Optimization of production conditions of Nisin bactreocin

produced from lactococcus lactis and its effect on

Staphylococcus aureus
Yazji S*,Mohamad M*,Malas B**
*Dept. of Food Science, Faculty of Agriculture, University of. Damascus
**Postgraduate student (PhD), Dept. of Food Science, Faculty of Agriculture, University of.
Damascus.

Abstract:
Best isolate lactococcus lactis B18 been selected according to its
effect on Staphylococcus aureus and were (6) mm as inhibition
diameters by halls method after pH modification, and nisin gene has
been detected by PCR technique, best production medium has been
selected and was M17 broth besides to 3% lactose and 3% yeast
extract, then production conditions have been optimized and were for
Staphylococcus aureus (pH: 6.5, temperature: 37oC, Incubation
time: 96H, and inoculation size: 1,5Ml), the inhibition diameter
became 11 mm.
Keywords: lactococcus lactis, nisin, Staphylococcus aureus.
Corresponding author: Email: bassammallas@hotmail.com , bassammmallas@gmail.com

Tel: +963 0955162805, +9630837255153.

Introduction:
In recent years bacterial antibiotic resistance has been considered a
problem due to the extensive use of classical antibiotics in treatment
of human and animal diseases (Roy, 1997; Lipsitch et al, 2000;
Yoneyama and Katsumata, 2006). As a consequence, multiple
resistant strains appeared and spread causing difficulties and the
restricted use of antibiotics as growth promoters. So, the continued
development of new classes of antimicrobial agents has become of
increasing importance for medicine (Kumar and Schweiser, 2005;
Fisher et al, 2005). In order to control their abusive use in food and
feed products, one plausible alternative is the application of some
bacterial peptides as antimicrobial substances in place of antibiotics
of human application. Among them, bacteriocins produced by lactic

acid bacteria have attracted increasing attention, since they are

active in a nanomolar range and have no toxicity.
Bacteriocins are proteins or complexed proteins biologically active
with antimicrobial action against other bacteria, principally closely
related species. They are produced by bacteria and are normally not
termed antibiotics in order to avoid confusion and concern with
therapeutic antibiotics, which can potentially illicit allergic reactions in
humans and other medical problems (Deraz et al, 2005).
Bacteriocins differ from most therapeutic antibiotics in being
proteinaceous agents that are rapidly digested by proteases in the
human digestive tract. They are ribosomally synthesized peptides,
and this fact creates the possibility of improving their characteristics
to enhance their activitiy and spectra of action (Saavedra et al,2004).
Antibiotics are generally considered to be secondary metabolites that
are inhibitory substances in small concentration, excluding the
inhibition caused by metabolic by-products like ammonia, organic
acids, and hydrogen peroxide. It is likely that most if not all bacteria
are capable of producing a heterogeneous array of molecules in the
course of their growth in vitro (and presumably also in their natural
habitats) that may be inhibitory either to themselves or to other
bacteria (Jack et al, 1995). Bacteriocin production could be
considered as an advantage for food and feed producers since, in
sufficient amounts, these peptides can kill or inhibit pathogenic
bacteria that compete for the same ecological niche or nutrient pool.
This role is supported by the fact that many bacteriocins have a
narrow host range, and is likely to be most effective against related
bacteria with nutritive demands for the same scarce resources
(Deegan et al, 2006).
Nisin is the most widely exploited and applied bacteriocin. It is
active against Gram (+) positive bacteria including highly pathogenic
and food spoilage microorganisms including S. aureus, B. cereus,
and L. monocytogernes. In the United States, its use has been
approve since 1988 by FDA for use in cheese, heat treated- chill
stored soups and pasteurized cheese spreads which are stored in
chill temperature. Nisin belongs to the Class I lantibiotics, is
composed by thirty-four amino acids and has a pentacyclic structure
with one lanthionine residue (Ring A) and four methyllanthionine
residues (rings B, C, D, E) nisin Z, the natural variant of nisin is
different only in that the histidine molecule on place 27 is replaced by
asparagines (Oliveira et al 2005).Nisin can be effective at nanomolar
concentrations depending on the target strain. Nisin is ribosomally
synthesized as a precursor peptide that is later enzymatically
modified. This prepeptide is biologically inactive and contains a c-

terminal prepeptide domain, following a variety of posttranslational

modification reactions, is cleaved from the N-terminal leader
sequence to yield the mature antimicrobial compound. It is an auto
regulatory two component system which can be activated fully by
nisin in very low sub toxic amounts (ng/ml) (Mierau 2005).Nisin is
heat stable at 121C but for prolonged heating, becomes less heat
stable, especially between pH 5 to 7. Nisin is sensitive to chymotrypsin but resistant to trypsin, elastase, carboxyl peptidase,
pepsin, and erepsin. Nisin is utilised as a food additive, is
commercially produced and is assigned under the number E234
(Mierau 2005) (Mierau and Lei 2005). And cause the severity and
likely hood of illnesses caused by pathogens specially
Staphylococcus aureus .
So that this research aimed to Optimize Nisin production conditions
and study its effect on Staphylococcus aureus .
Materials and Methods:
1- Selecting the best isolate according to its effect
Staphylococcus aureus
Lc.lactis has been isolated by using M17 media (MERCKGermany), added to it glucose sugar 0,5 % (Andr. et al, 2011).
And after isolation Lc.lactis from food samples and biochemical
assays have been done in former research, best isolate has been
selected according to its inhibition effect on Staphylococcus
aureus 10788, from BioBall company Australia by using halls
method (Tagg. and McGiven. 1971).
2- Detect nisin
technique:

gene

by

polymerase

chain

reaction

2-1. Total DNA Isolation

After bacterial cell growth at M17 broth at 37oC, the culture
Centrifuged at 7000g for 10 min and resuspend the cells in 5 mL of
lysis buffer. Then Incubated in a 37oC water bath for 2 h, 500 l of
10% SDS and 100 l of 25 mg/mL proteinase K was added.
Incubated in a
55oC water bath for 2 h. 2 mL of 5 M sodium chloride and 6 mL of
chloroformisoamyl alcohol then added, Incubation at room

temperature for 30 min. 1 volume of 100% isopropanol was added,

and washed with ice-cold 70% ethanol. Air-dry the DNA and
resuspend it in 600 l of TE buffer. (John and, Alicia 2001).
For the polymerase chain reaction: 2 l Dna isolated, 2.5 l Reaction
Buffer 10X, 3 l MgCl2, 0.5 l dNTPs, 1 l DNA polymerase, 1 l
primers, total size has been completed to 25 l by distilled water.
And nisin gene detection primers nucleated sequence Nisin F:
CGGCTCTGATTAAATTCTGAAG,
Nisin
R:
GGATTAGCTAGTAGTAACTGTTC.
2-2. Thermal program for polymerase chain reaction
Preheating at 92oC for 10 M for on cycle then, Denaturation phase:
94C for 54 S, Annealing phase: 50oC for 45 S, Extension phase: 72
oC for 45 S, For 30 cycles, and final extension at 72 oC for 10 M.
2-3. Electrophoresis has been done at Agarose gel 1.5% within
EDTA-Tris (TE) solution, to Separate nucleic acid fragments.
Samples are loaded into wells of an agarose gel and subjected to an
electric field, 85 volt, 150 amber, then studied at gel documentary.

3- Statistical program used was mini tab to optimize

temperature, pH, incubation time, inoculation size. After
choosing the best medium for nisin production
3-1. Choosing of production medium: five media has been used to
choose best medium for nisin production, M17 broth, M17 broth
besides to 0.5 % glocuse, M17 broth besides to 3% lactose and 3%
yeast extract, MRS, and MRS besides to 1% tween 80.
After choosing best broth for nisin production from lactococcus lactis
(M17 broth besides to 3% lactose and 3% yeast extract) production
conditions have been optimized.
3-2. Optimization of production conditions:
-

Choosing pH degree: many pH degrees have been tested for

production of nisin from lactococcus lactis (4.5 5 - 5.5 6 6.5).

Choosing temperature: many temperature degrees have been

tested for production of nisin from lactococcus lactis (25 28
31 34 - 37) oC.
Choosing incubation time: many times have been tested for
production of nisin from lactococcus lactis (12 24 48 72 96)h.
Choosing inoculation size: many sizes have been tested for
production of nisin from lactococcus lactis (0.5 1 1.5 2
2.5)ml.

Results:
Lc.lactis isolation and Selecting the best isolate according to its
effect on 1111 typhimurium and Staphylococcus aureus
Best isolate B18 been selected according to its effect on
Staphylococcus aureus as inhibition diameters by halls method after
pH modification. And the inhibition diameters were by average for
Staphylococcus aureus 6 mm.

Figer (1):
Choosing production medium and Optimization of nisin production
conditions:
Optimum production medium for nisin production was M17 broth
besides to 3% lactose and 3% yeast extract,

Tabe (1): Estimated Regression Coefficients for Staphylococcus

aureus :

Term

Coef

SE Coef

Constant

8.88523

0.7051

12.602

0.000

pH

0.57240

0.4070

1.406

0.178

Temperature

0.69745

0.4337

1.608

0.126

Time

-0.14398

0.4112

-0.350

0.731

Substrate

0.56852

0.4076

1.395

0.181

pH*pH

-0.37727

0.3358

-1.123

0.277

Temperature*Temperature

-0.76817

0.3339

-2.301

0.034

Time*Time

-0.79261

0.3767

-2.104

0.051

Substrate*Substrate

-0.90801

0.3200

-2.837

0.011

pH*Temperature

1.23106

0.8656

1.422

0.173

pH*Time

-0.47199

0.6346

-0.744

0.467

pH*Substrate

0.09389

0.5186

0.181

0.858

Temperature*Time

0.87932

0.8279

1.062

0.303

Temperature*Substrate

-0.36494

0.6823

-0.535

0.600

R-Sq = 76.9%

Response Optimizer plot:

Optimal
Hi
D
Cur
1.0000 Lo

pH
6.50
[6.50]
4.50

Temperat
37.0
[37.0]
25.0

Time
96.0
[96.0]
12.0

Substrat
2.50
[1.50]
0.50

ST
Maximum
y = 11.3537
d = 1.0000

Effect on Staphylococcus aureus

It has been noticed that the production of bacteriocin nisin and its
effect on Staphylococcus aureus . the inhibition diameter became 11
mm.
The optimum parameters were pH: 6.5, temperature: 37, Incubation
time: 96, and inoculation size: 1,5
The results disagree with scientist Mall results for the nisin
production medium and temperature (Mall et al 2010). And agree
with scientist Cheigh results for the nisin production medium but not
for production conditions (Cheigh 2002).
Discussion:
1- The main inhibition factor against Staphylococcus aureus was
by nisin bacteriocin after pH modification.
2- Optimization results on nisin production and its effect on
Staphylococcus aureus were: pH 5.5, temperature 31oC,
incubation time 54H, inoculation size 1.5 Ml.

REFERENCES:
-

Deegan, L. H. Cotter, P. D. Hill, C. and Ross, P. 2006.

Bacteriocins: Biological tools for biopreservation and shelf-life
extension. Int. Dairy J., 16, 1058-1071.

Deraz, S. F. Karlsson, E. N. Hedstrom, M. Andersson, M. M.

and Mattiasson, B. 2005. Purification and characterisation of
acidocin D20079, a bacteriocin produced by Lacto1111
acidophilus DSM 20079. J. Biotechnol., 117, 343-354.
Fisher, J. F. Meroueh, S. O. and Mobashery, S. 2005.
Bacterial resistance to beta-lactam antibiotics: compelling
opportunism, compelling opportunity. Chem. Rev., 105, 395424.
Jack, R. W. Tagg, J. R. and Ray, B. 1995. Bacteriocins of
Gram-positive bacteria. Microbiol. Rev., 59, 171-200.
Kumar, A. and Schweiser, H. P. 2005. Bacterial resistance to
antibiotics: active efflux and reduced uptake. Adv. Drug Deliv.
Rev., 57, 1486-1513.
Lipsitch, M.; Bergstrom, C. T. and Levin, B. R. 2000. The
epidemiology of antibiotic resistance in hospitals: paradoxes
and prescriptions. Proc. Natl. Acad. Sci. USA, 97, 1938-1943.
Roy, P. H. 1997. Dissemination of antibiotic resistance. Med.
Sci., 13, 927-933.
Saavedra, L. Minahk, C. Holgado, A. P. De R. and Sesma, F.
2004. Enhancement of the enterocin CRL35 activity by a
synthetic peptide derived from the NH2-terminal sequence.
Antimicrob. Agents
Chemother., 48, 2778-2781.
Yoneyama, H. and Katsumata, R. 2006. Antibiotic Resistance
in Bacteria and Its Future for Novel Antibiotic Development.
Biosci. Biotechnol. Biochem., 70, 1060-1075.
Oliveira, P. Nielsen, J. Forster, J. 2005. Modelling
Lactococcus lactis using a genome-scale flux model. BMC
Microbiology Journal. 5, 39-48.
Mierau, I. 2005. Optimization of the Lactococcus lactis nisincontrolled gene expression system NICE for industrial
applications. Microbial Cell Factories. 4, 16-28.
Mierau, I. Lei, J. P. 2005. Industrial scale production and
purification of an heterogenous protein in L.lactis using the
Nisin-controlled gene expression system NICE: The case of
lysostaphin. Microbial Cell Factories. 4, 1-9.
Mall, P. Mohanty, K. B. Patankar, B. D. Mody, R. and Tunga,
R. 2010. Physiochemical Parameters Optimization for
EnhancedNisin Production by Lactococcus lactis (MTCC 440)
BRAZILIAN ARCHIVES OF BIOLOGY AND TECHNOLOGY.
v.53 n.1: pp. 203-209.
John, F. T. Spencer and Alicia, L. Ragout de Spencer 2001.
Food Microbiology Protocols Humana Press Inc. Totowa, New
Jersey 07512.

AndreAbts, AntoninoMavaro,1 Jan Stindt,1 Patrick J.

Bakkes,1 SabineMetzger, Arnold J. M. Driessen,3 Sander H.
J. Smits,1 and Lutz Schmitt1. 2011. Easy and Rapid
Purification of Highly Active Nisin.
Cheigh, I. C. Choi, J. H. Park, H. Kim, S. B. Kook, M. C. Kim,
T. S. Hwang, J. K. and Pyun, Y. R. 2002. Influence of growth
conditions on the production of a nisin-like bacteriocin by
Lactococcus lactis subsp. Lactis A164 isolated from kimchi.
Journal of Biotechnology. 95, 225235
Tagg, J. R. and McGiven, A. R. 1971. Assay System for
Bacteriocins. Applied Microbiology. 21( 5 ) : 943.