresin del gen de inters con


la expresin del gen constitutivo el ndice que se obtenga
indicar la expresin real del gen de inters y se reporta
como porcentaje de expresin. Esto permite su comparacin con otras muestras analizadas de la misma manera.

PCR cualitativa
Esta modalidad de PCR permite detectar la presencia o
ausencia de un fragmento de ADN determinado. Es decir,
slo reporta si una muestra es positiva o negativa ante la
presencia de un determinado ADN. Se emplea para el diagnstico de enfermedades infecciosas y slo permite conrmar la presencia o ausencia de un determinado agente
patgeno, esto es, si una persona est o no infectada.

PCR semicuantitativa
Permite conocer los niveles de expresin de un gen (ARNm)
en particular, y normaliza los niveles encontrados de este
gen con los encontrados en un gen de expresin constitutiva, que se expresa de manera constante en la clula. Al rea-

PCR cuantitativa
En esta modalidad de PCR, el producto de PCR es cuanticable, lo que permite reportar en nmeros absolutos la cantidad de un microorganismo o del ARNm de un gen en una
muestra. Para la cuanticacin absoluta se amplica al mismo tiempo una curva con muestras de concentracin conocida del ADN que se quiere analizar. Los resultados de las
muestras se traslapan a los valores de la curva y de esta
manera se conoce la concentracin de la muestra.

PCR mltiple (varias regiones o varios genes)


En este tipo de PCR se realiza la amplicacin de ms de un
fragmento de ADN en una sola reaccin de PCR con dos o

ADN de inters

www.fullengineeringbook.net
3

a) Alineacin del primer juego de primers


3

Primer
sentido

Primer

antisentido

b) Alineacin del segundo juego de primers


3

Primer sentido
Primer antisentido
5

Figura 16-8. PCR anidada. Esta variante de la PCR es ms sensible porque amplica el ADN en dos rondas de amplicacin con
distintos pares de iniciadores en cada una. a) La primera reaccin de PCR se realiza con un par de iniciadores que ampliquen
una regin de ADN extensa. b) Una segunda PCR se realiza con el producto de amplicacin de la primera PCR como molcula
molde con otro par de iniciadores anidados. El producto de amplicacin de la PCR anidada ser por tanto de longitud ms corta
que el primer producto de PCR.

CAPTULO 16 Reaccin en cadena de la polimerasa

ms juegos de primers (cada juego para un gen en particular). Tiene la ventaja de que ahorra tiempo y reactivos, pero
presenta el inconveniente de que el diseo de los primers
debe ser adecuado para que no se complementen entre
ellos (hibridaciones inespeccas). La PCR mltiple o multiplex puede emplearse para la bsqueda de varias deleciones, mutaciones y polimorsmos en un solo gen o en
mltiples. Esta tcnica se utiliza para el anlisis simultneo
de mltiples marcadores moleculares asociados a alguna
enfermedad, para la deteccin simultnea de varios agentes
patgenos, organismos genticamente modicados, etctera.

PCR selectiva (detecta genes


silvestres o mutados)
Para la PCR selectiva se disean primers capaces de hibridar solamente en secuencias con presencia de una mutacin, por lo que, en caso de estar ausente, no se produce un
producto de PCR. Como control se produce una PCR con
primers diseados para la amplicacin de la forma silvestre del gen, cuyos resultados deben coincidir con los obtenidos con los primers que amplican la mutacin. En caso de
homocigatos slo una de las dos reacciones debe resultar
positiva, en el caso de heterocigenos ambas reacciones
resultan positivas.

153

PCR en punto nal


Es aquella en la que el producto de PCR se analiza despus de
25 a 35 ciclos en el punto previo a la saturacin de la reaccin,
mediante un gel de electroforesis. Presenta el inconveniente
de que diferente cantidad de material de inicio da lugar a una
cantidad diferente de producto al nal, adems de que diferente cantidad de material de inicio da lugar a la misma cantidad de producto al nal, de la reaccin. La deteccin en
punto nal tambin presenta las desventajas de que depende
de la resolucin del gel de agarosa, que suele ser baja y no
permite detectar pequeos cambios en la concentracin;
requiere un procesamiento posreaccin, y la tincin de bromuro de etidio es semicuantitativa, pues ms de una molcula de bromuro de etidio puede unirse a un solo producto de
PCR y, por tanto, tiene una precisin pobre y presenta una
sensibilidad menor que la PCR en tiempo real.

PCR en tiempo real


Las desventajas que presenta la PCR en punto nal llevaron
a los investigadosres a disear una tecnologa que solventara estos inconvenientes conocida como PCR en tiempo real.
La reaccin de amplicacin es la misma, lo que cambia es
el mtodo de deteccin del producto amplicado y su temporalidad. La deteccin de las copias del producto de PCR
se realiza al mismo tiempo que sucede la amplicacin,
mediante intercalados en el producto de PCR, un lser que
detecta uorocromos acoplados a los primers o a una sonda
que hibrida en medio de los primers, que se degrada y libera
su uorocromo por la accin exonucleasa 3-5 de la polimerasa. Mediante la deteccin de la uorescencia liberada
durante la reaccin de amplicacin puede medirse la cantidad de ADN sintetizado en cada momento, ya que la emisin de uorescencia producida en la reaccin es
proporcional a la cantidad de producto de PCR formado.
Esto permite conocer y registrar en todo momento la cintica de la reaccin de amplicacin.
Cabe mencionar que para la tcnica de PCR en tiempo
real la temperatura de alineacin y extensin es la misma,
por lo que ambos pasos se unican. Esto se logra porque la
temperatura ptima para la enzima AmpliTaq Gold es de
60C, lo que aunado a un diseo de primers que permite su
alineacin ptima a la misma temperatura permite que este
paso sea conjuntado y reduce el tiempo de reaccin.
Los sistemas de deteccin por uorescencia empleados
en la PCR en tiempo real pueden ser iniciadores marcados
por uorforos (primers LUX light uponextension uorogenic), sondas especcas marcadas con uorcromos
(sondas TaqMan) o bien agentes intercalantes uorescentes, como SyberGreen o SyberSafe.

www.fullengineeringbook.net

PCR in situ

Se realiza en una muestra de tejido embebida en parana


(laminilla) o congelada y cortada en criostato. No requiere
extraccin del ADN del tejido. En la laminilla se aaden los
reactivos necesarios para la PCR y se colocan en un termociclador especial, ya que en lugar de tener oricios para
colocar tubos contiene ranuras para colocar las laminillas.
Esta modalidad de PCR permite saber qu tipo celular presente en un tejido expresa un determinado gen o cul clula
est infectada por un patgeno.

PCR anidada (nested-PCR)


Esta variante de la PCR convencional proporciona mayor
sensibilidad a la tcnica, al amplicar las secuencias de
ADN en dos rondas de amplicacin con distintos pares de
iniciadores o primers en cada una. Esto es, primero se realiza una PCR con un par de iniciadores externos para amplicar una regin de ADN extensa, que contiene el segmento
diana que se desea amplicar. Despus, este producto de
amplicacin sirve de molde para una segunda PCR con
otro par de iniciadores internos (primers anidados) para
amplicar una regin ms pequea (interna). Por lo tanto,
la longitud del producto de amplicacin de la segunda
PCR, o PCR anidada, ser menor que la del primer producto de PCR (gura 16-8).

PCR en tiempo real empleando SyberGreen


Para la deteccin en tiempo real, puede emplearse un agente intercalante denominado SYBERreen. En este mtodo,

154

PARTE II Metodologa del ADN recombinante

SyberGreen

SyberGreen sin fluorescencia


SyberGreen con fluorescencia

Figura 16-9. PCR en tiempo real con SyberGreen. La deteccin en


tiempo real con SYBERGreen se basa en que esta molcula es
un agente intercalante en la doble cadena de ADN que se une
de manera inespecca, produciendo uorescencia. Al unirse a
toda molcula de ADN de doble cadena se puede unir tambin
a dmeros de primers, por lo que es poco especco, pero debido a su menor costo es ampliamente utilizado.

muy utilizado por su bajo costo, el uorforo se une al ADN


de doble cadena de manera inespecca y produce uorescencia (gura 16-9). La desventaja estriba en que la unin,
al ser inespecca, ser a lo largo de toda la molcula de
ADN de doble cadena, incluyendo los dmeros de primer
que pudieran formarse. El uso de SYBERGreen implica un
diseo muy cuidadoso de los primers con el n de evitar la
formacin de dmeros. La deteccin del producto amplicado corresponder a la intensidad de la uorescencia; sin
embargo, ya que varias molculas de SYBERGreen pueden
unirse a una sola molcula de ADNds, se considera un
mtodo de cuanticacin menos preciso que las tecnologas con primers LUX o sondas TaqMan.

mtodo consiste en la transferencia de energa uorescente


mediante resonancia entre dos molculas. Estas molculas
son dos tipos de uorocromos, un donador y un aceptor, y
su principio se basa en que una molcula de alta energa
cercana a otra de baja energa (quencher) promueve una
transferencia energtica sin emisin de uorescencia. Una
vez que se separan dichas molculas se emite la uorescencia, que capta el lector del equipo . Las sondas TaqMan son
cortas y para separar las dos molculas uorescentes necesitan la rotura de su estructura por la ADN polimerasa con
actividad endonucleasa y as liberar la uorescencia. En esta
tecnologa se emplea la ADN polimerasa (AmpliTaq Gold),
que se mantiene inactiva por la unin de un anticuerpo y se
libera cuando la reaccin se incuba a los 95C iniciales de
desnaturalizacin. Los dNTP empleados contienen dUTP
en lugar de dTTP, por lo que los productos de PCR contienen dUTP. La mezcla de reaccin contiene uracil-N-glicosilasa (UNG) (AmpErase). La enzima UNG degradados
productos de PCR de reacciones previas, previniendo la
contaminacin de la reaccin de PCR actual con ADN
endgenos. Ya que durante los ciclos normales de PCR las
altas temperaturas inactivan la UNG, slo los ADN presentes en la muestra servirn de molde para ser amplicados.
Asimismo, el uorocromo ROX (conjugado de glicina de
5-carboxi-X-rodamina, succinimidilster) se incluye como
referencia pasiva a una concentracin nal de 500 nM para
normalizar la uorescencia entre reacciones por cualquier
posible uctuacin asociada con variacin en el volumen.
El empleo de este tipo de sondas se esquematiza en la gura
16-10.

www.fullengineeringbook.net

PCR en tiempo real con sondas TaqMan


En esta tecnologa (de Applied Biosystems), la reaccin de
amplicacin se lleva a cabo en un termociclador que realiza, a la vez, la deteccin de uorocromos mediante luz
lser. En esta tecnologa, adems de un juego de primers se
utiliza una sonda marcada con uorescencia. La sonda TaqMan empleada se disea de manera que hibrida en algn
punto intermedio de la secuencia franqueada por el primer
sentido y el antisentido. Estos primers estn diseados para
amplicar fragmentos de entre 60 y 150 pb. La sonda tiene
acoplado un uorocromo en su extremo 5, silenciado por
otro uorocromo o quencher (referencia pasiva). La sonda
hibrida en la cadena molde del ADN que va a ser amplicada y libera su uorocromo slo cuando la sonda se degrada
por la accin de exonucleasa 5-3 de la ADN polimerasa.
Las sondas TaqMan se basan en el mtodo FRET. Este

PCR en tiempo real con primers LUX


La PCR con primers LUX se fundamenta en que uno de los
iniciadores se encuentra marcado con un uorforo; cuando el iniciador hibrida con la cadena blanco, el uorforo es
excitado, lo que da como resultado un incremento signicativo de la seal de uorescencia que el lser detecta. Para la
amplicacin con primers LUX se emplea una enzima TaqPlatinum ADN polimerasa que se activa slo despus del
hot-start inicial de la PCR (5 minutos a 95C). De la misma
manera que con la tecnologa TaqMan, la mezcla de reaccin contiene una UNG para prevencin de contaminacin
por acarreamiento. Adems, el mix contiene Tris-HCl, KCl,
6 mM de MgCl2, 400 M de desoxiguanina trifosfato
(dGTP), 400 M de desoxiadenosina trifosfato (dATP), 400
M de desoxicitidina trifosfato (dCTP), 800 M de desoxiuridina trifosfato (dUTP), UNG, 1 M de uorocromo
ROX y estabilizadores. Su empleo se esquematiza en la gura 16-11.

Semicuanticacin en tiempo
real con el mtodo 2DDCt
En la PCR en tiempo real la concentracin relativa se obtiene interpolando todas las muestras en un punto umbral,

155

CAPTULO 16 Reaccin en cadena de la polimerasa

Sonda Taqman
Primer

Alineacin y polimerizacin

ADN

5
5

Primer

Primer
marcado

R
Primer
Desplazamiento de hebra y
actividad exonucleasa de la AND
polimerasa sobre la sonda

sonda

sonda

Primer

Primer
3

Primer
marcado

R
5

Escisin de la sonda y liberacin


del uorocromo

Primer

Primer

No uorescencia

Fluorescencia

Primer
R
5

Polimerizacin completa y
emisin de la uorescencia

Primer

5
3

Primer

Figura 16-11. PCR en tiempo real empleando iniciadores LUX. La


deteccin del producto amplicado se fundamenta en que uno
de los iniciadores est marcado con un uorforo; cuando el
iniciador hibrida con la cadena blanco y se realiza la polimerizacin, el uorforo es excitado, resultando en un incremento
de la uorescencia, lo que es detectado por el lser.

www.fullengineeringbook.net
Extintor o Quencher

Reportero uorescente

Figura 16-10. PCR en tiempo real con sondas Taqman. Esta


PCR implica el uso de una sonda que hibrida en algn punto
intermedio de la secuencia franqueada por el par de primers
sentido y antisentido. La sonda tiene acoplado un uorocromo
en su extremo 5, el cual est silenciado por otro uorocromo
llamado extintor o quencher en el extremo 3 de la sonda. La
amplicacin de la cadena donde la sonda est unida libera el
uorocromo slo cuando la sonda es degradada por la accin
exonucleasa de la ADN polimerasa, lo que asegura que slo
habr deteccin cuando un producto de amplicacin haya
sido generado.

ciclo de corte o cyclethreshold (CT). El CT es el ciclo elegido por el usuario de la fase exponencial en donde la cantidad inicial de molculas del gen de inters presentes en una
muestra es inversamente proporcional a la intensidad de
uorescencia. El CT permite discriminar el comportamiento de las muestras, ya que a un menor valor de CT existe
mayor cantidad inicial de molculas del gen de inters en
una muestra. El CT lo determina un software a un umbral
de uorescencia jo (threshold) seleccionado por el analista, como se expone en la gura 16-12. Estos valores pueden
relacionarse con una curva estndar para determinar la
cantidad de molculas de ADN existentes (cuanticacin

absoluta) o con un grupo de referencia (cuanticacin relativa). La cuanticacin relativa puede utilizarse para determinar la expresin de los niveles de ARNm de un grupo de
clulas o tejidos respecto a una referencia (control o condicin experimental). Para la cuanticacin relativa debe
tenerse en cuenta que todas las muestras provienen de individuos diferentes; por tanto, debe realizarse un procedimiento conocido como normalizacin, con un gen control
endgeno (constitutivo), para eliminar la variabilidad entre
muestra y muestra. El clculo se realiza mediante la frmula 2Ct relativo a un grupo que se considera calibrador.
Donde:
CT = CT promedio del grupo de muestras para el gen
de inters CT promedio del grupo de muestras para el
gen constitutivo;
CT = CT grupo calibrador CT grupo de inters.
Por tanto, despus de la normalizacin de los datos respecto al gen constitutivo (CT) se selecciona un grupo que
funciona como calibrador del experimento y los datos del
resto de los grupos se comparan con el grupo calibrador
tendr el valor de 1 y el resto de los grupos, un valor menor
o mayor lo que proporciona un valor semicuantitativo.

156

PARTE II Metodologa del ADN recombinante

tras. La curva estndar se construye a partir de concentraciones conocidas de un plsmido que contiene clonado el
cADN de la muestra a analizar. Debe asegurarse que la eciencia de la PCR sea la misma para la muestra y para el
estndar. Las diferentes diluciones de la curva presentarn
CT proporcionales a la cantidad de muestra, y mediante la
frmula de regresin lineal (y = mx + b), interpolando los
valores de las muestras en el grco obtenido se puede
conocer la concentracin absoluta de las muestras.

Plateau
Amplificacin
lineal
Threshold

Amplificacin
xponencial
20

25

Cycle

30

35

40

Retrotranscripcin como
paso previo a la PCR
Threshold

15

20

Cycle

Valor de Ct
25
23.6

30

Valor de Ct
32.2

35

Figura 16-12. Grcas de PCR en tiempo real. La interpretacin


de datos en la PCR en tiempo real se realiza interpolando todas
las muestras en un ciclo de corte o cyclethreshold (CT). El CT
es aquel ciclo presente en cualquier punto de la fase exponencial de amplicacin en donde la cantidad inicial de molculas
del gen de inters presentes en una muestra determinada es
inversamente proporcional a la intensidad de uorescencia.
El CT permite discriminar el comportamiento de las muestras,
ya que a un menor valor de CT existe mayor cantidad inicial
de molculas del gen de inters en una muestra. El CT es
determinado por un software a un umbral de uorescencia jo
Threshold seleccionado por el analista.

La retrotranscripcin es una reaccin para la conversin


del ARN en ADNc y en general se lleva a cabo antes de una
PCR, cuando se pretende analizar secuencias de ARN. La
realizacin consecutiva de una retrotranscripcin y una
PCR se conoce como RT-PCR. Esta tcnica es una variante
de la tcnica convencional de PCR, con el objetivo de
amplicar un ARN especco para evaluar su expresin o
presencia. Esta tcnica es ms sensible y rpida que otras
tcnicas de anlisis de la expresin de genes (Northen blot,
Dot blot, Slot blot, ensayos de la nucleasa) y se basa en el
uso de transcriptasa inversa de los retrovirus cuya funcin
es sintetizar ADN a partir de ARN (gura 16-13).
En la reaccin de retrotranscripcin una cadena de ARN
se transcribe a ADN de secuencia complementaria al ARN,
por lo que se le denomina ADNc. La transcriptasa inversa
ms empleada es la del M-MLV (Murine-Moloney leukemia
virus). Adems del ARN molde, que se convertir en ADNc,
se requieren primers, generalmente hexmeros formados de
secuencias aleatorias de 6 nt. Estos hexmeros hibridarn
con las secuencias complementarias a ellos, que se localizan
por azar en todos los ARN presentes en la muestra. Para la
reaccin se requiere tambin un inhibidor de ARNsas (RNAsin, RNAseout), un componente enzimtico que impide la
accin de estas enzimas que puedan estar presentes en la
muestra. Los dNTP (A, G, C, T) se emplearn en la sntesis
de las cadenas de ADNc, mientras que una solucin amortiguadora proporcionar las condiciones de pH y cofactores
necesarios para un funcionamiento ptimo de la retrotranscriptasa. A diferencia de lo que sucede en la PCR, en esta
reaccin no se requieren ciclos, y basta con una hora a la
temperatura ptima de la enzima para realizar la conversin
del ARN a ADNc (para la M-MLV son 37C). Los pasos de
que consta esta reaccin son desnaturalizacin del ARN a
70C por 10 minutos para eliminar estructuras secundarias,
alineacin de los hexmeros por 10 min a 25C y polimerizacin por la retrotranscriptasa a 37C por una hora. Una vez
obtenida la cadena de ADNc, sta se emplea como molde
para la tcnica de PCR. Este mtodo se utiliza principalmente para detectar genomas virales compuestos por ARN (como
la inuenza A, el VIH y la hepatitis C), as como para cuanticar ARNm de cualquier protena expresada en un tejido.

www.fullengineeringbook.net

Semicuanticacin en tiempo
real con el mtodo 2Ct
Este mtodo de semicuanticacin para muestras procesadas en tiempo real se realiza cuando no se desea tomar un
grupo de muestras como referencia, como cuando la muestra se desea comparar frente a ella misma en diferentes condiciones. La frmula se aplica:
CT = CT promedio de la muestra para el gen constitutivo CT promedio de la muestra para el gen de inters.

PCR cuantitativa mediante


la tecnologa en tiempo real

Para una PCR cuantitativa se emplea la metodologa en


tiempo real y una curva con estndares de concentracin
conocida. Esta curva debe tener en cuenta que el ADN o
ARN que se emplee debe estar diluido de manera precisa, y
en el caso particular de ARN se asume que la eciencia de
retrotranscripcin ha sido la misma para todas las mues-

CAPTULO 16 Reaccin en cadena de la polimerasa

157

RT
1

Hexameros

Transcriptasa
Reversa

ARN

4
5

6
cADN

cADN

cADN
ARN

Rnasa

Figura 16-13. Reaccin de retrotranscripcin. Las molculas de ARN son retrotranscritas a ADNc. En la reaccin participa una transcriptasa reversa que polimeriza los dNTPs. Se requiere adems del RNA molde que ser convertido a ADNc, hexmeros aleatorios
de 6 nt que funcionen como iniciadores de la retrotranscripcin e inhibidores de ARNsas mientras se realiza la sntesis del ADNc.
Una vez concluida la transcripcin inversa el ARN ser degradado por las ARNsas del medio y las molculas de ADNc servirn de
molde a la reaccin de PCR.

www.fullengineeringbook.net

Aplicaciones de la PCR

Los productos de PCR pueden utilizarse para la secuenciacin, deteccin de patgenos infecciosos (virus bacterias,
hongos), amplicacin de segmentos para su anlisis
mediante ADN nger-printing, o huella deADN, en medicina forense, deteccin de mutaciones, anlisis de la expresin gnica o determinacin de carga viral, entre otras
muchas aplicaciones.

Diagnstico como aplicacin de la PCR


La PCR se encuentra al alcance econmico de la mayora de
los laboratorios y en los ltimos 20 aos se ha convertido en

una tcnica indispensable para el diagnstico mdico. Con


ella se pueden amplicar segmentos que contienen una
mutacin conocida (diagnstico) o bien mutaciones desconocidas que se secuenciarn y determinarn despus de
una PCR. Esto ha sido de gran ayuda para el diagnstico y la
correlacin de variaciones gnicas con enfermedades. En
cuanto a las enfermedades adquiridas, la deteccin de
genomas de patgenos es la aplicacin diagnstica ms
empleada de la PCR. Debido a su alta sensibilidad, permite
la deteccin aun de pocas copias del genoma, lo que suele
suceder en los periodos iniciales de la infeccin; por lo tanto, la PCR permite un diagnstico temprano.

158

PARTE II Metodologa del ADN recombinante

Ejercicio de integracin

1. La enfermedad de Parkinson (EP) se considera la segunda enfermedad neurodegenerativa en cuanto a prevalencia, y afecta de 1 a 2% de las personas en edad madura.
Es de origen multifactorial, por interaccin de factores
ambientales y uno o ms genes que coneren susceptibilidad. Los pacientes con esta afeccin presentan un 80%
de muerte neuronal; y se ha observado que en el citoplasma de las neuronas sobrevivientes hay inclusiones
proteicas de -sinuclena, codicada por el gen SNCA,
conocidos como cuerpos de Lewy.
Diversos polimorsmos en este gen se han relacionado con EP dominante, espordica y en otras formas de
demencia, con alteraciones en los cuerpos de Lewy, por
lo que se propone que estos polimorsmos pueden afectar la agregacin proteica e inuir en el desarrollo de EP
(Ramrez-Jirano L.J., 2006).
Para estudiar la posible vinculacin del polimorsmo,
116C-G, se requiere la bsqueda del genotipo en pacientes con EP y en individuos sanos, mediante la tcnica de
PCR y la posterior digestin con enzimas de restriccin
de los productos de PCR.
El fragmento del gen en el cual se encuentra la parte
polimrca de la -sinuclena es:

a) Si la secuencia del iniciador es de 20 pares de bases


y uno de ellos hibrida en la posicin 91, y el fragmento a amplicar es de 65 pb, escriba el iniciador sentido
y antisentido:
1. Sentido:
5
3
2. Antisentido:
5
3
b) Escriba el amplicn de ADNds resultante, indicando
los extremos 5-3y la ubicacin de los iniciadores sentido y antisentido.
c) En la siguiente esquematizacin de un gel de electroforesis indique con una banda dnde aparecera el
producto de PCR segn su longitud.

MPM

Muestra

150 pb

100 pb

91

5- CGCGGAAGTG AGGTGCGTCG GGGCTGCAGC


GCAGACCCCG GCCCGGCCCC TCCGAGAGCG TCCTGGGCGC TCCCTCACGC CTTGCCTTCA AGCCTTCTGC
- 3

50 pb

www.fullengineeringbook.net
25 pb

159

CAPTULO 16 Reaccin en cadena de la polimerasa

Ejercicio de integracin 2
Complete las frases del tema de PCR, RT y modalidades
de PCR con las siguientes palabras:
Iniciadores, ARN, PCR en tiempo real, constitutivo, curva
estndar ADN polimerasa, transcriptasa inversa, uracil-nglicosilasa, punto nal, electroforesis, desnaturalizacin,
ADNc
1. De una reaccin de retrotranscripcin in vitro se obtiene: ___________
2. Extraccin de ___________ de la muestra es el primer
paso para la realizacin de una RT-PCR
3. Por la accin de la ___________ se obtiene una molcula de ssADNc.
4. La ___________ utiliza las cadenas sencillas de ADNc
como molde para la sntesis de molculas de cadena
doble
5. El ___________ se inserta en vectores de clonacin y se
someten al proceso de clonacin.
6. Los ___________ son los reactivos clave para una PCR
especca.
7. La ___________ es una modalidad de PCR que emplea
sondas TaqMan.
8. Se denomina gen ___________ a aquel cuya expresin
no se modica con las condiciones experimentales.
9. La PCR cuantitativa requiere forzosamente la interpolacin de las muestras contra una ___________
10. La modalidad de ___________ presenta el inconveniente de que la diferente cantidad de material de inicio da
lugar a la misma cantidad de producto nal debido a la
saturacin.
11. A la temperatura de ___________ se destruyen estructuras secundarias del ADNc y corresponde a los 95C.
12. La enzima ___________ elimina los residuos de uracilo
del ADNss o ADNds previniendo que amplicones sirvan
de molde en una PCR posterior.
13. La visualizacin del producto de amplicacin se realiza
mediante una ___________

Ejercicio de integracin 3
La PCR para la deteccin del genoma del VHB genera un
amplicn de 325 pb. Interprete el siguiente gel obtenido
tras procesar el suero de tres pacientes sospechosos de
portar la infeccin.
MPM

P1

P2

P3

150 pb
100 pb

50 pb

25 bp

1.
2.
3.

Cul paciente (o pacientes) porta el genoma del VHB


en su sangre?
Cul paciente (o pacientes) es negativo a la infeccin?
Cmo interpreta el hecho de que la banda de P1 sea
ms intensa que la banda de P3?

www.fullengineeringbook.net

Bibliografa
Edwards M.C., Gibbs R.A. Multiplex PCR: advantages, developments

and applications. Houston: Institute for Molecular Genetics,


Baylor College of Medicine, Feb, 2011.
Hunt M. Real time PCR tutorial. The Board of Trustees of the Columbia: University of South Carolina, 2006.
Innis M.A., Gelfand D.H., Sninsky J.J. PCR strategies. Nueva York:
Academic Press, 1995.

Lffert D., Karger S., Twieling G., Ulber V., Kang J. Optimizing of

multiplex PCR. Hilden: QIAGEN GmbH, Nm 2, 1999.


Mackay I.M., Arden E.K., Nitsche A. Real-time PCR in virology.

Nucleic Acids Res, 2002;30:1292-1305.

Captulo

17

Secuenciacin del ADN


y microarreglos
Belinda Claudia Gmez Meda / Guillermo Moiss Ziga Gonzlez
Jos Mara Vera Cruz / Bertha Adriana lvarez Rodrguez

Introduccin

gel de poliacrilamida. El mtodo est limitado por el poder de


resolucin del gel de poliacrilamida que, en el contexto histrico de la poca, permita secuenciar aproximadamente 100
bases a partir del punto de marcaje.
La electroforesis es una tcnica para la separacin de
molculas segn su movilidad en un campo elctrico a travs de una matriz porosa, la cual nalmente las separa por
tamaos moleculares y carga elctrica, segn la tcnica que
se use. La electroforesis en gel en general se utiliza con propsitos analticos, pero puede ser una tcnica preparativa
para puricar parcialmente molculas antes de aplicar
espectrometra de masas, reaccin en cadena de la polimerasa (PCR), clonacin o secuenciacin de ADN (para mayores detalles, consultar el captulo relacionado).
Antes del tratamiento qumico que genera el corte, se
marca un fragmento de doble hebra producido por digestin con una enzima de restriccin (fragmento de restriccin) de una determinada longitud en sus dos extremos;
primero, se trata con fosfatasa alcalina para eliminar el fosfato terminal en su extremo 5, y despus, se aade un fosfato
marcado con 32P para producir una hebra marcada de forma
terminal. La fragmentacin selectiva de una cadena de ADN
marcada se consigue con el uso de cuatro tratamientos qumicos independientes, cada uno de los cuales est diseado
para producir patrones especcos de rotura y observacin
mediante autorradiograf a. El procedimiento consiste en
atacar qumicamente al ADN con reactivos que primero
daan y despus eliminan una base del nucletido. La desoxirribosa expuesta es, entonces, un punto dbil en el esqueleto de la cadena y es susceptible de roturas. Posteriormente,
se llevan a cabo reacciones qumicas para desprender completamente la desoxirribosa de los enlaces 5 y 3 de sus fosfatos, y la reaccin es tan especca que permite daar slo
uno de los residuos a lo largo de pocos pares de bases del
ADN. El reactivo especco para purinas es el dimetilsulfato,
mientras que el reactivo para pirimidinas es la hidracina.

A pesar del papel tan importante que desempea la secuencia de ADN en la materia viva, el desarrollo de los mtodos
para su determinacin es relativamente reciente, debido
sobre todo al tamao tan grande de las molculas de ADN
en las clulas.
En los decenios de 1960 y 1970, dos grupos de investigacin independientes, liderados por los britnicos Frederick
Sanger y Alan Coulson y los estadounidenses Alan Maxam
y Walter Gilbert, idearon de manera prcticamente simultnea dos procedimientos diferentes para determinar de
modo directo la secuencia del ADN. Estos mtodos slo
requieren de pequeas cantidades de ADN, son altamente
conables y han revolucionado la biologa molecular. En la
actualidad, el equipo automatizado hace que la secuenciacin sea un procedimiento rpido y de rutina en los laboratorios (gura 17-1).

www.fullengineeringbook.net

Secuenciacin
Mtodo qumico o de degradacin
de Maxam y Gilbert
Es un mtodo de secuenciacin que depende de la degradacin qumica especca del ADN que describieron Maxam y
Gilbert, en 1977. Este mtodo tiene la ventaja de que puede
emplear ADN de doble hebra, pero requiere una separacin
de hebras o fraccionamiento equivalente por cada fragmento de restriccin estudiado, lo cual lo hace laborioso.
La fragmentacin especca del ADN es la base de este
mtodo, desarrollado en cinco pasos, que a grandes rasgos
implican el marcaje radiactivo del extremo 5 con 32P, la
modicacin de una base, la eliminacin de la base modicada, rotura de la cadena de ADN en la desoxirribosa modicada
y el anlisis de la secuencia fragmentada por electroforesis en
160

CAPTULO 17 Secuenciacin del ADN y microarreglos

161

EXTREMO FIJO

ATTCGTGAGACTACCG
REACCIN
A

A
ATTCGTGA
ATTCGTGAGA
ATTCGTGAGACTA

A
T

REACCIN
T

REACCIN
G

AT
ATT
ATTCGT
ATTCGTGAGACT

ATTCG
ATTCGTG
ATTCGTGAG
ATTCGTGAGACTACCG

REACCIN
C
ATTC
ATTCGTGAGAC
ATTCGTGAGACTAC
ATTCGTGAGACTACC

P-P-P

P-P-P

P-P

OH

A
T

A
T

ddCTP

dGTP

5 Iniciador

T
A

G
C

C
G

C
G

G
C

T
A

OH

G
C

La incorporacin del
anlogo dideoxi detiene
la sntesis de la cadena

Cadena molde

www.fullengineeringbook.net

Figura 17-1. Estrategia general de secuenciacin de ADN. Los mtodos de secuenciacin se basan en la sntesis de ADN, en cuatro
reacciones en paralelo, una para cada nucletido, a n de producir el paro de la reaccin cuando un ddNTP se aada a la reaccin. Los ddNTP pueden marcarse diferencialmente con uorocromos de diferente color. Se obtendr la secuencia de la cadena
complementaria a la cadena molde por autorradiografa o uorescencia, leyendo de abajo hacia arriba (5 3).

Debido a que el enlace glucosdico de una purina metilada es inestable y se rompe fcilmente, las bases pueden
eliminarse calentando las hebras a pH neutro, dejando la
desoxirribosa libre. El tratamiento que de preferencia rompe residuos guanlicos se basa en un lcali suave a 90C
(NaOH 0.1 M), que libera completamente los restos de desoxirribosa despurinados de los grupos fosfato adyacentes
en sus enlaces 3 y 5, o cido frmico para corte en bases
pricas indiferenciado (A + G), mientras que para los residuos adenlicos el tratamiento es a 0C en condiciones ligeramente cidas (HCl 0.1 M). Cuando los fragmentos
marcados en su extremo se resuelven en gel de poliacrilamida, la autorradiograf a contiene un patrn de bandas
oscuras y claras. Las bandas oscuras se generan del rompimiento de guaninas, que se metilan cinco veces ms rpido
que las adeninas. Este patrn de guanina/fuerte y adenina/
dbil contiene, al menos, la mitad de la informacin necesaria para la secuenciacin; sin embargo, en la interpretacin
de estos patrones puede haber ambigedad, ya que la evaluacin de la intensidad de las bandas aisladas no es sencilla. Para determinar las bases de forma diferencial se
compara la informacin que contiene esta columna del gel

con una en paralelo en la cual se suprime el rompimiento de


guaninas, lo que permite que las adeninas se evidencien.
La evidencia de corte de adeninas se basa en que los
enlaces glucosricos de las adenosinas metiladas son menos
estables que las de las guanosinas, de manera tal que de preferencia las adeninas se liberan con un tratamiento suave
con cido diluido. Subsecuentemente, el rompimiento con
lcali producir un patrn de bandas oscuras correspondiente a las adeninas y con bandas claras para las guaninas.
Para el caso de deteccin de pirimidinas, la reaccin con
hidracina producir roturas en posiciones ocupadas tanto
por citosina como por timina. La reaccin se repite en presencia de NaCl 2 M, la sal suprime la reaccin de la hidracina con la timina, tal que en la autorradiograf a slo se
detectan fragmentos cortados mediante tratamiento con
piperidina en posiciones ocupadas por citosinas. Cuando se
comparan los patrones autorradiogrcos de C y C + T, la
banda oscura (correspondiente a la marca del radioistopo)
que aparezca en ambas radiograf as indicar rotura en la C,
mientras que un enlace slo presente en C + T representar
la rotura en una T.

162

PARTE II Metodologa del ADN recombinante

5
3

3 ADN de doble cadena


5
Marcaje de extremos

A+G

T+C

Corte con enzima de restriccin


Desnaturalizacin (slo los
extremos marcados sern visibles
en la autorradiografa)

Descartar

Exposicin de las cuatro muestras a diferentes qumicos en la


reaccin que rompen el ADN en la base indicada
G

T+C

A+G

3
C
G
A
T
T
C
C
G
G
T
G
T
A
T
G
T
T
T
A

A
+
G

T
+
C

La reaccin prosigue hasta producir


rompimiento en todos los fragmentos, de tal
manera que se generan fragmentos marcados
de diferentes tamaos representando todas las
posiciones de la base indicada en la secuencia
G

A+G

G T T

C A A T C G T A C G C A

SO4(CH3)2
pH7/

H2NNH2
H+/

NaCl2M
Piperidina/OH-

T+C

C
5

Electroforesis en paralelo
de las cuatro reacciones
y autorradiografa
C

5
G
T
T
C
A
A
T
C
G
T
A
C
G
C
A
3

www.fullengineeringbook.net
Piperidina/OH-

A+G

T+C

Gel de acrilamida

Secuencia de la
hebra molde

Figura 17-2. Mtodo de secuenciacin qumico de Maxam-Gilbert. En la secuenciacin qumica la ltima base que se va agregando a la
lectura de la secuencia de cada fragmento generado indica la base que fue qumicamente modicada y despus eliminada del
fragmento durante la reaccin de rotura mediada por la piperidina, es decir, la base que se indica es la que en realidad falta.

Para lograr el corte en citosinas y timinas, la hidracina


reacciona con timina y citosina, cortando la base y dejando
ribosilurea. La hidracina puede reaccionar para producir
hidrazona. Despus de una lisis de hidracina parcial en
solucin acuosa de hidracina 15 a 18 M a 20C, el ADN se
corta con piperidina 0.5 M. La amina cclica secundaria, as
como la base libre, desplaza todo el producto de la reaccin
con hidracina de la desoxirribosa y cataliza la eliminacin
de -fostatos. El patrn nal contiene bandas de intensidad
similar para los cortes en citosinas y timinas.
Cuando se analiza el patrn autorradiogrco de un gel
de secuenciacin obtenido de los cuatro tratamientos qumicos, si se considera una secuencia de carriles con A, G, C y
C + T, una banda fuerte en la primera columna con una banda dbil en la segunda genera una A; una banda fuerte en la
segunda columna con una banda dbil en la primera columna es una G; una banda que aparezca en la tercera y cuarta columnas es una C, y una banda solamente en la cuarta
columna es una T (gura 17-2). Para obtener la secuencia de

una hebra sencilla se comienza en la parte baja izquierda y se


lee hacia arriba; as, la secuencia que se lee de abajo hacia
arriba es la correspondiente a 5 3 de la hebra original de
ADN analizada. La sencillez de este mtodo radica en que
slo se necesitan cuatro radiografas para establecer la
secuencia de ADN.
La secuenciacin qumica tiene ventajas especcas. En
primer lugar, los tratamientos qumicos son sencillos de controlar; el ataque qumico ideal, una base eliminada por hebra,
produce una buena distribucin de materiales marcados a
travs de la secuencia. En segundo lugar, cada base es atacada, tal que en un corrimiento se desplegar cada base individual. La distincin qumica entre cada base es clara y la
secuencia de ambas hebras permite un chequeo ms adecuado. Estas reacciones especcas fueron elegidas para proveer
informacin ms que suciente para la secuenciacin. En
principio, podra secuenciarse ADN con tres reacciones qumicas especcas para cada base, utilizando la ausencia de
banda para identicar la posicin de la cuarta base; sin

CAPTULO 17 Secuenciacin del ADN y microarreglos

embargo, las aproximaciones tienden a error o a malinterpretarse por otra base, por esa razn se describen las reacciones
para diferenciar que son redundantes.
El mtodo de Maxam y Gilbert es ptimo para ADN que
no puede secuenciarse de forma adecuada mediante otros
mtodos (por ejemplo, oligonucletidos pequeos y secuencias de ADN que producen terminacin prematura debida a
estructuras secundarias fuertes). Adems, la secuenciacin
de Maxam y Gilbert puede usarse para mapear modicaciones de ADN, como alquilaciones y roturas producidas por
carcingenos, antineoplsicos y otros agentes que tienen
como blanco el ADN. En ensayos de huella digital qumica o
enzimtica, la tcnica permite la identicacin precisa de
secuencias especcas de ADN que se unen a molculas
pequeas y protenas. Por ello, las mejoras al mtodo son
bencas para gran variedad de aplicaciones en biologa
molecular y bioqumica.

El mtodo didesoxi de Sanger


Sanger tambin desarroll otro mtodo, el cual emplea anlogos de dNTP especcos de terminacin de cadena. Los
anlogos ms utilizados son los didesoxinucletidos trifosfatados (ddNTP), iguales que los dNTP pero sin el grupo
hidroxilo en el carbono 3 de la desoxirribosa. Estos pueden
incorporarse a una cadena de ADN en crecimiento por
medio de la ADN polimerasa, pero actan como terminadores porque, una vez incorporados a la cadena, y al no
contar con el OH en el extremo 3, no permiten que se una
otro nucletido. Este mtodo es ms rpido y acertado que
el mtodo qumico de Maxam y Gilbert, por lo que es el
utilizado en la actualidad de manera rutinaria en los laboratorios. El proceso consiste en encontrar diferentes cadenas,
tantas como nmero de bases tenga el fragmento que son
copias de la cadena de ADN que se va a secuenciar, cada
uno de un tamao diferente y terminado con la incorporacin de un 2 3 didesoxinucletido (gura 17-3).
El principio del mtodo didesoxi es el siguiente: se asla y se clona el ADN que se desea secuenciar; este ADN se
desnaturaliza y se emplea una sola hebra en la secuenciacin. En la secuenciacin se utiliza un iniciador o primer
marcado radiactivamente, el cual usualmente es un fragmento de restriccin, que suministra el extremo 3 OH que
necesita la ADN polimerasa para continuar la adicin de
nucletidos. El iniciador y el molde de ADN se alinean para
formar un complejo iniciador-molde y la mezcla resultante
se divide en cuatro partes. Con estas mezclas se preparan
cuatro tubos de reaccin, cada uno con el ADN molde de
hebra sencilla que se desea secuenciar, la ADN polimerasa,
el iniciador marcado radiactivamente y los cuatro dNTP. A
cada tubo se le aade uno de los ddNTP en exceso, es decir,
en mayor proporcin respecto a su dNTP convencional
(10:1). En cada uno de estos tubos se producirn cadenas de
ADN de distintas longitudes, terminando todas en el lugar
en el que se incorpor el didesoxi correspondiente (ddATP,
ddTTP, ddGTP, ddCTP) aadido al tubo.

163

Por ejemplo, una muestra de ADN se incuba con ADN


polimerasa en presencia de una mezcla de ddTTP (didesoxitimidina fosfato) y con bajas concentraciones de TTP junto
con concentraciones normales de los otros tres dNTP (uno
de los cuales puede marcarse con 32P, 35S o con marcadores
quimioluminiscentes o uorocromos). Conforme la cadena
de ADN se forma en el extremo 3 del iniciador, la posicin de
T se estar agregando en algunos casos con el sustrato normal y, por ende, la cadena seguir extendindose. En ocasiones se agregar un ddTTP, lo que har que acabe la sntesis,
tal que al trmino de la incubacin seguir habiendo una
mezcla de cadenas de longitud variable con terminacin T
en su extremo 3, pero todas con el mismo extremo 5 (el
extremo 5 original del iniciador). Incubaciones similares se
llevan a cabo en presencia de cada uno de los otros 3 ddNTP,
lo que da mezclas de terminacin en la posicin de cada uno
de los nucletidos restantes C, A o G, respectivamente.
Las cuatro mezclas son separadas en paralelo (cada
mezcla de reaccin en un carril) por electroforesis vertical
en gel de poliacrilamida-urea en condiciones desnaturalizantes (acrilamida 12% con urea 8 M), con resolucin de un
solo nucletido. Este sistema separa las cadenas de ADN de
acuerdo con su longitud; as, las ms pequeas migrarn
ms rpido y las ms grandes, ms lento.
En teora, cada una de las fracciones de las mezclas tendr sucientes fragmentos terminados en cada una de las
posiciones del nucletido y podrn visualizarse mediante
autorradiograf a cuando se utiliza marcaje radiactivo, ya sea
en el iniciador o en alguno de los dNTP. El tiempo de exposicin de la placa de rayos X sobre el gel vara de 20 a 30
horas y se expone a temperatura ambiente. En la actualidad,
se emplean marcas quimioluminiscentes (uorescentes)
para evitar el manejo de radiactividad. En este caso el marcaje es con uorocromos en el extremo 5 del iniciador y la
identicacin se hace separando los diferentes fragmentos
por medio de electroforesis en gel de poliacrilamida, para
que, de esta manera, la secuencia pueda leerse directamente
sobre el gel, de acuerdo con el patrn de bandas.
En general, secuencias de entre 15 a 200 nucletidos
desde el sitio del iniciador pueden determinarse con precisin mediante un solo iniciador e inclusive es posible leer
hasta 300 nucletidos. El problema ms grave es el apilamiento de bandas, causado por las asas de apareamiento de
bases que se forman en el ADN en las condiciones de la
electroforesis del gel de acrilamida y que se observan como
un nmero de bandas en la misma posicin o inusualmente
muy cercanas unas a otras en la electroforesis.

www.fullengineeringbook.net

Mtodo automatizado
Uno de los mayores avances en la tecnologa de secuenciacin del ADN fue el desarrollo de la secuenciacin automatizada, ya que aunque los procedimientos propuestos tanto
por Sanger como por Maxam y Gilbert son relativamente
sencillos y su interpretacin es fcil, su capacidad de resolucin de los procedimientos utilizados es limitada.

164

PARTE II Metodologa del ADN recombinante

5 -TGACAGTACCTGGCA- 3

CCGT

Mezclas de reaccin para cada


didesoxinucletido marcado con
fluorocromos diferentes

Secuencia de la hebra
molde

Iniciador

ADN polimerasa
Desoxinucletidos (dATP, dCTP, dTTP, dGTP)
Didesoxinucletidos marcados

ddATP ddCTP ddTTP ddGTP

5-TTACGGCCATGACAGT- 3

ddACCGT

Electroforesis en gel
poliacrilamida y deteccin de bandas
por autorradiografa

ddATGGACCGT

Fragmentos ms
grandes

ddGTP

ddTTP

ddCTP

ddATP

ddACTGTCATGGACCGT

5
(
"
$
"
(
5
"
$
$
5
(
(
$
5 -TGCCAGGTACTGTCA- 3 "

www.fullengineeringbook.net
Fragmentos ms
pequeos

Lectura de la secuencia del


corrimiento electrofortico de la base
hacia arriba (5
3), que
corresponde a la secuencia
complementaria a la hebramolde

Figura 17-3. Mtodo de secuenciacin didesoxi de Sanger. La reaccin requiere la hebra molde de ADN de cadena sencilla marcada
radiactivamente, un iniciador, ADN polimerasa y cuatro dNTP. La reaccin es dividida en cuatro alcuotas, uno para cada base,
cada tubo contendr uno solo de los ddNTP marcados y los otros tres dNTP y se contina con la polimerizacin incorporando los
nucletidos en sentido 5 3. Cuando se marcan con urocromos la reaccin total se puede hacer en un solo tubo, ya que el
color emitido servir para diferenciar las cadenas.

El mtodo de Maxam y Gilbert fue muy popular en sus


inicios; sin embargo, con la descripcin del mtodo enzimtico didesoxi, o de terminacin de cadena, esta tcnica qued
en desuso, ya que involucra el uso de sustancias qumicas
peligrosas y cantidades elevadas de ADN marcado radiactivamente, adems de ser tcnicamente ms complejo. Por
ello, en la actualidad los procedimientos de secuenciacin
automatizada estn basados en el mtodo enzimtico de
Sanger, que suple el marcaje radiactivo con mtodos quimioluminiscentes con el uso de uorocromos. De esta manera,
para la lectura de la secuencia se utilizan sistemas pticos
que detectan los diversos uorocromos empleados, con
lo que se logra un mtodo ms directo, fcil, rpido y seguro.
Esta variante es conocida como dye-primer sequencing
(secuenciacin mediante colorantes acoplados al iniciador).
Para evitar el error debido a lo repetitivo y a los pasos de
pipeteo, en la actualidad un robot industrial puede automa-

tizar las reacciones de secuenciacin del mtodo didesoxi.


Este sistema utiliza microrreacciones a temperatura controlada; en un ciclo de reaccin (alrededor de 50 minutos)
se procesan arriba de 48 moldes. Con este robot se resuelven ms de 450 bases en secuenciacin automtica de
ADN, protocolo que es aplicable tanto a marcaje radiactivo
como uorescente.
En estos sistemas automatizados el fragmento de ADN
uorescente pasa por el punto de tensin del secuenciador
automtico, y estas seales se envan a una computadora
con un programa especial. As, un golpe de lser excita la
tincin uorescente, la seal de uorescencia emitida se
digitaliza y es captada por detectores que una computadora
analiza y descifra, y pueden observarse los resultados obtenidos en tiempo real. En minutos, este programa procesa la
imagen del gel capilar. Para cada muestra secuenciada se
crean curvas de cuatro colores, uno por cada nucletido, y

CAPTULO 17 Secuenciacin del ADN y microarreglos

Cadena molde

Alineacin con
el iniciador

5
3

C
G

C
G

Mezcla de
reaccin

T
T

ADNpol

dNTPs
marcados con
fluorocromo

dNTPs
C
G

C
G

T
A

5
3

C
G

C
G

T
A

5
3

C
G
C
G

C
G
C
G

T
A
T
A

A
T
A
T

T
A
T
A

C
G
C
G

C
G
C
G

T
A
T
A

A
T
A
T

T
A
T
A

G
C
G
C

C
G
C
G

T
A
T
A

C
G
C
G
C
G
C
G
C
G
C
G
C
G

C
G
C
G
C
G
C
G
C
G
C
G
C
G

T
A
T
A
T
A
T
A
T
A
T
A
T
A

T
A
T
A
T
A
T
A
T
A

G
C
G
C
G
C
G
C

C
G
C
G
C
G

T
A
T
A

5
3
5
3
5
3

Computadora y
analizador de imagen

Elongacin

Capilar
Pol lquido

Productos de
la reaccin
de secuenciacin

5
3
5
3
5
3
5
3
5
3

A
T
A
T
A
T
A
T
A
T
A
T

Detectores

Prismas

Desnaturalizacin

ADN
polimerasa
4 dNTPs
4 ddNTPs

5 TAGCATTGCCTAGCTAT3
3 ATCGTAACGGATCGATA5

Cadena molde de
secuencia
desconocida

Se aplican los fragmentos


de ADN marcados en el gel
capilar para la electroforesis

G
T

Migracin
del ADN

4
Detector

AT C G TA A C G G AT C G ATA

Reaccin de
secuenciacin

Ventanas

5 Iniciador 3

Electroferograma

Fragmentos de ADN
marcados, generados a partir
de la cadena molde

A
T

Placa
caliente

Lser

C
5
3
5
3

165

Lser

5
Se genera un electroferograma
como resultado de la deteccin
de la migracin de los
fragmentos marcados

www.fullengineeringbook.net

Figura 17-4. Mtodo de secuenciacin automatizado. Para realizarlo se obtienen fragmentos de ADN de la hebra molde de inters, se
marcan los cuatro nucletidos con uorocromo de distinto color, se realiza el ciclo de secuenciacin mediante PCR, se eliminan
NTP sobrantes. Los fragmentos son sometidos a electroforesis en gel y mediante el sistema automatizado; el lser emitir la luz
que el detector interpreta diferencialmente de acuerdo con el uorocromo que pase por el haz de luz para generar un patrn de
curvas de acuerdo a la longitud de onda diferente para cada base, a n de poder leer la secuencia obtenida.

debajo de cada pico de la secuencia se identica la secuencia


de nucletidos correspondientes al fragmento analizado.
Puede analizarse la secuencia de 10 muestras simultneamente o bien estudiar 40 fragmentos de ADN.
La secuenciacin por terminacin uorescente es un
mtodo para el anlisis de la secuencia del ADN mediante
automatizacin parcial. Es una variante modicada en la
cual el marcaje se realiza con un uorforo unido de forma
covalente en el oligonucletido iniciador utilizado. En esta
opcin se utiliza un color diferente para cada uorforo de
cada reaccin especca para nucletidos A, C, G o T, marcndolos como terminadores reversibles mediante la unin
del uorforo a la base en el grupo 3-OH, de tal forma que
la ADN polimerasa an la puede reconocer como sustrato.
Despus, las mezclas de reaccin se combinan en una
coelectroforesis en un mismo gel, y la informacin de la
secuencia se lee directamente mediante una computadora.
Cuando el uorforo se agrega en la terminacin de la
cadena, se tiene la ventaja de que este ltimo mtodo puede
llevarse a cabo en una sola reaccin en lugar de en cuatro,
como en el mtodo en que se marca el iniciador. En esta
reaccin los ddNTP se marcan con uorocromos de dife-

rente color para cada base, con lo cual la terminacin de


cada cadena determinar el color y, por ende, el NTP respectivo. Esto har que al uorescer a diferentes longitudes
de onda, el sistema ptico del equipo identique directamente en un grco las seales de uorescencia de cada
una de las bases (gura 17-4). El grco generado es acorde
con el color del uorocromo, en el cual se representa cada
base con picos de intensidad de luz.
Las investigaciones siguen progresando de tal forma
que se ha planteado la utilizacin de la tecnologa de espectrofotometra de masas para secuenciar ADN. Otras propuestas adaptan la tcnica de Maxam y Gilbert en una
tecnologa innovadora denominada secuenciacin multiplex, que permite aumentar la velocidad de secuenciacin y
faculta al investigador para analizar un gran grupo de fragmentos de ADN como una mezcla a travs de los pasos
de secuenciacin de ADN, lo cual incrementa la eciencia de
los procedimientos estndares por un factor de 10.
La pirosecuenciacin es un sistema basado en el mtodo
enzimtico, que aprovecha la liberacin de pirofosfato cuando un nucletido se incorpora en la hebra de ADN en crecimiento, mediante bioluminiscencia; es un sistema til para

166

PARTE II Metodologa del ADN recombinante

analizar tanto secuencias cortas de ADN como polimorsmos de nucletido simple (SNP) y genotipicacin. La longitud de lectura tendr que seguir mejorando para dar
aplicaciones ms precisas y ms amplias a esta alternativa.
Este mtodo tiene la dicultad de que descifra de forma adecuada las regiones homopolimricas del molde de ADN;
sin embargo, existen abordajes metodolgicos que permiten
modicar nucletidos en posicin 3-OH mediante enlaces
qumicos reversibles para terminacin de cadena usando un
grupo alil o un grupo 2-nitrobencilo.
Se han propuesto mtodos de secuenciacin del ADN
que no involucran ni electroforesis en gel o reacciones qumicas o enzimticas. Entre ellos se encuentran mtodos
con uorescencia para deteccin mediante citometra de
ujo como alternativa a la tcnica de secuenciacin en
geles, la posibilidad del marcaje de la ADN polimerasa o la
secuenciacin por nanoporos; otros enfoques estn dirigidos a la utilizacin de microscopia electrnica de tnel
para leer las bases directamente en la hebra de ADN
mediante el marcaje de las bases con halgenos para la
deteccin visual.
La dicultad para secuenciar fragmentos de ADN de
longitudes grandes (> 300 nucletidos) se debe a la capacidad limitada para resolver fragmentos grandes de ADN que
dieran en un solo nucletido. Una de las soluciones es la
secuenciacin sobrelapada, en la cual el ADN genmico
se fragmenta y se clona en un vector de ADN, se amplica, se
purica y se analiza para ensamblarse en una secuencia larga y continua, donde se identican las regiones sobrelapadas (secuenciacin shotgun, de fuerza bruta o de un tiro).
Para llevar a cabo esta tcnica no se requiere contar con
antecedentes de la secuencia de ADN, por lo que se le conoce como secuenciacin de novo.
Tcnicas desarrolladas recientemente permiten secuenciar ADN genmico de clulas microbiales individuales
(secuenciacin de clula nica). sta es una estrategia til
para determinar secuencias naturales de microorganismos
que suelen cambiar cuando se cultivan en laboratorio. Adems, las reacciones de amplicacin pueden producir rearreglos en el ADN, de tal forma que, al no requerir ni el
cultivo ni la reaccin, se puede llevar a cabo la determinacin de la secuencia de la clula original tomada directamente del ambiente. En la actualidad, en los centros de
secuenciacin ms de 70% de los genomas se recuperan
de clula nica.

capacidad y la rapidez con que ha evolucionado la secuenciacin, sobre todo en los ltimos cinco aos.
Las plataformas actuales comparten caractersticas tecnolgicas comunes, como secuenciacin masiva en paralelo de molculas nicas de ADN separadas en un ujo de
clulas o clonadas in vitro, para lograr muchas copias de la
molcula original y despus ser amplicadas, con ciclos
repetidos de extensin de nucletidos mediados por polimerasas o por ligacin de oligonucletidos. Como se trata
de un proceso masivo en paralelo, estos sistemas pueden
generar centenares de megabases (Mb) y gigabases (Gb) de
secuencias nucleotdicas en un solo corrimiento de un aparato.
Por ejemplo, la tecnologa 454 (Roche; http://www.454.
com) se deriva de la pirosecuenciacin y la PCR de emulsin,
en la cual se detecta la quimioluminiscencia generada por la
liberacin de pirofosfatos cuando se incorpora un dNTP en
una reaccin de polimerizacin. Segn estas bases, en 2005
se present el GS20 como el primer secuenciador de nueva
generacin, mediante el cual se pudo secuenciar el genoma
de Mycoplasma genitalia (580 069 pb secuenciadas a 96%
con 99.96% de precisin) en una sola corrida. Posteriormente, en 2007, Roche Applied Science adquiri la 454 Life
Sciences y present una nueva versin, GS-FLX, el cual
mediante el mismo principio permite hacer microtitulaciones (a nivel de picolitros, es decir, la millonsima parte de un
mililitro) mediante un haz de bra ptica.
El mtodo para secuenciar con este tipo de tecnologa
requiere preparar una genoteca de ADN molde mediante
fragmentacin por nebulizacin o sonicacin, los fragmentos se reparan en sus extremos y ligados a oligonucletidos;
despus, la genoteca de ADN se diluye hasta la concentracin de molcula nica; luego se desnaturaliza e hibridada a
una microesfera que contiene oligonucletidos adaptadores
con secuencias complementarias, con las cuales se lleva a
cabo la PCR de emulsin; posteriormente, se liberan los fragmentos y se someten a enzimas de secuenciacin mediante
un ujo sucesivo de los 4 dNTP. Cada evento de incorporacin de un dNTP produce la liberacin de un pirofosfato, y el
sistema reconoce la luminiscencia producida, que se transmite por la bra ptica que dirige y traduce la seal. Una ventaja reconocida de la tecnologa 454 es la amplia longitud de
lectura de secuencias, ya que puede leer fragmentos de ms
de 400 bases de longitud mediante el principio de pirosecuenciacin y en el tiempo de una sola corrida (10 horas) se
pueden secuenciar 500 Mb.
Adems, la secuenciacin de la nueva era permite llevar
a cabo la secuenciacin de transcriptomas, un enfoque muy
poderoso denominado ARN-Sec, para mapear y cuanticar
trnscritos a partir de muestras biolgicas. El rango dinmico del ARN-Sec para determinar niveles de expresin es
de 3-4 rdenes de magnitud, comparado con dos rdenes de
magnitud de expresin por microarreglos. De esta manera,
esta alternativa permite la deteccin cuantitativa tanto de
trnscritos producidos a bajo y alto nivel, adems de poder

www.fullengineeringbook.net

Secuenciacin de alto rendimiento:


la secuenciacin de la prxima generacin
A partir del Proyecto Genoma Humano, en 2008 se secuenci un genoma humano completo en cinco meses con 1.5
millones de dlares; en 2009 el proceso se realiz en horas y
con slo 10 000 dlares, y actualmente, con un menor tiempo y costo, en una sola reaccin se puede conocer la secuencia completa de un individuo, lo cual demuestra la gran

CAPTULO 17 Secuenciacin del ADN y microarreglos

deducir la diversidad de la informacin cualitativa y cuantitativa del corte y empalme. La ARN-Sec se ha aplicado a
gran variedad de organismos, incluidos Saccharomyces cerevisiae, Arabidopsis thaliana, ratn y clulas humanas.
La secuencia de nucletidos de los genes humanos ha
sido y contina siendo de gran importancia como herramienta de investigacin para el entendimiento de las bases
de los procesos celulares que denen la siologa y el desarrollo. La organizacin de los genes en los genomas existe
en un cromosoma concreto en un orden particular. La comparacin de mapas cromosmicos de animales superiores
proporciona informacin acerca de cul organizacin gnica est asociada con qu expresin gnica y qu funcin
gnica. Sin embargo, conocer la secuencia de ADN de los
genes y cmo se traducen en protenas no es suciente para
establecer cmo estn controlados o cmo la funcin del
producto gnico en una clula particular en el organismo es
un todo. Entender la relacin entre la estructura de la protena y su funcin es el siguiente paso crucial.

Microarreglos
La bioinformtica es el campo de la ciencia en la cual las
tecnologas de la informacin, las ciencias de la computacin y la biologa se unen para formar una sola disciplina.
Este campo ha sido indispensable para la interpretacin
de la secuenciacin de los genomas, ya que por la cantidad de
nucletidos, el gran nmero de reacciones, el anlisis del
sobrelapamiento y la coordinacin de las secuencias slo
pueden evaluarse de forma adecuada gracias a los programas y a las bases de datos que guardan toda la informacin
que se produce da a da. Por ejemplo, el genoma humano
consta de 3 mil millones de pares de bases, si la fragmentacin del genoma se llevara a cabo cada 500 nucletidos y
stos pudieran secuenciarse sin sobrelapamiento, sera
necesaria la secuenciacin de 6 millones de fragmentos.
El uso de la bioinformtica desemboc en la implementacin de una nueva herramienta de la biologa molecular y
la genmica denominada microarreglos (microarrays).
Los microarreglos constituyen una distribucin ordenada de ms de 10 mil genes por cm2 en una pequea
supercie, del tamao de un portaobjetos, en el cual pueden estudiarse simultneamente mediante hibridacin y
puede obtenerse una interpretacin instantnea de la
expresin de mltiples genes (distinguibles unos de otros)
en un solo anlisis.
Para ello, es necesario contar con un soporte o matriz
slida (membranas o vidrio) donde se inmovilicen las sondas de unos cuantos pares de bases de longitud, para su
exposicin a la muestra que se pretende analizar.
El fundamento de la tcnica de microarreglos se basa en
la hibridacin de cidos nucleicos y su deteccin por uorescencia mediante anlisis de imagen, de tal manera que,
como en otras tcnicas, slo se obtendr seal uorescente
en los puntos (genes) donde haya habido hibridacin; la

167

intensidad de uorescencia ser directamente proporcional


al nivel de expresin del gen (gura 17-5).
Para poder interpretar los resultados debe existir previamente una cdula de identicacin, es decir, una plantilla que dena la codicacin que se est manejando de
acuerdo con la base de datos que se trabaje, a n de saber en
qu posicin se ubica un determinado gen o marcador y
cul muestra fue aplicada. Para poder diferenciar los puntos
que emiten uorescencia y poder relacionarlos de forma
correcta con el gen correspondiente, y as poder leer el
resultado claramente, debern determinarse diferencias
signicativas que muestren datos relevantes en el estudio.
Por esto, el diseo de los microarreglos debe obedecer a un
diseo de estudio bien planeado que responda a las incgnitas que plantea la investigacin para los genes de inters.
Para ello, debe contarse con una muestra de anlisis de muy
buena calidad, en que la pureza e integridad se aseguren
para contar con resultados conables y sin contaminacin.
Adems, debe contarse con un buen mtodo bioestadstico
para inferir resultados.
A n de estandarizar la metodologa se ha propuesto
trabajar con duplicados, de diferentes fuentes o eventos
duplicado biolgico o mediante dos ensayos diferentes
de una misma muestra para vericar la calidad y reproducibilidad de los resultados duplicado tcnico. Para ello se
ha sugerido el uso de molculas de ARNm que funcionen
como controles internos, ya que esta tcnica permite detectar incluso un solo trnscrito, lo que da conabilidad al
ensayo.
El tipo de ensayo de microarreglos depender de la sonda utilizada. Entre los ms comunes se encuentran los
empleados para determinar cambios en los niveles de expresin de genes o anlisis de mutaciones o polimorsmos. En
el caso de las sondas, los oligonucletidos son ADN sinttico de cadena sencilla (15 a 25 o 50 a 120 nucletidos). En la
actualidad, la tendencia es utilizar oligonucletidos de longitud corta. En esta presentacin existen los bioarreglos
(bioarrays), con genes preseleccionados para diagnstico de
enfermedades precisas. Su aplicacin est enfocada al desarrollo de frmacos y terapias, respuesta a medicamentos y
asesoramiento de riesgos de enfermedades o progresin.
Adems, existe la alternativa del ensayo de microarreglos de protenas, donde las sondas son anticuerpos jos en
el soporte; sin embargo, an no se ha estandarizado por
completo, debido a la complejidad de estructuras tridimensionales en estas molculas. Por otro lado, los microarreglos en tejidos son una buena alternativa cuando se cuenta
con cantidades limitadas de muestra para realizar pruebas
de ADN, ARN o protenas.
Adicionalmente, se integra un mtodo citogentico
molecular llamado hibridacin genmica comparativa (comparative genomic hybridization, CGH), basado en la hibridacin competitiva por coloracin diferencial entre el tejido
con la anomala y sin ella, a partir del anlisis de metafases o
de ADN genmico. Para este tipo de anlisis se utilizan gran-

www.fullengineeringbook.net

168

PARTE II Metodologa del ADN recombinante

Fabricacin de la sonda

Luz
PCR

Deteccin de
la seal

Biochip

Hibridacin

Excitacin

Emisin de fluorescencia

ADN 1
(control)

ADN 2
(control)
Se fragmenta el ADN de los pacientes.
Posibilidades:
a) Para estudio de ADN, obtener el ADN del paciente.
b) Para estudio del ADN, primero se obtiene
el ADNc por RT-PCR

Incubacin de los dos ADN


en cada pocillo, si es
complementario habr
hibridacin

Microarreglo o chip por pocillos, en cada uno hay


fragmentos de ADN conocidos

www.fullengineeringbook.net
Si se hibrida el ADN1 emite en color verde, si se
hibrida el ADN2 en rojo y si se hibridan ambos
emite amarillo

Figura 17-5. Microarreglos. Un microarreglo es una distribucin ordenada de genes en una pequea supercie, y mediante hibridacin con el ADN problema se puede obtener respuesta instantnea de la actividad o expresin de mltiples genes en un solo anlisis. La intensidad de uorescencia es directamente proporcional al nivel de expresin del gen. La interpretacin de los marcajes
indicar un patrn de colores; as, cada punto en el soporte del microarreglo se asocia con el gen localizado segn su color.

des porciones de ADN genmico en las que se incluyen


regiones conocidas de cromosomas, a n de estudiar anomalas cromosmicas, como ganancias y prdidas de genes relacionados con una enfermedad particular (por ejemplo, para
la deteccin de tumores, defectos congnitos, presencia o
ausencia de genes predisponentes o nmero de copias de
genes involucrados en la evolucin de la enfermedad). Este
mtodo presenta la ventaja de poder analizar muestras de
archivo, incluso embebidas en parana. En el ensayo se utilizan sondas con regiones cromosmicas especcas y se
hibrida con ADN genmico marcado de los tejidos enfermo
y sano. De esta manera, la uorescencia emitida se diferenciar de acuerdo con la presencia del gen o el nmero de
copias, comparado con el tejido sano o control; as, la aplicacin del ensayo es til para la clasicacin de tumores, el asesoramiento de riesgos, la prediccin de la evolucin clnica,
as como para determinar qu tratamientos farmacolgicos
son adecuados y su efectividad.

Los elementos que hay que tomar en cuenta para un


buen ensayo de microarreglos deben contemplar el diseo
experimental, el diseo del arreglo que se utilizar y la localizacin de cada punto en el arreglo, las muestras utilizadas
y su marcaje, as como los controles, la hibridacin, los
datos generados y su anlisis e interpretacin. El proceso
implica preparar el soporte con los ADN elegidos, incubar
e hibridar con el ADNc y las marcas uorescentes, detectar
la unin de ADNc mediante tecnologa lser, almacenar los
datos y analizar las imgenes con mtodos estadsticos adecuados. La interpretacin de los marcajes indicar un
patrn de colores, en el que de manera general un color A
representara al ADN control, uno B al ADN de la muestra de anlisis, uno C indicara una doble hibridacin y el
negro, o sin color, la no hibridacin. De esta manera, cada
punto en el soporte del microarreglo se asocia, segn su
color, con el gen localizado. Segn el tipo de arreglo, la localizacin, as como la intensidad de color, se obtendr infor-

CAPTULO 17 Secuenciacin del ADN y microarreglos

macin acerca del estado del gen y de su nivel de expresin


(ver la gura 17-5).
La tecnologa de microarreglos surgi hace poco ms de
una dcada y fue recibida con entusiasmo, ya que permita
conocer la expresin de gran nmero de genes al mismo
tiempo. Esta tecnologa revolucion el rea por su aplicacin en el entendimiento de las enfermedades complejas y
de la medicina personalizada. En la actualidad, su uso se ha
diseminado a campos de la biologa bsica, estudio del cncer, diagnsticos de enfermedades, guas de tratamiento e
investigacin de nuevos frmacos. Sin embargo, ahora es
claro que la gran cantidad de informacin que se genera con
esta tecnologa se vuelve un problema ms que una ayuda,
ya que la interpretacin de datos es complicada incluso para
los estadsticos, por la gran cantidad de informacin obtenida, y an no hay un consenso denitivo sobre cmo analizar e interpretar esta informacin. De hecho, los estudios

169

con microarreglos an estn en desarrollo, por lo que se


prev que poco a poco se estandaricen procesos. As, los
nuevos enfoques estarn destinados a estudiar las familias
gnicas, el nivel de coordinacin de su expresin entre
familias y a conocer nuevos genes. De esta manera, la integracin de la informacin acerca de los patrones de expresin gnica mltiple y simultnea, la interaccin y la
coordinacin de la funcin celular permitirn revelar cmo
los mltiples productos gnicos trabajan en conjunto para
producir la gran gama de manifestaciones f sicas y qumicas que las clulas requieren. Mientras ms se perfeccione
esta tecnologa, ms precisa, conable y til ser la informacin, a n de prevenir o pronosticar enfermedades o su
evolucin, e integrar el diagnstico y la terapia con frmacos o tratamientos personalizados. Incluso puede tener
aplicacin en la bsqueda de formas de vida en ambientes
extremos o externos a nuestro planeta.

Ejercicios de integracin
1. Cul es la secuencia de la hebra complementaria a esta
secuencia de ADN?
5-AGCGTCATGTTATAGCTATCGGTCTAGCTCTGCAATCGAGCTCG-3
a) 5-TCGCAGTACAATATCGATAGCCAGATCGAGACGTTAGCTCGAGC-3
b) 3-TCGCAGTACAATATCGATAGCCAGATCGAGACGTTAGCTCGAGC-5
c) 5-AGCGTCATGTTATAGCTATCGGTCTAGCTCTGCAATCGAGCTCG-3
d) 3-TCGCATAGCCAAGACGTTAGGTACAATATCGACTCGGATCGAGC-5
2. La secuenciacin qumica tiene ventajas especcas sobre otras tcnicas, seale cul de las siguientes armaciones no es cierta:
a) Los tratamientos qumicos son sencillos de controlar,
slo una base es eliminada por hebra, lo que produce
que los materiales marcados a travs de la secuencia
se distribuyan de forma correcta.
b) Cada base es atacada, tal que cada base individual
ser desplegada en un corrimiento electrofortico.
c) Es un mtodo ptimo para ADN que no puede ser
secuenciado de forma adecuada mediante otros mtodos, por ejemplo oligonucletidos pequeos y secuencias de ADN que producen una terminacin prematura debida a estructuras secundarias fuertes.
d) La interpretacin de los marcajes indica un patrn de
colores, en el cual el verde representa el ADN control,
el rojo el ADN de la muestra de anlisis, el amarillo
una doble hibridacin y el negro la no hibridacin.
3. En el mtodo de secuenciacin qumica, cuando se producen los fragmentos y se determina en el carril del gel
la posicin de una guanina, eso signica que el punto de
terminacin del fragmento secuenciado era:
a) Guanina, porque es la base que se est detectando.
b) Citosina, porque es la base complementaria a la cadena molde.

c) Es la base previa a una guanina, porque por la reaccin especca la G fue modicada y eliminada.
d) Es la base previa a una adenina, porque la reaccin es
especca para purinas.
4. En el mtodo de secuenciacin de Sanger, el punto de
paro de la sntesis se da como resultado de:
a) La incorporacin de una base modicada por reactivos especcos.
b) La eliminacin de un anlogo de base marcado con
un uorocromo que emite en una longitud de onda
especca.
c) La incorporacin de un didesoxinucletido en la hebra
que se est sintetizando.
d) La incorporacin de un desoxinucletido anlogo en la
hebra que se est sintetizando.
5. Respecto al mtodo de secuenciacin automatizado, seale cul de las siguientes armaciones no es cierta:
a) Para llevar a cabo el proceso, como requerimientos
bsicos se debe contar con el marcaje diferencial uorescente de los dNTP, sistema de electroforesis, lser,
detectores de uorescencia, computadora, analizador de
imgenes.
b) Se han desarrollado alternativas que permiten analizar
un gran grupo de fragmentos de ADN como una mezcla, otros que no involucran ni electroforesis en gel o
reacciones qumicas o enzimticas, como la citometra de ujo o microscopia electrnica de tnel para
leer las bases directamente en la hebra de ADN.
c) Segn la sonda utilizada para la hibridacin se determinan cambios en los niveles de expresin de mltiples genes a la vez, mediante el uso de ADNc o de
oligonucletidos, los cuales se amplican selectivamente en placas por PCR y una vez vericada la calidad y pureza, se colocan en portaobjetos de vidrio por
capilaridad.
d) La tcnica permite secuenciar ADN genmico de clulas
microbiales individuales, estrategia til para determi-

www.fullengineeringbook.net

170

PARTE II Metodologa del ADN recombinante

nar mutaciones en la secuencia de microorganismos


que suelen cambiar cuando se cultivan en laboratorio.
6. Cul es la base de la tcnica de microarreglos?
a) Se basa en la polimerizacin de una hebra molde de
ADN mediante bases modicadas, y la obtencin
de diferentes cadenas, tantas como nmero de bases
tenga el fragmento, cada uno de un tamao diferente
y terminado con la incorporacin de un didesoxinucletido.
b) Se basa en la hibridacin de cidos nucleicos y su
deteccin por uorescencia mediante anlisis de imagen, de tal manera que slo se obtendr seal uorescente en los puntos (genes) donde haya habido hibri-

dacin; la intensidad de uorescencia es directamente


proporcional al nivel de expresin del gen.
c) Se basa en la fragmentacin especca del ADN, proceso que implica la modicacin de una base, eliminacin de la base modicada, rotura de la cadena de
ADN en la desoxirribosa modicada y el anlisis de la
fragmentacin por electroforesis en gel de poliacrilamida.
d) Se basa en la separacin de molculas segn la movilidad de stas en un campo elctrico a travs de una
matriz porosa, la cual nalmente las separa por tamaos moleculares y carga elctrica.

Bibliografa
Chandra H., Reddy P.J., Srivastava S. Protein microarrays and novel

detection platforms. Expert Rev Proteomics, 2011;8(1):6179.


Gabrielson E., Berg K., Anbazhagan R. Functional genomics,
gene arrays, and the future of pathology. Mod Pathol,
2001;14(12):12941299.
Lander E.S., Linton L.M., Birren B., Nusbaum C., Zody M.C., Baldwin J, et al. (International Human Genome Sequencing Con-

sortium) Initial sequencing and analysis of the human genome.


Nature, 2001;409(6822):860921.
Maxam A.M., Gilbert W. A new method for sequencing ADN. Proc
Natl Acad Sci USA, 1977;74(2):560564.

Smith L.M., Sanders J.Z., Kaiser R.J., Hughes P.,Dodd C., Connell
CR, et al. Fluorescence detection in automated ADN sequence

analysis. Nature, 1986;321(6071):674679.


Venter J.C., Adams M.D., Myers E.W., Li P.W., Mural R.J., Sutton
G.G., et al. The sequence of the human genome. Scien-

ce, 2001;291(5507):1304-1351. Fe de errores en: Science,


2001;292(5523):1838.
Voelkerding K.V., Dames S.A., Durtschi J.D. Next-Generation
sequencing: from basic research to diagnostics. Clin Chem,
2009;55(4):641658.

www.fullengineeringbook.net

Mukherjee S., Tamayo P., Rogers S., Rifkin R., Engle A., Campbell
C., et al. Estimating dataset size requirements for classifying

ADN microarray data. J Comput Biol, 2003;10(2):119142.


Sanger F., Nicklen S.,Coulson A.R. ADN sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA, 1977;74(12):5463
5467.

Zimmermann J., Voss H., Schwager C., Stegemann J., Ansorge


W. Automated Sanger dideoxy sequencing reaction protocol.

FEBS Lett, 1988;233(2):432436.

18

Captulo

Polimorsmos de ADN
y huella gentica
Belinda Claudia Gmez Meda / Ana Lourdes Zamora Prez
Mara Guadalupe Snchez Parada

Introduccin

de ADN, los cuales no son un sello exacto, pero s permiten


relacionar muestras de un mismo origen o de personas
emparentadas (familiares, ancestros comunes). Estas secuencias se eligieron porque se conoce que varan entre individuos no relacionados, de tal manera que el anlisis de un
grupo de ellas para encontrar concordancias permite inferir
asociaciones con probabilidades altas de que tener un mismo
origen o ser de la misma persona.
Un gen est representado como una seccin de cromosoma, que equivale a un segmento de ADN con una secuencia
determinada, con la informacin necesaria para crear una
protena especca. Los genes de un organismo contienen
toda la informacin de manera precisa acerca de cada aspecto y proceso de la formacin y desarrollo de un individuo; si
bien, los genes no pueden dictar su comportamiento, por lo
que hay que considerar que el ambiente desempea un papel
muy importante en cmo estos genes se expresan a lo largo
de la vida del organismo.
Un gen se presenta en doble dosis, uno que aporta el
padre y otro la madre; a estas copias se les llama alelos, por
lo que hay dos alelos por cada gen, uno de origen materno y
otro paterno. Estas formas allicas de un mismo gen existen
porque la secuencia del ADN est sometida a cambios, en
ocasiones debido a mutaciones que suceden al azar pero
que originan formas alternas de un gen, estables y heredables, a veces con una funcin diferente al alelo original o
silvestre. La mutacin es la base de la variacin gradual de
la estructura gentica de las poblaciones; esto es, la base de la
evolucin.
La posicin f sica donde se ubica un gen en el genoma
se denomina locus (loci en plural), por tanto los alelos silvestres o modicados de un mismo gen residen en un mismo locus. Cuando un individuo tiene diferentes formas
allicas en el locus se dice que es heterocigoto, ya que la
secuencia de cada alelo puede generar variantes de la misma protena. Por el contrario, un homocigoto sera identi-

El ADN de todas las especies de organismos conocidas tiene la misma estructura qumica; sin embargo, cada organismo es completamente diferente a otro; la diferencia se debe
al orden de las bases nitrogenadas en la molcula de ADN.
Los organismos de una misma especie comparten secuencias en su molcula de ADN, pero an dentro de la misma
especie existen variaciones entre individuos. Organismos
de una misma especie compartirn regiones de su secuencia hasta en ms de 99%, lo que les conere caractersticas
similares; ms an, los familiares cercanos tendrn secuencias con mayor parecido entre ellos, pero nunca sern iguales, lo que dene la variabilidad gentica intra e interespecies.
En el caso del ADN humano, las secuencias que contienen a los genes son poco variables dentro de la especie; no
obstante, el resto de la secuencia es muy propenso a la
variabilidad y, debido a que hay millones de pares de bases
por molcula de ADN y un alto porcentaje de sta no codica para una protena, cada persona tiene una secuencia de
ADN nica, lo que permite identicarlo tan slo por el
orden de sus pares de bases. Estas secuencias variables se
denominan polimorsmos.
Existen dos tipos de polimorsmos genticos: los que
muestran cambio de un solo nucletido por sustitucin de
bases y los que implican cambios en el tamao de la secuencia;
esto puede deberse a inserciones o deleciones de secuencias de ADN, o bien a la repeticin de bases (o combinacin
de bases) de manera continua en un segmento del ADN.
Esta variabilidad es un proceso biolgico comn, ya que
30% de la secuencia de ADN es altamente repetitivo, lo
que permite establecer patrones genticos especcos para
identicar individuos, es decir, para establecer una huella
gentica o huella de ADN (ADN ngerprinting).
Por ello, los cientcos han desarrollado estrategias para
poder identicar individuos al analizar patrones repetitivos

www.fullengineeringbook.net

171

172

PARTE II Metodologa del ADN recombinante

cado cuando el individuo presente la misma forma allica


(de origen paterno y materno) en el locus, el resultado de la
expresin gnica ser un mismo producto proteico, ya sea a
partir del alelo silvestre o del modicado.

Polimorsmos
Las secuencias variables son mltiples en los organismos,
los anlisis de gentica poblacional han permitido detectar
dos o ms alelos por cada una, y cuantos ms alelos diferentes hay es ms polimrco; es decir, hay mayor poder de
identicacin, ya que como existe mayor variabilidad en las
secuencias, ser menos probable que dos individuos compartan las mismas regiones polimrcas.
Se considera que hay un polimorsmo gentico cuando
existen mltiples alelos de un gen en una poblacin denida
o, de manera ms especca, cuando la secuencia de bases
nitrogenadas de la molcula de ADN de un locus en particular es variable entre los organismos de una poblacin.
La palabra polimorsmo est compuesta por poli
(muchos), morfo (forma) e ismo (proceso o estado); es decir,
de muchas formas. Los cidos nucleicos y las protenas tienen la propiedad de presentarse en diferentes formas moleculares o en mltiples alelos, lo que puede tener implicaciones
en las patologas moleculares. Un polimorsmo puede
observarse en un individuo completo (polimorsmo fenotpico), en formas variables de protenas o grupos sanguneos
(polimorsmo bioqumico), en las caractersticas morfolgicas de los cromosomas (polimorsmo cromosmico) o
en el ADN, por diferencias en la secuencia nucleotdica
(polimorsmos del ADN).
Las variantes allicas de las secuencias codicantes de
genes en el ADN, debidas a procesos normales de la funcin
celular, propician la produccin de codones polimrcos y,
con ello, de formas alternas de las protenas, aunque generalmente sin que se altere la funcin del producto sintetizado, lo que permite diferenciar un polimorsmo de una
mutacin, lo que se da generalmente al azar.
El polimorsmo puede presentarse en la regin promotora del gen, lo cual inuye en la expresin gnica del ARN
mensajero y, por ello, en la protena que codica (diferentes
fenotipos) o inclusive identicarse en regiones no traducidas (intrones), de tal forma que no se tiene una interpretacin de su funcin, al menos conocida hasta ahora, pero
siguen siendo secuencias que permiten diferenciar individuos y especies.
Los polimorsmos, como las mutaciones, pueden clasicarse, de acuerdo con su efecto, como polimorsmos
sinnimos o silentes (los que no cambian la traduccin del
producto proteico en la variacin de la secuencia; esto es,
los que, cuando la secuencia nucleotdica cambia, el codn que codicaba al aminocido original se cambia por otro
que codica para el mismo aminocido o por otro con
caractersticas qumicas similares), y polimorsmos no
sinnimos (los que s producen variacin en la lectura del

cdigo gentico, por alterar codones que cambian el sentido de la traduccin de un aminocido por otro. Adems, se
considera que los polimorsmos neutros, que son los que
varan en su secuencia en regiones no codicables del ADN
tambin son silentes. Un polimorsmo se considera neutro
si la presencia o ausencia del alelo no conere ninguna ventaja o desventaja al individuo. Adems, un polimorsmo
puede representar ventajas evolutivas para una determinada poblacin, como conferirle resistencia a condiciones
medioambientales, de acuerdo con la zona geogrca en la
que habita.
El trmino polimrco es til para denir genes o alelos,
e incluso se observan secuencias que varan mucho, como
en los alelos que denen los grupos sanguneos y las molculas de los antgenos leucocitarios humanos (HLA, human
leukocyte antigen, que constituye el complejo mayor de histocompatibilidad), a los que se considera altamente polimrcos.
En gentica, el concepto bsico de polimorsmo menciona que cuando un alelo en un locus en la poblacin presenta
una frecuencia de ms de 1% se denomina polimrco. Este
porcentaje indica que la presencia de estas variantes es
comn y no se da por azar, es decir, que el alelo menos comn
no puede mantener su frecuencia simplemente por mutacin.
Los polimorsmos se acumulan en las poblaciones hasta
que se tornan comunes entre las especies; entonces se denominan divergencia gentica. As, con el paso del tiempo, un
polimorsmo podra llegar a presentarse en un alto porcentaje de una poblacin e incluso ser tan comn como un alelo
silvestre. Por tanto, un alelo que originalmente pudo considerarse polimrco puede llegar a ser el alelo ms comn en
una poblacin.
La combinacin de secuencias en los alelos que se heredan es nica para cada descendiente; as, el anlisis de sus
polimorsmos permite obtener un patrn o perl denido
nico para cada organismo, semejante al cdigo de barras de
los productos de los supermercados. A esto se le denomina
huella gentica individual, por su semejanza a las huellas
dactilares, tambin nicas y caractersticas de cada persona.
Los polimorsmos se utilizan como marcadores genticos para identicar o relacionar a personas, ya que al ser
heredables, generalmente sin cambios de padres a hijos,
permiten establecer parentescos biolgicos directos, ya que
comparten los mismos marcadores.
Para poder llevar a cabo estos estudios de marcadores,
en primer lugar hay que denir los tipos de polimorsmos
genticos, ya que pueden clasicarse de acuerdo con diferencias de estructura, forma de transmisin, distribucin,
estabilidad, tamao. Dado a que los mtodos de estudio e
identicacin de polimorsmos son diversos y cada opcin
tiene ventajas y desventajas, la utilizacin de varios tipos de
polimorsmos que aporten diferente informacin sobre su
herencia e individualidad permite obtener resultados ms
amplios y tiles para una interpretacin adecuada.

www.fullengineeringbook.net

CAPTULO 18 Polimorsmos de ADN y huella gentica

Tipos de polimorsmos
Las caractersticas de las secuencias que permiten detectar
sitios polimrcos son muy variables. As, pueden diferenciarse dos tipos de polimorsmos: los que involucran cambios en un solo nucletido y en los que intervienen
deleciones o inserciones de pocos o muchos pares de bases.
De acuerdo con esta clasicacin, los marcadores polimrcos ms utilizados para realizar un perl gentico son:

Polimorsmos de un solo nucletido o nucletido nico


(single nucleotide polymorphism, SNP).
Polimorsmos de longitud de fragmentos de restriccin
(restriction fragments length polymorphism, RFLP).
Nmero variable de repeticiones continuas o en tndem (variable numbers of tandem repeats, VNTR). De
estos polimorsmos se diferencian dos tipos: minisatlites y microsatlites.
Repeticiones cortas y continuas (short tandem repeats,
STR).
Polimorsmos del cromosoma Y.
Marcadores mitocondriales.
Insertion-deletion (InDel).

Polimorsmos de un solo nucletido o nucletido nico


Como su nombre lo indica, los SNP son variaciones en un
solo nucletido o par de bases en una secuencia dada (gura 18-1). Estos polimorsmos pueden estar representados
por la delecin, insercin o sustitucin de una base nitrogenada en la secuencia nucleotdica normal. Este tipo de polimorsmo es muy frecuente, y se ha descrito que es posible
encontrar un SNP en el ADN humano cada 1000 a 3000 pb,
en secuencias codicantes de protenas. Adems, es posible
que estn presentes de manera ms cercana en el ADN no
codicante, inclusive entre 500 a 1000 pb en promedio.
Las ventajas de los SNP como biomarcadores son bsicamente su amplia distribucin a travs de todo el genoma
humano, su frecuencia y su estabilidad; adems, debido a su
alta frecuencia, muchas enfermedades genticas estn causadas por un SNP o se relacionan con la identicacin de un
SNP especco.

173

Polimorfismos genticos
CODONES POLIMRFICOS

Gen

Segmento
exn/intrn

Alelo 1
Alelo 2

EXN 2

G C T T A C C C G T A C T C G
G C T T A C A C G T A C T C G N

Codn polimrfico C>A

Figura 18-1. Polimorsmo SNP. Representado por el cambio de


una base por otra.

resolver los fragmentos en un corrimiento electrofortico


se obtendr como resultado una sola banda en el gel, a una
distancia determinada (gura 18-2).
El hecho de que un individuo sea heterocigoto signica
que tiene alelos diferentes en un determinado locus, por
lo que al identicar su secuencia en un gel se observar ms de
una banda: una para el fragmento sin corte de restriccin y
otras con el corte. En este caso, el nmero de variantes allicas es siempre dos (C: corta/NC: no corta) y se maneja en
funcin de la identicacin del sitio de restriccin por la
enzima utilizada en la digestin, es decir, si corta o no corta
en la secuencia analizada. En cambio, pueden identicarse
tres genotipos: homocigoto para corte C/C, heterocigoto
C/NC y homocigoto para no corte NC/NC (gura 18-3).
De esta manera se identica a los individuos con reconoci-

www.fullengineeringbook.net

Polimorsmos de longitud de fragmentos de restriccin


Este tipo de polimorsmos se evidencian mediante el uso
de enzimas de restriccin, que cortarn determinadas
secuencias de ADN. De este modo se generan fragmentos
(de restriccin), que pueden hibridar con sondas especcas para poder reconocerlos. Si un SNP afecta el sitio de
restriccin de una enzima, se evidenciar un polimorsmo
de restriccin o RFLP. Cuando el cambio de un nucletido
altera la secuencia diana para una determinada enzima de
restriccin puede detectarse el polimorsmo en funcin
de la variacin que ste genera en el patrn de restriccin.
En los casos en que el sitio de restriccin se reconozca en
ambas cadenas de ADN, se considerar un homocigoto, y al

560 pb

Alelo 1

400 pb

160 pb

Alelo 2

Sonda

Sitio de reconocimiento y corte

Figura 18-2. Polimorsmos genticos RFLP. Sitio de reconocimiento


de la enzima de restriccin en un fragmento de ADN, mediante el cual se pueden evidenciar segmentos de diferente
longitud de acuerdo con el fragmento de restriccin generado.
Resultado de la digestin. Alelo 1. Bandas variables (hay
reconocimiento del sitio de restriccin y hay corte enzimtico;
se evidencian dos fragmentos de 400 y 160 pb). Alelo 2. Banda
nica (no hay reconocimiento del sitio de restriccin por la
enzima, y por lo tanto no hay corte observando slo una banda
de 560 pb).

174

PARTE II Metodologa del ADN recombinante

Marcador
25 pb

AA

CC

Polimorfismos genticos
MICROSATLITES

AC
Gen

300 pb
275 pb
250 pb
225 pb
200 pb

199 pb

Alelo 1
Alelo 2

N N G C G C G C G C G C N N N
G C G C G C G C G C G C G C G C

175 pb

(GC)5
(GC)8

Nucletidos polimrficos

150 pb
125 pb

INTRN 4

Segmento
exn/intrn

135 pb

100 pb

Figura 18-4. Deteccin de microsatlites. La deteccin de microsatlites se realiza en regiones no codicantes del ADN, en
el cual se muestran alelos con diferencia en la repeticin de
nucletidos de una secuencia analizada.

75 pb
64 pb
50 pb

Figura 18-3. SNP TNFR1-383 A>C, identicado por PCR-RFLP. Fragmentos de digestin esperados para el polimorsmo TNFR1
-383 A>C. Se muestra el patrn de bandeo obtenido de un gel
de electroforesis donde se evidencia la digestin con la enzima
Bgl II para el polimorsmo TNFR1-383 A>C y se identican
diferentes genotipos: AA (135 y 64 pb), que identica el homocigoto para corte de la enzima de restriccin; AC (199, 135 y
64 pb), donde se observa un heterocigoto, el cual muestra una
banda sin corte debido a que no hubo reconocimiento por la
enzima, y otro par de bandas que muestran el corte enzimtico
por el reconocimiento del sitio de restriccin, y CC (199 pb),
que muestra al homocigoto sin corte, es decir, que no presenta
el sitio de reconocimiento para el corte por la enzima, y por lo
tanto, ambos alelos se evidencian con una sola banda.

cientos o miles de veces a lo largo del genoma. Estas secuencias estn localizadas en la heterocromatina constitutiva
(por ejemplo, en los centrmeros o en regiones cercanas a
los telmeros), aunque en ocasiones estn presentes en
algunas regiones intracromosmicas.
Asimismo, a lo largo de la secuencia de ADN es posible
encontrar secuencias en las que se repiten de 2 a 9 pb, denominados microsatlites, o repeticiones de 10 a 60 pb, llamados minisatlites, que son ms tiles para estudios de
identicacin que los satlites. Su identicacin se lleva a
cabo mediante reaccin en cadena de la polimerasa (PCR)
con iniciadores especcos que anquean el sitio de la
secuencia donde estn localizados los mini o microsatlites,
y su variacin se identica de acuerdo con el nmero de
secuencias repetidas presentes, que puede ir desde dos
repeticiones hasta cientos. Los mini o microsatlites se
encuentran muy distribuidos a lo largo del genoma, aunque
los minisatlites, en particular, se localizan con frecuencia
cerca de la regin telomrica. Se consideran polimorsmos
codominantes, de tal forma que un heterocigoto generar
dos bandas en un corrimiento electrofortico, mientras que
los homocigotos generarn slo una banda con tamao
variable, de acuerdo con el nmero de repeticiones existentes en el individuo (gura 18-4).
Estas regiones de ADN repetidas en bloque o en tndem estn sujetas a procesos como duplicacin o recombinacin, por lo que pueden ser altamente variables y diferir
mucho entre individuos, lo que las convierte en marcadores
genticos muy informativos.

www.fullengineeringbook.net

miento de la enzima de restriccin en ambos alelos, en uno


solo o en ninguno de ellos (gura 18-3).
El hecho de poder diferenciar homocigotos de heterocigotos mediante este tipo de polimorsmos permite denir
a los RFLP como codominantes; es decir, que ambos alelos
se maniestan sin dominar la expresin de uno sobre el
otro. Sin embargo, a pesar de que los RFLP son prueba de
que existe variacin heredable en el ADN, este tipo de polimorsmos suele ser dif cil de encontrar, y en todo caso,
slo permite determinar si se presenta o no un sitio polimrco en una secuencia especca. Por ello, su utilizacin
en el diagnstico indirecto es limitada, ya que normalmente
presentan un nmero de alelos bajo.

Satlites, microsatlites y minisatlites


El ADN satlite se dene como secuencias repetitivas de
tamao variable, que pueden ir desde los 100 a los 200
nucletidos repetidos en bloque uno tras otro (en tndem),

Polimorsmos con nmero variable de repeticiones continuas o en tndem, y con repeticiones cortas y continuas
Los VNTR y STR se consideran microsatlites o minisatlites, es decir, loci que corresponden a secuencias cortas de
ADN (un par o tro de bases), repetidas en bloque o tndem
un nmero especco de veces. La longitud de estas secuencias puede ser de pocas bases hasta algunas decenas de

175

CAPTULO 18 Polimorsmos de ADN y huella gentica

Polimorsmos genticos
VNTR
Alelo 1

Abuelos

F1
A,F

3 repeticiones

D,G

B,C

E,H
Padres

F2
Alelo 2

6 repeticiones

C,H

F,G
10 repeticiones

Alelo 3
Sonda (southern blot)

Unidad repetida en tndem


Hijos

F,3

Figura 18-5. Anlisis de VNTR. Se muestra el anlisis de VNTR


en alelos de diferentes individuos, en el cual se observa la
variacin en el nmero de secuencias repetidas en bloque o
tndem, que ser distintivo para cada individuo, de acuerdo
con el marcador evaluado.

nucletidos, y la cantidad de repeticiones determinar la


variabilidad de alelos distintos en un mismo locus. As, en
un mismo cromosoma pueden existir regiones con diferente nmero de repeticiones en la poblacin (gura 18-5).
Estos polimorsmos se localizan con frecuencia en
regiones intrnicas o no codicantes, su longitud es variable, de entre 20 y 100 pb repetidas y su variabilidad es alta
dentro de las poblaciones, lo que permite su uso conable
en la identicacin de individuos.
Debido a que los polimorsmos son heredables, una
persona podr presentar VNTR heredados de su madre y
padre, pero no podra presentar VNTR que sus padres no
tengan. De esta manera, las secuencias repetidas de un individuo presentan un patrn nico, y mientras ms VNTR
sean analizados ms distintivo e individualizado ser el perl o patrn polimrco obtenido, tal como las huellas dactilares, slo que a escala molecular (gura 18-6).
El anlisis con STR se basa en los microsatlites y se
diferencian en motivos repetidos, denominados perfectos
cuando se presentan sin interrupcin y de forma ordenada
(por ejemplo, TATATATATATATA); en caso contrario, se
trata de repeticiones interrumpidas (TATATAGCTATAT)
o combinadas (TATATAGCGCGCGCGCTATATA).
La desventaja principal de este tipo de polimorsmos es
que no estn distribuidos por todo el genoma, lo que limita
su uso para determinadas condiciones o enfermedades; sin
embargo, su aplicacin ha sido amplia en pruebas de paternidad y en gentica forense.

F,C

C,F

F,H

A
B
C
D
E
F
G
H

Figura 18-6. Identicacin de parentesco. De acuerdo con el patrn


de bandeo de un anlisis de marcadores heredados de padres
a hijos se realiza la identicacin del parentesco.

polimorsmos de utilidad seran secuencias especcas del


cromosoma Y, las cuales se identican mediante amplicacin de regiones determinadas, utilizando iniciadores especcos.
La secuencia de la heterocromatina del cromosoma Y es
variable y a lo largo de la molcula se han identicado secuencias repetitivas tipo microsatlites, como repeticiones AC.
Adems, hay que considerar que el ndice de mutacin para
el cromosoma Y es muy bajo y no tiene implicaciones negativas para la reproduccin, de manera que son variaciones
muy tiles para identicar parentescos o rastrear descendientes por lnea paterna. Esto tambin ha servido, en los
estudios evolutivos de la especie humana, para la determinacin de un origen comn, producto de una sola migracin
procedente de frica.

www.fullengineeringbook.net

Polimorsmos del cromosoma Y


El cromosoma Y tiene recombinacin gentica con su homlogo (cromosoma X) slo en aproximadamente 1% de su
secuencia; por ello, la porcin no recombinante es de especial inters, ya que contiene secuencias que no se encuentran
en otras regiones del ADN nuclear, adems de que son puramente de herencia paterna a hijos varones.
Si el inters es determinar relaciones familiares de herencia paterna, comparar familiares o descendientes varones, los

Marcadores polimrcos mitocondriales


La mitocondria es un organelo celular que existe en mltiples copias segn el tipo de clula. Las mitocondrias son
exclusivamente de herencia materna, es decir, todos los descendientes tendrn en sus clulas mitocondrias de su madre.
Esto se debe a que en el momento de la fecundacin el vulo
conserva las mitocondrias en el citoplasma, mientras que las
mitocondrias de espermatozoide, que se encuentran en el
cuello, entre la cabeza y la cola, se eliminan y no se integran
al interior del vulo para la formacin del embrin. Este
mtodo permite identicar a individuos de acuerdo con
parentescos por lnea materna, ya que todos los hermanos,
hombres y mujeres, compartirn la misma informacin en
su ADN mitocondrial (ADNm).Las ventajas del anlisis del

176

PARTE II Metodologa del ADN recombinante

ADNm es que existen mltiples mitocondrias (1 103-1


104 copias) por clula, cada una con varias molculas de
ADNm, caracterizado por ser una doble hebra circular y
tener un genoma pequeo (16569 pb, que codica para 37
genes). Adems, este genoma presenta una alta tasa de
mutacin (5 a 10 veces ms que el ADN nuclear), lo que le
conere hipervariabilidad. Este tipo de anlisis es til, sobre
todo para anlisis evolutivos, antropolgicos o forenses, o
cuando no se tiene fcil acceso al ADN nuclear, ste est
deteriorado o existe en nmas cantidades.
Para llevar a cabo este tipo de anlisis, es necesario
extraer el ADNm. Para ello, se requiere amplicar regiones
determinadas del ADNm, en particular las regiones hipervariables HV1 (16024-16035, 342 pb) y HV2 (73-340, 267
pb), localizadas en la regin control, que es la zona que
regula la transcripcin de la molcula. Estos segmentos de
ADNm son luego secuenciados y comparados con muestras de familiares provenientes por lnea materna, por el
tipo de herencia mitocondrial, para detectar diferencias en
la secuencia gnica.

Insertion-deletion
Se han descrito polimorsmos que consisten en bases insertadas o suprimidas. Las secuencias involucradas son pequeas, en general de hasta 10 pb; sin embargo, es posible que se
presenten secuencias de hasta 1000 a 1500 pb, como en el
caso de la insercin de elementos transponibles o transposones (fenmeno de transposicin, presente en algunos genes
que pueden moverse a travs del genoma y reinsertarse en
lugares denidos en otra regin cromosmica).

pero no si esta secuencia se presenta en mltiples alelos o


slo en uno.

Polimorsmos de protenas
Pueden realizarse estudios de polimorsmos de protenas,
mediante la identicacin de la secuencia de aminocidos.
Esto es especialmente til para la diferenciacin de isoenzimas en el citoplasma celular, mediante la deteccin de
mutaciones no sinnimas en el ADN, que ocasionaran que
la estructura primaria de la protena tuviera variaciones,
aunque sin alterar su accin sobre un mismo sustrato, sino
que slo afectara su anidad por el mismo.
Este anlisis se lleva a cabo mediante electroforesis,
basado en que, al cambiar en la secuencia un aminocido
por otro con propiedades sicoqumicas diferentes (por
ejemplo, un aminocido por uno bsico, o uno polar por uno
no polar), la estructura nal de la protena sera diferente y
sus patrones de migracin en la electroforesis se veran
afectadas, ya que las cargas e interacciones entre aminocidos tendran variaciones. Estas variantes se consideran
polimorsmos codominantes, ya que pueden tener funcin
proteica a la par de su homlogo silvestre.
Este anlisis es til para identicar polimorsmos en protenas que tienen funcin enzimtica. Las variantes pueden dar diferente respuesta metablica y ocasionar que
la homeostasis se altere. Hay que considerar, sin embargo, la
inuencia ambiental, ya que si sta es mnima es ms sencillo
analizar las consecuencias de un polimorsmo en la actividad de la enzima. Como ejemplo cabe mencionar las enzimas metablicas de la familia citocromo P-450 (CYP450),
que intervienen en la transformacin, neutralizacin y eliminacin de compuestos, por ejemplo, de los medicamentos.

www.fullengineeringbook.net

Polimorsmos de secuencias aleatorias


Es posible analizar polimorsmos de fragmentos o secuencias de ADN amplicado de forma aleatoria (Random
Amplied Polymorphic ADN, RAPD). La ventaja de esta
tcnica es que no se requiere conocimiento previo de la
secuencia ni sondas homlogas, como en los RFLP, lo que
la convierte en una opcin como prueba tamiz.
En este caso, para la amplicacin se utilizan iniciadores de 8 a 10 pb con secuencia aleatoria, de manera que, de
encontrarse las secuencias de complementariedad entre el
iniciador y la muestra de estudio, puede amplicarse una
muestra representativa del genoma.
Al realizar anlisis por electroforesis se evidenciarn
mltiples bandas que muestran fragmentos de ADN; es
decir, si existiera homologa en las secuencias stas seran
amplicadas y evidenciadas como una sola banda, mientras
que si no existiera homologa entre el iniciador y la muestra,
debido a algn cambio en la secuencia que hiciera perder la
regin de acoplamiento del iniciador, entonces el fragmento
no amplicara y no habra banda. Con este mtodo no es
posible diferenciar heterocigotos de homocigotos que presenten la secuencia, ya que en ambos se presentara la banda en el gel, por eso se dice que es una prueba tamiz, ya que
slo identica si se encuentra la secuencia en la muestra,

Utilidad del anlisis de patrones


polimrcos o huella gentica de ADN
Los mtodos de estudio, cada vez ms precisos, permiten
llevar a cabo los anlisis de marcadores genticos casi con
certeza absoluta. Sin embargo, el estudio de polimorsmos
requiere de conocimientos tcnicos y cientcos adecuados,
adems de una gran experiencia en la interpretacin de los
resultados, a n de que stos sean conables.
La creacin de perles genticos por medio de polimorsmos se realiza con marcadores o regiones con patrones de
repeticin denidas (micro o minisatlites). El perl gentico,
o huella de ADN, determinar el genotipo de un individuo de
acuerdo con los marcadores genticos analizados. Cuanto
mayor sea el nmero de marcadores analizados, mayor ser la
certeza para la identicacin del individuo o para la conrmacin de la relacin lial, lo que permite realizar estudios de
paternidad, logenticos, o de gentica forense o criminalstica, para la identicacin molecular de individuos.
Los polimorsmos pueden asociarse directa o indirectamente a patologas o procesos de enfermedad especcos,

CAPTULO 18 Polimorsmos de ADN y huella gentica

o incluso servir para establecer asociaciones entre la presencia del polimorsmo con un gen defectuoso cercano a
l, por estudios de desequilibrio de ligamiento o solamente
como marcadores de susceptibilidad, en los que su identicacin permite establecer riesgos para el desarrollo de
enfermedades multifactoriales.
Los polimorsmos conocidos y ms tiles son generalmente modicaciones puntuales de la secuencia de ADN.
Estas modicaciones se estudian principalmente para estudios de riesgo gentico para diversas enfermedades, aunque
tambin se consideran las variaciones de secuencia de fragmentos de cromosomas, como las alteraciones cromosmicas estudiadas en el cariotipo, los segmentos polimrcos
en la heterocromatina del cromosoma Y, o las secuencias
repetitivas, inserciones o deleciones, entre otras. Estas ltimas, si bien tambin sirven para el diagnstico gentico,
son ms tiles para estudios de identicacin familiar, liacin, identicacin de individuos en accidentes, criminalstica y ciencia forense, entre otros.
La identicacin de SNP tiene una gran importancia en
la investigacin biomdica, ya que ha permitido conocer y
entender el proceso de enfermedad, as como poder establecer estrategias de tratamiento, control y prevencin.
Su aplicacin clnica incluye, por ejemplo, la identicacin de genotipo E4 del gen de apolipoprotena E humano
(APOE), que se ha asociado con enfermedades del metabolismo de lpidos y con susceptibilidad a desarrollar la enfermedad de Alzheimer.
En el gen del metil-tetrahidrofolato reductasa (MTHRF),
involucrado en el metabolismo de folatos, se reconoce como
distintivo el polimorsmo Cis677Tre, que genera una enzima termolbil menos activa. Esto produce niveles bajos de
folato en plasma y niveles elevados de homocistena, lo que
est ligado a enfermedad cardiovascular.
Los polimorsmos en enzimas metabolizadoras de frmacos ocasionan diferencias en la respuesta al tratamiento
y en efectos de ste entre pacientes, ya que la biotransformacin de cada compuesto puede variar, segn el genotipo
del individuo. Los SNP en estas enzimas han servido para
identicar de forma temprana efectos secundarios a frmacos, incompatibilidad o resistencia a terapias y variacin
en la ecacia de medicamentos. Todo esto ayuda al mdico en
la toma de decisiones de la teraputica adecuada para cada
paciente. A este proceso se le conoce como medicina personalizada.
Para la farmacogentica es de gran utilidad el estudio de
los genes CYP450, entre ellos el CYP2D6, que metaboliza
una gran cantidad de frmacos y presenta mltiples variantes allicas. Se denen cuatro fenotipos, de acuerdo con la
actividad que presente su producto gnico, es decir, si sern
metabolizadores rpidos, funcionales, lentos o pobres (sin
funcin enzimtica). Todo ello conlleva implicaciones clnicas importantes. Por un lado, en un metabolizador lento o
pobre la permanencia en la clula de los compuestos o sus
formas reactivas ms tiempo del necesario podra ocasio-

177

nar toxicidad, debido a la falta de uno de los alelos funcionales (lento) o por tener alelos que producen variantes poco
funcionales de la enzima (isoenzimas) o carecer de la enzima (pobre). Por otro lado, un metabolizador rpido (o
ultrarrpido) puede tener ms de dos copias del alelo activo,
lo que produce enzimas altamente funcionales con actividad enzimtica acelerada, de manera que el compuesto se
metaboliza tan rpido que posiblemente pierda ecacia.
Tambin son importantes los polimorsmos de acetilacin de genes involucrados en el metabolismo de una gran
variedad de compuestos con arilaminas e hidracinas, adems de carcingenos. Estos compuestos son metabolizados
por la enzima citoslica N-acetiltransferasa (NAT2), donde
la identicacin de polimorsmos se ha asociado con una
funcin disminuida de la enzima. A esto se le conoce como
fenotipo acetilador lento y conlleva riesgo o susceptibilidad
aumentada a padecer cncer colorrectal o de vejiga.
Para el diagnstico gentico, el estudio de polimorsmos tipo SNP permite identicar variantes allicas que se
han asociado con riesgo de presentar enfermedades, sobre
todo multifactoriales. Estas determinaciones ayudan a establecer programas de prevencin, ya que al ser multifactorial, el componente ambiental tiene una gran importancia.
As, si se sospecha o existe la certeza de tener variantes
gnicas de riesgo es posible hacer cambios en diversos factores del estilo de vida que puedan desencadenar la enfermedad. Por ejemplo, diversos SNP se han asociado con la
predisposicin a padecer diabetes tipo 2, entre ellos SNP en
el gen PPARG (peroxisome proliferator-activated receptor
gamma o receptor de glitazona NR1C3, rs1801282 Pro12Ala,
C/G), receptor nuclear implicado en el metabolismo de glucosa y en el catabolismo y almacenamiento de los cidos
grasos. El gen ENPP1 (ecto-nucletido pirofosfatasa/fosfodiesterasa 1 o PC1, rs1044498 Lis121Gln, C/A), que codica para una glucoprotena de membrana clase 2, se ha
asociado con resistencia a la insulina. Adems, el gen IL6
(interleucina 6, rs1800795 -174, G/C) es citocina con funciones biolgicas diversas, incluida la respuesta inmune.
Adems, en muchos de los SNP asociados se han encontrado variantes no sinnimas, de tal manera que el producto
gnico de la secuencia modicada tendra una alta probabilidad de conferir alteraciones funcionales.
Por otro lado, la tipicacin de genomas microbianos permite determinar la distribucin de los tipos microbianos en
determinada poblacin, su patogenicidad y resistencia a tratamientos o inmunogenicidad. Esto permite monitorizar poblaciones en riesgo de manera anticipada, identicar patrones de
transmisin y crear nuevos frmacos o vacunas.

www.fullengineeringbook.net

Mtodos de deteccin de patrones


polimrcos o huella de ADN
A n de encontrar secuencias especcas con un patrn
determinado que permitan el corte con enzimas de restriccin o que puedan hibridarse para su deteccin, se emplean

178

PARTE II Metodologa del ADN recombinante

varios abordajes comunes, basados en la homologa de las


secuencias de ADN con sondas especcas.
Segn las reglas de Charga, el grado en el cual dos
secuencias de ADN se complementen o emparejan se le llama homologa. Una complementariedad total entre dos fragmentos de ADN demuestra una alta homologa, mientras
que una complementariedad slo en una pequea porcin de
pares de bases pone de maniesto una baja homologa.
Para detectar polimorsmos se pueden emplear diversas
tcnicas el Southern blot es un mtodo ideal para detectar
polimorsmos en el ADN, ya que mediante el uso de sondas
especcas para identicar secuencias repetidas (VNTR o
STR), localiza regiones de hibridacin homlogas a una
secuencia de inters. Asimismo, la PCR con enzimas de restriccin y electroforesis permite localizar secuencias blanco
(ver el captulo 15, Tcnicas de hibridacin).
Existe tambin una tcnica en la cual, mediante PCR, se
amplican regiones polimrcas que incluyen varios polimorsmos (AmpFLP). Esta tcnica se ha automatizado y
permite estudiar y crear rboles logenticos, basados en
anlisis comparativo de muestras de ADN individuales. As,
pueden distinguirse VNTR de manera sencilla y a un costo
relativamente bajo, lo que hace a este tipo de mtodos
populares aun en laboratorios o pases con bajos recursos.
Para el anlisis de STR, los loci con STR, en primer
lugar, se tratan con iniciadores especcos para amplicar
fragmentos que contengan secuencias cortas (cuatro bases
repetidas) con repeticiones continuas, para despus ser
separadas por electroforesis en gel o capilar, a n de documentar el nmero de repeticiones y distinguir patrones de
repeticin que puedan compararse y asociarse con un
estndar o blanco. Se debe contar con una secuencia de
referencia para establecer o descartar asociaciones, por
ejemplo, en una investigacin criminal, contar con muestras de ADN obtenidas de una vctima, para que puedan
compararse con la muestra del sospechoso.
Los STR son comunes, los comparten 5 a 20% de las
personas, lo que obliga a la bsqueda de combinaciones de
loci en reacciones multiplex, para lograr un mtodo adecuado de discriminacin e identicacin precisa, al considerar siempre una secuencia base o de referencia con la cual
hacer la comparacin.

para conrmar, por ejemplo, la situacin legal de un menor,


su nacionalidad u origen, y tambin son tiles para determinar la compatibilidad de rganos en trasplantes, as como
para denir el origen y/o la composicin de alimentos; incluso puede usarse en estudios evolutivos de poblaciones animales salvajes o para postular hiptesis acerca de la gentica
poblacional y las migraciones humanas a travs del tiempo.
A pesar de que este mtodo de identicacin mediante
la huella de ADN se considera equivalente al cdigo de
barras de un producto comercial, ya que cada persona tiene
un patrn gentico especco, hasta ahora los VNTR slo
dan evidencia de probabilidad (mayor o menor) de que el
patrn gentico analizado sea homlogo o concuerde con
el de una persona en particular. Sin embargo, esta probabilidad estara denida como de homologa de 1 en 2 mil
millones, lo que no descarta la posibilidad de que no lo sea
o, lo que es ms comn, de que la tcnica se haya llevado a
cabo de manera poco conable y haya error o falsos positivos. Esto se ha abordado con prontitud y actualmente existen normas y reglamentaciones universales de seguridad y
precisin en el anlisis de huella de ADN, que permiten
minimizar el error tcnico.
Para solventar estos problemas es til la automatizacin
de los procesos, as como el anlisis de combinaciones de
polimorsmos raros (o poco comunes entre las personas).
stos permiten crear patrones que incrementan la probabilidad de que las muestras en comparacin efectivamente
coincidan, en el caso de identicar que provengan de la
misma persona, o que correlacionen, en el caso de establecer relaciones biolgicas familiares, considerando las variaciones debido a diferencias en raza o etnia. Todo ello
involucra en gran medida a la gentica de poblaciones para
establecer relaciones entre lneas raciales.
En un futuro la huella del ADN podra ser una herramienta til de identicacin para todas las personas al
nacer, aunque sobre este tema todava existe controversia
respecto a asuntos bioticos. Hasta el momento existen
bases de datos, sobre todo de carcter judicial, que permiten identicar a sospechosos en juicios criminales, lo que
deja fuera a todas las personas que no hayan pasado por
algn proceso de este tipo. Se plantea que solicitar la huella
gentica de cualquier persona sin alguna razn de carcter
penal podra considerarse discriminatoria. Esto sera fcilmente rebatible si la prueba se aplicase a toda persona al
nacer, ya que sera una forma de identicacin personal
vlida y conable; sin embargo, los costos que implica llevar
a cabo el anlisis para cada persona an son muy altos, lo
que lo vuelve de momento una alternativa no prctica y
poco viable.
Otra implicacin de carcter tico se reere al diagnstico gentico, ya que realizar anlisis de polimorsmos asociados a enfermedades produce resultados (positivos o
negativos) que ataen a la familia por completo y no slo al
propositus o individuo en estudio. Ello, en ocasiones, ante
enfermedades o situaciones delicadas, genera conictos

www.fullengineeringbook.net

Controversias en el anlisis
de la huella gentica
La identicacin de polimorsmos para establecer un
patrn gentico o huella gentica es til en diversos campos
de estudio. Por ejemplo, en ciencias forenses permite comparar sospechosos mediante muestras de sangre, cabello,
saliva o semen, a n de determinar responsabilidad o exoneracin en juicios criminales. Tambin es til en la identicacin de restos humanos, familiares extraviados, pruebas de
paternidad, identicacin de inmigrantes o personas indocumentadas, para establecer relaciones biolgicas familiares

179

CAPTULO 18 Polimorsmos de ADN y huella gentica

entre lo que deben o no saber los dems miembros de la


familia y/o cunto poder tiene el propositus para evitar que
dicha informacin pueda difundirse o utilizarse para otros
nes, de carcter comercial o legal que pudieran afectarle
en su vida laboral o personal. ste sera el caso si las compaas aseguradoras pudieran denir primas especcas a
personas con determinado patrn gentico. Por otra parte,

la identicacin de factores de riesgo o predisposicin a


diversas enfermedades sera sumamente til para la prevencin y el tratamiento adecuados de las enfermedades y
generara benecios mdicos y socioeconmicos evidentes,
sin dejar de lado por supuesto el estudio y el control del
factor ambiental, con grandes implicaciones en el desarrollo y la expresin de cierto perl gentico.

Ejercicios de repaso
I. Identicacin de fragmentos de restriccin para genotipicar de forma diferencial homocigotos de heterocigotos:
1. Indique en la lnea inferior de cada carril los genotipos
correspondientes a los siguientes fragmentos de digestin, para cada una de las muestras de los pacientes representadas en el siguiente gel.
Fragmentos de digestin esperados:
GG (131, 103, 60 pb), GC (163, 131,103, 60 pb), CC
(131 y 163 pb).
Enzima de restriccin utilizada: BglII
Gel donde se muestra la digestin para el polimorsmo
TGFB1+915 C>G
PACIENTES
Marcador
25 pb

Abuelos

F1
1,2

3,4

5,6

7,8
Padres

F2
1,4

5,7

Hijos

F3
Genotipos
1
2
3
4
5
6
7
8

www.fullengineeringbook.net
300 pb
275 pb
250 pb
225 pb
200 pb
175 pb

2. Considere el siguiente anlisis de marcadores de una familia y, tomando como base los alelos distintivos de ambos padres, identique y explique la liacin de cada uno
de los hijos.

150 pb
125 pb
100 pb
75 pb
50 pb

25 pb

II. Identicacin de parentesco a partir de la herencia de alelos


1. De acuerdo con el siguiente patrn de bandeo, identique en la lnea el genotipo de cada uno de los hijos en
esta genealoga.

Madre

Padre

Hijo 1

Hijo 2

Hijo 3

Hijo 4

180

PARTE II Metodologa del ADN recombinante

Bibliografa
Daniels M., Trowern A. Pharmacogenomics SNPing away. Bioche-

mist. 2003:19-23.
Hartl D. A primer of population genetics, 3 ed. Boston: Sinauer
Associates; 2000.
Jeffreys A.J., Wilson V., Thein S.L. Hypervariable minisatellite
regions in human DNA. Nature, 1985;314:67-73.
Jeffreys AJ, Wilson V, Thein S.L. Individual-specic ngerprints of
human DNA. Nature, 1985;316(6023):76-79.
Passarge E. Color Atlas of Genetics. Nueva York: Thieme Medical
Publishers; 1995:411.
Suzuki D.T., Grifths A.J.F., Miller J.H., Lewontin R.C., Introduccin al anlisis gentico. Madrid: McGraw-Hill Interamericana,
1992:800.

Wang H., Kim R.A., Sun D., Gao Y., Wang H., Zhu J., et al. Eva-

luation of the eects of 18 non-synonymous single-nucleotide


polymorphisms of CYP450 2C19 on in vitro drug inhibition
potential by a uorescence-based high-throughput assay. Xenobitica, 2011;41(9):826-835.
Willer C.J., Bonnycastle L.L., Conneely K.N., Duren W.L., Jackson
A.U., Scott L.J., et al. Screening of 134 single nucleotide po-

lymorphisms (SNPs) previously associated with type 2 diabetes


replicates association with 12 SNPs in nine genes. Diabetes,
2007;56(1):256-264.

www.fullengineeringbook.net

www.fullengineeringbook.net

Parte III

Bases moleculares de
las enfermedades
Contenido
Captulo 19
Captulo 20
Captulo 21
Captulo 22
Captulo 23
Captulo 24
Captulo 25
Captulo 26

Bases moleculares de las patologas humanas


Enfermedades monognicas
Bases moleculares del cncer
Bases moleculares de la diabetes mellitus
Bases moleculares de la obesidad
Bases moleculares de la hepatitis B
Bases moleculares de la hepatitis C
Bases moleculares del virus de la inmunodeciencia humana

www.fullengineeringbook.net

Captulo

19

Bases moleculares de
las patologas humanas
Jos Macas Barragn / Selene G. Huerta Olvera

Introduccin

clasicacin, la enfermedad se encuentra dada por disfunciones celulares y/o tisulares, y genera cambios temporales o
permanentes en el organismo as como variaciones en la funcin de rganos y sistemas, que en ltimo trmino se reejan
en forma de padecimiento, incluso aquellas debidas a otras
causas y que no se consideran de origen molecular.
Existen diferentes tipos de diagnstico de una enfermedad de acuerdo con la informacin analizada:

El desarrollo tecnolgico en la biologa molecular y, en


especial, en la gentica molecular ha abierto un sinf n de
ventajas clnicas indiscutibles en la prctica mdica diaria.
La sensibilidad y la especicidad de las tcnicas usadas en el
diagnstico directo de defectos genticos o agentes etiopatognicos asociados a los procesos mrbidos representan
una herramienta valiosa en la medicina, a lo que hay que
aadir la velocidad con la que se obtienen los resultados.
Por ello, es esencial conocer cmo el ADN se replica, se
transcribe y se traduce a protenas (dogma central de la biologa molecular), as como los mecanismos de expresin
basal e inducible de genes en el genoma. Uno de los principales objetivos es conocer los mecanismos de regulacin y
expresin gentica en los procesos de la enfermedad para
tratar de detenerla e incluso prevenirla, ya que mediante
estudios genticos pueden saberse las probabilidades de
que se presente en individuos susceptibles.
A partir del descubrimiento en que se relacion que
todas las enfermedades tienen una causa molecular, se han
llevado a cabo grandes progresos para conseguir un tratamiento ecaz a dichas enfermedades. Cualquier enfermedad cursa, en mayor o menor grado, con alteraciones en la
estructura, propiedades, metabolismo o funcin de una o
varias biomolculas.
Entre las causas que pueden inducir una enfermedad se
encuentran agentes f sicos (radiaciones, polvos, traumatismos, etc.), exposicin a compuestos txicos (solventes,
metales pesados, toxinas, etc.) o biolgicos (virus, bacterias, parsitos, etc.) y trastornos de origen gentico cuya
etiologa radica en la informacin gentica contenida en el
organismo.
Segn la biomolcula alterada, las enfermedades tambin
pueden clasicarse en hormonales, inmunolgicas, nutricionales y metablicas, entre otras. Con independencia de su

www.fullengineeringbook.net

1. El diagnstico clnico se lleva a cabo a partir de la


observacin mdica (exploracin), con el apoyo de los
datos de laboratorio (anlisis clnicos, radiologa e imagen, etc.), y se basa en un criterio fenotpico y de las
manifestaciones bajo la forma de sndrome clnico.
2. El diagnstico molecular de una enfermedad se basa
en criterios genotpicos que alteran la constitucin del
genoma. Desde el punto de vista molecular, las enfermedades se pueden clasicar en: genticas, exgenas y
mixtas. Esta clasicacin no es aceptada de forma generalizada, debido a que no se conoce con precisin la
causa molecular de muchas enfermedades.
El objeto de estudio de la patologa molecular es el
conocimiento de la enfermedad desde el punto de vista de
su alteracin molecular para contribuir a su diagnstico y
teraputica. A principios del siglo xx se estableci la expresin errores congnitos del metabolismo para describir alteraciones hereditarias presentes durante la vida del paciente,
que afectan vas metablicas especcas, debido a la ausencia o a la falta de actividad de molculas particulares (en su
mayora enzimas), como el albinismo, la alcaptonuria, cistinuria y galactosemia.
El inicio sistemtico de la patologa molecular tiene
lugar en el decenio de 1950, con las tcnicas que permiten
el estudio de los cromosomas humanos y el conocimiento
de su papel en el desarrollo sexual y de las anomalas cromosmicas relacionadas.

183

184

PARTE III Bases moleculares de las enfermedades

La genmica incluye el genoma, as como la aplicacin


de pruebas genticas, para identicar las alteraciones responsables de una enfermedad. De manera anloga, la
transcriptmica y la protemica denen el papel que desempea el ARN y las protenas en el inicio o establecimiento de la enfermedad.

Clasicacin molecular de
las enfermedades humanas
Desde el punto de vista molecular, una enfermedad gentica es una situacin causada por un cambio, llamado mutacin, que se presenta durante la replicacin, transcripcin o
traduccin de uno o varios genes. En general, dicha alteracin interere con la produccin de la protena codicada
por el gen que presenta dicha mutacin. Las enfermedades
genticas se transmiten de generacin en generacin debido a que se originan por una alteracin presente en las clulas madre, por lo que son de carcter hereditario. En
cambio, alteraciones en las clulas somticas no son hereditarias y slo afectan al organismo que las desarrolla.
Las enfermedades genticas pueden clasicarse segn
caractersticas especcas en alteraciones genticas, segn
su extensin: mutacin puntual (es la alteracin de un solo
nucletido y la causa de las enfermedades monognicas);
mutacin mediana (normalmente tiene lugar en secuencias
repetidas, como los satlites o microsatlites, e implica la delecin o insercin de secuencias de ms de dos nucletidos), y
nalmente, mutacin a gran escala (pueden ser cromosmicas o citogenticas, y afectan a cromosomas completos o a
grandes fragmentos de ellos). Se distinguen translocaciones,
deleciones o inserciones de fragmentos cromosmicos, adems de anomalas en el nmero de cromosomas de la clula.
Las alteraciones numricas se deben a segregacin cromosmica errnea, mientras que las anomalas estructurales o cromosomopatas lo hacen a reordenamientos cromosmicos.
Adems, las enfermedades genticas tambin pueden
clasicarse en alteraciones genticas, segn el genoma
afectado, ya que pueden presentarse en el genoma nuclear
o mitocondrial; las primeras son ms frecuentes, ya que el
tamao del material gentico nuclear es mayor. A su vez, las
alteraciones genticas nucleares pueden clasicarse segn
el tipo de cromosoma afectado, ya que el defecto puede
estar localizado en los cromosomas sexuales (cromosomas
X o Y) o en los cromosomas autosmicos (22 pares). Esta
distincin combinada con el carcter dominante o recesivo
con el que se expresa la enfermedad es la clasicacin ms
sencilla y la empleada de forma ms comn en gentica.
Sin embargo, clsicamente, desde el punto de vista
molecular, las enfermedades del ser humano se dividen en:
1) enfermedades monognicas o mendelianas (nucleares y
mitocondriales); 2) enfermedades exgenas, adquiridas o
ambientales, y 3) enfermedades multifactoriales de origen
complejo.

Enfermedades monognicas
Enfermedades nucleares
Enfermedades hereditarias causadas por la mutacin o alteracin de un solo gen (o locus). Tambin se les conocen
como enfermedades mendelianas, ya que se transmiten en
la descendencia segn las leyes de Mendel. Se conocen ms
de 6 000 enfermedades hereditarias monognicas, con una
prevalencia de un caso por cada 200 nacimientos. Si el alelo
anormal aparece en ambos cromosomas homlogos, el
individuo es homocigoto para dicha alteracin, mientras
que si lo hace en uno solo de los alelos cromosmicos se
denomina heterocigoto para la mutacin.
Para su inclusin en este grupo, la enfermedad ha de
cumplir las siguientes caractersticas:

Debe estar determinada genticamente; es decir, deberse a mutaciones que alteran la secuencia o la organizacin del genoma codicante.
Debe afectar a molculas en cantidad, estructura, actividad o funcin. En especial, se alteran las protenas, en
cantidad o en actividad.
La alteracin bioqumica que afecta a estructuras celulares o vas metablicas y causa la enfermedad debe ser
el resultado de las alteraciones en las molculas.

Las alteraciones monognicas generan mltiples enfermedades; entre las ms conocidas se encuentran: albinismo, anemia falciforme, daltonismo, distroa muscular de
Duchenne, hemolias o hipercolesterolemia familiar, entre
otras. Para obtener una mayor informacin acerca de estos
temas se puede acceder por va electrnica a la base de
datos del OMIM (Online Mendelian Inheritence of Man;
http://www.ncbi.nlm.nih.gov/omim). Esta base de datos de
consulta en lnea es un catlogo actualizado de genes humanos y alteraciones genticas. El OMIM se centra principalmente en las enfermedades genticas heredables.
Algunos ejemplos de enfermedades monognicas
comunes son: anemia falciforme, brosis qustica, enfermedad de Batten, enfermedad de Huntington (cromosoma 4),
enfermedad de Marfan, hemocromatosis, deciencia de
alfa-1 antitripsina, distroa muscular de Duchenne, sndrome de cromosoma X frgil, hemolia A y fenilcetonuria.
Cada enfermedad y gen tienen asignados un cdigo de seis
dgitos. A este nmero se le denomina cdigo MIM (herencia mendeliana en el hombre, por sus siglas en ingls), en el
cual se concentran las alteraciones genticas heredadas y
no heredadas. Adems, es una base de datos referente al
proyecto del genoma humano. A esta informacin se accede mediante el OMIM, que se actualiza a diario. Debido a
los avances cientcos que inducen un constante reordenamiento de las diferentes enfermedades genticas es ms
aconsejable basarse en la versin on line que en la impresa.
Las enfermedades monognicas (cuadro 19-1) se transmiten segn los patrones hereditarios mendelianos y pueden clasicarse como:

www.fullengineeringbook.net

CAPTULO 19 Bases moleculares de las patologas humanas

Enfermedad autosmica dominante. Slo se necesita un


alelo mutado del gen para que la persona manieste una
enfermedad autosmica dominante. Por lo menos uno de
los dos progenitores de una persona afectada padece la
enfermedad y este progenitor tiene 50% de probabilidad de
transmitir el gen mutado a su descendencia, que manifestar la enfermedad (gura 19-1A).
Enfermedad autosmica recesiva. Para que la enfermedad se manieste, se requiere que los dos alelos del gen se
encuentren mutados en la persona afectada, cuyos padres
en general no padecen la enfermedad, pero portan cada uno
al menos una copia del gen mutado, por lo que pueden
transmitirlo a la descendencia. La probabilidad de tener un
hijo afectado por una enfermedad autosmica recesiva
entre dos personas portadoras de una sola copia del gen
mutado (que no maniestan la enfermedad) es de 25%
(gura 19-1B). Una de las enfermedades genticas ms
comunes e importantes de tipo autosmica recesiva son las
hemoglobinopatas, como por ejemplo la anemia falciforme, tambin llamada anemia drepanoctica o enfermedad de
la hemoglobina SS (Hb SS). Esta afeccin es el resultado
de la sustitucin de adenina por timina en el gen de la globina beta, lo que conduce a una mutacin de cido glutmico por valina en la posicin 6 de la cadena polipeptdica de
globina beta y a la produccin de una hemoglobina funcionalmente defectuosa, la hemoglobina S. Debido al cambio
de ese aminocido, las molculas de hemoglobina se agregan formando bras y dndole al hemate su caracterstica
forma de hoz. Aunque esta enfermedad est presente al
nacer, generalmente los sntomas no ocurren hasta despus
de los cuatro meses de edad. Esta anemia puede volverse
potencialmente mortal y los pacientes pueden presentar
crisis o episodios dolorosos y agudos causados por vasos
sanguneos bloqueados y rganos daados. Se conocen
varios tipos de crisis: crisis hemoltica (cuando se daan los
glbulos rojos), crisis de secuestro esplnico (cuando el bazo
se agranda y atrapa clulas sanguneas) y crisis aplsica
(cuando una infeccin hace que la mdula sea deje de producir glbulos rojos). Estas crisis dolorosas, que ocurren en
casi todos los pacientes en algn momento de sus vidas,
pueden durar de horas a das y afectar los huesos de la
espalda, los huesos largos y el trax. Algunos pacientes presentan un episodio con intervalos de unos cuantos aos,
mientras que otros, muchos episodios por ao. Estas crisis
pueden ser tan graves que requieren hospitalizacin para el
control del dolor. Adems, las crisis repetitivas pueden ocasionar daos a los riones, los pulmones, los huesos, el
hgado y el sistema nervioso central (gura 19-1).
Enfermedad ligada al cromosoma X. Se maniesta en
las mujeres con una mutacin en, por lo menos, uno de los
alelos de un gen presente en el cromosoma X, mientras en
los hombres se maniesta en aquellos que presentan el alelo
mutado en el nico cromosoma X que portan. Tanto los
hijos como las hijas de una madre afectada en uno de sus
alelos tienen 50% de probabilidades de estar afectados, aun-

185

A. Patrn de herencia autosmica dominante


Padre
afectado

Madre
no afectada
Gen mutado
Gen normal

50%
Hijos afectados

50%
Hijos no afectados

B. Patrn de herencia autosmica recesiva


Padre
portador

Madre
portadora
Gen mutado
Gen normal

www.fullengineeringbook.net
25%
Hijos
no afectados

50%
Hijos portadores
no afectados

25%
Hijos
afectados

Figura 19-1. Patrn de herencia autosmica dominante A) y recesiva


B). Los rasgos autosmicos se asocian con un nico gen en
un autosoma (cromosoma no sexual). Se le llama dominante
porque un solo ejemplar heredado de cualquiera de los padres
es suciente para causar la aparicin de este rasgo. El carcter
autosmico recesivo es un patrn de herencia de un rasgo, enfermedad o trastorno que se transmite a travs de las familias.
Para que un rasgo o enfermedad recesiva se manieste, dos
copias del gen (o los genes) responsable (s) de la aparicin de
ese rasgo o alteracin tienen que estar presentes en el genoma
del individuo.

que la manifestacin de la enfermedad es generalmente


ms leve en mujeres que en varones, por la compensacin
que realiza el alelo no-mutado en las mujeres (gura 19-2).
Los varones afectados slo transmiten la enfermedad a
sus hijas y sus hijos nacern sanos. Estas enfermedades pueden transmitirse a su vez de forma dominante (gura 19-2A)
o recesiva (gura 19-2B). En el cuadro 19-2 pueden observarse algunos ejemplos de estos tres tipos de enfermedades.

186

PARTE III Bases moleculares de las enfermedades

A. Patrn de herencia dominante ligado al cromosoma X

Padre
afectado

Madre
no afectada

Padre
no afectado

X Y

X X

X Y

X X

X X

100% Hijas afectadas

Y X

100% Hijos no afectados

Madre
afectada

X X

X X

X X

50% Hijas
no afectadas

50% Hijas
afectadas

Y X

Y X

50% Hijos
no afectados

50% Hijos
afectados

B. Patrn de herencia recesivo ligado al cromosoma X

www.fullengineeringbook.net
Padre
afectado

Madre
no portadora

Padre
no afectado

Madre
portadora

X Y

X X

X Y

X X

X X

X X

100% Hijas
portadoras no afectadas

Y X

100% Hijos
no afectados

X X

50% Hijas
no portadoras

X X

50% Hijas
portadoras

Y X

50% Hijos
no afectados

Y X

50% Hijos
afectados

Figura 19-2. Patrn de herencia autosmica dominante A) y recesiva B) ligada al cromosoma X. Los genes ligados al cromosoma X se encuentran en el cromosoma sexual X y, tal como los genes autosmicos, tienen tipos recesivos y dominantes. Las alteraciones recesivas
ligadas al cromosoma X raramente se ven en mujeres y usualmente afectan nicamente a hombres. Esto se debe a que los hombres heredan su cromosoma X (y todos los genes ligados a X) de su madre. Los padres nicamente pasan su cromosoma Y a sus
hijos varones, as que ningn rasgo ligado a X es pasado de padre a hijo. Las mujeres expresan alteraciones ligadas a X cuando
son homocigotas para el mismo y se convierten en portadoras cuando son heterocigotas

CAPTULO 19 Bases moleculares de las patologas humanas

187

Cuadro 19-1. Enfermedades monognicas asociadas al brazo largo del cromosoma 21 humano.
Enfermedad

OMIM

Gen

Herencia

Alzheimer familiar (a)

104300

APP(Y00264)

AD

Esclerosis lateral amiotrca

105400

SOD1(X02317)

AD

Sndrome poliglandular autoinmune de tipo

240300

AIRE(Z97990)

AR

Homodistinuria

236200

CBS(L00972)

AR

Epilepsia mioclnica progresiva de Unverricht y Lindborg

254800

CSTB

AR

Trastorno hereditario de las plaquetas asociado a predisposicin a sufrir


leucemia mielognica aguda

151385

RUNX1(AML1)

AD

Sndrome de deciencia de adhesin leucocitaria

116920

ITGB2

AR

Sordera no sindrmica recesiva 8 (DFNB8)

601072

TMPRSS3

AR

Sordera no sindrmica recesiva 10 (DFNB10)

605316

TMPRSS3

AR

Sordera no sindrmica recesiva 29 (DFNB29)

605608

CLDN14

AR

Sndrome de Usher tipo 1E

602097

AR

Sndrome de Knoblock

267750

COL18A1

AR

Holoprosencefalia tipo 1

236100

AR

Deciencia mltiple de las carboxilasas

253270

HLCS

AR

Sndrome de Jervell y Large-Nielsen (b)

220400

KCNE1

AR

Cataratas congnitas de herencia autosmica dominante

123580

CRYA1

AD

Miopata de Bethlem (C)

158810

COL6A1, COL6A2

AD

Sndrome de Longo QT6

603796

KCNE2

AR

Micobacteriosis familiar atpica (d)

209950

IFNGR2

AR

Anemia hemoflica por deciencia en fosfofructuocinasa

171860

AR

www.fullengineeringbook.net
Deciencia de enterocinas

226200

PRSS7

AR

Se indica el nmero de OMIM, el gen responsable y el tipo de herencia que presenta (AD, autosmica dominante; AR, autosmica recesiva). (a) La mayora de casos de
enfermedad de Alzheimer son espordicos y no presentan un patrn de herencia mendeliano. (b) Mutaciones en el gen KVLQT1, localizado en 11q15.5, tambin producen el
sndrome de Jervell y Large-Nielssen. (c) Mutaciones en el gen COL6A3, localizado en 2q37, tambin producen miopata de Betlem. (d) Mutaciones en los genes INFGR1,
localizado en 6q23-q24, y IL12RB1, localizado en 5q31-q33, tambin producen micobacteriosis familiar atpica. (e) Mutacin autosmica dominante en clula somtica.

Enfermedades mitocondriales
Estas enfermedades son inducidas por la prdida o disminucin de la funcin mitocondrial de las clulas afectadas.
Cuando ciertos intermediarios metablicos no funcionan
de forma adecuada, hay una crisis energtica, lo que puede
interrumpir algunas reacciones qumicas importantes para
la supervivencia celular. La herencia mitocondrial es una de
las excepciones a los principios de transmisin mendeliana
de las enfermedades monognicas, ya que su herencia es
exclusivamente por lnea materna y se ven afectadas por la
heterogeneidad gentica o heteroplasmia. Algunos ejemplos de estas enfermedades son:
Sndrome de MELAS. Tambin se denomina encefalomiopata mitocondrial o acidosis lctica. Es un trastorno
asociado con una mutacin A-G en el ARNt, en la posicin
3243 en 80% de los casos descritos, aunque se han noticado otras mutaciones. Los sntomas, adems de la triada
caracterstica, pueden incluir migraa, vmitos, demencia,
epilepsia, sordera, ataxia, retinosis pigmentaria, cardiomiopata, disfuncin tubular renal proximal y miopata.
Sndrome de MERRF. El sndrome de epilepsia mioclnica asociada a bras rojas rasgadas (myoclonic epilepsy

with ragged red bers) es una enfermedad que cursa principalmente con mioclonas y epilepsia. Est causado por
varias mutaciones, pero cada una de ellas, de forma independiente, conlleva el desarrollo de la enfermedad. Entre 80
y 90% de los casos se da la mutacin A8344G (hay una transicin de adenina a guanina en la posicin 8344 del gen). El
sndrome de MERRF es una de las enfermedades con una
mayor variabilidad en la expresin de su sintomatologa,
incluso dentro de una misma familia de afectados. El cuadro clnico de esta enfermedad suele comenzar durante la
infancia o la adolescencia y puede incluir epilepsia mioclnica progresiva, degeneracin neuronal progresiva, atroa
cerebral y cerebelar visible con tcnicas de neuroimagen,
demencia, bras rojas rasgadas, que se observan en la biopsia del msculo, acidosis lctica, aumento de lactato en el
lquido cefalorraqudeo (LCR), etctera.
Sndrome de NARP. Es un trastorno neurodegenerativo y progresivo de inicio juvenil-adultez temprana. Est
incluido dentro de las alteraciones de la fosforilacin oxidativa. Los pacientes presentan debilidad muscular proximal,
con neuropata sensorial, ataxia y retinitis pigmentaria. La
forma de inicio infantil, MILS (sndrome de Leigh de herencia materna) se caracteriza por una encefalopata asociada a

188

PARTE III Bases moleculares de las enfermedades

Cuadro 19-2. Diagnstico de enfermedades monognicas.


Enfermedad

OMIM

Autosmicas recesivas

Fibrosis qustica
Atroa muscular espinal (tipo 1 o de Werding-Hoffmann)
Talasemia
Anemia falciforme
Incompatibilidad factor Rhesus D

219700
253300
141900
603903 (*141900)
*111680

Autosmicas dominantes

Distroa miotnica o enfermedad de Steinert


Huntington
Enfermedad de Charcot-Marie-Tooth
Enfermedad AD rin poliqustico

160900 (*605377)
*143100
118220 (*159440)
600666

Ligadas al cromosoma X

Sndrome de Marfan (MFS)


Sndrome de X frgil
Distroa miottica de Duchenne (DMD)
y DM Becker (DMB)
Hemolia A

154700 (1*34797)
309550
310200
306900

El diagnstico de estas enfermedades en el genoma es un proceso largo y complicado que puede acortarse signicativamente gracias a la tcnica de reaccin en cadena de la
polimerasa (PCR). Cada uno de los genes de inters se puede amplicar con cebadores especcos para, posteriormente, secuenciarlos y detectar la existencia de mutaciones.
El diagnstico gentico preimplantacional (DGP) es el estudio del ADN en embriones humanos, con el propsito de detectar aquellos que portan algn defecto congnito. En
este mtodo a partir de la blasmera se extrae el ADN hasta de una sola clula, y la secuencia que se pretende estudiar es amplicada por PCR con los cebadores especcos.
Es fundamental tomar las precauciones necesarias para amplicar el material de una nica clula (dos alelos, una copia cada uno) sin contaminacin de otros tipos celulares.

lesin bilateral y simtrica de ganglios basales. El gen MTATP6 es el nico asociado a NARP. Ms 50% de los individuos afectados presentan una mutacin en el nucletido
8993 de este gen (T8993G).
Neuropata ptica hereditaria de Leber (NOHL) o atroa ptica de Leber. Es una degeneracin de los gangliocitos
de la retina y sus axones que conlleva una prdida aguda o
subaguda de visin central. En la fase aguda, que dura algunas semanas, el ojo afectado muestra una apariencia edematosa de la capa de bras nerviosas y microangiopata, y
afecta sobre todo a hombres adultos jvenes. La NOHL se
debe habitualmente a una de tres posibles mutaciones puntuales en el ADN mitocondrial. Estas mutaciones afectan a
los nucletidos de las posiciones 11.778, 3.460 y 14.484, respectivamente, en los genes de las subunidades ND4, ND1 y
ND6, del complejo I de la cadena de transporte de electrones en las mitocondrias.

productor de la faringitis purulenta y en ocasiones de la


ebre reumtica y escarlata).
Priones: protenas que producen degeneracin del
sistema nervioso central (inducen la enfermedad de
Creutzfeld-Jacob ECJ en humanos, encefalopata
espongiforme bovina o enfermedad de las vacas locas en
reses y scrapie en ovejas). Hay tres clases principales de
la enfermedad de ECJ: puede ser adquirida a travs
del consumo de partes de animales infectados, sobre
todo tejidos nerviosos, pero tambin puede ser espordica o hereditaria.
b) Enfermedades nutricionales. Alcoholismo, anemia
ferropnica, deciencia de cido flico y vitaminas.
c) Enfermedades ambientales. Se subdividen en:
Fsicas: traumatismos o accidentes.
Qumicas: intoxicacin por medicamentos o xenobiticos, envenenamiento por gases txicos (monxido
de carbono), quemaduras por componentes qumicos
(cidos, lcalis, lquidos amables).
Varios de los ejemplos anteriores son condicionados
o exacerbados por factores como el rea geogrca, el clima, la urbanizacin o las polticas sociales, que aumentan la vulnerabilidad humana a padecer enfermedades de
tipo exgeno. Como ejemplo de estos factores cabe mencionar el aumento de la temperatura en las tierras altas,
las guerras y el calentamiento global.

www.fullengineeringbook.net

Enfermedades exgenas,
adquiridas o ambientales
El origen de estas enfermedades no est determinado genticamente y son producto de la interaccin del individuo
con agentes externos. Segn su origen, se clasican en:
a) Enfermedades biolgicas. Ocasionadas por agentes
microbiolgicos, como parsitos, bacterias, hongos, virus
o priones. Algunos de los ejemplos ms representativos
de estas enfermedades son:
Virus: virus de inmunodeciencia humana (agente
causal del sida), virus de papiloma humano (asociado al
cncer cervicouterino), virus herpes zster (principal
agente de varicela).
Bacterias: Staphylococcus aureus (agente causal de
sndrome sptico), Streptococcus pyogenes (el grupo A,

Enfermedades multifactoriales
o de origen complejo
A diferencia de las enfermedades monognicas, la manifestacin clnica de enfermedades multifactoriales es un reejo del efecto combinado o interaccin acumulativa de
alteraciones producidas por factores genticos (mutaciones
mltiples, a veces simultneas, en un nmero impreciso de

CAPTULO 19 Bases moleculares de las patologas humanas

genes) y factores ambientales o exgenos (efecto nutricional, agentes txicos, estrs oxidativo, factores psicolgicos,
etctera).
En cualquier caso, la complejidad del origen diculta un
diagnstico preciso, lo que ha llevado a que una misma
enfermedad reciba distintos nombres. Como no se trata de
trastornos de un nico gen, la herencia de estas alteraciones
no sigue la gentica clsica mendeliana; a pesar de ello, son
ms comunes dentro de una familia que entre individuos no
emparentados. Para que el sndrome se presente en otro
miembro de la misma familia es necesario que se rena una
combinacin de cambios gnicos y medioambientales.
Entre estas enfermedades pueden citarse malformaciones
congnitas (labio leporino, cardiopatas congnitas, anencefalia, espina bda, malformaciones congnitas del sistema digestivo y respiratorio, etc.), que se maniestan desde
el nacimiento y pueden ser producidas por un trastorno
durante el desarrollo embrionario o el parto, o como consecuencia de un defecto hereditario. Las exposiciones a productos qumicos o radiaciones en el medio ambiente
pueden inducir resultados reproductivos adversos, como
reduccin en la fertilidad, abortos espontneos, bajo peso al
nacer, malformaciones y deciencias del desarrollo. Otra
categora son las enfermedades de la edad adulta (algunos tipos de cncer, enfermedades cardacas y presin arterial elevada, artrosis, artritis, Alzheimer, Parkinson, sordera,
ictus, demencia senil y diabetes mellitus); en todas estas
enfermedades se ha observado una predisposicin gentica. Las condiciones en las que se transcurre por la vida
adulta obedecen a diversos factores de ndole personal,
familiar y cultural. Entre los factores con un papel decisivo
en la incidencia de estas enfermedades se incluyen el consumo prolongado de ciertos medicamentos y drogas, el
tabaquismo, el consumo excesivo de alcohol, el sedentarismo, la nutricin inadecuada y dietas hipercalricas. Por
ejemplo, entre los principales factores ambientales que
incrementan el riesgo de presentar diabetes tipo 2 son la
nutricin excesiva y una forma de vida sedentaria, con el
consiguiente sobrepeso y obesidad. Un tratamiento completo de la diabetes no slo debe incluir la disminucin de
caloras consumidas y ejercicio f sico moderado y habitual,
sino tambin un control mdico constante. De igual manera, el nivel educativo, los ingresos, las funciones sociales y
las expectativas personales inuyen en la modicacin de
los hbitos de vida, que sern condicionantes del futuro
envejecimiento.

189

cin gentica son: historia clnica, examen f sico y exmenes


de laboratorio. A continuacin, se hace referencia a estos
ltimos exmenes, ya que complementan el diagnstico clnico. Los exmenes de laboratorio se pueden realizar para:

Rastreo de poblaciones en riesgo: cuando se tienen sospechas de que el producto puede ser portador de la
enfermedad por antecedentes familiares, se obtiene una
muestra de vellosidad corinica despus de la semana
10 de gestacin. sta es la forma ms comn de diagnstico prenatal en poblaciones de riesgo, como por
ejemplo en la enfermedad de Tay-Sacks en judos.
Rastreo familiar de portadores: se lleva a cabo para
determinar qu personas son portadoras del gen y, por
tanto, pueden transmitir la enfermedad a sus hijos. El
objetivo de estas pruebas es evitar que dos personas
portadoras tengan hijos entre ellos.
Programa de tamiz neonatal (screening): constituye una
prioridad dentro de la atencin en problemas de salud
pblica, ya que busca en una poblacin a los individuos
que presentan alguna caracterstica fuera de lo normal
o que haga sospechar de la presencia de una enfermedad, para su posterior tratamiento. Este mtodo se realiza a partir de gotas de sangre, lo que hace posible
determinar una amplia gama de molculas. Entre los
principales padecimientos que se detectan mediante
este procedimiento son:
Alteraciones endocrinas: hiperplasia adrenal congnita
e hipotiroidismo congnito, brosis qustica.
Alteraciones de las clulas de la sangre: anemia falciforme.
Errores innatos del metabolismo de los carbohidratos:
galactosemia.
Errores innatos del metabolismo de los aminocidos: fenilcetonuria, homocistinuria y enfermedad de la orina
con olor a jarabe de maple o arce, trastornos del ciclo de la
urea, acidemias propinica, metilmalnica e isovalrica.
Errores innatos del metabolismo de los cidos orgnicos:
deciencia de la biotinidasa.
Trastornos de la carnitina y de la oxidacin de cidos
grasos: trastornos neuromusculares, cardiacos o muerte
sbita.
Problemas pulmonares y digestivos: brosis qustica.

www.fullengineeringbook.net

Rastreo y diagnsticos en
las afecciones genticas
Se debe sospechar una afeccin gentica cuando un nio
presente: bajo peso, un tamao pequeo para su edad gestacional, hipotona, malformaciones externas e internas, dismoras, dicultad para alimentarse, vmitos, somnolencia,
convulsiones, etc. Los pilares del diagnstico de una afec-

En Mxico, la Norma Ocial Mexicana NOM-007SSA2-1993 slo establece como obligatoria la prueba para
detectar el hipotiroidismo congnito (2011), afeccin causada por la disminucin de la produccin de la hormona
tiroidea en un recin nacido, que puede ocasionar retardo
mental severo y retraso en el crecimiento. Tambin la
Secretara de Salud promueve el tamiz auditivo, para detectar sordera congnita e hipoacusia (disminucin de la audicin). Como ya se ha mencionado el diagnstico prenatal
gentico se realiza mediante una biopsia de vellosidades
coriales (amniocentesis), prueba de la alfa-fetoprotena en
sangre materna (AFP), ecograf a, cordocentesis, determinacin de clulas fetales en sangre materna, fetoscopia, etc.,

190

PARTE III Bases moleculares de las enfermedades

para detectar enfermedades genticas del producto durante


el embarazo. En la actualidad, se dispone incluso de mtodos de diagnstico gentico preimplantacional (anlisis
diagnstico de una o ms clulas embrionarias), que conlleva la seleccin embrionaria para la implantacin de embriones no afectados.

Tratamiento y prevencin
de enfermedades genticas
La mayora de las enfermedades genticas no tienen tratamiento denitivo o curativo y, en general, stos son sintomticos. Una vez realizado el diagnstico (en el cuadro 19-2
se presentan algunas enfermedades que pueden detectarse
mediante la tcnica de reaccin en cadena de la polimerasa,
PCR) en forma pre o posnatal, existen medidas teraputicas
que mejoran la calidad de vida de los pacientes afectados.

Algunas enfermedades genticas son tratables mediante la aplicacin de medidas paliativas, como por ejemplo
dietas de eliminacin (fenilalanina en la fenilcetonuria),
suplementacin de cofactores (factor VIII de la coagulacin
en hemolia), reemplazo de enzimas (glucocerebrosidasa
en la enfermedad de Gaucher), trasplante de rganos
(mdula sea en la talasemia) y medidas quirrgicas tales
como correccin (labio leporino). Tambin es posible realizar terapia preventiva de enfermedad gentica, como es el
caso de la escisin quirrgica del colon (colectoma) en la
poliposis familiar. Para que una enfermedad gentica pueda
tratarse mediante terapia gnica somtica se requiere conocer el gen defectuoso que la produce y habitualmente se
requiere contar con un modelo celular in vitro o modelo
animal de la afeccin. El tratamiento mediante terapia gnica de estas y otras enfermedades se describir con ms
detalle en otro captulo de este libro.

Ejercicios de integracin
1. Desde un punto de vista molecular, qu es una enfermedad de origen gentico?
2. Mencione las dos principales caractersticas de las enfermedades monognicas o mendelianas.
3. Para que una enfermedad autosmica se manieste, se
requiere que los dos alelos del gen se encuentren mutados en la persona afectada?
4. Caso clnico. Describa a qu enfermedad se reeren las
siguientes caractersticas: nia de 5 aos que consult
por ebre de 4 das. En la exploracin fsica destacaban
palidez cutnea y mucosa, subictericia y esplenomegalia.
En la analtica sangunea destacaban: Hb de 79 g/L, he-

matocrito de 27%, volumen corpuscular medio de 93.4


y reticulocitos de 3%. En el frotis de sangre perifrica
destacaban anisocitosis y policromasia. La prueba de
estabilidad trmica fue positiva. La electroforesis mostr
una banda difusa entre HbA2 y HbA. La cromatografa
lquida de alta resolucin (HPLC) mostr una Hb no identicada, que corresponda a 12% del total. El estudio molecular demostr la mutacin CD92 His * Pro, en estado
heterocigoto, patrn que se repiti en la madre. Su expresividad clnica se agudiza tras la ingesta de frmacos
oxidantes o infecciones. La HPLC permiti el diagnstico
diferencial entre los diferentes tipos de Hb.

www.fullengineeringbook.net

Bibliografa
Ma Pereira M.M., Coll Sibina M.T., Garca Mateos E., Vives
Corrons J.L. Hemoglobinopathy Newcastle: use of chroma-

Merson M.H. The HIV-AIDS pandemic at 25-the global response. N

tography and rst case reported in Spain. Med Clin (Barc),


2008;130(12):455-458.
Negredo C., Monks E. A novel real-time ultrasonic method for prion
protein detection using plasminogen as a capture molecule.
BMC Biotechnol, 2007;7:43.
Jameson L., Kopp P. Genetics and Disease. En: Kasper D, Harrison
T. Harrisons Principles of Internal Medicine, 16 ed. Nueva York:
McGraw-Hill, 2005:365-409.
Luque J, Herrez A. Texto ilustrado de biologa molecular e ingeniera gentica. Conceptos, tcnicas y aplicaciones en ciencias de la
salud, 1 ed. Madrid: Harcourt, 2001:78.
Hamosh A., Scott A.F. Online Mendelian Inheritance in Man
(OMIM), a knowledgebase of human genes and genetic disorders. Nucleic Acids Res, 2005;33:514-517.

Moreno R., Aspillaga M. Frecuencia y caractersticas de la mor-

Engl J Med, 2006;23:2414-2417.


bilidad gentica en un hospital peditrico. Rev Chil Ped,
1991;62:112-117.
McKusick-Nathans Institute of Genetic Medicine, Johns-Hopkins
University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda,
MD), Online Mendelian Inheritance in Man, OMIM (TM).

18/09/2007. Disponible en: http://www.ncbi.nlm.nih.gov/omim.


Scriver C., Beaudet A. The metabolic and molecular bases of inheri-

ted disease, Vol 3, 8 ed. Nueva York: McGraw-Hill, 2001:34213452.

Captulo

20

Enfermedades monognicas
Silvia Mora Lee / Paola B. Castro Garca

Introduccin

50% estarn afectados, dado que reciben el alelo de la enfermedad de su madre.


Ciertas enfermedades importantes estn causadas por
genes recesivos ligados al cromosoma X, como por ejemplo
la hemolia y la enfermedad de Duchenne.

Las enfermedades monognicas tambin se conocen como


enfermedades hereditarias mendelianas. Se producen por
alteracin de un solo gen, de ah su nombre. Alrededor de
1% de los nios nacidos vivos presentan alguna de estas
enfermedades, de las que se conocen ms de 6 mil.
Las enfermedades monognicas pueden clasicarse
segn el patrn hereditario que presentan. Cuando la madre
es portadora y el padre no presenta la mutacin (cuadro
20-1), para cada uno de sus descendientes hay 50% de probabilidades de que si es varn presente la enfermedad y 50%
de que si es mujer sea portadora del gen.

Cuadro 20-2. Hombre afectado emparejado con mujer normal:


Xh/Y XH/XH

www.fullengineeringbook.net
XH

XH

Xh

XH/Xh

XH/Xh

Hijas: todas son


portadoras

XH/Y

XH/Y

Hijos: ninguno
est afectado

Cuadro 20-1. Hombre normal emparejado con mujer portadora:


XH/Y XH/Xh
XH

Hemolia

Yh

XH

XH/XH

XH/Xh

Hijas:
normales
portadoras

50%
50%

XH/Y

Xh/Y

Hijos:
normales
portadores

50%
50%

La hemolia es una coagulopata crnica, congnita, hereditaria ligada al cromosoma X, por lo que los varones la
padecen y las mujeres son portadoras. Esta enfermedad se
caracteriza por la presencia de hemorragias tanto internas
como externas debido a la deciencia funcional cuantitativa
de algn factor de coagulacin.

En el caso de que el padre est afectado y la madre no


(cuadro 20-2), dado que el padre slo puede transmitir el
cromosoma Y, todos los hijos nacern sanos; sin embargo,
todas las hijas sern portadoras de la enfermedad, ya que
recibirn el cromosoma X paterno.
Cuando el padre est afectado y la madre sea portadora
(cuadro 20-3), 50% de las hijas sern portadoras heterocigotas, mientras que el otro 50% sern homocigotas, por lo que
estarn afectadas; 50% de los hijos nacern sanos y el otro

Cuadro 20-3. Hombre afectado emparejado con mujer


portadora: Xh/Y XH/Xh

191

XH

Xh

Xh

XH/Xh

Xh/Xh

Hijas:
portadoras,
afectadas

50%
50%

XH/Y

Xh/Y

Hijos:
normales,
afectados

50%
50%

192

PARTE III Bases moleculares de las enfermedades

Los factores de coagulacin son un grupo de protenas


responsables de activar el proceso de coagulacin. Se han
identicado 13 factores (I, II, XIII). Los factores de coagulacin actan en cascada, es decir, uno activa al siguiente.
Cuando hay carencia o dcit de algn factor de coagulacin, la sangre tarda ms tiempo en formar el cogulo y,
aunque llegue a formarse, ste no es consistente y no se
detiene la hemorragia.

Antecedentes histricos de la hemolia


Los primeros datos histricos que se conservan sobre la
hemolia datan del siglo II a. C., cuando los rabinos Rabbi
Judah y Rabbi Simon ben Gameliet observaron que algunos
nios sangraban demasiado al practicarles la circuncisin;
por ello, aplicaron diversas normativas en su obra judaica,
conocida como el Talmud, y declararon que un nio que
tuviese hermanos mayores con problemas de sangrado no
tena que ser circuncidado, ni tampoco los nios cuyos primos (hijos de las hermanas de su madre) se hubiesen desangrado.
En 1803, el mdico estadounidense John Conrad Otto
demostr que la enfermedad estaba ligada al cromosoma X,
que sta quedaba limitada a los varones y que las mujeres
eran nicamente portadoras. La reina Victoria portaba esta
enfermedad y la transmiti a gran parte de la realeza europea, entre ellos a su hijo Leopoldo, que muri a los 31 aos
de edad a causa de una hemorragia cerebral tras una cada.
El caso ms famoso de esta enfermedad es el zar de Rusia,
Alexis Nikolavevich Romano. La enfermedad le fue transmitida por su madre, Alexandra de Hasse, nieta de la reina
Victoria. Por ello, a esta enfermedad se la conoce como
enfermedad de reyes.
Esta afeccin se clasica segn la deciencia de la actividad del factor de coagulacin. Slo existen dos tipos de
hemolia heredada: la hemolia A, que se caracteriza por la
deciencia del factor XIII de coagulacin, y la hemolia B,
que afecta al factor IX. Tanto el factor XIII como el IX se
encuentran slo en el cromosoma X. Segn el nivel de factores de coagulacin en la sangre se han diferenciado tres
niveles de gravedad de la hemolia: grave, moderada y leve
(cuadro 20-4).
Cuanto ms grave es el nivel de hemolia, ms hemorragias se presentan. El nivel de actividad de los factores de
coagulacin depende del tipo de mutacin; as, las mutaciones
que dan lugar a cambios muy pequeos como mutaciones puntuales, pequeas deleciones o inserciones, todas
ellas de tipo missense (aparicin de un codn correspon-

diente a un aminocido distinto), generan una protena con


mayor funcionalidad (encontradas en pacientes con hemolia moderada o leve), que las que tienen lugar en los
pacientes que han sufrido grandes mutaciones, como inversiones o translocaciones, o las anteriormente mencionadas
de tipo nonsense (aparicin de un codn de parada que produce la interrupcin temprana de la sntesis del factor VIII),
que producirn una hemolia A grave. Aunque, en general,
se da este patrn, cabe destacar que se han dado casos en
los que una misma mutacin puntual en diferentes pacientes da lugar a distintos niveles de hemolia. Se postula que
esto podra deberse a otras mutaciones no detectadas.

Hemolia grave
Las personas con hemolia generalmente se diagnostican
durante el primer ao de vida, y sin el tratamiento prolctico correcto presentan hemorragias internas frecuentes,
aproximadamente una o dos a la semana, en su mayora en
los msculos o las articulaciones.

Hemolia moderada
Las personas con hemolia moderada, rara vez presentan
sangrado espontneo; sin embargo, s tienen hemorragias
prolongadas despus de un traumatismo relativamente
menor y en general se diagnostican antes de los 5 o 6 aos.
La frecuencia de los episodios de sangrado vara de una vez
al mes a una al ao.

www.fullengineeringbook.net

Cuadro 20-4. Clasicacin de gravedad en hemolia

Hemolia leve
Las personas con hemolia leve no presentan sangrados
espontneos, pero s hemorragias anormales despus de
cirugas y extracciones dentales. La frecuencia de sangrado
puede variar desde una vez al ao a una vez cada 10 aos.
A menudo estos pacientes no se diagnostican hasta pasados
varios aos de vida.
En cualquier persona con hemolia, los episodios de sangrado suelen ser ms frecuentes en la infancia y la adolescencia que en la edad adulta. As, aproximadamente 10% de las
mujeres portadoras tienen riesgo de hemorragia y, por tanto,
son portadoras sintomticas, aunque los sntomas suelen ser
leves. Cerca de uno de cada 5 mil varones nace con este trastorno, que no puede contagiarse, ya que se trata de una enfermedad hereditaria que se transmite de padres a hijos y
sucesivas generaciones; no obstante, existen excepciones en
las que se producen mutaciones espontneas en individuos
sin antecedentes en el historial familiar. Se considera que
alrededor de 30% de los pacientes hemof licos presentan la
enfermedad presumiblemente por la adquisicin de una
mutacin de novo, sin antecedentes familiares conocidos.

Clasicacin

% de actividad del factor (VIII, IX)

Grave

Menor a 1

Hemolia A

Moderada

1a5

Leve

5 a 40

Esta enfermedad se caracteriza por la deciencia de la actividad del factor VIII, cuyo gen tiene 186 kb de longitud, y es

193

CAPTULO 20 Enfermedades monognicas

Telmero

22

23

Centrmero

F8

A
1

22

23

Telmero

Centrmero

A
F8

22

Telmero

23

Centrmero

F8

Regin invertida

Figura 20-1. Representacin de la mutacin por inversin que sufre el gen F8. En la parte superior se muestra la localizacin de los intrones
1, 22 y 23, as como la posicin de la secuencia repetitiva F8A en el gen F8. En la parte media se muestra el bucle que probablemente se genera alrededor del cromosoma X durante la inversin del intrn 22. Como consecuencia de homologa > 90% de los intrones 1 y 22 pueden ocurrir dos posibles inversiones, aunque la recombinacin con el intrn 1 se da con mucha menor frecuencia
probablemente debido a las limitaciones fsicas. En el panel 3 se representa el resultado obtenido con la inversin con el intrn 22.

www.fullengineeringbook.net

uno de los ms largos que se conocen. Contiene 26 exones


y 25 intrones y est localizado en la regin distal del brazo
largo del cromosoma X, en la banda Xq28. La mayora de
los exones son pequeos y tan slo unos pocos cientos
de nucletidos de longitud, a excepcin de los exones 14 y
16; el exn 14 tiene 3 kb de longitud. Este exn codica para
el dominio B de la protena FVIII. Este gen produce un
ARNm de 9 kb. Los intrones 1 y 22 son notablemente grandes y presentan repeticiones de secuencia, las cuales se presentan en otros lugares en el cromosoma X. Estas regiones
repetidas se encuentran envueltas en dos inversiones intracromosmicas. Despus del clonado del gen del FVIII,
numerosos estudios detectaron mutaciones causales de la
hemolia A grave, moderada o leve, incluyendo casi todo
tipo de mutaciones. Las inversiones en este gen representan
aproximadamente 45% de las mutaciones en el FVIII causantes de hemolia A grave. Se trata de una disrupcin del
gen ocasionada por una inversin que separa los exones
1-22 de los 23-26 (aproximadamente 500 kb). Esta inversin
es el resultado de una recombinacin homloga intracromosmica que se debe a la presencia de las secuencias repetidas mencionadas anteriormente denominadas F8A. Dos
de estas secuencias F8A se encuentran presentes en el brazo q del cromosoma X situado upstream (corriente arriba)
del gen del factor VIII y otra dentro del intrn 22 del gen.
Esto hace que puedan producirse dos tipos de inversin:
proximal o distal, segn con cul de las dos repeticiones

situadas corriente arriba recombine, aunque ambas tendrn


un fenotipo de hemolia grave, ya que esta divisin impedir generar una protena funcional. Entre ambas variantes se
ha estimado que aproximadamente 80% corresponde a la
inversin distal y 20% a la proximal (gura 20-1).
La protena madura del factor VIII de coagulacin tiene
2332 residuos de aminocidos, con un peso molecular de
265000 daltons, y se expresa con un pptido seal de 19 aminocidos. La protena tiene dominios de estructura repetitivos A y C, adems de un nico dominio largo B (gura 20-2).
El factor VIII se sintetiza principalmente en el hgado y su
concentracin en el plasma es inferior a 0.1 mg/ml. En la
circulacin, el factor VIII se estabiliza al unirse al factor de von

Factor VIII
NH2

COOH

Factor V
NH2

Dominio B

A
3

COOH

Figura 20-2. Esquema del gen del factor VIII. El factor VIII tiene una
estructura de dominios repetidos A y C ms un dominio nico
largo denominado B. Muestra una similitud de 35% en el gen
del factor V.

194

PARTE III Bases moleculares de las enfermedades

Activacin
XII
XIIa
FVW

XI

XIa

Hemofilia B

IXa

VIIIa

Hemofilia A

X
Xa
Protrombina
(II)

Trombina
(II)

Figura 20-3. Va intrnseca de coagulacin. En el esquema de la


cascada de coagulacin se indica con una cruz naranja el punto en el que se interrumpe la va en la hemolia A y con una
cruz roja donde se interrumpe con la hemolia B. Los defectos
ya sean en F8 o F9 dan como resultado los mismos sntomas,
esto es, se trunca la formacin del cogulo.

Willebrand (FVW). Una vez activados por pequeas cantidades de trombina, es liberado del FVW, se une a fosfolpidos de
membrana, interacta con el factor IXa y activa el factor X
durante la va intrnseca de la coagulacin (gura 20-3).

lugar a la regin EGF-1; el exn 5, a la regin EGF-2; el exn


6 codica para el pptido de activacin, y nalmente, los
exones 7 y 8 corresponden al dominio proteasa o cataltico.
El producto del gen F9 es una proteasa de serina que se
activa tras sufrir protelisis especca por el complejo
FVIIa-FT. Una vez activado, puede formar el complejo de
activacin de FX mediante la unin a FVIIIa, fosfolpidos
de supercie y calcio. Modicaciones postraduccionales,
como la glucosilacin, la sulfatacin, la fosforilacin, la
hidroxilacin y la carboxilacin, convierten los primeros 12
residuos en cido g-carboxiglutmico (Gla). El dominio Gla
se une a iones calcio y adopta una conformacin capaz de
unirse a una supercie de fosfolpidos durante la cascada
de coagulacin. Los dominios EGF-1 y EGF-2 se denominan as porque presentan una gran homologa con los del
factor de crecimiento epidrmico (epidermal growth factor,
EGF). Ambos estn situados en tndem y comprenden los
residuos 48 a 127. Se encuentran dominios similares en
otras sern proteasas, como el FX y FXII. En EGF-1 se
encuentra una regin de alta anidad por el Ca2, al igual que
en el dominio Gla. El dominio contiguo es el pptido de
activacin, que es el dominio menos conservado entre las
sern-proteasas; consta de 35 aminocidos comprendidos
entre los residuos Arg145 y Arg180, sobre los cuales acta
el FXIa. Sin embargo, slo el corte proteoltico en Arg180
da lugar a la actividad cataltica del FIXa. El dominio proteasa o cataltico del FIX corresponde al de una tpica sernproteasa; es el dominio ms grande y se extiende desde el
residuo 181 al 415 (gura 20-4).

www.fullengineeringbook.net

Hemolia B

Esta enfermedad se caracteriza por deciencia en la actividad del factor IX de la coagulacin. Aproximadamente 10%
de las mujeres portadoras tienen una actividad siolgica
inferior a 30%, con independencia de la gravedad de la
hemolia B. El gen F9 es ms pequeo que F8 y slo consta
de 34 kb de longitud, y de 8 exones y 7 intrones. Se encuentra situado en la regin telomrica del brazo largo del cromosoma X, en la banda Xq27. En esta misma regin, en
posicin distal, se encuentra el locus correspondiente al
gen de FVIII. El tamao de los exones vara entre los 25
nucletidos del exn 3 y los 1 935 nucletidos del exn 8. La
longitud de los intrones tambin presenta una gran heterogeneidad, y son de tan slo 188 nucletidos en el intrn 2 y
de 9473 nucletidos en el 6. Los 8 exones dan lugar a los
dominios funcionales y prcticamente cada exn codica
para un dominio. As, el exn 1 corresponde al pptido
seal; el exn 2, al propptido y a la regin Gla, el exn 3
codica para la regin rica en aminocidos aromticos que
hace de puente entre los dominios adyacentes; el exn 4 da

p
r
e

p
r
o

GLA

EGF

EGF

Sern-proteasa

Figura 20-4. Esquema del factor IX de la coagulacin. Se muestran


los dominios que conforman el factor IX.

Arg

Lys

Lys

Thr

Gln

TGC CGA

AAA

AAA

ACG

CAG

Try

Arg

Lys

Lys

Thr

Gln

TAC CGA

AAA

AAA

ACG

CAG

Cys

Cys

Stop

TGC TGA

Normal

Sentido
equivocado

Sin sentido
AAA

AAA

ACG

CAG

Figura 20-5. Mutaciones comunes en hemolia. La mayora de los


pacientes de hemolia tanto A como B tienen mutaciones de
sentido equivocado o sin sentido, que pueden presentarse en
cualquier posicin del F8 o F9. La gravedad de la enfermedad
depender de la localizacin y la funcin particular del aminocido afectado. Se muestra la secuencia nucleotdica normal y
la secuencia aminoacdica resultante de ella. Una sustitucin
del nucletido G>A remplaza Cys por Tyr. El panel inferior
muestra una sustitucin C>T, la cual remplaza una Arg por un
codn de paro. Las mutaciones sin sentido aparecen en ambas
hemolias y estn asociadas con hemolias graves.

CAPTULO 20 Enfermedades monognicas

195

Lmina Basal
cadena 2
Laminina 2
sarcoglicano

distroglicano
distroglicano

sarcolema
citoesqueleto
de actina

CYS

sarcolema
ONS
y de sintrofinas
COOH de sintrofina
distrobrevina
sincoilina

distrofina

Figura 20-7. Esquema de la posicin de la distrona y su relacin con


los miembros del complejo distrona-glicoprotena (DGC). La distrona
acta como un vnculo entre la lmina basal y la actina del
citoesqueleto que ayuda a mantener la integridad del sarcolema. La prdida de distrona compromete la DGC y conduce a
un sarcolema frgil.

www.fullengineeringbook.net
Figura 20-6. Afecciones en la hemartrosis. Las articulaciones
afectadas por la hemartrosis en la hemolia son sobre todo los
hombros, los codos, la cadera, la rodilla y los tobillos.

HE

10x

HE

10x

Figura 20-8. Morfologa en las bras musculares en distroa muscular de Duchenne. Inmunohistoqumica de cortes de tejido muscular de
ratn sano A) y ratn con modelo de DMD B), donde se muestra la aparicin de necrosis C).

196

PARTE III Bases moleculares de las enfermedades

GEN DE LA DISTROFIA
ADN
exones

ARNm
A

Enfermedad
de Duchenne

Enfermedad
de Becker

protena

Distrofina
truncada no
funcional

Distrofina
funcional

Distrofina
parcialmente
funcional

Figura 20-9. Alteracin del gen de la distrona. El gen de la distrona tiene mltiples exones. Debido a cambios en el marco de lectura
abierta se puede producir un ARNm incompleto que produce una protena truncada no funcional causante de la enfermedad de
Duchenne o a una protena parcialmente funcional que produce la enfermedad de Becker.

www.fullengineeringbook.net

Captulo

21

Bases moleculares del cncer


Carmen Magdalena Gurrola Daz

Introduccin

celular), as como a otro tipo de protenas, que son producto de los protooncogenes y los genes supresores de tumor
que, de igual forma, participan de forma orquestada en este
control, y cuyas funciones se revisarn a lo largo del captulo (gura 21-2).
Es evidente la complejidad e importancia del control del
ciclo celular, as como la participacin mltiple y paralela de
varios factores. Esto otorga el carcter multifactorial al
cncer y nalmente complica el restablecimiento de un
fenotipo normal en clulas malignas.

El cncer se caracteriza por ser una enfermedad multifactorial que afecta el crecimiento y la proliferacin normal de
las clulas, adems de producir alteraciones en el proceso
de diferenciacin celular, lo que condiciona la formacin de
un tumor en un tejido especco. Por ello, el trmino cncer
implica, adems de un descontrol en el crecimiento y la
proliferacin celular, una transformacin maligna, es decir,
una prdida de las caractersticas y funciones normales de
las clulas en un tejido. Estos procesos estn inuidos por
alteraciones genticas o epigenticas de numerosos genes
que codican protenas que regulan este proceso, contribuyendo a un fenotipo maligno. Asimismo, existen factores ambientales implicados en la tumorognesis con una
inuencia determinante en algunos tipos de cncer.
Para una mejor comprensin del control del ciclo celular, ste se puede esquematizar en forma analgica como un
reloj biolgico, el cual opera desde el ncleo de las clulas en
donde existen y/o convergen diversos estmulos que inhiben o inducen la progresin del ciclo celular (gura 21-1).
En las clulas eucariticas, el ciclo celular est compuesto
de las fases G1, S, G2 y M. Su regulacin es prioritaria y es
controlada por la participacin de diferentes protenas llamadas ciclinas y cinasas dependientes de ciclinas (cyclin dependent kinases, CDK). Ambas actan cooperativamente, en
donde las CDK fosforilan ciertas ciclinas en un momento
especco y permiten que la clula contine el ciclo celular.
Adems, es importante considerar que entre las fases mencionadas existen puntos de control (checkpoints) que involucran una maquinaria compleja de protenas que verica si en
la clula se dan las condiciones adecuadas o no para continuar con la fase siguiente del ciclo celular. Estos puntos controlan la progresin entre las fases G1/S, G2/M y M.
La regulacin del ciclo celular involucra a las ciclinas y
las cinasas dependientes de ciclinas (ver el captulo 2, Ciclo

www.fullengineeringbook.net
Protooncogenes, oncogenes y
genes supresores de tumores

De manera normal, las clulas responden a seales tanto


internas como externas que estimulan la proliferacin celular, lo que requiere de una regulacin en la que participan
diferentes protenas que estimulan el ciclo celular. Entre los
numerosos genes relacionados con la transformacin maligna de clulas se encuentran dos grandes grupos, clasicados
como oncogenes y genes supresores de tumores. Ambos
presentan como denominador comn su implicacin en la
proliferacin celular.

Oncogenes
En 1910, Peyton Rous, del Instituto Rockefeller y ganador
del Premio Nobel, experiment con sarcoma de pollo. Al
inyectar homogeinado de sarcoma libre de clulas en pollos
sanos se induca la misma clase de tumor, planteando la
incgnita de cul era el agente, molcula o factor responsable de la tumoracin.
En las dcadas siguientes se descubri el agente etiolgico de este padecimiento: un retrovirus denominado
virus del sarcoma de Rous (Rous sarcoma virus, RSV). En
1970, se describe que uno de los genes del virus del sarcoma
197

198

PARTE III Bases moleculares de las enfermedades

Receptores del Factor de Crecimiento


transformante (TGF- )

Receptores de tirosina-cinasa
Estado nutricional

Receptores acoplados
a protenas G
Integrinas

Reloj biolgico

Factores transcripcionales

Citocinesis
G1

Ciclinas y CDKs

G0

G2
S

Figura 21-1. Estmulos del ciclo celular. Relacin analgica entre el ciclo celular y un reloj biolgico: su progresin depende de la
participacin de diversos estmulos.

www.fullengineeringbook.net

de Rous, el gen src, tiene la capacidad de transformar clulas


normales en fenotipos malignos. El estudio de este gen en
experimentos de hibridacin in situ realizados por
J. Michael Bishop y Harold E. Varmus, en la Universidad de
California en San Francisco (1976), mostraron que clulas
normales de pollo contenan algunos elementos del gen src,
lo que dio lugar a la siguiente controversia: cmo es posible
que genes que se encuentran en el virus oncognico (RSV)
tambin lo hagan en clulas eucariotas normales? Estudios
posteriores demostraron que versiones similares de genes
virales oncognicos se encuentran en clulas normales y
participan en el proceso de proliferacin celular. De hecho,
el gen src pertenece a una familia cinasas de tirosina que
participa en la regulacin del desarrollo embrionario y crecimiento celular. Estos genes se denominaron protooncogenes, y con este antecedente histrico puede denirse a los
protooncogenes como genes que codican protenas que
regulan de manera normal y siolgica la cascada de eventos que sirven para mantener el control de la progresin del
ciclo celular y el estado normal de diferenciacin de la clula. Se les antepone el prejo c de celular para distinguirlos de las versiones virales, a las cuales se les antepone el
prejo v (por ejemplo, c-src celular y v-src viral). Las
versiones alteradas de estos protooncogenes por mutaciones dan lugar a los oncogenes. En consecuencia, las
funciones de los productos gnicos de los protooncogenes y
de los oncogenes son diferentes; en los oncogenes estos
productos son las oncoprotenas. Estas protenas actan
pleiotrpicamente provocando una serie de cambios tanto

celulares como moleculares, segn el nivel molecular especco en donde acten.


De igual forma que los oncogenes, son determinantes
en la evolucin del cncer. Tambin los genes supresores
de tumores o antioncogenes desempean un papel clave
en la tumorognesis, ya que operan restringiendo o
suprimiendo la proliferacin celular bajo ciertas condiciones. Estos genes son sumamente importantes, ya que para
la formacin tumoral maligna es necesaria su inactivacin o
prdida, lo que les conere una naturaleza recesiva. En
1986, se clona el primer gen supresor de tumores el retinoblastoma (Rb) y dos aos despus el gen p53, una molcula
que por su importancia en el papel siolgico la revista

B CDC2
M
G2

D
G1

A CDC2

CDK4/6

CDKls:
p16INK4A
p15INK4B
p18INK4C
p19INK4D

S
A CDK2

E CDK2

Figura 21-2. Ciclo celular: ciclinas, CDK y CDKI. Existen diferentes


complejos de ciclinas/CDK a travs de la transicin de una fase
del ciclo celular a otra. La inhibicin de estos complejos se
logra por los CDKI.

199

CAPTULO 21 Bases moleculares del cncer

cientca Science la denomin la molcula del ao. En


la actualidad, los avances en el estudio de los oncogenes
y genes supresores de tumores han situado a p53 como
el centro de atencin del estudio de los procesos cancergenos.
De esta manera, puede hablarse de genes relacionados
con susceptibilidad al cncer de mama, de un modelo que
ha establecido una asociacin entre lesiones histopatolgicas y las diferentes mutaciones en protooncogenes y genes
supresores de tumor, como es el cncer de colon (teora
multipasos), y cmo el virus del papiloma humano es uno
de los principales factores de riesgo para el desarrollo de
cncer crvicouterino.

Ruta estimuladora

Ruta inhibidora

Factor de
crecimiento

Receptor

Factor
inhibidor de
crecimiento
Receptor

Transmisores
intracelulares

Transmisores
intracelulares

Protooncogenes y genes supresores


de tumor de inters biomdico
FT

Para profundizar en la comprensin del concepto de protooncogn es necesario revisar la cascada de eventos que conducen a la divisin celular.
Protenas denominadas factores de crecimiento proporcionan un estmulo externo a la clula; estas protenas, al
unirse a su receptor en la membrana celular, interiorizan la
seal autoactivndose como una enzima con capacidad de
tirosina cinasa o a travs de segundos mensajeros como
puede ser protenas G, con lo que se inicia una cascada de
fosforilaciones en protenas citoplasmticas que nalmente
modican factores transcripcionales que se encuentran en
el citoplasma y migran hacia el ncleo, unindose al DNA y
activando la expresin de protenas que inducen la divisin
celular (gura 21-3A). Asimismo, existen seales inhibitorias que pueden frenar la divisin celular a travs de
mecanismos similares (gura 21-3B). Precisamente, el balance entre estas dos cascadas de seales es lo que permite
la homeostasis de la divisin celular en una clula normal,
entre otros mecanismos.
Esta cascada de seales es coordinada, entonces, por
protenas desde el espacio extracelular hasta el mismo
ncleo, por lo que pueden encontrarse diferentes niveles
celulares en donde se controla la divisin celular, que a continuacin se describen brevemente.

FT
ADN

ADN
Protena que PROMUEVE
la divisin celular

Protena que INHIBE


la divisin celular

Figura 21-3. Transduccin de seales. Ruta de factores que desencadenan vas de sealizacin que nalmente promueven o
inhiben la divisin celular.

www.fullengineeringbook.net

Factores de crecimiento
Los factores de crecimiento se unen a dominios extracelulares de receptores enclavados en la membrana plasmtica,
donde disparan una seal de transduccin. El primer oncogn descrito como factor de crecimiento fue v-sis, oncogn
procedente del virus del sarcoma de los simios, similar a la
cadena del factor de crecimiento derivado de plaquetas
(platelet-derived growth factor, PDGF).

Receptor con actividad de tirosina cinasa


El receptor del factor de crecimiento epidrmico (epidermal growth factor, EGF) es una protena transmembranal
con actividad de tirosina cinasa que se activa cuando se une

el factor de crecimiento en el dominio extracelular; en consecuencia, la tirosina cinasa de la protena v-erb-B (protena
codicada por el virus de la eritroblastosis aviar) se activa
inespeccamente sin necesidad de estmulo; as, pierde su
funcin normal y conduce a la oncognesis. En forma independiente, otros grupos de investigacin identicaron
genes relacionados con el gen v-erb-B que llamaron HER-2.
El receptor al factor de crecimiento epidrmico se encuentra sobreexpresado o mutado en carcinoma pulmonar y, de
hecho, es el blanco teraputico de un grupo de frmacos
llamados inhibidores de tirosina cinasa.

Protenas G asociadas a membrana


Un ejemplo tpico de estos protooncogenes implicados en
la transduccin de seales es la familia de los genes ras, que
incluye tres protooncogenes estrechamente relacionados,
Harvey (ha)-ras, Kirsten (Ki)-ras y N-ras. stos codican
para protenas de ~21 kDa que estn en la supercie interna
de la membrana plasmtica, y su funcin es unir GTP/GDP
a travs de su actividad de GTPasa, participando en vas de
transduccin de seales que regulan el crecimiento celular.
Las mutaciones puntuales pueden activar el potencial
oncognico de los genes ras, alterando la secuencia aminoacdica de las protenas p21. In vivo, estas mutaciones se
encuentran casi exclusivamente en los codones 12, 13 o 61,
aunque se han descrito mutaciones puntuales en otros
codones (59, 63, 116 y 119), cuyo potencial transformante
se ha demostrado por mutagnesis in vitro. Entre las vas
que activan las protenas ras se encuentra la va de sea-

200

PARTE III Bases moleculares de las enfermedades

lizacin de las cinasas MAP (mitogen-activated-protein).


De manera importante, la identicacin de mutaciones en
ras tambin contribuye al pronstico de diferentes tipos de
cncer, entre ellos en cncer de colon y el pulmonar, ya
que la presencia de mutaciones en ras puede contribuir a que
los tumores metastaticen en fases ms tempranas de su
evolucin, lo que puede servir como un factor pronstico
para los pacientes.

Cinasas citoplasmticas
La mayora de la actividad cinasa en mamferos la lleva a
cabo la fosforilacin de residuos de serina/treonina. Estas
cinasas son protenas solubles citoplasmticas y miembros
de la cascada de sealizacin que fosforilan una protena
activndola; sta, a su vez, fosforila a otra, y as sucesivamente, formando una cascada de fosforilaciones que nalmente culmina en la activacin de factores transcripcionales
que actan en el ncleo; esto es, funcionan como segundos
mensajeros. El oncogn viral v-raf es una versin truncada
de la protena celular. La regin reguladora amino terminal
tiene una delecin que da como consecuencia una cinasa
constitutivamente activa.

Factores transcripcionales
Finalmente, la cascada de seales culmina en la activacin
de genes relacionados con la divisin celular, fenmeno que
ocurre a travs de la activacin/inactivacin de factores
transcripcionales. El gen c-myc se ha asociado con diversos
neoplasmas en un nmero amplio de especies, y la alteracin en este gen est relacionada con diversos tipos de
cncer, lo cual sugiere que desempea un papel clave en los
procesos biolgicos en la proliferacin celular. En procesos
neoplsicos, el gen c-myc acta por medio de amplicacin,
es decir, la protena es normal pero la expresin se encuentra aumentada; en tumores primarios se reportan entre 8 a
10 copias de c-myc por clula. Este fenmeno ocurre aun en
ausencia de factores de crecimiento. La presencia de mltiples copias de protooncogenes en clulas tumorales se ha
asociado a un mal pronstico para los pacientes.

genes supresores de tumor se necesita que ambos alelos del


gen estn alterados para que no sean funcionales; esto es,
tienen un carcter recesivo. Los mecanismos por los cuales
ambos alelos se pueden inactivar pueden ser por el mismo
tipo de mutacin o por una mutacin diferente. Aunque
normalmente se poseen dos alelos de un gen sin alteraciones, en algunas ocasiones se puede heredar un gen con uno
de sus alelos mutado; sin embargo, el otro alelo tiene la
capacidad de reemplazar la prdida de funcin del alelo
mutado. Cuando se pierde esta combinacin por alguno de
los mecanismos ya mencionados, que puede incluir una
mutacin de manera aleatoria, se da una prdida de heterocigosidad de los alelos; esto implica cambios en dos
alelos mutados, lo que favorece el desarrollo de un tumor,
condicin inicial para el desarrollo del cncer. La prdida de
heterocigosidad est relacionada, por tanto, con la teora
de los dos golpes (establecida en 1971 por Alfred G. Knudson), que describe la mayor probabilidad de desarrollar un
tipo especco de cncer en individuos que heredan un alelo
mutado y cuyas clulas son ms susceptibles de presentar
una mutacin somtica en el alelo normal. De hecho, el
efecto de la teora de los dos golpes en una clula es el inicio
de una proliferacin descontrolada que da origen a ms
clulas con esta caracterstica; sin embargo, en el cncer,
las clulas hijas con esta mutacin pueden presentar otro
tipo de mutacin, ya sea en el mismo gen o en otros genes,
lo que origina que la proliferacin sea aun ms rpida o que
las clulas no se diferencien de acuerdo con su estirpe; esto
da lugar a lo que se denomina naturaleza clonal del cncer.
Lo anterior pone de maniesto la complejidad biolgica de
esta enfermedad.
Entre los genes supresores de tumores mejor caracterizados en el ser humano se incluye el gen de retinoblastoma
(Rb), localizado en el cromosoma 13 brazo q14.1-q14.2, y el
gen p53, situado en 17p13.1. Existen otros genes supresores
de tumores con una importancia similar, pero se limitan a
tipos especcos de cncer, como los genes APC y DCC,
situados en 5q21-22 y 18q23.3, respectivamente, cuya signicacin clnica se ha limitado al cncer de colon. Los
genes NF-1 y NF-2, cuyas posiciones en el genoma son
17q11.2 y 22q12.2, se han asociado a neurobromatosis.

www.fullengineeringbook.net

Genes supresores de tumores


Como describi Bert Vogelstein, investigador en el rea de
cncer de la Universidad Johns-Hopkins, una analoga sencilla que permite ubicar fcilmente los dos principales tipos
de genes involucrados en cncer es que un oncogn se parece
al acelerador de un automvil, mientras que un gen supresor
de tumor puede considerarse como el freno. En trminos de
la clula, cuando una clula se acelera, se divide, y cuando se
frena, ocurre lo contrario; por ello, los genes supresores de
tumor tambin se conocen como antioncogenes.
Una diferencia entre los oncogenes y los genes supresores
de tumor es que los primeros solamente necesitan de un
alelo mutado para que se active su funcin tumorignica; es
decir, poseen carcter dominante. Por el contrario, en los

Retinoblastoma
El retinoblastoma es una enfermedad que se maniesta por
una tumoracin maligna en la retina desde la infancia. Al
estudiar esta enfermedad se observ que el cariotipo de los
pacientes con retinoblastoma mostraba una delecin del
cromosoma 13, donde se localiza el gen Rb. Cabe mencionar que el fenotipo maligno slo se desarrolla cuando
ambos alelos de Rb estn mutados. En la forma hereditaria
de la enfermedad, uno de los alelos de origen parental porta
la delecin y cuando se altera el otro alelo (no mutado) se
desarrolla el tumor. Se ha reportado hasta 70% de los casos de
retinoblastoma con prdida de heterocigosidad en clulas somticas de la retina. Existen tambin casos espordi-

CAPTULO 21 Bases moleculares del cncer

Ciclina B
CDC2

P
P

Rb

Rb

M
G2

Ciclina D
CDK4, 6

G1

S
Ciclina A
CDK2

P
P

Rb

P
P

Rb
P

P
Ciclina E
CDK2

Figura 21-4. Rb y ciclo celular. La progresin del ciclo celular


depende del estado de fosforilacin de Rb.

cos en que los alelos de origen parental son totalmente


normales; sin embargo, el tumor se puede presentar por
mutaciones somticas en los dos alelos. Aunque en la mayora de los casos el defecto lo causa una delecin, en otros
estudios se demuestra que el defecto puede estar en la
expresin del gen. La inactivacin del gen Rb se ha reportado en el retinoblastoma, el osteosarcoma y el cncer pulmonar de clulas pequeas. En el caso de las alteraciones en la
expresin gnica, se encuentra la metilacin del promotor
del gen de Rb en tumores de cerebro. El gen Rb codica para
una fosfoprotena nuclear implicada en la regulacin del
ciclo celular, a travs de su unin cclica a los complejos
ciclina-CDK, especcamente las ciclinas D, E, y al factor
transcripcional E2F. Durante el nal de la fase G1 se fosforila y libera al E2F, lo que permite la transcripcin. Durante
la mitosis este gen sufre una desfosforilacin y esta forma
hipofosforilada inhibe la proliferacin celular (gura 21-4).

201

de Li-Fraumeni y presenta un patrn de herencia autosmico dominante.


En 1987, Donna George y colaboradores reportaron
que el oncogn MDM2 suprime la capacidad de p53 para
inhibir la tumorognesis. A este respecto, se han reportado
amplicaciones de MDM2 y mutaciones en p53 en osteosarcomas. Debido a que p53 est implicado en numerosos
tipos de cncer, se ha propuesto que su deteccin podra ser
til como un marcador en la evolucin de la enfermedad.
Las mutaciones reportadas con ms frecuencia en p53
son puntuales de sentido equivocado (ver el capitulo 8,
Mutaciones), que se pueden producir en todo el marco de
lectura, en particular de los exones 5 a 8 que constituyen la
regin central de la protena. No obstante, cada tipo de
cncer tiene mutaciones particulares ms frecuentes en
sitios especcos. Por ejemplo, en cncer de colon se han
detectado mutaciones en el codn 165 y en carcinoma
hepatocelular, en el codn 249. Las mutaciones puntuales
sin sentido suelen asociarse a una prolongacin en la vida
media de la protena y, por lo tanto, a un incremento en el
nivel basal de la protena.
Finalmente, la prdida de la actividad de algn gen
supresor de tumor siempre se compensa por la actividad de
otro gen que surge como mecanismo de seguridad ante
situaciones emergentes de las clulas. No obstante, estos
mecanismos se pierden en la tumorignesis.

www.fullengineeringbook.net

P53
El gen p53 codica para un factor transcripcional que activa
la transcripcin de ciertos genes y, en respuesta al dao en
el DNA, detiene el ciclo celular. Lo anterior se logra por la
inhibicin de los complejos de CDK/ciclinas, as como por
la fosforilacin de Rb. En caso de que el DNA no pueda
repararse, las clulas aumentan sus niveles de p53 y se
detienen en la fase G1 antes de entrar a la fase de sntesis,
para activar los mecanismos de reparacin. Si la lesin no es
reparable, la clula es inducida a apoptosis; las clulas con
una lesin reparable retornan a la fase S y a la divisin celular. El principal objetivo es evitar que la informacin gentica alterada se transmita. Las clulas premalignas con una
mutante de p53 pueden transmitir esta alteracin.
Como sucede con Rb, si se heredan mutaciones de los
alelos de origen parental existe la tendencia a desarrollar
cncer. Esta patologa heredada se conoce como sndrome

Virus y cncer

El cncer cervicouterino (CaCu) es un tipo de cncer que


tiene como factor de riesgo la infeccin con el virus del papiloma humano (VPH). Algunos estudios reportan la infeccin positiva a VPH en pacientes con CaCu en ms de 90%
de los casos. Cabe mencionar que existen tipos virales de
alto riesgo (VPH 16 y 18, entre otros) y de bajo riesgo (VPH
6 y 11, entre otros) al desarrollo de CaCu. Debido a que la
infeccin con VPH se produce en las clulas epiteliales
basales, sta se mantiene durante el proceso de diferenciacin
epitelial, para asegurar la sntesis de protenas virales que
darn origen a nuevos virus. En respuesta a la infeccin, las
clulas activan mecanismos de defensa celular que implican
a p53 y Rb y dirigen a la clula infectada a apoptosis. Los
tipos virales de VPH de alto riesgo sobreexpresan las oncoprotenas virales E6 y E7, que inactivan los genes supresores
de tumor mencionados. E6 inactiva la funcin de p53,
mientras que E7 inactiva a Rb. En ambos casos se produce
una prdida de su actividad, lo que contribuye a la tumorognesis del CaCu, ya que se producen cambios en el crecimiento normal y diferenciacin del epitelio cervical, y se
acumulan alteraciones genticas en estas clulas. No
obstante, adems de la infeccin viral con algn genotipo
de alto riesgo de VPH, es importante considerar la competencia del sistema inmunolgico del husped en la eliminacin de la infeccin viral, ya que no todas las infecciones
con VPH de alto riesgo progresan a CaCu; esto pone de

202

PARTE III Bases moleculares de las enfermedades

maniesto la importancia de la respuesta inmune humoral


y celular, as como otros factores, entre los que se incluyen
infecciones recurrentes, coinfecciones con otros tipos
virales y la integracin en el DNA celular.

Predisposicin gentica al cncer


Los cnceres de tipo familiar implican un riesgo elevado de
heredar la enfermedad. El retinoblastoma infantil, en que
se hereda un alelo mutado del gen supresor de tumores Rb,
es quiz uno de los ejemplos ms ilustrativos. En esta afeccin, ms de 80% de los casos desarrollan retinoblastoma
entre los 3 y los 4 aos de edad. Sin embargo, un pequeo
porcentaje de las personas que heredan un alelo Rb mutado
no desarrollan un tumor. Esto indica que existe una predisposicin al cncer en determinadas etapas del desarrollo, ya
que dichos pacientes pierden la susceptibilidad a la enfermedad si no la desarrollan en los primeros aos de la infancia. En los pacientes portadores de una mutacin en Rb que
no presentaron retinoblastoma en la niez, desarrollan
tumores no oculares en etapas posteriores de la vida. De
igual manera, los pacientes afectados con el sndrome de
Li-Fraumeni presentan un alto riesgo de desarrollar tumores
cerebrales y mamarios, entre otros.
Otro sndrome neoplsico de carcter hereditario relacionado con defectos en genes supresores de tumor es la
poliposis adenomatosa familiar (PAF), cuyo patrn de herencia es autosmico dominante. Esta enfermedad representa
un modelo de estudio por la correlacin que existe entre la
evolucin de las lesiones histopatolgicas en el epitelio
colnico y las alteraciones genticas en genes supresores de

tumor (APC, MCC, DCC, p53) y oncogenes (ras). Los pacientes con PAF heredan mutaciones en el gen APC, que
estimula la formacin de plipos que tienden a malignizarse a medida que participan otras alteraciones genticas
en genes supresores de tumores durante la transformacin
maligna, presentndose lo que se conoce como prdida de
heterocigosidad y expansin clonal. La expansin clonal
es la capacidad de las clulas de iniciar, promover y convertirse a un fenotipo maligno por expansin de la clona
mutada.
Los diferentes tipos de cncer son enfermedades complejas, que presentan un carcter multignico y, en algunos
casos, una fuerte inuencia del medio ambiente.

Teora de las mutaciones mltiples


Como se ha mencionado en el desarrollo de este captulo, la
tumorognesis implica varios eventos en el que obviamente
estn involucrados tanto oncogenes como genes supresores
de tumores, y en la actualidad tambin se han asociado
numerosos genes relacionados con el control del ciclo y la
diferenciacin celular. Dichos genes participan en diferentes vas de sealizacin, procesos de evasin de la respuesta
inmunolgica, apoptosis y angiognesis, de manera tal que
las alteraciones genticas involucradas en el proceso de
malignizacin de las clulas se van acumulando para nalmente transformar una clula y dar origen a un tumor. Estas
mutaciones mltiples, de naturaleza clonal, tienen lugar en
diferentes estadios histolgicos y se han correlacionado con
la evolucin, como es el caso del cncer de colon, uno de los
modelos ms representativos de esta teora.

www.fullengineeringbook.net
Ejercicios de integracin

1. Investigue los procesos moleculares implicados en los


puntos de control del ciclo celular.
2. Describa la importancia de la fase S.
3. Investigue qu subfase de la mitosis es crtica como punto de control en la divisin celular.
4. Mencione los genes cuya expresin es activada por p53.
5. Dena prdida de heterocigosidad.
6. Investigue cules son los genes de susceptibilidad involucrados en el cncer de mama y mediante qu mecanismo participan en la tumorognesis.

7. Como ejercicio integrador, realice un ensayo donde se


mencionen cules seran los principales blancos moleculares que regulan en el tratamiento de un tipo de cncer
que usted elija, y qu estrategia farmacolgica realizara
para revertir, ya sea parcial o totalmente, el proceso maligno.

CAPTULO 21 Bases moleculares del cncer

203

Bibliografa
Barbacid M. Ras genes of mammalian cells. Ann Rev Biochem,

Lasky T., Magder L. Hepatocellular carcinoma p53 G>T transver-

1987;56:779-827.
Bishop J.M. Cellular oncogenes and retroviruses. Ann Rev Biochem,
1983;52:301-354.

sions at codon 249: the ngerprint of aatoxin exposure? Environ


Health Perspect, 1997;105:392-397.
Lewin B. Genes X. Nueva York: Oxford University Press, 2003.
Marx J. Oncogenes reach a milestone. Science, 1994;266:1942-1944.

Cavanee K.W., Dryja T.P, Phillips R.A., Benedict WF, Godbout R., Gallie B.L., et al. Expression of recessive alleles by chromosomal

mechanisms in retinoblastoma. Nature, 1983;305:779-784.


Cross M, Dexter T.M. Growth factors in development, transformation, and tumorigenesis. Cell, 1991;64:271-280.
Hunter T. Cooperation between oncogenes. Cell, 1991;64:249-270.
Jansson A., Gentile M., Sun XF. p53 Mutations are present in colorectal cancer with cytoplasmic p53 accumulation. Int J Cancer,
2001;92:338-341.
Jones SN, Hancock A.R., Vogel H., Donehower L.A., Bradley
A. Overexpression of Mdm2 in mice reveals a p53-independent

role for Mdm2 in tumorigenesis. Proc Natl Acad Sci USA,


1998;95:15608-15612.
Land H., Parada L.F., Weinberg R.A. Cellular oncogenes and multistep carcinogenesis. Science, 1983;222:771-777.

Rodenhuis S., Slebos R.J., Boot A.J., Evers S.G., Mooi W.J., Wagenaar S.S., et al. Incidence and possible clinical signicance

of K-ras oncogene activation in adenocarcinoma of the human


lung. Cancer Res, 1988;48:5738-5741.
Smith M.R., Matthews N.T., Jones K.A., Kung H.F. Biological actions of oncogenes. Pharmacol Ther, 1993;58:211-236.
Weinberg R.A. The biology of cancer. Garland Science, Taylor and
Francis Group, 2007.
Yoshida K., Hamatani K., Koide H., Ikeda H., Nakamura N., Akiyama
M., et al. Preparation of anti-ras Mr 21,000 protein monoclonal

antibodies and immunohistochemical analyses on expression of


ras genes in human stomach and thyroid cancers. Cancer Res,
1988;48:5503-5509.

www.fullengineeringbook.net

Captulo

22

Bases moleculares de
la diabetes mellitus
Ana Rosa Rincn Snchez / Mara Cristina Islas Carvajal

Introduccin

Latina es de 4 a 16%, y se espera un incremento en los prximos 25 aos de 25 a 50%. En Estados Unidos, en pacientes
jvenes con obesidad la prevalencia es de 6.6%; de 4% para
los individuos de 20 a 60 aos; de 12% para los de 60 a 64, y
de 17% para los ancianos.
Se espera un incremento en la prevalencia de ambos
tipos de diabetes en todo el mundo, aunque es posible que
la de la DM2 aumente con ms rapidez a causa de la obesidad creciente, la reduccin de la actividad f sica, el envejecimiento de la poblacin y la urbanizacin de las sociedades.
En Mxico, la DM2 supone la primera causa de muerte
y de incapacidad prematura y denitiva, con una prevalencia de 10.9%; adems, una de cada cuatro personas desconoce que sufre de la enfermedad y, aun con tratamiento,
cerca de 60% no muestra un control ptimo de la glucemia.

La diabetes mellitus (DM) se dene como una enfermedad


endocrinometablica caracterizada por hiperglucemia crnica, con alteraciones en el metabolismo de los carbohidratos, grasas y protenas, que puede estar producida por una
deciencia en la secrecin de insulina, una resistencia a la
accin de la misma, o una mezcla de ambas, originada por
la destruccin de las clulas (beta) de los islotes de Langerhans por un mecanismo autoinmunitario o por una causa
desconocida (DM tipo 1, DM1); o bien, por fenmenos de
resistencia a la insulina (RI), lo cual ocasiona una dicultad
para que esta hormona acte en los tejidos a causa de trastornos en el nmero o anidad de sus receptores (DM tipo
2, DM2).
En el siglo i, el trmino diabetes se empleaba para referirse a la eliminacin de grandes cantidades de orina
(poliuria). El trmino fue acuado por el lsofo griego Arateus que le denomin diabetes mellitus o diabetes sacarina,
debido al olor dulce de la orina, y se supona que tambin
tena un sabor dulce como la miel, de ah su denominacin
latina: mellitus. En los ltimos aos, se han eliminado los
trminos diabetes mellitus insulinodependiente y diabetes
mellitus no insulinodependiente, que antes se aplicaban a la
diabetes tipos 1 y 2, respectivamente, ya que ambas clases
de diabetes pueden necesitar la administracin de insulina
para su tratamiento.

www.fullengineeringbook.net
Clasicacin de la diabetes

La clasicacin etiolgica ms utilizada es la recomendada


por la American Diabetes Association (ADA) en 1997
y por el Comit de Expertos para la Clasicacin y Diagnstico de la Diabetes (Organizacin Mundial de la Salud
OMS, 1998). Ambas organizaciones clasican a la DM
en:
DM tipo 1. Puede ser de 2 tipos: autoinmune (DM1a) e
idioptica (DM1b). Es conocida tambin como diabetes
juvenil, pues con frecuencia se presenta durante la infancia,
aunque tambin puede ocurrir en adultos.
DM tipo 2. Puede variar entre la insulinorresistente,
con deciencia relativa de insulina, a un defecto preferentemente secretor con o sin RI. Corresponde a la mayora
(90%) de los casos de diabetes. Sin embargo, en la mayora de los pacientes con DM2, mltiples factores genticos y
ambientales contribuyen tanto al origen como a la progresin y las complicaciones tardas de la enfermedad.

Epidemiologa
La DM en la actualidad se reconoce como una verdadera
epidemia. Se estima que en el mundo cerca de 200 millones
de personas padecen diabetes y se pronostica que esta cifra
se elevar a 300 millones para el ao 2025.
La Asociacin Latinoamericana de Diabetes (ALAD)
indica que la prevalencia de la diabetes mellitus en Amrica
204

CAPTULO 22 Bases moleculares de la diabetes mellitus

MODY (maturity onset diabetes of the young). Implica


defectos genticos de la funcin de la clula B pancretica de inicio en la juventud o en la madurez.
DM gestacional. Es aquella que se presenta en el curso
del embarazo. Consiste en la presencia de niveles elevados de
glucosa en la sangre. Esta condicin se desarrolla en cualquier momento durante el embarazo en una mujer sin diabetes.
DM de la infancia. Puede agruparse en varios subtipos
principales:

Diabetes neonatal transitoria o permanente (DMNT y


DMNP, respectivamente).
DM1: DM1a, autoinmune, DM1b, idioptica.
DM2: este tipo de DM se reporta en nios obesos.
Diabetes mitocondrial (DMMt).
Diabetes relacionada con brosis qustica (DRFQ).
Diabetes asociada a sndromes como Down y Turner.

Diabetes mellitus tipo 1


Esta enfermedad se caracteriza por la deciencia absoluta
de insulina, ocasionada por un ataque inmunolgico en
contra de las clulas beta del pncreas. Los islotes de Langerhans se inltran con linfocitos T activados y originan
insulitis. Este ataque autoinmune conduce a un agotamiento gradual de las clulas beta del pncreas. Los sntomas
aparecen en forma sbita cuando se destruye de 80 a 90% de
las clulas beta del pncreas. El pncreas deja de responder
en forma adecuada al estmulo de la glucosa para secretar
insulina, por lo que sta debe ser administrada en forma
exgena para restaurar el control metablico y prevenir la
cetoacidosis que puede poner en riesgo la vida del paciente.
Para que este ataque autoinmune se presente, es necesario
la presencia de un estmulo en el ambiente (en algunos
casos es por una infeccin viral), adems de un determinante gentico que lleve al sistema inmune a no reconocer a las
clulas beta como propias. Las personas con DM1 deben
administrarse insulina exgena para poder vivir.

205

mir alimentos, y de la toma inadecuada de glucosa por los


tejidos perifricos sensibles a la insulina, particularmente
en el msculo esqueltico.
La falta de respuesta de los tejidos receptores a la insulina mantiene el estmulo de la glucemia elevada, lo que se
traduce en incremento en la produccin y liberacin de
insulina por las clulas beta pancreticas, con el n de compensar y mantener los niveles normales de glucemia. Este
proceso siopatolgico de hiperglucemia e hiperinsulinemia y alteracin funcional de la clula pancretica puede
durar varios aos de vida del individuo (hasta 15 aos), hasta volverse insostenible para las clulas beta, por lo que se
presenta intolerancia a la glucosa, con elevacin exagerada
de la glucosa posprandial, RI y, posteriormente, proceso
patolgico de la DM2.
Las alteraciones metablicas en la DM2 son ms leves
que las descritas para la DM1 (cuadro 22-1), en parte porque
la secrecin parcial de insulina, aunque insuciente, limita la
presencia de cetognesis. La aparicin de la DM2 depende
casi por completo de factores genticos y ambientales, los
cuales se consideran factores de riesgo para esta enfermedad, como son:

Padres o hermanos diabticos.


Obesidad e hipertensin.
Edad superior a 45 aos.
Pertenecer a ciertos grupos tnicos (afroamericanos,
nativos americanos, asiticos, isleos del Pacco e hispanoamericanos).
Diabetes gestacional o parto de un beb con un peso
mayor de 4 kg.
Niveles elevados de triglicridos en la sangre.
Niveles elevados de colesterol en la sangre.
Falta de ejercicio y vida sedentaria.

www.fullengineeringbook.net

Diabetes mellitus tipo 2


Es una enfermedad crnica con complicaciones que suponen una importante causa de mortalidad y se asocian con el
dao o la falla de varios rganos. La RI con hiperinsulinismo
est ya presente en el estadio normoglucmico prediabtico.
Los factores genticos de susceptibilidad son polignicos;
sin embargo, factores ambientales contribuyen a exacerbar
estas anormalidades. Los individuos con DM2 tambin se
caracterizan por una reduccin en la masa de clulas beta
del pncreas y aumento en la apoptosis celular.
La DM2 se caracteriza por la presencia de hiperglucemia en ayuno y posprandial. La hiperglucemia en ayuno es
resultado de la resistencia heptica a la accin de la insulina.
La hiperglucemia posprandial resulta de la secrecin anormal de insulina por las clulas beta del pncreas al consu-

La ADA recomienda que adultos mayores de 45 aos se


evalen para DM2 al menos cada 3 aos y con mayor frecuencia en personas de alto riesgo. El criterio diagnstico
de la ADA dene la DM como glucemia en ayuno 126
mg/dl o una glucemia > 200 mg/dl a las 2 horas de una carga de 75 g de glucosa anhidra (cuadro 22-2).

Criterios diagnsticos
para la diabetes mellitus tipo 2
Con independencia de la denicin, existen diversos criterios para el diagnstico de la DM constantemente revisados
por la ADA y la OMS. Estos criterios se resumen en el cuadro 22-2.

Prueba aleatoria de glucosa


Se sospecha la existencia de diabetes si los niveles son superiores a 200 mg/dl y estn acompaados por los sntomas
clsicos de aumento de sed, miccin y fatiga (esta prueba se
debe conrmar con otra de nivel de glucosa en la sangre en
ayunas).

206

PARTE III Bases moleculares de las enfermedades

Cuadro 22-1. Comparacin de las principales caractersticas clnicas entre diabetes tipo 1 y 2
Caractersticas clnicas

Diabetes tipo 1

Diabetes tipo 2

Edad de inicio

Casi siempre durante la infancia o la pubertad.

Por lo general despus de los 35 aos de edad.

Tiempo de desarrollo

Se desarrolla con rapidez.

Se desarrolla en forma gradual (crnico).

Estado de nutricin

A menudo se presenta desnutricin.

Casi siempre hay obesidad.

Prevalencia

900 000 = 10% de los diabticos diagnosticados.

10 millones = 90% de los diabticos diagnosticados.

Predisposicin gentica

Moderada.

Muy marcada.

Defecto o deciencia

Las clulas beta se destruyen, eliminando la produccin


de insulina.

Resistencia a la insulina, combinada con la incapacidad


de producir cantidades adecuadas de insulina.

Presencia de cetosis

Frecuente.

Rara.

Insulina plasmtica

Baja o ausente.

Alta en etapas iniciales, baja en la fase crnica.

Complicaciones

Cetoacidosis.

Coma hiperosmolar.

Empleo de
hipoglucemiantes orales

No responde al tratamiento.

S responde al tratamiento.

Tratamiento

Siempre ser necesaria la aplicacin de insulina.

Hipoglucemiantes orales, dieta, ejercicio, y algunas veces


insulina.

Prueba de glucosa de ayuno durante


por lo menos horas
Se diagnostica diabetes si el resultado es mayor de 126 mg/
dl en dos ocasiones. Los niveles entre 100 y 126 mg/dl se
denominan alteracin de la glucosa en ayunas o prediabetes. Dichos niveles se consideran factores de riesgo para la
DM2 y sus complicaciones.

sobre todo a largo plazo. La importancia de esta prueba


radica en que la HbA1c tiene memoria e indica al mdico el
control de la glucosa promedio durante los ltimos 2-3
meses de prueba.

Estadios de la diabetes mellitus tipo 2


Estadio I. Normoglucemia compensada por hiperinsulinemia con diferentes grados de resistencia.
Estadio II. Normoglucemia basal con hiperinsulinismo
asociada a disminucin de la respuesta de la clula beta
pancretica a la glucosa, generando hiperglucemia posprandial.
Estadio III. Disminucin de la secrecin de insulina con
hiperglucemia en ayuno.

www.fullengineeringbook.net

Prueba de tolerancia de glucosa


Inicia con toma de glucosa en ayuno. Despus, el paciente
toma una cantidad moderada de glucosa en una bebida dulce. La glucosa se mide a intervalos especcos. Se diagnostica diabetes si el nivel de glucosa es superior a 200 mg/dl,
luego de 2 horas (esta prueba se usa con ms frecuencia
para la DM2).
Existen otras pruebas, como la glucosa casual, la glucosa en ayunas, la glucosa posprandial, la curva de tolerancia
a la glucosa oral y la hemoglobina glucosilada (GHB). De
todas estas pruebas, la GHB o hemoglobina A1c (HbA1c) es
una excelente medida del control de la glucosa en sangre,
Cuadro 22-2. Criterios diagnsticos de la Asociacin Americana
de Diabetes (ADA), 1997
A. Diabetes
Sntomas de diabetes + glucemia al azar 200 mg/dl
Glucemia 126 mg/dl en ayuno en 2 das diferentes
Glucemia 2 horas post SOG 200 mg/dl en dos pruebas.
B. Alteracin de la glucemia en ayuno (AGA):
Glucemia en ayuno entre 110 y 125 mg/dl
Si existen factores de riesgo de diabetes hay que realizar una
prueba de SOG:
Si 2 h 200 mg/dl = diabetes
Si 2 h < 140 mg/dl = no diabtico
Si 2 h entre 140 y 199 mg/dl = ATG
C. Alteracin de la tolerancia a la glucosa (ATG):
Glucemia 2 horas SOG entre 140 y 199 mg/dl
SOG, sobrecarga oral de glucosa.

Tratamiento de la diabetes mellitus tipo 2


Lograr un buen control metablico, evitar complicaciones
agudas y prevenir las complicaciones crnicas son los objetivos del tratamiento para lograr un automonitoreo y un
autocuidado efectivos, junto con un equilibrio emocional
adecuado. El tratamiento es muy variable, en funcin de las
caractersticas del paciente y el estadio de la enfermedad,
pero el esquema general debera incluir desde ejercicio f sico y rgimen diettico (sin uso de frmacos) hasta estas
actividades combinadas con el uso de diferentes tipos de
frmacos, administracin de insulina y diferentes combinaciones.
Esquema teraputico general:
1. Despus del diagnstico positivo, se deben ajustar tanto
una dieta como una rutina de ejercicio f sico.
2. Si las medidas anteriores no funcionan (por lo menos
3 meses), se inicia un tratamiento farmacolgico. En
sobrepeso: la metformina es el frmaco de primera eleccin. Inhibe la produccin heptica de glucosa y mejora
la sensibilidad a la insulina, puede combinarse con sulfo-

207

CAPTULO 22 Bases moleculares de la diabetes mellitus

nilurea (SU), glitazona, secretagogo o inhibidor de alfaglucosidasa. En personas de peso normal: se recomiendan
secretagogos para estimular la secrecin de insulina. Se
pueden usar SU solas o en combinacin con metformina, inhibidores de alfa-glucosidasa o glitazona.
3. Si no funciona el tratamiento farmacolgico, debe administrarse insulina sola o combinada con los medicamentos mencionados.

Fisiopatologa de la diabetes mellitus tipo 2


La patogenia de la DM2 sigue siendo enigmtica. Sin
embargo, queda claro que los hbitos de vida desempean
un papel crtico, como lo demuestra la obesidad como factor de riesgo. No obstante, se considera que los factores
genticos son incluso ms importantes que en la DM1.
Estudios en gemelos homocigotos demuestran que la incidencia de DM2 en ellos tiene una concordancia de 60 a 80%.
En pacientes con antecedentes familiares de DM2 y en
gemelos no homocigotos, el riesgo de desarrollar la enfermedad es de 20 a 40%, mientras que la cifra en poblacin
general es de 5 a 7%.
La DM2 es un sndrome heterogneo que tiene, como
elemento comn, una hiperglucemia crnica por una deciencia de insulina o una efectividad de su accin insuciente. La glucorregulacin es un proceso siolgico complejo,
en el cual las fallas a diferentes niveles conducen nalmente
a hiperglucemia. En la actualidad, se han identicado defectos en clulas, tejidos o funciones relacionados con la expresin de la enfermedad, o bien la presencia de polimorsmos.
Cada uno de estos cambios en las clulas aporta su propio
riesgo, modicado por los factores ambientales; la sumatoria de estos factores es lo que predispone en mayor o
menor medida al desarrollo de la enfermedad.
La obesidad es un factor desencadenante de la DM2.
Alrededor de 80% de los pacientes con DM2 son obesos; la
obesidad abdominal (en oposicin a la obesidad en depsitos subcutneos) es la que presenta un riesgo mayor. La
accin lipoltica se opone a los efectos lipognicos de la
insulina y moviliza cidos grasos para su uso como fuente
de combustible durante el ayuno.
Los factores de riesgo propuestos para explicar el incremento de complicaciones e incidencia de enfermedad cardiovascular en la diabetes son la presencia de hiperglucemia,
la dislipidemia, la formacin acelerada de productos nales
de glucosilacin avanzada (AGE), como la HbA1c, el incremento del estrs oxidativo y factores genticos.

la glucosa, lpidos y protenas. Adems, promueve la divisin y el crecimiento celulares a travs de sus efectos mitognicos.
La insulina es una hormona de 5.8 kDa, y se compone
de 51 aminocidos dispuestos en dos cadenas polipeptdicas A y B, unidas por dos puentes disulfuro (gura 22-1A).
La cadena A consta de 21 aminocidos y la cadena B, de 30.
Tambin contiene un puente disulfuro intramolecular entre
los residuos 7-7 y 20-19 de aminocidos de la cadena A y B.
La insulina se libera a la vena porta en respuesta a un
aumento de la glucemia, y su principal funcin es mantener
la concentracin de glucosa sangunea en un rango entre 80
y 105 mg/dl, para favorecer la entrada y el almacenamiento
de este nutriente en el msculo y el tejido adiposo.
El hgado absorbe alrededor de 50% de la insulina; el
resto permanece en la corriente sangunea, con una vida
media de entre 5 y 8 minutos en personas sanas. El resto de
la glucosa se almacena en el hgado como glucgeno, lo que
inhibe la produccin de insulina.
Las acciones de la insulina son mediadas por cascadas
de sealizacin intracelular, en las cuales la fosforilacin inicial del receptor en residuos tirosina (Tyr) lleva a una serie
de eventos de fosforilacin/desfosforilacin de cinasas de
Tyr y serina/treonina (Ser/Thr), que transmiten la seal para
la regulacin de eventos metablicos dentro de la clula.
En la gura 22-1B se observa el procesamiento de la
insulina en la clula pancretica, en donde el producto nal
es la insulina y el pptido C.
La funcin siolgica de la insulina es regular el nivel de
glucosa en sangre. Sin embargo, tras una comida, y en funcin del ndice glucmico, el nivel de insulina sangunea puede elevarse de manera espectacular. Una comida compuesta
en su mayor parte de protenas, grasa y muy pocos carbohidratos producir una respuesta glucmica reducida, mientras que una comida rica en monosacridos (carbohidratos
simples, como el azcar) ocasionar una gran respuesta glucmica.

www.fullengineeringbook.net

A
Cadena A

GLI ILE VAL GLU GLN CIS CIS THR SER ILE CIS SER LEU TIR GLN LEU GLU ASN TIR CIS ASN

Cadena B

s
s

PHE VAL ASN GLN HIS LEU CIS GLI SER HIS LEU VAL GLU ALA LEU TIR LEU VAL CIS GLI GLU ARG GLY PHE PHE TIR THR PRC LIS THR

B NH3
Secuencia
seal
Retculo
endoplsmico

Insulina

ss

s
s

Aparato A B
de Golgi s s s

ss

Funcin de la insulina
La insulina es una hormona pancretica liberada por las
clulas beta de los islotes de Langerhans en respuesta a
niveles elevados de nutrientes en sangre, que controla funciones energticas fundamentales, como el metabolismo de

coo-

NH3

Secuencia
Preproinsulina seal
Preproinsulina

ss

INSULINA
Pptido C

Figura 22-1. Insulina. A) Estructura de la insulina. B) Formacin


de la insulina humana madura a partir de la preproinsulina.

208

PARTE III Bases moleculares de las enfermedades

Las comidas habituales pueden elevar la concentracin


de glucosa en sangre a 140 mg/dl. Las clulas beta del pncreas son capaces de reconocer el incremento de glucosa y
liberar insulina en 30 segundos, y la insulina se une a un
transportador de protena de la sangre que conduce los
macronutrientes y los micronutrientes a los miocitos,
los hepatocitos y los adipocitos. En los miocitos existen dos
transportadores de glucosa: Glut 1 y Glut 4. Se considera
que las protenas Glut 1 son los transportadores bsales de
la glucosa, porque su presencia en la membrana celular no
vara. Sin embargo, las protenas Glut 4 reciben el nombre
de transportadores inducibles de glucosa, pues se desplazan
a la supercie de la clula en respuesta a la insulina o a la
contraccin muscular. El ejercicio f sico aumenta el nmero de protenas Glut 4 de la membrana celular y, por consiguiente, la sensibilidad a la insulina. Tanto es as, que al
introducir la glucosa en esas clulas, la insulina logra restablecer el nivel de glucosa en la sangre en 2 horas.
Tanto la obesidad como la lipoatroa ocasionan RI y
una predisposicin a la DM2, lo que demuestra que el tejido
adiposo es crucial para la regulacin del metabolismo de los
carbohidratos, ms all de su capacidad para captar glucosa. Aunque la insulina no estimula la captacin de glucosa
en el hgado, bloquea la glucogenlisis y la gluconeognesis,
y estimula la sntesis de glucgeno; de esta manera regula
los niveles de glucosa en ayuno. La accin de la insulina en
tejidos que normalmente no se consideran sensibles a la
insulina, incluyendo el cerebro y las clulas beta pancreticas, tambin son importantes en la homeostasis de glucosa.

secrecin de glucagn es el nivel de glucosa en sangre).


Anormalidades genticas de las protenas de las clulas
beta del pncreas, como la glucocinasa, el complejo formado por el receptor de las sulfonilureas y el canal de
potasio, el factor promotor 1 de la insulina, el factor
nuclear de los hepatocitos y el sustrato 1 del receptor de
la insulina.
Reduccin de la masa de las clulas beta del pncreas
causada, principalmente, por apoptosis.

La resistencia a la insulina aumenta con el incremento


de peso y, por el contrario, se reduce con la disminucin.
Esto sugiere que la acumulacin de grasa es importante en
el desarrollo de la resistencia a la insulina. El tejido adiposo
no es tan slo un rgano que almacena energa, sino que
tambin es un rgano secretor. Las sustancias reguladoras
que producen los adipocitos incluyen leptina, resistina y
adiponectina, las cuales contribuyen al desarrollo de resistencia a la insulina. Los niveles altos de cidos grasos que se
presentan en la obesidad tambin participan en el desarrollo de resistencia a la insulina.
El efecto nocivo de los cidos grasos en la sealizacin
de la insulina se lleva a cabo a travs de la activacin de
diferentes protenas serina cinasa (JNK, IKK, PKC y PKC
), que fosforilan al sustrato del receptor de la insulina (IRS)
1 (IRS-1). Por ello, la fosforilacin en serinas del IRS-1 desempea un papel crucial en la resistencia a la insulina inducida por cidos grasos. Al impedir esta fosforilacin se
protege el msculo contra la resistencia a la insulina.
Las clulas adiposas expresan y liberan al factor de
necrosis tumoral alfa (TNF), factor cuya participacin
se reconoce en la induccin de la RI. Esta molcula ejerce
mltiples efectos sobre la funcin del adipocito, como inhibicin de la lipognesis y aumento de la liplisis. El TNF
interere en la sealizacin de insulina y causa resistencia a
insulina en la obesidad (gura 22-2).

www.fullengineeringbook.net

Resistencia a la insulina
La RI puede denirse como la incapacidad de las clulas
blanco de responder a la insulina, debido a defectos en su
sealizacin. Esta RI es una de las principales caractersticas
en las manifestaciones patolgicas asociadas con la DM2.
Se han identicado mltiples anormalidades en las
reacciones de sealizacin de la insulina que contribuyen a
esta resistencia:

Reduccin del nivel de expresin de receptores de insulina.


Reduccin del nivel de actividad de la tirosina cinasa
intrnseca, lo que resulta en una fosforilacin del sustrato del receptor de la insulina inadecuada.

Entre las causas potenciales para la disfuncin de las


clulas beta del pncreas se encuentran:

Anormalidades metablicas reversibles como la glucotoxicidad y la lipotoxicidad.


Cambios hormonales como la accin inadecuada de la
incretina y la secrecin aumentada de glucagn (las
hormonas incretinas se producen en el tracto gastrointestinal y se liberan cuando los nutrientes ingresan al
intestino y, tras su liberacin, se estimula la secrecin
de insulina; el principal mecanismo regulador para la

Sealizacin de la insulina
La insulina ejerce varios efectos pleiotrpicos en las clulas:
incrementa la replicacin y supervivencia celular, disminuye
la apoptosis, participa en el ciclo celular y regula la homeostasis del metabolismo energtico. La resistencia a la insulina
puede deberse a mltiples defectos en la transduccin de
las seales como, por ejemplo, la activacin defectuosa
del receptor insulnico y la activacin disminuida de la cinasa de fosfatidilinositol trifosfato (PI3K) estimulada por
insulina.
Se investigan varias molculas como estrategia para
intervenir en la transduccin de seales mediadas por la insulina. Los nuevos enfoques se dirigen a inhibir las vas enzimticas que desactivan el receptor de insulina, o a sus
efectores intracitoslicos subyacentes, como las protenas
IRS. De esta manera, se han podido identicar protenas de
tirosin-fosfatasas especcas (PTP), entre otras, como
objetivos teraputicos.

CAPTULO 22 Bases moleculares de la diabetes mellitus

Evolucin patolgica de la Diabetes Mellitus tipo II


TNF

Normal

Sndrome
metablico

GLUT-4

Obesidad

GLUT-4

Lipognesis
Liplisis

TNF
IL-6, IL-1

Hiperglucemia +
hiperinsulinemia

Resistencia
a la insulina

Figura 22-2. Evolucin patolgica de la diabetes mellitus tipo 2.


La TNF interere en la sealizacin de insulina y causa
resistencia a la insulina en individuos con obesidad. En seres
humanos obesos se incrementa la actividad de TNF y puede
inducir resistencia a la insulina a travs de un defecto en la
capacidad del receptor de insulina de fosforilacin, o por
la disminucin en la expresin gnica de los transportadores
de glucosa Glut 4. TNF es un estimulante de la liplisis,
mientras que inhibe la lipognesis.

209

rilativa intracelular, mediante un intercambio de fsforos


entre diversas molculas dentro de la clula. Como consecuencia de la unin de la insulina a las subunidades alfa, la
subunidad beta, con propiedades de protena cinasa, se
autofosforila en los residuos de tirosina, serina y treonina.
Posteriormente, se inicia una cascada de reacciones de fosforilacin y desfosforilacin de un gran nmero de sustratos intracelulares, intermediarios de muchas acciones
metablicas. De este modo, la insulina alcanza sus efectos
nales mediante un conjunto de acontecimientos celulares
que involucran reacciones muy diversas.
El IRS-1 fosforilado, a su vez, se une a varias protenas
llamadas protenas SH2, que contienen dominios SH2, por
homologa al dominio 2 de la protena Src.
Una vez fosforilado, el InsR atrae protenas adaptadoras
que contienen dominios de unin a fosfotirosinas (PTB),
como el IRS y la protena homloga de Src (Shc). Las protenas adaptadoras que se unen al receptor fosforilado pueden
activar la va de la protena cinasa activadora de la mitognesis (MAPK) o la va de sealizacin de la PI3K, como se
describe en la gura 22-3.
En la va de sealizacin de la fosfatidilinositol-3-cinasa
(PI3K), las protenas sustrato del InsR, como la IRS1 e IRS2,
se unen a las tirosinas fosforiladas del InsR y se activan de

Receptor de insulina

www.fullengineeringbook.net
1IR

Cys

s s

Cys

Subunidad

1IR

s s
s s

2IR

Subunidad

Unin de insulina

s s

2IR

Dominio cataltico

Una vez en la sangre, la insulina llega a los dos rganos


blanco principales: las clulas del tejido adiposo y las de los
msculos; estas ltimas son las grandes consumidoras de
glucosa. Las clulas del msculo tienen receptores especcos para la insulina en su supercie.
Las acciones de la insulina inician con su acoplamiento
al receptor de insulina (InsR), el cual es una protena transmembranal heterotetramrica, compuesta de dos subunidades extracelulares alfa y dos subunidades beta transmembranales con actividad tirosina cinasa. La insulina se une a
dos sitios asimtricos de las subunidades extracelulares alfa,
con lo que se inducen cambios conformacionales que dan
lugar a la autofosforilacin de las subunidades beta insertadas a travs de la membrana y producen la activacin de la
tirosina cinasa intrnseca del receptor (enzima fosforilante).
En ese momento, la porcin intracelular del receptor
adquiere la capacidad de cinasa, y hace que una molcula de
fosfato (H3PO3) se combine con el aminocido tirosina en
cada subunidad, como se describe en la gura 22-3.
La subunidad beta tiene tres sitios de autofosforilacin:
uno cerca de la membrana; otro dentro del asa de regulacin, y el tercero en el extremo carboxilo terminal. La autofosforilacin es el inicio de una cascada de respuestas de
sealizacin celular que incluyen la fosforilacin de la familia de protenas IRS, de las cuales se han identicado al
menos cuatro, con estructuras qumicas similares, pero que
se distribuyen en forma distinta en los tejidos corporales. El
efecto insulnico se da por la activacin de la cadena fosfo-

2IR

2IR

Sitio de unin a ATP


Sitio de activacin

COOH-terminal

Figura 22-3. Estructura del receptor de insulina: dominios


funcionales del receptor. IR es un heterotetrmero con dos
subunidades extracelulares unidas a dos subunidades por
puentes disulfuro. Las subunidades contienen las regiones
de unin a insulina 1IR y 2IR en adicin a una regin rica
en cistenas (Cys). La subunidad contiene una porcin
extracelular, una transmembranal y una intracelular. En su
porcin intracelular se localiza un dominio cataltico de cinasa
de tirosina con un sitio de unin a ATP y sitios de fosforilacin
en tirosina que se localizan en las regiones juxtamembranal,
sitio de activacin y carboxilo terminal. (Tomado de Olivares
Reyes J.A., 2008.)

210

PARTE III Bases moleculares de las enfermedades

manera que pueden unir el dominio SH2 de la PI3K de la


clase IA, que se une a residuos de fosfotirosina en los receptores activados y protenas adaptadoras.
La unin de PI3K a fosfotirosinas en las protenas sustrato del InsR permite la liberacin de la subunidad p85 de
la PI3K que se encuentra inhibida por la subunidad p110
de PI3K. As, el heterodmero p85-p110 se puede unir a su
sustrato fosfatidil inositol -4, 5-bifosfato (PIP2) en la membrana plasmtica y producir fosfatidil inositol -3, 4, 5-trifosfato
(PIP3), como se muestra en la va descrita en la gura 22-4.
La sntesis de PIP3 lleva al reclutamiento de cinasas de serina/treonina, como Akt (tambin denominada protena
cinasa B o PKB), la cual se puede unir a lpidos de fosfatidil
inositol en las membranas celulares. Akt es miembro de
una familia de protenas (existen tres genes: Akt1, Akt2 y
Akt3) y se fosforila por PDK1 (complejo proteico mTor/Rictor), en el residuo de treonina 308 y serina 473, que la activan. Akt acta sobre varias protenas regulando procesos
como la sntesis proteica, el crecimiento y metabolismo
celular, la plasticidad neuronal y la apoptosis. Akt tambin
puede actuar sobre la cinasa glucgeno-sintetasa 3 (GSK3)
regulando la progresin del ciclo celular.

ellos pertenecen a la familia de las protenas IRS del receptor


de insulina. Otros incluyen a las protenas Gab-1, p60dok,
Cbl, APS e isoformas de Shc. Las tirosinas fosforiladas en
estos sustratos actan como zonas de acoplamiento para
protenas que contienen dominios de SH2.

Inhibicin de la sealizacin del receptor de insulina


En adicin a la fosforilacin de tirosina, tanto el receptor de
insulina como las protenas IRS son susceptibles a las fosforilaciones en sus residuos de serina, que pueden atenuar o abolir la va de sealizacin intracitoslica de la insulina, al
disminuir o interrumpir la fosforilacin de tirosina mediada
por la insulina y promover tambin interacciones con las
protenas 14-3-3. La familia de protenas 14-3-3 se caracteriza por estar implicada en la transduccin de seales
mediante su unin a protenas que contienen fosfoserina.
Las protenas 14-3-3 actan como moduladoras de la fosforilacin. Esto signica que, luego que una protena es fosforilada, se genera un sitio de unin para 14-3-3, y esta interaccin
realmente modica el estado de activacin de la protena
(gura 22-5).
Estas fosforilaciones retroalimentan de forma negativa la
sealizacin de insulina, y sirven como mecanismo molecular puente para la comunicacin cruzada de otras vas intracitoslicas involucradas en la resistencia a la insulina. En
este proceso se han implicado varias cinasas, incluyendo la

Sustratos del receptor de insulina


Se han identicado al menos nueve sustratos intracelulares
de las cinasas del receptor de insulina/IGF-1. Cuatro de

www.fullengineeringbook.net
Ins

IR
PI (4, 5)P2
PY
PY

PY

PY

IRS

PY
PY

Membrana
plasmtica

PI (3, 4, 5)P3

Akt
PDK1 T308 S473 PDK2

p110

p85

Citoplasma

a9

as

sp

Ca

p
p

mTOR

XO

FO

GSK3
Apoptosis
Sntesis de
protenas

PI (3, 4, 5)P3
p85 p110

PI3K

Adipognesis

Sntesis de
glucgeno

Figura 22-4. Activacin de la va de PI3K/AKT por insulina. Esta va representa el principal mecanismo por el que la insulina ejerce
sus funciones en el metabolismo. El IR activo y autofosforilado activa a IRS, que contiene varios sitios de fosforilacin en residuos
de Tyr (Y) que, al ser fosforilados por el IR, se convierten en sitios de unin y activacin de protenas que contienen dominios SH2
como PI3K. La PI3K posee una subunidad reguladora (p85) y una subunidad cataltica (p110). La interaccin entre p85/IRS-1 da
por resultado la activacin de p110 y ya activada la p110 tiene acceso a su sustrato PI(4,5)P2, el cual es fosforilado en la posicin
3 del inositol, generando PI(3,4,5)P3, que sirve como sitio de unin para cinasas de Ser como PDK1 y Akt. El complejo proteico
PDK2 activa a Akt, lo que induce una primera fosforilacin en la Ser473 seguida de una segunda fosforilacin en la Thr308, esta
ltima inducida por PDK1. Akt regula varios de los efectos metablicos de la insulina a travs de regular la activacin de diferentes sustratos que propagan la respuesta, como mTor, FOXO, GSK3 y caspasa 9. (Tomado de Olivares Reyes J.A., 2008.)

CAPTULO 22 Bases moleculares de la diabetes mellitus

211

Insulina

Receptor de insulina (tirosincinasa)

IR

PIP3

IRS (p) en Ser y Tir

PTEN

Fosforila los IRS

Fosfatasa 3

IRS

-Msculo y tejido
adiposo
-Clulas
pancreticas P

SHIP2
Fosfatasa 5

14-3-3
inhibe a
IRS-IR

Protena
14-3-3

PI-3K
P

P
P

PI-3K activa
a IRS-Tir-P

PDK
Cascada de
fosforilacin

P
P

AKT

Translocacin
GLUT4

PI-3K
cataliza
PIP3

PIP3 activa
PDK

PDK fosforila
Akt

GLUT4

Figura 22-5. Va AKT y papel de la protena 14-3-3. La insulina se une a su receptor (IRS) y lo activa. ISR se forforila en Ser y Tir.
Cuando el dominio SH2 de PI-3K reconoce a la Tirosina fosforilada el IRS se activa. La protena 14-3-3 se une al sitio fosforilado
de serina e inhibe al IRS-IR. PI-3K activa se transloca y cataliza PIP3 que se une y activa la enzima PDK. PDK foforila la Akt (es
una serina/treonina quinasa humana) y la activa y nalmente hace que se trastoque el transportador Glut 4.

www.fullengineeringbook.net

PI-3K, Akt, la cinasa glucgeno-sintetasa GSK-3 y el receptor en mamferos de rapamicina (mTOR, mammalian target
of rapamycin). Por otro lado, la atenuacin de la sealizacin
de insulina inducida por tejido adiposo podra desencadenarse a travs de otras vas moleculares y genmicas que
ocasionan la activacin secuencial de la protena cinasa C
(PKC) y la cinasa del inhibidor del factor nuclear-kappa beta.
La accin de la insulina tambin es atenuada por protenas fosfatasas de tirosina (PTPasas), que catalizan una desfosforilacin rpida del receptor y sus sustratos.

Cascadas de fosforilacin estimuladas


por la insulina
Como en otros factores de crecimiento, la insulina estimula
la MAPK, para a su vez estimular la cinasa regulada por
seales extracelulares (ERK). Esta va involucra la fosforilacin de tirosinas en las protenas IRS y/o Shc, que a su vez
interactan con la protena adaptadora Grb2, reclutando la
protena de intercambio Son-of-sevenless (SOS) hacia la
membrana plasmtica para activar la protena Ras. La activacin de Ras requiere tambin la estimulacin de la tirosina
fosfatasa SHP2, a travs de su interaccin con sustratos
del receptor como Gab-1 o IRS1/2. Una vez activada, la
protena Ras opera como un interruptor molecular, estimulando a su vez una cascada de serinas-cinasas a travs de la

activacin secuencial de las protenas Raf, MEK y ERK.


La activacin de ERK la transloca al interior del ncleo en
donde cataliza la fosforilacin de factores de transcripcin,
que dan lugar a la proliferacin y diferenciacin celulares,
como se aprecia en la gura 22-6.

Transportadores de difusin
facilitada para hexosas
Los transportadores de difusin facilitada para hexosas
(Glut) son una gran familia de protenas y sus miembros
poseen caractersticas comunes con secuencias extremadamente conservadas que determinan estructuras secundarias
y terciarias (dominios o motifs). Estos dominios les dan
especicidad a los transportadores por uno o ms carbohidratos, determinan su distribucin tisular, la ubicacin
celular y la regulacin de su actividad por hormonas.
En los ltimos cuatro aos se han identicado nuevos
genes que codican protenas transportadoras tipo TDFH
para la glucosa y que pertenecen a la familia SLC2A (del
ingls SoLute Carrier 2A). Sobre la base de la homologa de
la secuencia primaria, la familia de los Glut puede dividirse
en tres subfamilias:
a) Familia de clase I: se encuentra formada por los Glut 1,
2, 3 y 4.

212

PARTE III Bases moleculares de las enfermedades

Se le considera un transportador basal, lo que es importante para el tejido nervioso y el eritrocito (los tejidos donde se
encuentra).

Insulina

Receptor de insulina

Glut 2 (SLC2A2): funcin glucosensora


Shc PY PY PY PY IRS
Grb2
Grb2
Ras SOS
SOS

GTP
GDP
Raf-1
Elk-1
ERK1/2

Transcripcin de genes

MEK

Figura 22-6. Activacin de la va de las MAPK por accin de la


insulina. La insulina activa la va de las MAPK a travs de dos
mecanismos: en el primero, la activacin del IR promueve la
asociacin de la protena Shc y sta une al complejo Grb2/
SOS; SOS activa a Ras y una vez activado se inicia el encendido de la cascada de las MAPK. GTP-Ras une y activa a Raf-1
que subsecuentemente lleva a la fosforilacin y activacin de
MEK y de las ERK1/2. Alternativamente, existe una va independiente de Shc pero dependiente de la activacin del IRS
por la que la insulina es capaz de activar a las MAPK. En esta
va, una vez que IRS est activo, se une al complejo Grb2/SOS,
siguiendo la misma secuencia de activacin de protenas para
Shc. (Tomado de Olivares Reyes J.A., 2008.)

Glut 2 es un transportador de glucosa con baja anidad


(Km = 15-20 mM), se expresa en el hgado humano adulto,
el rin, las clulas beta de los islotes de Langerhans y la
membrana basolateral de las clulas epiteliales del intestino
delgado. Se le atribuye la propiedad de glucosensor porque,
con una baja concentracin de glucosa en plasma, no es
capaz de transportar glucosa al interior de la clula beta y la
secrecin de insulina es muy baja. En cambio, despus de
una comida, cuando se incrementa la concentracin plasmtica de glucosa, el ATP generado por el metabolismo
puede estimular la liberacin de insulina. Glut 2 es un
transportador de tipo bidireccional, que puede transportar
glucosa desde la sangre al tejido o bien desde el tejido hacia
la sangre, lo que es muy til para el hgado y el rin.

Glut 3 (SLC2A3): Glut de ms alta


anidad por la glucosa
Glut 3 es un transportador de glucosa de alta anidad (Km =
1 a 2 mM) que primero fue caracterizado en el cerebro. Es
un transportador coagregado con Glut 1 en el tejido nervioso y la placenta. Este transportador participa en el desarrollo embrionario.

www.fullengineeringbook.net

b) Familia de clase II: constituida por los Glut 5, 7, 9 y 11.


c) Familia de clase III: formada por los Glut 6, 8, 10, 12,
el Glut 13, o transportador para mioinositol (HMIT -1),
y el Glut 14.

Glut 1 (SLC2A1): transportador


con alta anidad
Se encuentra en los tejidos que emplean glucosa como
combustible principal. A Glut 1 tambin se le conoce como transportador de glucosa eritrocito/cerebro. Se encuentra ampliamente distribuido en el ser humano y se expresa
en numerosos tejidos fetales y adultos, como los eritrocitos,
las clulas endoteliales, las clulas nerviosas, la placenta, los
glbulos blancos, las clulas de la retina, el rin (mesangio), el tejido adiposo, etc. Glut 1 tiene una alta anidad por
la glucosa (Km* = 1 a 2 mM), por lo que puede transportarla
al interior de las clulas a cualquier concentracin de sta.

* Nota: Km = constante de anidad: expresa la relacin de anidad que


tiene una enzima y su sustrato. El valor de esta constante es inversamente
proporcional a la anidad de la enzima por el sustrato.

Glut 4 (SLC2A4): Glut con gran movilidad


Glut 4 es un transportador de alta anidad para la glucosa
(Km = 5 mM) que se expresa fundamentalmente en el tejido
muscular estriado, el tejido muscular cardiaco y el adipocito.
Glut 4 representa un mecanismo muy no de regulacin del
metabolismo de la glucosa, que slo permite la entrada de
glucosa al tejido muscular cuando es lo sucientemente elevada como para estimular la secrecin de insulina que favorecer la entrada del excedente de glucosa al interior
muscular. El mecanismo de Glut 4 es a travs de la unin de
vesculas con la membrana plasmtica gura 22-7. Este
complicado sistema requiere el concurso de una serie de
protenas de las vesculas y de la membrana, que se denominan en conjunto protenas Snare. La translocacin de Glut 4
a la membrana tambin requiere de la activacin de la enzima fosfatidilinisitol-3-cinasa (PI-3K), por intermedio del
IRS-1 fosforilado, que forma un complejo con dicha enzima
que produce un incremento de su actividad unas 20 veces.

Glut 5 (SLC2A5): transportador


especco para fructosa
Se expresa fundamentalmente en las clulas del ribete en el
cepillo del intestino delgado, donde media el paso de la
fructosa desde el lumen hasta la clula epitelial intestinal

CAPTULO 22 Bases moleculares de la diabetes mellitus

213

Extracelular

que la capacidad de transporte de glucosa en el msculo es


casi normal, sin que se observe un incremento compensatorio en la expresin de Glut 1 o 3. Este abordaje llev a la
identicacin y la caracterizacin de Glut 8 y Glut 9 (en
la actualidad reclasicado como Glut 6).

Intracelular

Glut 9 (SLC2A9): el verdadero Glut 9

Glucosa

Receptor GLUT-4
A

C
D
NH2

COOH

Figura 22-7. Activacin de Glut 4. La glucosa ingresa a la clula


en cuatro etapas: 1) se une al transportador en la cara externa
de la membrana; 2) el transportador cambia de conformacin
y la glucosa y su sitio de unin quedan localizados en la cara
interna de la membrana; 3) el transportador libera la glucosa al
citoplasma, y 4) el transportador libre cambia nuevamente de
conformacin, expone el sitio de unin a la glucosa en la cara
externa y retorna a su estado inicial.

(Km = 10 a 13 mM). Niveles bajos de este transportador


tambin se encuentran en los eritrocitos, el rin, los espermatozoides, el msculo esqueltico y el tejido adiposo de
humanos y ratas.

Glut 9 es un transportador perteneciente a la clase II, con


una homologa de 55% con Glut 5. Se expresa de manera
importante en el rin y el hgado, y a bajos niveles en el
intestino delgado, la placenta, el pulmn y los leucocitos.

Glut 10 (SLC2A10): hace pareja


con el Glut 2
El Km de Glut 10 es de 0.3 mM. El gen del transportador se
localiza en una regin asociada fuertemente con posibles
diabetogenes. La localizacin del gen y sus propiedades
funcionales sugieren que Glut 10 puede llevar a cabo funciones metablicas de gran importancia y ser un elemento
clave en el desarrollo de la DM2. Este transportador se
encuentra en mayor concentracin en el hgado (adulto y
fetal), as como en el pncreas, el msculo cardiaco, el pulmn, el cerebro (adulto y fetal), el msculo esqueltico, la
placenta y el rin.

www.fullengineeringbook.net

Glut 6 (SLC2A6): Glut 6 de baja anidad,


como en el caso del Glut 23

Glut 11 (SLC2A11): un transportador


ms de fructosa

La protena ms similar Glut 6 es el transportador Glut 8


(44.8% de homologa).

Slo se han conseguido productos del gen de Glut 11 humano en el msculo esqueltico y cardiaco; de ste se han descrito 3 tipos de variantes: la primera es causada por la
existencia de tres exones de inicio diferentes. A diferencia
de Glut 4, la actividad del transporte de glucosa de Glut 11
es inhibida en gran medida por la fructosa, lo que lleva a
pensar que ste es un transportador para fructosa con baja
anidad para la glucosa.

Glut 7 (SLC2A7): un nmero fallido


Despus de analizar las secuencias de Glut 7 de ratas, se
concluy que ni los hepatocitos de rata ni los de humanos
contenan el ARNm equivalente al que se clon en los experimentos iniciales, por lo que se inere que el hallazgo inicial
de Glut 7 fue un artefacto de las tcnicas de clonaje usadas
en la poca. Ms adelante se detect un gen con caractersticas similares a la de los Glut adyacentes al gen de Glut 5,
con el cual tiene gran similitud (58% de homologa). Este
gen se ha denominado provisionalmente SLC2A7, aunque
an no se conoce el patrn de expresin de este gen ni la
especicidad de su trnscrito por sustratos.

Glut 8 (SLC2A8): se inicia la carrera


por descubrir nuevos Glut
Al encontrar niveles muy bajos de ARNm de las isoformas
conocidas de estos transportadores, surge la idea de la existencia de nuevos transportadores. Experimentos en ratones
que no expresan Glut 4 (Glut 4 knockout mice) mostraron

Glut 12 (SLC2A12): hermano menor


del Glut 4
El ADNc de este Glut codica para una protena de 617
aminocidos que posee las caractersticas esenciales de los
Glut. El grado de homologa de este transportador con Glut
4 es de 29% y con Glut 10 de 40%. Glut 12 presenta un asa
extracelular de gran tamao entre las hlices transmembrana 9 y 10. El inmunoblot ha puesto en evidencia la
expresin de Glut 12 en el msculo esqueltico, el tejido
adiposo y el intestino delgado. Este hecho ha planteado la
hiptesis de que este transportador representa el elusivo
segundo sistema de transporte sensible a la insulina que se
encuentra en clulas musculares, ya que su ARNm se ha
encontrado en el msculo y en la prstata.

214

PARTE III Bases moleculares de las enfermedades

Glut 13 (SLC2A13): transportador de


mioinositol dentro de la clasicacin
de los Glut
Glut 13, o transportador de H+/inositol, codica para una
protena transportadora de membrana de 629 aminocidos
con una analoga de 35% con Glut 6 y que se expresa fuertemente en clulas de la gla y en algunas neuronas, con la
capacidad de transportar mioinositol y glucosa cuando se
encuentra a una alta concentracin. El inositol y sus derivados fosforilados (fosfoinositsidos) tienen una funcin
importante como osmolitos y como segundos mensajeros
en la regulacin de la exo y la endocitosis de vesculas. La
expresin de este transportador en ovocitos de Xenopus
laevis ha demostrado que la actividad de transporte es casi
exclusiva para el mioinositol y algunos de sus ismeros, con
una Km de 100 mM. Su expresin preferencial en el sistema
nervioso central hace pensar que su principal papel est en
la regulacin de estos metabolitos en el cerebro.

Glut 14 (SLC2A14): una codicacin lejana


Este Glut est codicado unas 10 Mb corriente arriba del
gen del Glut 3, con el cual comparte un importante parecido. Hasta ahora se haba credo que Glut 14 era un seudogen (como el Glut 6, en sus principios), resultado de la
duplicacin del gen de Glut 3. El gen de Glut 14 posee
dos formas: una corta, que consiste en un trnscrito de 497
aminocidos, similar al Glut 3 en un 94.5%. La segunda forma, llamada forma larga, codica para una protena de 520
aminocidos que diere de la anterior en el extremo aminoterminal. Sin embargo, en contraste con Glut 3 este
transportador se expresa fundamentalmente en los testculos, donde su ARNm se encuentra en una concentracin
cuatro veces mayor que Glut 3.

Genes de susceptibilidad a
diabetes mellitus tipo 1 y 2
La aplicacin de tcnicas de biologa molecular ha avanzado en la bsqueda de marcadores genticos asociados a
diversas enfermedades, para su diagnstico y tratamiento
oportunos.
En contraste con la DM1, en donde se ha encontrado
una estrecha relacin con los genes del sistema HLA, en la
DM2 no ha sido posible establecer un solo gen involucrado
con esta enfermedad. Sin embargo, se han descrito varios
genes relacionados con esta afeccin, entre los que destacan
los genes que codican para las protenas involucradas en la
va de sealizacin de la insulina, el transporte de la glucosa, la sntesis de glucgeno, la sntesis y absorcin de cidos
grasos y la diferenciacin de los adipositos (cuadro 22-3).
Formas menos comunes de DM2 como las MODY presentan herencia autosmica dominante (formas mendelianas).
Este subtipo de diabetes, generalmente de inicio temprano,
al igual que la diabetes de herencia compleja, es genticamente heterognea. A la fecha se han descrito seis genes
causales de MODY distintos: el gen que codica para la
enzima glucocinasa, regulador importante de la secrecin
de insulina por el pncreas, y cinco genes ms que codican
para factores transcripcionales involucrados en la expresin del gen de la insulina y otros genes pancreticos, como
el factor nuclear de los hepatocitos (HNF) 4 alfa, (HNF-4),
HNF-1, HNF-1, IPF-1 y beta2/neuroDl.

www.fullengineeringbook.net
Diabetes y actividad fsica: efecto en glut 4,
glucogenlisis y resistencia a la insulina

Los efectos beneciosos de la actividad fsica para el tratamiento de la DM2 son reconocidos. En varias investigaciones

Cuadro 22-3. Genes candidatos asociados a diabetes tipo 2.


Gen

Funcin

CAPN10

Calpana 10, posee actividad enzimtica intracelular tipo cistena-proteasa. Pertenece al grupo de peptidasas de las calpanas.

PAR-

Receptor activador de los peroxisomas, protena nuclear involucrada en las rutas metablicas de los cidos grasos.

PPARGC1A

Coactivador 1 del PPARG. Protena que funciona como receptor nuclear y cofactor transcripcional. Est involucrado en la
diferenciacin del adipocito, en la gluconeognesis, en la oxidacin de los cidos grasos y en la termorregulacin.

UCP-1

Protenas desacopladoras, participa en el transporte de protones.

UCP-2

Participa en la unin y el transporte de protones. Se relaciona con el desarrollo de la obesidad.

UCP-3

Est involucrado en el metabolismo de los lpidos y el intercambio de gases durante la respiracin; tambin participa en el
transporte de protones.

IRS-1

Sustrato del receptor de la insulina. Protena citoplasmtica que al unirse al receptor de la insulina activa la va de sealizacin de la glucosa.

SUR1

Receptor de la sulfonilurea. SUR-1 Cassette que une ATP. Algunas mutaciones se han asociado con DM2.

Grelina

Ligando endgeno que regula la secrecin de la hormona de crecimiento (GH). Participa en la sealizacin clula/clula
acoplado a protenas G.

Adipo

Hormona secretada por los adipocitos que regula la homeostasis de la glucosa y el metabolismo de los lpidos.

-2

CAPTULO 22 Bases moleculares de la diabetes mellitus

215

AMPK y consumo de glucosa del msculo

se ha demostrado que el ejercicio aerbico es una forma


muy conveniente de entrenamiento, aunque hoy en da en
pacientes con DM2, tambin se recomienda el ejercicio de
sobrecarga como un componente importante de los programas de acondicionamiento f sico.
En los miocitos, existen dos transportadores de glucosa,
Glut 1 y Glut 4. Se considera a las protenas Glut 1 los transportadores basales de la glucosa, porque su presencia en la
membrana celular no vara. En otras palabras, las clulas
musculares poseen un nmero determinado de protenas
Glut 1 en la membrana celular para transportar glucosa. Sin
embargo, los transportadores Glut 4 se desplazan a la supercie de la clula en respuesta a la insulina o a la contraccin
muscular inducida por la actividad f sica (gura 22-8). As,
el ejercicio f sico aumenta el nmero de protenas Glut 4 en
la membrana celular y, por consiguiente, la sensibilidad a la
insulina, ya que es translocado hacia la membrana de
la clula muscular, sin intervencin de la insulina. Una simple caminata permite la entrada de 100 g de glucosa/hora a
los msculos; mientras que el ejercicio intenso permite
la entrada, como mximo, de 200 g de glucosa/hora.

La protena cinasa activada por AMP (AMPK) es una enzima que se activa cuando se produce un cambio en los depsitos energticos de la clula, debido a mecanismos de
contraccin. Tambin se ha visto que cuando el msculo se
ejercita se activa por hipoxia. Su papel crucial en el consumo de glucosa se ha demostrado siolgica y farmacolgicamente. Este mecanismo, observado in vitro, se presenta
de manera independiente de los mecanismos inducidos por
la insulina. En la medida que AMPK activa el consumo de
glucosa en el msculo, los niveles de glucosa sangunea descienden. La magnitud de este fenmeno es dependiente del
contenido de glucgeno muscular, del grado de entrenamiento del msculo y del tipo de bras musculares que lo
componen. Otro fenmeno implicado en el consumo de
glucosa por AMPK es la accin de sta sobre la sensibilidad
del receptor de insulina, asociada a la disminucin de triglicridos (TG) intracelulares. Dichos TG entorpecen la sealizacin de insulina y junto con la disminucin de Malonil
CoA estn implicados en la patogenia de la RI.

Ins

Glucosa

www.fullengineeringbook.net
IR

Membrana
plasmtica
PDK1

PI (4, 5)P2

p110

PY

PY

PY

PY

PY

PY

PY

PY

IRS

p85 PY

Complejo
APS/CAP/
Cbl

PKC p
/ p

PI (3, 4, 5)P3

PY

IRS

p110

PDK2

PDK1

PY p85
T308

S473

Akt

Rab-GTP act
Citoplasma

Cbl
Crk
p

PI (3, 4, 5)P3

p85

p110

C3G

Par
6/3
p
TC10 p
PKC /
AS160

Rab-GDP inh
GLUT4

PI3K

Figura 22-8. Regulacin del transporte de glucosa por insulina. La insulina promueve la translocacin del transportador Glut 4
de compartimentos intracelulares a la membrana plasmtica. La protena AS160 en su estado no fosforilado y activo regula
negativamente a la protena G pequea Rab, la cual participa en el trco vesicular de Glut 4. AS160 estimula la hidrlisis
del GTP unido a las Rab (generando Rab-GDP, inactivo) e inhibiendo el trco vesicular. Cuando la AS160 es fosforilada
por Akt se inhibe, lo que incrementa el trco-dependiente de Rab-GTP (activo) de Glut 4 a la membrana plasmtica. Por
otra parte, PDK1 induce tambin la fosforilacin de sitios crticos en el asa de activacin de dos formas atpicas de la PKC
(PKC/ ), que contribuyen de gran manera a la translocacin de Glut 4 inducida por insulina. Recientemente, se describi
una va alternativa independiente de PI3K/PDK1/Akt, en donde la unin de insulina a su receptor activa a la protena G pequea
TC10 va el complejo APS/CAP/Cbl. Es as que TC10 participa en la activacin de las PKC/ que produce la translocacin
de Glut 4. (Tomado de Olivares Reyes J.A., 2008.)

216

PARTE III Bases moleculares de las enfermedades

El AMPK tambin estimula la translocacin de los


transportadores de glucosa, Glut 4. La presencia de xido
ntrico estimula el AMPK, y ste, a su vez, el metabolismo
de glucosa.

Seales hacia el transporte de glucosa


durante el ejercicio
El ejercicio induce, de manera independiente del mecanismo de la insulina, la incorporacin y el consumo de glucosa
por parte del msculo. Al parecer, uno de los mecanismos
esenciales est mediado por las variaciones en las concentraciones del Ca2+ por medio de la activacin de la PKC que
involucra al AMPK y otras protenas que corresponden a la
cascada de seales de insulina, como la p38 y la familia de
las MAPK.
Durante el consumo de glucosa por parte del msculo,
estn involucrados los procesos de aumento del aporte de
glucosa a la membrana celular, debido al incremento de la
capilaridad y perfusin que supone el ejercicio, y seguidamente por una mayor capacidad de transporte de la membrana obtenida por la va de translocacin de los Glut 4 y

por los microtbulos que los trasladan desde el espacio


intracelular a la membrana. En la contraccin repetida del
msculo se incorporan diacilgliceroles, que inhiben la cascada de seales de insulina y, por lo tanto, funcionan como
protenas moderadoras de la entrada de glucosa al citoplasma celular.

Aspectos ligados al entrenamiento fsico


El entrenamiento f sico incrementa la posibilidad de metabolizar u oxidar cidos grasos, gracias al aumento de la capilaridad que posee el tejido muscular entrenado. ste es capaz
de modicar el umbral oxidativo y, ante una misma carga, el
msculo entrenado puede cambiar la proporcin oxidativa
de grasas y glucgeno. Por otro lado, se ha observado que el
exceso de glucosa plasmtica, acompaado de elevaciones
de insulina, inhibe la oxidacin de cidos grasos en el
msculo. Este efecto no sucede a la inversa, es decir, ante un
aumento de cidos grasos circulantes no aumenta la capacidad oxidativa de grasas por parte del msculo durante el
ejercicio. Esto es muy importante ante los diferentes estados
siopatolgicos relacionados con la RI.

Ejercicios de integracin

www.fullengineeringbook.net

1. Complete el siguiente cuadro de clasicacin de los tipos


de DM con la informacin contenida en el captulo.

Diabetes tipo 1
Prevalencia en Mxico

Enfermedad/Estado desencadenante

Edad de inicio

Genes asociados

Defecto en la sealizacin de insulina

Niveles de insulina plasmtica

Complicaciones

Tratamiento

Diabetes tipo 2

Diabetes MODY

Diabetes
gestacional

CAPTULO 22 Bases moleculares de la diabetes mellitus

217

2. Complete el siguiente esquema de la sealizacin de insulina, rellenando los cuadros con los nombres de las
molculas:

Cadena
GLU

Cadena

P-Ser
Transcripcin
de genes

IRS-1
p11 p85
Fosfatidil
Inositol

Bibliografa

www.fullengineeringbook.net

Aguilar-Salinas C.A., Velazquez Monroy O., Gmez-Prez F.J., Gonzlez Chavez A., Esqueda A.L., Molina Cuevas V., et al. Charac-

teristics of the patients with type 2 diabetes in Mexico: results


from a large population-based, nationwide survey. Diabetes
Care, 2003;26:2021-2026.
American Diabetes Association. Report of the expert committee on
the diagnosis and classication of Diabetes Mellitus. Diabetes
Care, 1997;21(Suppl 1):S5-S16.

Bolen S., Feldman L., Vassy J., Wilson L., Yeh H.C., Marinopoulos
S, et al. Systematic review: comparative eectiveness and safety

of oral medications for type 2 diabetes mellitus. Ann Intern Med,


2007;147(6):386-399.
Canizales-Quinteros S., Huertas-Vzquez A., Riba-Ramrez L.,
Monroy-Guzmn A., Domnguez-Lpez A., Romero-Hidalgo S., et
al. Identicacin de distintos loci de susceptibilidad relacio-

nados al desarrollo de diabetes de inicio temprano y enfermedad cardiovascular en familias mexicanas. Gac Md Mx.
2005;141(2):115-122.
Cruz M., Garca-Mena J., Lpez-Ordua E., Valladares A., Snchez R., Wacher-Rodarte N., et al. Genes candidatos como

posibles marcadores de susceptibilidad a diabetes tipo 2. REB,


2005;24(3,4):81-86.
Inzucchi S.E. Oral antihyperglycemic therapy for type 2 diabetes:
scientic review. JAMA, 2002;287(3):360-372.
NICE. Clinical Guideline. Management of type 2 diabetes: Management of blood glucose. Londres: National Institute for Clinical
Excellence; 2002.
Olaiz-Fernndez G., Rojas R., Aguilar-Salinas C.A., Rauda J., Villalpando S. Diabetes mellitus en adultos mexicanos. Resultados

de la Encuesta Nacional de Salud 2000. Salud Pblica Mex,


2007;49(Supl 3):S331-S337.
Olivares Reyes J.A., Arellano Plancarte A. Bases moleculares de las
acciones de la insulina. REB, 2008;27(1):9-18.
Plum L., Belgardt B.F., Brning J.C. Central insulin action in energy
and glucose homeostasis. J Clin Invest, 2006;116(7):1761-1766.
U.K., Prospective Diabetes Study (UKPDS) Group. Lancet,
1998;352(9131):837-853.

Captulo

23

Bases moleculares de la obesidad


Blanca Estela Bastidas Ramrez / Anglica Sof a Gonzlez Garibay
Alfonso Lpez Vzquez / Viviana Carolina Nez Valdez

Introduccin

dista L. A. J. Quetelet, por lo que el IMC tambin se conoce


como ndice Quetelet. El IMC es la relacin resultante de
dividir el peso corporal en kilogramos (kg) entre la talla en
metros al cuadrado (m2):
IMC = peso en kg / talla en m
Con base en la clasicacin de la Organizacin Mundial
de la Salud (OMS), se considera que un IMC igual o mayor
de 30 kg/m2 corresponde a obesidad (cuadro 23-1). Asimismo, un valor de IMC igual o mayor a 25 kg/m2 aumenta las
probabilidades de desarrollar enfermedades asociadas con
la obesidad. Se estima que la herencia en la variacin del
IMC est en el rango de 0.4 a 0.7; es decir, la probabilidad de
heredar la obesidad es muy baja y est ms asociada a factores exgenos.

Durante las ltimas dcadas la obesidad se ha convertido en


una enfermedad con una alta prevalencia a escala nacional y
mundial. A 2012, Mxico ocupa el primer lugar de obesidad en adultos y el segundo en obesidad infantil. La obesidad
aumenta seis veces el riesgo de padecer enfermedades crnicodegenerativas no transmisibles, como diabetes mellitus
tipo 2 (DM2), enfermedad cardiovascular (ECV) y enfermedad cerebrovascular. En la actualidad, estas tres enfermedades constituyen las principales causas de mortalidad en
Mxico.
Hasta hoy, los avances cientcos y tecnolgicos han
brindado una respuesta incompleta de la etiologa de la obesidad. Es evidente que los factores genticos y ambientales,
como una dieta incorrecta y la inactividad f sica, participan
en el desarrollo de esta enfermedad. Es fundamental comprender los mecanismos moleculares que regulan el hambre
e inducen la ingesta de alimentos, as como de los mecanismos de las seales de saciedad, para encontrar alternativas
en la prevencin y el tratamiento de la obesidad.

www.fullengineeringbook.net
Comorbilidades de la obesidad

La obesidad es un factor de riesgo para desarrollar resistencia a la insulina (RI), DM2, ECV, accidente cerebrovascular,
osteoartritis, cncer del endometrio, cncer de mama y
cncer de colon, entre otras afecciones crnicas no transmisibles asociadas. Adems, la obesidad tambin est
vinculada a varias enfermedades digestivas, que incluyen la
enfermedad por reujo gastroesofgico, la esofagitis erosiva, plipos colorrectales y la esteatohepatitis no alcohlica.
La obesidad y el sobrepeso estn asociados a 44% de los
casos de DM2, 23% de los casos de cardiopatas isqumicas
y 7 a 41% de los casos de cncer.

Obesidad
Denicin
La obesidad es una enfermedad crnica degenerativa multifactorial caracterizada por un aumento desproporcionado
de tejido adiposo, o adiposidad, en el organismo, que se
asocia con el deterioro de la salud. Este aumento de tejido
adiposo se debe al balance energtico positivo resultado del
desequilibrio entre la ingesta calrica y el gasto energtico.

Tejido adiposo
El tejido adiposo, o tejido graso, es de origen mesenquimal
y representa un tipo de tejido conjuntivo. Est conformado
por adipocitos que acumulan triglicridos en su citoplasma.
Estos adipocitos tienen dos funciones primordiales: reserva
de energa y termognesis. Sin embargo, al tejido adiposo se

Diagnstico de obesidad
El ndice de masa corporal (IMC) es una estimacin indirecta para diagnosticar la obesidad y fue ideado por el esta218

CAPTULO 23 Bases moleculares de la obesidad

219

Cuadro 23-1. Clasicacin de la Organizacin Mundial de la Salud de los valores del IMC para el diagnstico de la obesidad.
IMC OMS
(kg/m2)

IMC NOM
(kg/m2)

Clasicacin

Menor de 18.5

Peso bajo

18.5 a 24.9

Normal

25 a 29.9*

Sobrepeso

30 a 34.9**

Obesidad nivel I

35 a 39.9

Obesidad nivel II

Mayor a 40

Obesidad nivel III mrbida

*En poblacin mexicana el sobrepeso se diagnostica con valores de IMC 25; pero < 27, as como IMC > 23 en poblacin de talla baja.
**En poblacin mexicana se diagnostica obesidad si el valor de IMC es 27 y en poblacin de talla baja si el IMC > 25.

le reconoce actualmente como un rgano endocrino, debido a que no slo responde a sistemas tradicionales de hormonas y al sistema nervioso central (SNC), sino que
expresa y secreta diversas protenas con funciones endocrinas. Entre stas se encuentran la adiponectina, la leptina, la
resistina, diversas citocinas, componentes del complemento, el factor inhibidor del activador de plasmingeno-1 y
protenas del sistema renina-angiotensina. Por tanto, el
conocimiento de la funcin de estas molculas contribuir
a comprender el complejo desarrollo de la obesidad.
En el adulto, el balance energtico positivo ocasiona un
aumento en el tamao del adipocito, fenmeno conocido
como hipertroa, mientras que en nios y adolescentes predomina el aumento en el nmero de adipocitos, lo que se
conoce como hiperplasia. La hipertroa del adipocito ocasiona modicaciones en su expresin gnica, de tal manera
que aumenta la sntesis del factor de necrosis tumoral alfa
(TNF), una citocina proinamatoria sintetizada principalmente por los macrfagos. El TNF, a su vez, aumenta la
secrecin de la citocina proinamatoria llamada interleucina 6 (IL6). De esta manera, el TNF, junto con la protena
de unin al retinol srico y la protena C reactiva, se consideran marcadores de inamacin en obesidad.
Otro de los cambios en la expresin gnica es la alteracin de la sntesis de protenas como la adiponectina, la leptina y la resistina.

entre los niveles circulantes de adiponectina y la cantidad


de masa grasa presente en un organismo o su IMC.
En un estudio longitudinal en adultos se sugiri que la
concentracin baja de adiponectina en plasma es un factor
de riesgo para presentar DM2. Este argumento se bas en
que los sujetos que desarrollaron DM2 presentaban concentraciones 22% ms bajas que quienes no la desarrollaron. Sin embargo, en este mismo estudio se encontr un
grupo de sujetos con obesidad de nivel II que tenan un rango siolgico de adiponectina plasmtica y no desarrollaron comorbilidades metablicas.
En modelos de ratones tratados con adiponectina se ha
encontrado que sta es un factor protector de RI en mayor
grado en los ratones obesos que en los que presentan un peso
normal. Un estudio realizado en nios mexicanos demostr
que la adiponectina tiene una fuerte asociacin inversa con la
edad, el IMC y las concentraciones de insulina. Adems,
la adiponectina mejora la sensibilidad a la insulina, inhibe la
gluconeognesis en el hgado, inhibe la expresin de molculas de adhesin, bloquea la migracin de macrfagos, evita la
formacin de clulas espumosas, reduce la produccin de
clulas B, disminuye la respuesta de las clulas T y favorece la
translocacin de los transportadores de glucosa.

www.fullengineeringbook.net

Protenas del tejido adiposo


Adiponectina
El gen de la adiponectina, o ADIPOQ, tambin conocido
como ACDC, ACRP30, APM1 o GBP28, se localiza en el
cromosoma 3q27 y se expresa principalmente en el tejido
adiposo blanco. La adiponectina es una hormona constituida por 244 aminocidos que contiene un pptido seal, el
cual permite su secrecin al exterior del adipocito. La adiponectina se modica de forma postraduccional mediante
hidroxilacin y glucosilacin. Debido a estas modicaciones, es capaz de conformar trmeros, hexmeros e isoformas de alto peso molecular. Existe una relacin inversa

Leptina
El gen de leptina (del griego leptos, delgado), se descubri en
1994 en el ratn. En el ser humano se localiza en el cromosoma 7q31.3 y se le ha denominado gen LEP, pero tambin
se le conoce como gen OB o gen de la delgadez. El gen OB
codica una protena no glucosilada, con carcter de hormona, de 167 aminocidos, con una secuencia seal de 21
aminocidos, que se elimina antes de que la leptina se transporte al torrente circulatorio como una protena de 146 aminocidos. En su forma activa, contiene una unin disulfuro
intercadena, la cual es importante para que la protena ejerza su actividad biolgica. La leptina presenta una alta homologa entre las diversas especies y equivale a 84% en el ratn
y 83% en la rata. Se expresa principalmente en tejido adiposo y los niveles circulantes son directamente proporcionales a la masa grasa.

220

PARTE III Bases moleculares de las enfermedades

Entre las funciones de la leptina destacan la disminucin


de la ingesta de alimento, el aumento del gasto energtico, la
estimulacin de la liplisis y la mejora de la sensibilidad a
la insulina. El aumento de la masa grasa se correlaciona con
el aumento en la sntesis de leptina. Por ello, los niveles de
leptina se han relacionado con obesidad, DM2 y RI.
En modelos animales se ha observado que, al recibir
una dieta alta en grasa, aumentan los niveles plasmticos de
leptina. La leptina atraviesa la barrera hematoenceflica
mediante un sistema de transporte saturable, de tal manera
que, aunque los niveles de leptina sean altos, no toda llegar
al SNC. A este hecho se le conoce como bloqueo leptinrgico o resistencia a la leptina (RL).
En sujetos obesos coexiste la RI y la RL, por lo que se ha
postulado que la leptina es la responsable de la relacin
entre la obesidad y la RI. Los nios y los adolescentes que
presentan DM2 y sobrepeso tienen mayor concentracin
de leptina con respecto a los sanos. La expresin del gen
LEP disminuye en caso de ayuno prolongado. Otro factor
que afecta los niveles de leptina es la prdida de peso, ya que
conduce a una disminucin rpida y desproporcionada de
leptina. Al parecer, las variaciones en las concentraciones
de leptina tambin dependen del sexo, ya que en mujeres se
han encontrado niveles ms elevados.
Se ha demostrado que la administracin de leptina exgena normaliza la hiperglucemia y la hiperinsulinemia en
modelos animales de obesidad gentica. La obesidad que se
acompaa de RL en humanos es ms grave.
Cuando la leptina ingresa al SNC induce la expresin
del trnscrito regulado por cocana y anfetamina (CART) y de
propiomelanocortina (POMC), y ste, a su vez, estimula los
receptores de melanocortina 3 (MC3R) y 4 (MC4R); este
proceso induce saciedad y bloquea el estmulo del hambre.

genotipo G de la regin promotora -420G incrementa la


expresin del gen y aumenta los niveles de resistina en plasma, que se relaciona con el desarrollo de obesidad y RI. Sin
embargo, otro grupo de investigadores no encontr correlacin entre los niveles de resistina en plasma y los SNP en
obesidad o DM2. Lo que s que se ha comprobado es que la
resistina tiene relacin estrecha con el entorno inamatorio,
debido a su predominante produccin por macrfagos y por
su correlacin con los niveles de IL6.

Regulacin del hambre y la saciedad


Regulacin central
Desde hace medio siglo, se conoce de la existencia de diversos mecanismos siolgicos que intervienen en la regulacin
homeosttica del peso corporal. Uno de estos mecanismos lo
lleva a cabo la leptina, que acta en el SNC. La adiposidad
ocasiona el incremento de la sntesis de leptina; la leptina
ingresa al SNC hacia el ncleo arqueado y estimula las neuronas productoras de POMC y CART, y al mismo tiempo la
leptina acta sobre neuronas que sintetizan neuropptido Y
(NPY) y la protena relacionada a Agouti (AgRP), bloqueando su sntesis (gura 23-1).

www.fullengineeringbook.net
Cambios en la ingesta de alimentos
y gasto de energa

NCLEO
ARQUEADO
VIA
OXIGNICA

NEURONA
EFECTORA

VA
ANOREXIGNICA

Resistina
El gen de la resistina (RETN) se localiza en el cromosoma
19p13 y codica un prepptido de 108 aminocidos, con un
pptido seal hidrofbico que es escindido antes de su
secrecin. La resistina es una hormona cuyo nombre se
deriva de su participacin en la RI, pertenece a la familia
FIZZ (found in inammatory zone), y tambin es conocida
como ADSF (adipocyte-specic secretory factor) o FIZZ3.
La resistina se expresa en el tejido adiposo visceral y en
macrfagos, y se ha demostrado que su expresin aumenta
durante la diferenciacin de adipositos; al disminuir el tejido adiposo visceral, disminuyen los niveles de resistina en
plasma. Tambin se ha demostrado que, en ratones, los
niveles de resistina estn relacionados con la glucemia. El
papel que esta protena desempea en humanos es controvertido, ya que no todas las personas con obesidad y DM2
tienen niveles plasmticos elevados de resistina.
Algunos investigadores apoyan la idea de que los polimorsmos de un solo nucletido (single nucleotide polymorphisms, SNP) de la resistina estn asociados con el desarrollo
de obesidad, RI y DM2. Se ha reportado en humanos que el

NPY,
AgRP

POMC,
CART

LEPR

LEPR

LEPTINA

TEJIDO
ADIPOSO

Figura 23-1. Regulacin central del hambre y la saciedad. La


liberacin de leptina del tejido adiposo es dependiente de la
adiposidad. La leptina se une al receptor de leptina (LEPR), el
cual se encuentra en la supercie de las clulas secretoras de
propiomelanocortina (POMC) y trnscrito regulador de anfetamina y cocana (CART); a su vez se comunica con una neurona efectora, disminuyendo la ingesta de alimentos. Se muestra
tambin cmo la leptina inhibe al neuropptido Y (NPY) y a la
protena relacionada a Agouti, las cuales al comunicarse con
una neurona efectora aumentan la ingesta de alimento.

CAPTULO 23 Bases moleculares de la obesidad

POMC es una protena de 285 aminocidos sintetizada


en el ncleo arqueado y el tracto solitario. Esta protena
puede sufrir una escisin proteoltica que resulta en la sntesis de ocho pptidos diferentes, como las tres isoformas
de la hormona estimulante de melanocitos alfa, beta y gamma. CART es una protena que promueve el balance negativo de energa, suprime la ingesta alimentaria y ejerce sus
efectos mediante la unin a MC3R y MC4R, los cuales
se expresan principalmente en cerebro. POMC y CART se
comunican con un