Sie sind auf Seite 1von 6

FILOGENIA DE ALGUNAS ESPECIES DE LA FAMILA BRUCHIDAE (COLEOPTERA)

USANDO DATOS MOLECULARES (12S SMALL SUBUNIT RIBOSOMAL RNA GENE,


PARTIAL SEQUENCE; MITOCHONDRIAL)

Reales-Caate, C.1
1
Estudiantes de Biologa, Universidad del Atlntico, Ciudadela Universitaria, Km 7 antigua
va a Puerto Colombia-Barranquilla, Colombia

INTRODUCCION
Las especies de la familia Bruchidae (Insecta: Coleoptera) son conocidas como brquidos, gorgojos
o escarabajos de las semillas. (Kingsolver, 2002; Romero, 2002).
La familia Bruchidae se encuentra conformada por ms de 1700 especies a nivel mundial. Se han
realizado muy pocos trabajos en esta familia, especialmente en lo miembros que habitan en los
bosques naturales (Reyes et al, 2009).
La familia Bruchidae fue ensamblada por Latreille en 1802. Aunque a travs de los aos la familia
ha sufrido cambios, gneros propuestos por Linn, 1767 (Bruchus); Fischer, 1807 (Kytorhinus);
Thumberg, 1805, 1815 (Pachymerus y Amblycerus); Schoenherr, 1833 (Spermophagus); Fahraeus,
1839 (Megacerus) y Horn, 1885 (Zabrotes) han permanecido dentro de la familia. Entre los grupos
conflictivos se encuentra el gnero Rhaebus, el cual fue descrito por Fisher von Waldheim en 1824
dentro de Curculionidae, posteriormente en 1826 Schoenherr lo traslada a Bruchidae, este mismo
autor en 1833 lo transfiere a Chrysomelidae y dentro de este grupo se ha colocado en diversas
subfamilias como Chrysomelinae, Criocerinae y Sagrinae. Posteriormente varios autores lo
removieron de Cherysomelidae, regresndolo a Bruchidae y viceversa; el trabajo ms reciente
elaborado por Kingsolver y Pfaffenberger (1980) en donde realizan un estudio ms riguroso sobre
morfologa de larvas y adultos de cinco especies de Rhaebus pone de manifiesto su estrecha y
definitiva relacin con los Bruchidae, para lo cual se propone la creacin de una nueva subfamilia
monotpica para Rhaebus. Lo interesante de este grupo de insectos es su color metlico, carcter
realmente poco usual en Bruchidae, que lo conecta con Sagrinae de Chrysomelidae; sin embargo,
por el carcter de ser espermatfago, la forma de la genitalia del macho, la antena subserrada,
presencia de una carina frontal en la cabeza, carina lateral en el pronoto, estras elitrales y la
estructura de las partes bucales de la larva ratifica la permanencia de este gnero en la familia
Bruchidae.
OBJETIVO

Determinar qu relacin cercana tiene las dos familia (Bruchidae y Chrysomelidae) usando
secuencias de ADN con el marcador 12S small subunit ribosomal RNA gene, partial sequence;
mitochondrial

ANTECEDENTES
Los estudios realizados Los gorgojos de las leguminosas o escarabajos de las semillas,
cientficamente conocidos como brquidos, constituyen un grupo monofiletico muy bien
caracterizado desde un punto morfolgico y biolgico, ya que renen caractersticas nicas que le
han merecido su consideracin con rango taxonmico de familia.pero en la taxonoma dentro del
rbol filogentico de los Chrysomeloidea, que en los inicios de la Taxonoma entomolgica tuvo
numerosos cambios hasta ser considerada una familia independiente (Bruchidae), desde mediados
del siglo XX ha estado sometida a una viva controversia, an inacabada, entre taxnomos y
filogenticos. Para unos, los brquidos constituyen un grupo monofiltico que se separ de los
restantes Chrysomeloidea, como lo hicieran anteriormente los Cerambycidae, por lo que debe
mantenerse su status como familia independiente (Bruchidae). Para otros, en cambio, estos insectos
deben ser incluidos dentro de la familia Chrysomelidae con rango de subfamilia (Bruchinae).
Segn Lacordaire (1866) puso en duda la relacin, que es demasiado cercana, de los brquidos
respecto de los Anthribidae, dentro del suborden Rhynchophora (siendo hoy la superfamilia
Curculionoidea), marcando una estrecha relacin con los Chrysomelidae, dentro del suborden
Phytophaga (hoy superfamilia Chrysomeloidea). Esta posicin al parecer que obtuvo mayor
consenso, por lo que finalmente estos insectos fueron situados dentro del suborden Phytophaga (hoy
Chrysomeloidea), con los que conlleva su condicin de escarabajos sin el rostro prolongado que
definitivamente identifica a los Curculionoidea. En muchas obras los brquidos conservaron la
denominacin especfica de Lariidae en muchas obras de la poca. Bridwell (1932) fue quien, en su
revisin de la familia Bruchidae, apart los Bruchela (actualmente en los Urodoninae) de Latreille,
si bien apartando tambin a los Rhaebus (entonces considerados como Chrysomelidae), que
nuevamente estn incluidos para los Bruchidae en el siglo XX.

PLANTEAMIENTO DEL PROBLEMA


Muchos de los trabajos realizados para el estudio de la familia bruchidae con relacin a la familia
chrysomelidae ha puesto que su estudio sea taxonmico y biolgico pero si tener en cuenta los datos
moleculares con un marcador en comn.
Por tal razn ser ha formulado esta pregunta Ser la familia bruchidae un grupo natural incluido
en la familia chrysomelidae y no sea un grupo independiente teniendo en cuenta un marcador
molecular?
METODOLOGIA
Se escogieron 17 especies de 6 gneros con secuencias de 12S small subunit ribosomal RNA gene,
partial sequence; mitocondrial encontrados en genbank que pueden ser de ayuda para la realizacin
de este trabajo

>gi|63028426|gb|AY945990.1| Acanthoscelides zonensis 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTATAATCATTTTAAAAATATTTCAAAATTACTGT
CAAATCCAAATTCAAATTTATATTAATATAAATTATCCTTAAATAAATTTATTGTAACCCATTTCTACTT
TATTATAAACTACACCTTGATCTGATTTACTTTTTAATAAAAATTCTTGAATATTAATATTCTATTAAAA
TATTCTAACTACGATGATATGTAAACTAATAAATAAAGTATTTCTAATCGTGGACTATCAATTACAGAAC
AGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTAATACTAATTTA
GTATTTTAATTTACATTTTAAATAATAGGGTATCTAATCCTAGTTTA

>gi|63028425|gb|AY945989.1| Acanthoscelides taboga 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATCTTTAAAAAATTTAAAAATTACTCT
CAAATCCAATTCAAATTTTTATAATAAAAATTATCCTTAAATAATTTTATTGTAACCCATTTCTACTTCA
CTATAAATTACACCTTGATCTGATTTATTTTTTTATAAAAAATCTTGAATATTAATATTCTAATAAAATA
TTCTACCTACGACGATATGTAAACTAATAAGTAAAGTTATTCTAATCGTGGACTATCAATTATAGAACAG
GTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTAATAATAATTTAGT
ATTTTAAATTTACATTTTCAATAATAGGGTATCTAATCCTAGTTTA

>gi|63028424|gb|AY945988.1| Acanthoscelides stylifer 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAATAAAATTTTAAAATTACTAT
CAAATCCATATTCAAATTTTTATAATAAAAATTATCTTAAAATAAATTTATTGTAACCCATTTCTTCTTT
ACTATAAACTACACCTTGATCTGATTTACTTTTTAATTAAAAATTTTAAATATTATGATTCTATTAAAAT
ATTTTAACTACGACGATATGTAAACTAATAAATAAAGTACATCTAATCGTGGACTATCAATTACAGAACA
GGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTAATACTAATTTAG
CATTTTAAATTTACATTTTTTATAATAGGGTATCTAATCCTAGTTTA

>gi|63028422|gb|AY945986.1| Acanthoscelides sanblas 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAAAAATATATTTAATATTACTT
TCAAATCCAAATTCAAATTTTTATAATAAAAATTATCCTTAAGTAAACTTATTGTAATCCATCTCTTCTT
TACTATAAACTACACCTTGATCTGATTTATTTTTTAATTAAAAATTACGAATATTATTATTCTAATAAAA
TATTCAACTACGACGATATATAAATTAAAAAATAAAGTATGTATATTCGTGGACTATCAATTACAGGACA
GATTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAAAATAACTAATACTAATTTAA
TATTTAAAATTACATTTTAAATAATAGGGTATCTAATCCTAGTTTA

>gi|41058670|gb|AY509807.1| Bruchus laticollis 12S small ribosomal RNA


gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTTTAATCATTTTAAATAAATATATAAAATTACTA
TCAAATCCAAATTCAAATTTTTATAATAAAAATTATCCTAAAATAATTTTATTGTAACTCATCTCTACTT
TCATATAAACTACACCTTGATCTGATTTATTTTTTAATATAAAATTTTGAATATTTAATTTTCTATTAAA
ATATTCAAACTACGACGATATGTAAATTAATAATAAAAGTACACCTAATCGTGGGTTATCAATTACAGGA
CAAGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACTTAACTAATACTAATTT
AGTATTTTAAATTTAAATTAAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457957|gb|AY390661.1| Bruchus loti 12S small subunit ribosomal RNA


gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAAATAAATTTTTAAAATTACTC
TCAAATCCAAATTCAAATTTTTATAATAAAAATTATCCTAAAATAAATTTAATGTAACCCATCTCTACTT
TAATATAAACTACACCTTGATCTGATTTATTTTTTAATATAAAATCTTGAACATTAAATTTCTATTAAAA
TATTCAAACTACGACGATATGTAAATTAATAATTAAAATAAATTTAATCGTGGACTATCAATTACAGGAC
AGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAGCTAATACTAATTTA
GTATTTCAAATTTAAATTAAGAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457961|gb|AY390665.1| Bruchus signaticornis 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTATAATCATTTTAAATAAATATATAAAATTACTC
TCAAATCCAAATTCAAATTTTTGTAATAAAAATTATCCTAAAATAATTTTATTGTAACTCACCTCTACTT
TAATATATACTACACCTTGATCTGATTTATTTTTTAATATAAAATCTTGAATATTAAATTTCTATTAAAA
TATTCAAACTACAATGATATGTAAATTAATAATTAAAGTACGTCTAATCGTGGACTATCAATTACAGGGC
AAGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTAAAGAACATAACTACTACTAATTTA
GTATTTAAAATTTACATTAAAAATAATAGGGTATCTAATCCTAGTTTA
>gi|40457963|gb|AY390667.1| Bruchus tristis 12S small subunit ribosomal
RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAAATAAATATATAAAATTACTC
TCAAATCCATATTCAAATTTTTATAATAAAAATTATCCTTAAATAATTTTATTGTAACTCACCTCTACTT
TAATATATACTACACCTTGATCTGATTTATTTTTTAATAAAAAATCTTGAATATTAAATTTCTATTAAAA
TATTCAAACTACGATGATATGTAAATTAATAATTAAAGTACATCTAATCGTGGACTATCAATTACAGGGC
AAGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTTAAGAACATAACTAATACTAATTTA
GTATTTTAAATTTACATTAAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457955|gb|AY390659.1| Bruchus dentipes 12S small subunit ribosomal


RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAAATAAATTTTTAAAATTACTC
TCAAATCCAAATTCAAATTTTTATAATAAAAATTATCCTAAAATAAATTTAATGTAACCCATCTCTATTT
TAATATAAACTACACCTTGATCTGATTTATTTTTTAATATAAAATCCTGAACATTAAATTTCTATTAAAA
TATTCAAACTACGACGATATGTAAATTAATAACTAAAATAAATTTTATCGTGGACTATCAATTACAGGAC
AGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTAATACTAATTTA
GTATTTTAAATTTAAATTAAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457948|gb|AY390652.1| Bruchidius seminarius 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTATAATCATCTTAAATAAATATTTTAAAATTACT
CTCAAATCCATATTCAAATTTTTTTTAAAAAAAATTATCCTAAAATAATTTTATTGTAACCCATCTCTCC
TTTACTATAAACTACACCTTGATCTGATTTATTTTTTTATTTAAAATTCTGAATATTCATAATTCTATTA
AAATATTCAAACTACGACGATATGTAAACTAATAAGTAAAGTTTTTATAATCGTGGACTATCAATTACAG
GACAGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTACTACTAAT
TTAGCATTATAAATTCACATTTAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457947|gb|AY390651.1| Bruchidius pygmaeus 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTATAATCATTTTATAAAAATATATTAAAATTACT
ATCAAATCCATATTCAAATTTTTTTAAAAAAAATTATCCTAAAATAAATTTAATGTAACCCACCTCTTCT
TTATTATAAACTACACCTTGATCTGATTTATTTTCTTATTTAAAACTTTGAATATTAATTTTCTATTAAA
ATATTCTAACTACGACGATATGTAAACTAATAAATAAAGTTCGTCTAATCGTGGACTATCAATTACAGGG
CAGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTGATACTAATTT
AGCATTTAAAATTCACATTTAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457946|gb|AY390650.1| Bruchidius pusillus 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTATAATCATTTTAAATAAATATTTTAAAATTACT
CTCAAATCCACATTCAAATTATTTTAAAAAAAATTATCCTAAAATAAATTTATTGTAACCCATCTCTCCT
TTACTATAAACTACACCTTGATCTGATTTATTTTTTAATATAAAACTCTGAATATTATATTTCTATTAAA
ATATTCAAACTACGACGATATGTAAACTAATAAGTAAAGTTTTTCTAATCGTGGACTATCAATTACAGAA
CAGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTAATACTAATTT
AGCATTTTAAATTCACATTTAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|40457945|gb|AY390649.1| Bruchidius picipes 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTATAATCATTTTATATAAATATATTAAAATTACT
ATCAAATCCAAATTTTAATTTTTTTAAAAAAAAATTATCCTAAAATAATTTTATTGTAACCCATCTCTCC
TTTATTATAAACTACACCTTGATCTGATTTATTTTTTAATAAAAAATTCAGAACATTTAATTTCTATTAA
AATATTCAAACTACGACGATATGTAAACTAATAAATAAAGTTCATCTAATCGTGGACTATCAATTACAGG
ACAGGTTCCTCTGAAAAGACTAAAACACCGCCAAATTTTTTAATTTTAAAGAACATAACTTATACTAATT
TAGTATTATAAATTTACATTTAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|55276441|gb|AY625319.1| Callosobruchus chinensis 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTGCATATTTTAGAGCTTAAATCATCTTATATAAATTATATAAAATTACT
ATCAAATCCAAATTCAAATCCCTTTAAAAAAAATTATCCTTAAATTAATTTATTGTAACCCATCTCTACT
TTATTATAAACTACACCTTGATCTGATTTACTTTTTAATTCAAAATTATAAATATTCAATTTCTAATAAA
ATATTTAAACTACAACGATATATAAATTAAAAAATAAAGTATTTTTAATCGTGGATTATCAATTACAGGA
CAGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAAAATAACTGATACTAATTT
AGTAATAAATAATTTACATTTAAAATAATAGGGTATCTAATCCTAGTTTA

>gi|55276442|gb|AY625320.1| Callosobruchus maculatus 12S small subunit


ribosomal RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTAAAATCATTATAAATATATATTTATAATTACTT
TCAAATCCACATTCAAATCCTTTTAAAAAAAATTATCCTTAAATATTTTTAATGTAACCCATCTCTACTT
TATTATAAACTATACCTTGATCTGATTTATTTTTTAATTTAAAATTATGAATATTTAACTTCTCTTAAAA
TATTCAAACTACAACGATATATAAATTAATAAATAAAGTTTTTCTAATCGTGGACTATCAATTACAGGAC
AGGTTCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACATAACTACTAATAATTTA
GTATCAAAAATTAACATTTAAAATAATAGGGTATCTAATCCTAGTTTA
>gi|63028401|gb|AY945965.1| Merobruchus placidus 12S small subunit
ribosomal RNA gene, partial sequence; mitochondrial
ATCCAAATTCAAATTTTTTTAAAAAAAATTATCCTGAAATAAATTTAATGTAACCCACCTCTCCTTTACT
ATAAACTACACCTTGATCTGATTGATTTTTTAATTTAAAATTATGAATATTAAATTTCTATTAAAATATT
CCAACTACGACGATATGTGAACTAATAAATAAAGTAAGTTTTATCGTGGACTATCAATTACAGGGCAGGT
TCCTCTGAAAAGACTAAAATACCGCCAAATTTTT

>gi|40457932|gb|AY390636.1| Pachymerus cardo 12S small subunit ribosomal


RNA gene, partial sequence; mitochondrial
TTAAGAGCGACGGGCGATGTGTACATATTTTAGAGCTTAATCATCTTAACTAAATAATTAAAATTACCCT
CAAATCCAAATTCAAACTTTTTTACTAAAAATTATCCTAAAATAAATTTATTGTAACCCATCTCTACTTT
ATTATAAACTACACCTTGATCTGATATCCTCACTAATTAATAATCATGAACATTATTCTCTTAAAATATT
CCAACTACAACGATATGTAAACTAATAAATAAAGTTCATTTAATCGTGGACCATCAATTACAGGACAGGT
TCCTCTGAAAAGACTAAAATACCGCCAAATTTTTTAATTTTCAAGAACTTAACTACTACTAATCTGGTAA
AAACACACTTTTAAAATAATAGGGTATCTAATCCTAGTTTA