Sie sind auf Seite 1von 3

CLUSTAL 2.0.

12 multiple sequence alignment

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum ATGAGTAAAAACATACAAACTCATAATGCCAAAATAGATTTAATTAAAAAATTCCTTAAT

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum TATGCAAACATAACTGATGCAAGTTATGCGATGCTAGAATCTGTATTTGAAAAAGCAATT

HELHP -------------------------------------ATGACAAATAAACAACAGATTCA
bilis --------------------------------------------TTAAGCCACCCGTTCA
pullorum AAAGATGAGAGCGGTAATGAAATAGAAAAAGAATTAGATGGTTTAACACTAAAAGCTACA
* * * **
HELHP AAAATTAA--GAGACAATGCAGAACTTGCAATGGCTTCCTATGGATATTTTCATTTAA--
bilis TTTGCAAT--CAAATTCT-TAGAATCTTTAATAACTTCATAGATTTGCTTAGAATCTAGC
pullorum ACTATAAATGAAAATAATCAAACATTCCTTACTACCTACGCCCGAGCTATCGAAGCAAGG
* * * * * * * * * * * *
HELHP TCGATAAAAAGTTT----AATCATAAAAGCAAAACACGAAAAGATG---ACTTCATAACC
bilis ATGATATGCGGTTTTAG-ATTCTTCGCACCAGGTGCATTAAAGGTATACACTTCATTAAT
pullorum TTTATGCAAGATTCTAAAAATCCTCAAGGCAAGAAAATTGATAATA---AGATTACAAAT
** ** * ** * ** * * * * * *
HELHP CTCCACGACATCTTGGATTCCACCTACAAAGGCTATGTAACTTCCGAGCATACAACTTTC
bilis GATAGAATCTTGATTGAATTCAGTAGCCAAAACATCAGGATTCTTAGCAAAACAGAGGGC
pullorum GTTTCTAAAGAAATAGACCAAAATCAAGATAAAAATGGAATCCATAATGATACAGGAAA-
* ** * * * * ***
HELHP A-----TTAATCCAGAGAAAC-TCGATGGCGACTTCACCCCAACCCAAGCAAAAAGATTC
bilis AAATATTTGAGCCAAACAACCACCTAGAGAGTGTCCTACTATATTTAAGCTTTTAGGCTT
pullorum A-----TTAATTAAAATGTAT-CC--TAAAGAACTAACTGATA---GAACTATCAAATTT
* ** * * * * * * * * * *
HELHP TTTGAACGCTATGATTTACTAGAGCATTGCCCCAACACAGATTCAGGATTCTCCGCCACT
bilis AGTAATCTCTGGATATTGTTT-AGCACAAGATTCATAAAAAAGTATCATTGCATGG-AGA
pullorum ACCAATCGCTTTAAACTCTTAAAACATCAAGAAAACACAGATTCAGGATTCTCTGCTACA
* * ** * * * ** * * * * * *** * *
HELHP CTCTTTAAAGATACAAAGGCAGATTCTA-AAGATTCAGAATATATCCTCTCTATTCGTGG
bilis TATTCAAAAGGTATAGTAGAATCTTTAAGGAGATTCACAAAGTCTGTTGTGTAATCAGCA
pullorum CTCTTTGAGGATACAGAGGATAAT-----AAG---CAAAAGATAT--TTGCTATTAGAGG
* * * ** * * * ** ** ** * * * ** *
HELHP CACAGAATTTAAACTAGAGCAAATCCAAGATTTACTCAATGATTATTACATAGGCACAAA
bilis GAATCAAAGCTTCCTCGTATGGCTAAAGTATATTCTTTAGATTCTTTATCTTGAAATAAA
pullorum CACAGAGTTTCCCTCTGGATTCTCTAACGATGTGCTA---GATTCTGATGCTAATCTAGC
* * * * ** * ** * * * *
HELHP TAATAGTG-ATATGAATAGAGTGATA----GAGCAGTATTTTGATATGCTTCTCTTTTAT
bilis CAAGCGTGGAGGCCTTTGGAATTGTCTTTAGGATAATAGTCTAGCA-AATAGTATCTTTT
pullorum TCTTAGCT-CACTC--CCAAGTAAT--------CAATACATTGATATGATTAAGTTTTAT
* * * * * ** * * * * ** *
HELHP GAGGAAACTCTCAAGCCTTTACTACGAGAAAAAGGCATTGCAAGGATTAATGTTATAGGA
bilis AAGGAATTCTT--TGGTTTGAATAT-CGCCAAATTCACCACCAAGTTTATCACCATTAAA
pullorum ACACAATGTAT-AGTAGATAAGCATATCGCAGAATC--TACACCTTTAATCATTACAGGG
** * * * * * * * * * * *
HELHP -----CATTCACTTGGTGGCTATCTCGCTCAAC----TCTTTGCTTTA-----AGCTATC
bilis ACTGTCCTTGGCTCTATTTCTCATTTTCGTAAAAATATCATTGCTTTGCTCTAAATTCAC
pullorum -----CATTCACTCGGTGGTGCATTAGCCCAAC----TCCTCACACTCTCCCTTGCTACC
* ** ** * * * ** ** * * * * *
HELHP ----------CGCATAGTATCAATGAAGTTTATACTTACAATGCACC------TTTAGAA
bilis ----TAATACTTCTTGGTTGTAATATTTTTTGTTTATGATATGCTCCAAATTAATTGGTG
pullorum ACAGAAAGTGCAAACAATGTCAAGGAAGTCTATACCTTTAATTCCCCAGGG-GCTAAGAA
* ** * * * * ** * ** * *
HELHP TCTATGAGTCTTGCTTAA------------------------------------------
bilis TTTCCCTGTATTCTCTAGGATAGTTTTTATCTTTTATTTTTTGTCCTTGCTCATCTAGTT
pullorum TCTAAGAAT--TGATGAGGATACTTTAGGCAGAGTCTATGAGATAGATTCTACAATCCTT
* * * * *
HELHP ------------------------------------------------------------
bilis GATAAATCTTTCTAGGAATATTACTAGAATCTTTTAGTAAATCAAAATAAAAATAGGAAG
pullorum AATGCTAAGGATAAAGAAAGAGCATTATTTAAAAAAATACGAGGATATGAGTATGGAGAG

HELHP ------------------------------------------------------------
bilis CCCAAGCTAGTTCCGCATTATCCCTAAGTTTTTTAATTATTTCTCTATTTGTCAT-----
pullorum AAAGACAATCTTTTAAGAGATACCACACTCATTGGATATGATAATCATTTATTTAATGCA

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum ATCTATAAATATTTTACAAATAATGAGAATCTCAAAGAGCATTCTATCCTTGTAAGGACG

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum CTAACCACAACGAACATAAAACCTATTACATATATGGCTACAACATCTAGTATTACTTAC

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum ACCTATAAAATTTTTGATATAAATCAAACTTTTATCAACTGCCTTGAAATACTAAAGGCT

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum AATAATCGCTTAAAGCAACCCTTAGCTTGTCAAGATTCTATCCATCACATAGAATCTGAT

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum GACGATTCAAATCCAGATAACAACCAATGGCAAGATGAACTTATACAAAATCTAGGCACA

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum GATATAGACGGGAAGCATTATTATATCAATCTAGGGGCTTTTAGTGGCTCTCACTATATA

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum CTGCCTACTATCCACGCACTGCAAAGAGTGCTAATGCTTCTAAATAGTGGCAATATCGAT

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum AATCTCTTAGAATACAATAAAATCAAAGATTTAAAAGATGAAAGTATGTTTTTAAGGACT

HELHP ------------------------------------------------------------
bilis ------------------------------------------------------------
pullorum ACTCGAGAGAGGAAGAATGCTGAAAGGCTTTTGCATACACAGCCTAGCTCTTTGTATAAT

HELHP ------------
bilis ------------
pullorum CTCTACTATTAG