Sie sind auf Seite 1von 5

CLUSTAL 2.0.

12 multiple sequence alignment

CAMHC ------------------------------------------------------------
CAMCO ATGAGCAAAAACATTAAAACACAAGAAGCTAAATTAGACTTAATCACTAAATTTTTAGAC

CAMHC ------------------------------------------------------------
CAMCO TATGCTAATTGTGCAGATGCTAGTTATGCTTTATTAGATCCAGTTTTTACAGGTGTTATT

CAMHC ------------------------------------------------------------
CAMCO ATTGATAAACAAGAAAAGGAGTTAGAAAAAGATTTAGATACCCAAAGACTAGGTGATAAA

CAMHC ------------------------------------------------------------
CAMCO CATAATAATCAAAATTCTACCTATGCAAGAGCTATACAAGCTCGTTTTGAACAAAATAAA

CAMHC ------------------------------------------------------------
CAMCO ATAGTTAAAATAGAACCTAAATATTGTATTTCTCTTATAAATACTTGTTTTGATAGTAAA

CAMHC ------------------------------------------------------------
CAMCO GAAATAACATTGGATAATGATATTAGTAGGGTAGGATTGAATGATGCACTGAGTAAAAGA

CAMHC ------------------------------------------------------------
CAMCO ACTATTGATTTTGTAAATAGATTTAAACTTTTAAAACATCAGCCCAACACTACAAGTGGC

CAMHC ------------------------------------------------------------
CAMCO TTTAGTGCTACTTTGTTTGAAGATACTAAAGATAATAATCAAAAGATTATAGTCATACGA

CAMHC ------------------------------------------------------------
CAMCO GGAACAGAGCCTACAAGTAATTTTAGTGTAGATATTTTGGATGCTGATGTTGATTTAGCT

CAMHC ------------------------------------------------------------
CAMCO TTAGGCAAAGTTCCCTATAATCAATATCTTGATATGATTAAATTTTATTCTGAGTGTGTT

CAMHC ------------------------------------------------------------
CAMCO AAAGAATTTCCAAATATTATAAAAGACAAAGGTTTGGTAATTGTAGGTCATTCTTTAGGC

CAMHC ------------------------------------------------------------
CAMCO GGAGCTTTGGCACAACTACTTACTCTTTCATTAGCGAGTGTTAATTCTAGTGCTAATGTT

CAMHC ------------------------------------------------------------
CAMCO AAAGAAATCTACACTTTCAATTCGCCTGGTGCAAAAGAACTAAAAGCTTTAAATTTAAAT

CAMHC ------------------------------------------------------------
CAMCO CAAATTTACAGAATAGATGGAAAAATTATCAATTCTGATAATAAAGAGCAAGCATTGTTT

CAMHC ------------------------------------------------------------
CAMCO TATCAAATAAGATCTTATAAATATCAAAAAAGTATAGAAATAAACTTAATAGGATATGAT

CAMHC ------------------------------------------------------------
CAMCO TCTAATTTATTTCAAAATATAAAATCATACTTTCACAATAAAACAAACTTAAAAGAACAT

CAMHC ---------------------------------------ATGAGTAATCAATTCGGGGCT
CAMCO TATATCTTTATAAAAACAAATATAATTTATAGTAAATCAACGAATTATTTTTATGATATT
* ** * ** * * *
CAMHC TACAAAATTTACGCACAGTTGGCACAAGATGCTTATTTGGACGATA--------AACAAC
CAMCO TTTGAAGTTGATGAAGTATTTATAAATTGTGTTAATCAGCTCCTTACTAATCTTAATATC
* ** ** * * * ** * * ** * ** * * ** ** * *
CAMHC AAAAAGGTC--AATTA--GGTGATTGGAAATTTGAAGGTGCGATACACAATTCTTTCACA
CAMCO AAAAATATTTTAGCTACAAGTGATAATACTTATCATATTGAAACAGATACTGATTCCGAT
***** * * ** ***** * * * * ** * * * * * ** *
CAMHC GGTTTCGACATAGCAGTATATTCAAATGGTAATGAAAAAGTTATAG-CTTTTCGTGGAAC
CAMCO GCTTCTAACACAAAAGGGGTGATACAAGATTTAGGAGTAGATATAGACGGGAAGCATTAT
* ** *** * ** * * * * * * ** ***** * * *
CAMHC AGATTTGACTTGGAAAA--GACCTATAAA----CACTATCGAAGATTTAATAAACGATAT
CAMCO ATTGTTAATTTAGGGGATCGATTTTGGGATTCTCATTTTTTAGAGCCTACTATCATAGAA
* ** * ** * * ** * * ** * * * ** ** * *
CAMHC ACAACTTGCAATTTGGGG-TGATGAAAATTTTCAATCACGGTTTGATTTAAAAAATTTAT
CAMCO TTAAATTATATTTTAAATCTTATGAAAAATAAAGAAATTGATAACCTTTTAGAGTATAAT
** ** * *** * ******* * * * * *** * * * **
CAMHC ACAA-TGAACTTGCAGAACAA-GGCTATATTTCAAGCAC--TGATAAAATAGTAGTTACA
CAMCO ATAAATAAGGATGAAGAGCTATGGACTTTTATCAAATACCATAATAATGTTTTGGCTACC
* ** * * ** *** * * ** * * **** ** * **** * * * ***
CAMHC GGAC--ACTCGCTAGGCGGAT---ATTTAGC------TCAGC-TTTTTACAATCGCTAAT
CAMCO GCAAGAACTCGTTATGATGATCGTATTTTGTCATATTTTAGCATTCCTAAACTATCTAAT
* * ***** ** * *** **** * * *** ** ** * * *****
CAMHC GAAGAT--AAAATCTCTCATACAT----ACACTTATAATGCCCCA---GGACTTGGTGGA
CAMCO GATTTTTCAAATTCTTTGGAATATTTGCAAATTCATTATTTACCAAAAGAACCCAAAAAA
** * *** *** * * ** * * * ** ** *** * ** *
CAMHC GCAAGATT------AAATTTCTTGCGTTTATT-----TGGTATTGAAAG-TCCGATAAAA
CAMCO CCTTTATTTGCAGCAAATATTCAAGGTTTCTCATCTACGCAATTGCAAGCTTTGGAGGAA
* *** **** * **** * * **** *** * * **
CAMHC TATAATTCTAAAATTAC-AGACATAGTAGCCA---AAGATTTTGCAAATTTAATTCA-CG
CAMCO TATAAAATAAAAAAAGCTAAATATGATGAGGAGTTAAAATGGTATGAACTTTATAAAGTA
***** **** * * * ** * * ** ** * ** ** ** *
CAMHC AGGTAGGTATGAATATTGGCGAATAT---ATCGAAGTCTCAGGCGATTCTCACGGTATAA
CAMCO AAATATGAAAGAG-AACAACAAATTTTTAATCAGAAATTTAAAGAGTATTTTTCAGAAAT
* ** * * ** * * *** * *** * * * * * * *
CAMHC AAGACCTAACCCAAATT--CTTTATTTCTACGATATGGCT--ATATCAAACGGAGCAAGT
CAMCO AATTTTTTATCAAAATAGACTCTATTCTCATAAAAAAACACAAGAGAAAATTATATTAAA
** * * * **** ** **** * * * * * * *** *
CAMHC GAAAACGTCGTAACAAACTATTTAAGTGGATTTTATAACACACCAAATTCATTATTTAGT
CAMCO TGCAATAATACAACAAATTAATCAAAAAGA---TATAACATATTTTAATTTGTATTCCGT
** ****** ** * ** ** ******* * * * **** **
CAMHC GGAAGTGTAGCTAAAACAGCTCAAAGCACAATCTCA-CAAATAGAACAAATAGTAGGCAA
CAMCO GATAGAATTTTTAAAAGAAAACAAGGCTTATTATAAATATATAGATTTAAATGAAATCCA
* ** * ***** * *** ** * * * * * ***** ** * * * *
CAMHC AG---------CAAATGGAGCAAACGATATAATAGAA-ATTTGTAACGCCT---------
CAMCO AGATTTAATTTTAAATGATTTAGATAATAAATTGGGTTATTTTTATTGCCTTTATGTATG
** ***** * * *** * * * **** ** ****
CAMHC -ATGAAAATAATAATGTCAAATTCAACCTTGATTTAATATCTCC----AACTTCAAGCGT
CAMCO TATAAATTTAATAGTATTAAGAGAAGATAAAAATACTTATTTCACCCAAGCTACTGCTAT
** ** ***** * * ** * * * *** ** * ** * *
CAMHC AACTTCCTTTTTCTCAGGCTCAAATTTAA-GCACACCTGCTTTATATGCTCTTGTGAATT
CAMCO AAACAATCTAGGCTATAATTCTACTTTCACAAAAATCTTCATCCTAGATAAAGAAAAGCT
** * ** ** * *** * * * ** * * ** * *
CAMHC TAA--AT-CCTTTCATAGTATCTGGCGTAAATTCGAACGCT-------TATTCTGAACTA
CAMCO CAATGATACCTATCTTGATGCTAGAAAAAGGCTTTATAAATCTATCAATACTTTAAAAGA
** ** *** ** * * * * * * * ** * * ** *
CAMHC GAAAA---ATATAAAGATGAAT-ATAGTGGGAACTATGTAAGTGATAAAGCTAAAATGCT
CAMCO AAAAAGAAATGAAAAAATAAAAGATATCCAAGACTATTTAAATAAAGAAATTTCCTTACA
**** ** *** ** ** *** ***** *** * * ** * * *
CAMHC TGA-AGCATTACTAGGTAAA--TCAAATTCTAGTGCATATTATAGTGATTTGCAAACAGG
CAMCO AGATAATCTAAATAATCAAAGCTTTAATACTAAGGAAAATGATGTTAATTTAATTTTAAA
** * * * ** *** * *** *** * * ** ** * **** *
CAMHC TAAG--ATTTATCATAGCGAAACTAT-TGTTGATGATGCCACCACCGATGAAT--ATATC
CAMCO CGAAGTATTTAACATAGAGCAATTTTATGATAAAAATACCAATACCATAGTATTAAAGAC
* ***** ***** * ** * * ** * * ** *** *** * ** * *
CAMHC GTAGCAAATAAGGGTTTTTTCTTTGGCACAAATTCTAATGATATTATC-ACAGGCAAACT
CAMCO AAATAATATAAAAATCATATTCTTAG-ATAAAGTAAATTTACAAGATTTGCAAGATAATT
* * **** * * * ** * * *** * * * * * ** ** * ** *
CAMHC TGGTGAAAACTTTATAGATAC--ACGCAAAGAAAACTTTATTTACACCCTAGCAGGAGAT
CAMCO CTAACAATACTTCTTTCATCTCTATGTCAAATTTAATCCATATTTATGATAATCATTG-T
** **** * ** * * ** * * ** * * ** * *
CAMHC GACACCATAACTCTAACTAGTGGCTCAAACTATATAGAAGCAGGAAGCGGAAGTGATTAT
CAMCO GATATTTTTGCAAAAGATAGAAGTGTTTTGGATATAAAGGACATAGAAGAAAAATATCAA
** * * * * *** * ***** * * * * ** ** *
CAMHC ATAGATTTAAGCGGTATAAAAGATACAAACTCAACAAATACAA---TCTATGCAGATTTA
CAMCO ATAGATTTTAAAAGTTTAGATATAAAAATCTTCCTAAACTCCACCCTCCTTACAGGCTCA
******** * ** ** * * ** ** *** * * ** * *** * *
CAMHC AAAGATAGCAAAGATGACAAAGATAGTGGCAATGATACAATCATAGGCTCAGCCGGTAAA
CAMCO AATGAACTTC---CTAACAATCCTTTTTACTTTGG-AGAATTA---GATCAA--GATAAT
** ** * **** * * * ** * *** * * *** * ***
CAMHC GATACTATGTATGGTGGCTCAGGCTATAATACCTAC---AAAGCAGGAGACGGCGATACC
CAMCO ACTATAAAACAAGATACACCTAGTTATTATTTTTCTCCTAAAGATGAAAGCAGTGGTTTA
** * * * * * * *** ** * **** * * * * * *
CAMHC ATAGAAGATGATGATAAAGGTCAAGGCTCTGTATATTTCAATTCAAATTCTCCACTTACA
CAMCO GGAAGACTTAGTATCTTTTATAAAAATGATGAACTTTGCTTGCTTAATTATTCTATTATA
* * * * * ** ** * ** * **** * * *** *
CAMHC GGCGGAACATACGATAA-AGATAAAGGTTGTTATGTTGGTGGAATTTACGAATATCA---
CAMCO GAAAATTCTTTAAATATCAAATTAGAATGCTTAAGCAAACAAAGCTTA-GAATACAAAGA
* * * *** * ** * * *** * * *** ***** *
CAMHC TCTAAACGGAAACACTCTTATAGTA---------ACAGACACAGCCAAAAATGAAAGCAT
CAMCO TTTAATTTCAAACACTCTAAAAGAACAAAAAACCACACAAGTAGATAAAAAACAAAGCAT
* *** ********* * ** * *** * ** ***** *******
CAMHC AACCAT-CAACA-ACTACTCCAAAAAAGATAAATCTCTTG-GTATAGATCTAATAGAAGC
CAMCO AGCCAAACTTCACGCTCTTTTAGAAAATCAAAACCTAGAATGTATCCATGGAGGCAAAGT
* *** * ** ** * * **** *** ** **** ** * ***
CAMHC -------AGATGAGATAGATATAATCATATCAAATGCAACAGTAACAGAAGGAGAC--GA
CAMCO CATACTTAAATCAAACAAAGGAAAAACTTTTAAAGATGATGGTGTGCCTATAATGCTAGA
* ** * * * * ** * * *** * ** * * * **
CAMHC AAGCGAACCAAATAAAGACGGAAAAGCACCATAT---AACACTAGTATAGGTATAAAACT
CAMCO AAGTGATTTATTAAACTCTAGTATAGTAGCTTGTCCTAATACTATAGCAGGTGTAAGTGT
*** ** * ** * * ** * * * * ** **** **** *** *
CAMHC A------AGTAGAGAATTAAAAGAAGACGAATTTATCATCATACAAAAATACAATTATGA
CAMCO TCCTTGTACTAAAGTTGTTAATGTAAAAGGATCCTTATCTCAAAAGAAAGTCAATCATGA
* ** ** * ** * * * * ** * * * *** **** ****
CAMHC AAA-ACAATCC-ACA-GAGTTAGTTTTATTTGGAACATTACCACAAGATTATGATACCAG
CAMCO ATATGTAATCTTACAAGAACTCATCTCAGCTTGTAAAACAGATAAAGGCTTTGCTTTAAA
* * **** *** ** * * * * * * * * * *** * ** * *
CAMHC TCTTT-TTAAAAGCTTATTAAGTGATAATAAAACACTCGATTTTAGCTGGTATGGAAATA
CAMCO AGTAAGCTTTACTCCTACTAAGTTTAAATTTGATCACAGCTTTGATCCTAAAGAGGGCTT
* * * * ** ***** *** * * *** * * * * *
CAMHC AAACAAAAGAAGAAGATAGAAAATACTGCGTAGGTGGCGTA-AATAT--CTTTGCTAAAT
CAMCO AGGAGAACAAAGTAAAAATCAAATAGAGTTAAAAGAACCTATAATAAGACTTCATTATAA
* ** *** * * * ***** * * * ** **** *** ** *
CAMHC CAGATAATTTAACTATAAGAGATATAAAACCGGGATATGTCACTATCAAAGACGACGACA
CAMCO -AAGTGATAGATTTCAAAAAGATAATTTACCTATCTATAATCTTTTAATCAATAATGAAA
* * ** * * ** ***** *** *** * * * * * ** *
CAMHC AAGATCCAAACGATGATAAGCCAGAAACTTACGATCCACTTGCAATAGACCTTAATAAT-
CAMCO AAAAAGAACAAGATAAGGCTTTAAATGAATTTAATATAGATTTAAAAGATTTAAAAGATA
** * * * *** * * * * ** * * ** *** * ** **
CAMHC --GATGGCATAAAAGGC----ACAAATTTA-----GACTATAAGATAAATTTTGACCTTG
CAMCO TAGAGGATATAAATATTCTTAACCAATTCAAACAAGACTTTAGTAAAGATTATGAATTTA
** * ***** ** **** * **** ** * * *** *** **
CAMHC ATAATAACGGCTTTAAAGAGGCTACAAGCTGGATAGA---TAACAATGACGCCTTTATCA
CAMCO AAGAATTAAATCTTAGCTTTGATACTAATTTAATCAAACTTTATTTTATTATCCCAAAAA
* * *** * *** * * ** * * * * * * *
CAMHC CCATTGATAAAAACAACAACGGCGCAATCGATAA--TGGTAGCGAGCTATTTGGAAACAA
CAMCO ACATTGCTAAAGTTTATAAAAGTGCTTATAAGGAATTTGAAAATAAAGATTTAGGAGTAG
***** **** * ** * ** * * * * * * **** * * *
CAMHC GAGCATCTCAAATAACGCC-----TATGCCTACACTAATCCAAACGCAAAAAATGGCTTT
CAMCO G-GTATTTTACACAGCTACATGAGTATGATAAAATCATCAAAAATGCTTTAGAAGATAAT
* * ** * * * * * * **** * * * *** ** * * * *
CAMHC GAAGCATTAAGCGAATTTGATAGCAAT-----AACGATGGCATAATCGATGAA-------
CAMCO AAAGAATTAAACGAATATCATTTTAGTTTTTTAGCTCCTGCAAAAATGCAAAATTTAAAA
*** ***** ***** * ** * * * * *** ** * **
CAMHC ------------------------------------------------------------
CAMCO CTTCAAATCGCACAAGGACTAGATGAAATCTTAGAAGATGAAGATAGAAAACAAGAGCTT

CAMHC ------------------------------------------
CAMCO TATGTTTGTAAATTTGTGGTGGTAAATGGGGTTAAAATATGA