Sie sind auf Seite 1von 5

1)Secuencia de DNA:

ATGTGCGACCATACCAAGCTGAAAATACTGCATCCCGTCTGATCTGCACAGTCAAGCAGCTT
AGGGCCCAGTCAGTAGTGCGGTGGGGGACCATGCGCGAACATTGTGGTGTTGCACTTATGT
GCGACCATACCAAGCTGAAAATACTGCATCCCGTCTGATCTGCACAGTCAAGCAGCTTAGG
GCCCAGTCAGTAGTGCGGTGGGGGACCATGCGCGAACATTGTGGTGTTGCACTTATGTGCG
ACCATACCAAGCTGAAAATACTGCATCCCGTCTGATCTGCACAGTCAAGCAGCTTAGGGCCC
AGTCAGTAGTGCGGTGGGGGACCATGCGCGAACATTGTGGTGTTGCACTTATGTGCGACCAT
ACCAAGCTGAAAATACTGCATCCCGTCTGATCTGCACAGTCAAGCAGCTTAGGGCCCAGTC
AGTAGTGCGGTGGGGGACCATGCGCGAACATTGTGGTGTTGCACTT

Ordenada:

0001 ATGTGCGACCATACCAAGCTGAAAATACTG 0030


0031 CATCCCGTCTGATCTGCACAGTCAAGCAGC 0060
0061 TTAGGGCCCAGTCAGTAGTGCGGTGGGGGA 0090
0091 CCATGCGCGAACATTGTGGTGTTGCACTTA 0120
0121 TGTGCGACCATACCAAGCTGAAAATACTGC 0150
0151 ATCCCGTCTGATCTGCACAGTCAAGCAGCT 0180
0181 TAGGGCCCAGTCAGTAGTGCGGTGGGGGAC 0210
0211 CATGCGCGAACATTGTGGTGTTGCACTTAT 0240
0241 GTGCGACCATACCAAGCTGAAAATACTGCA 0270
0271 TCCCGTCTGATCTGCACAGTCAAGCAGCTT 0300
0301 AGGGCCCAGTCAGTAGTGCGGTGGGGGACC 0330
0331 ATGCGCGAACATTGTGGTGTTGCACTTATG 0360
0361 TGCGACCATACCAAGCTGAAAATACTGCAT 0390
0391 CCCGTCTGATCTGCACAGTCAAGCAGCTTA 0420
0421 GGGCCCAGTCAGTAGTGCGGTGGGGGACCA 0450
0451 TGCGCGAACATTGTGGTGTTGCACTT 0476

2) Obtén la siguiente información a partir de ella:


a) Secuencia reversa (según la pauta de lectura 3'->5').

0001 TTCACGTTGTGGTGTTACAAGCGCGTACCA 0030


0031 GGGGGTGGCGTGATGACTGACCCGGGATTC 0060
0061 GACGAACTGACACGTCTAGTCTGCCCTACG 0090
0091 TCATAAAAGTCGAACCATACCAGCGTGTAT 0120
0121 TCACGTTGTGGTGTTACAAGCGCGTACCAG 0150
0151 GGGGTGGCGTGATGACTGACCCGGGATTCG 0180
0181 ACGAACTGACACGTCTAGTCTGCCCTACGT 0210
0211 CATAAAAGTCGAACCATACCAGCGTGTATT 0240
0241 CACGTTGTGGTGTTACAAGCGCGTACCAGG 0270
0271 GGGTGGCGTGATGACTGACCCGGGATTCGA 0300
0301 CGAACTGACACGTCTAGTCTGCCCTACGTC 0330
0331 ATAAAAGTCGAACCATACCAGCGTGTATTC 0360
0361 ACGTTGTGGTGTTACAAGCGCGTACCAGGG 0390
0391 GGTGGCGTGATGACTGACCCGGGATTCGAC 0420
0421 GAACTGACACGTCTAGTCTGCCCTACGTCA 0450
0451 TAAAAGTCGAACCATACCAGCGTGTA 0476

b) Secuencia complementaria.

0001 TACACGCTGGTATGGTTCGACTTTTATGAC 0030


0031 GTAGGGCAGACTAGACGTGTCAGTTCGTCG 0060
0061 AATCCCGGGTCAGTCATCACGCCACCCCCT 0090
0091 GGTACGCGCTTGTAACACCACAACGTGAAT 0120
0121 ACACGCTGGTATGGTTCGACTTTTATGACG 0150
0151 TAGGGCAGACTAGACGTGTCAGTTCGTCGA 0180
0181 ATCCCGGGTCAGTCATCACGCCACCCCCTG 0210
0211 GTACGCGCTTGTAACACCACAACGTGAATA 0240
0241 CACGCTGGTATGGTTCGACTTTTATGACGT 0270
0271 AGGGCAGACTAGACGTGTCAGTTCGTCGAA 0300
0301 TCCCGGGTCAGTCATCACGCCACCCCCTGG 0330
0331 TACGCGCTTGTAACACCACAACGTGAATAC 0360
0361 ACGCTGGTATGGTTCGACTTTTATGACGTA 0390
0391 GGGCAGACTAGACGTGTCAGTTCGTCGAAT 0420
0421 CCCGGGTCAGTCATCACGCCACCCCCTGGT 0450
0451 ACGCGCTTGTAACACCACAACGTGAA 0476

c) Transcrito de ARN.

0001 AUGUGCGACCAUACCAAGCUGAAAAUACUG 0030


0031 CAUCCCGUCUGAUCUGCACAGUCAAGCAGC 0060
0061 UUAGGGCCCAGUCAGUAGUGCGGUGGGGGA 0090
0091 CCAUGCGCGAACAUUGUGGUGUUGCACUUA 0120
0121 UGUGCGACCAUACCAAGCUGAAAAUACUGC 0150
0151 AUCCCGUCUGAUCUGCACAGUCAAGCAGCU 0180
0181 UAGGGCCCAGUCAGUAGUGCGGUGGGGGAC 0210
0211 CAUGCGCGAACAUUGUGGUGUUGCACUUAU 0240
0241 GUGCGACCAUACCAAGCUGAAAAUACUGCA 0270
0271 UCCCGUCUGAUCUGCACAGUCAAGCAGCUU 0300
0301 AGGGCCCAGUCAGUAGUGCGGUGGGGGACC 0330
0331 AUGCGCGAACAUUGUGGUGUUGCACUUAUG 0360
0361 UGCGACCAUACCAAGCUGAAAAUACUGCAU 0390
0391 CCCGUCUGAUCUGCACAGUCAAGCAGCUUA 0420
0421 GGGCCCAGUCAGUAGUGCGGUGGGGGACCA 0450
0451 UGCGCGAACAUUGUGGUGUUGCACUU 0476

d) Proteína codificada (estructura primaria). ¿Cuántas soluciones posibles hay


para la secuencia problema? ¿Por qué?

Hay tres soluciones posibles, esto se debe a que no sabemos si la secuencia de DNA
que tenemos nosotros empieza desde el primer nucleótido, desde el segundo o el
tercero, y por ello podemos leer tres fragmentos distintos de proteínas

Fragmento 1:
MCDHTKLKILHPV*SAQSSSLGPSQ*CGGGPCANIVVLHL
CATIPS*KYCIPSDLHSQAA*GPVSSAVGDHARTLWCCTY
VRPYQAENTASRLICTVKQLRAQSVVRWGTMREHCGVALM
CDHTKLKILHPV*SAQSSSLGPSQ*CGGGPCANIVVLH

Fragmento 2:
CATIPS*KYCIPSDLHSQAA*GPVSSAVGDHARTLWCCTY
VRPYQAENTASRLICTVKQLRAQSVVRWGTMREHCGVALM
CDHTKLKILHPV*SAQSSSLGPSQ*CGGGPCANIVVLHLC
ATIPS*KYCIPSDLHSQAA*GPVSSAVGDHARTLWCCT

Fragmento 3:
VRPYQAENTASRLICTVKQLRAQSVVRWGTMREHCGVALM
CDHTKLKILHPV*SAQSSSLGPSQ*CGGGPCANIVVLHLC
ATIPS*KYCIPSDLHSQAA*GPVSSAVGDHARTLWCCTYV
RPYQAENTASRLICTVKQLRAQSVVRWGTMREHCGVAL

e) Estadística de las secuencias

e.1) Porcentaje de nucleótidos.

A: 112 nucleótidos 23.52%


C: 120 nucleótidos 25.21%
G: 136 nucleótidos 28.57%
T: 108 nucleótidos 22.68%

e.2) Porcentaje de dímeros (parejas de bases diferentes)

AA: 24 dímeros 5.04%


AC: 28 dímeros 5.88%
AG: 32 dímeros 6.72%
AT: 28 dímeros 5.88%
CA: 48 dímeros 10.08%
CC: 28 dímeros 5.88%
CG: 20 dímeros 4.2%
CT: 24 dímeros 5.04%
GA: 20 dímeros 4.2%
GC: 44 dímeros 9.24%
GG: 32 dímeros 6.72%
GT: 40 dímeros 8.4%
TA: 19 dímeros 3.99%
TC: 20 dímeros 4.2%
TG: 52 dímeros 10.92%
TT: 16 dímeros 3.36%

e.3) Porcentaje de tripletes (codones)

AAA: 8 tripletes 1.68%


AAC: 4 tripletes 0.84%
AAG: 8 tripletes 1.68%
AAT: 4 tripletes 0.84%
ACA: 8 tripletes 1.68%
ACC: 12 tripletes 2.52%
ACG: 0 tripletes 0%
ACT: 8 tripletes 1.68%
AGA: 0 tripletes 0%
AGC: 12 tripletes 2.52%
AGG: 4 tripletes 0.84%
AGT: 16 tripletes 3.36%
ATA: 8 tripletes 1.68%
ATC: 8 tripletes 1.68%
ATG: 8 tripletes 1.68%
ATT: 4 tripletes 0.84%
CAA: 8 tripletes 1.68%
CAC: 8 tripletes 1.68%
CAG: 16 tripletes 3.36%
CAT: 16 tripletes 3.36%
CCA: 16 tripletes 3.36%
CCC: 8 tripletes 1.68%
CCG: 4 tripletes 0.84%
CCT: 0 tripletes 0%
CGA: 8 tripletes 1.68%
CGC: 4 tripletes 0.84%
CGG: 4 tripletes 0.84%
CGT: 4 tripletes 0.84%
CTA: 0 tripletes 0%
CTC: 0 tripletes 0%
CTG: 16 tripletes 3.36%
CTT: 8 tripletes 1.68%
GAA: 8 tripletes 1.68%
GAC: 8 tripletes 1.68%
GAG: 0 tripletes 0%
GAT: 4 tripletes 0.84%
GCA: 16 tripletes 3.36%
GCC: 4 tripletes 0.84%
GCG: 16 tripletes 3.36%
GCT: 8 tripletes 1.68%
GGA: 4 tripletes 0.84%
GGC: 4 tripletes 0.84%
GGG: 16 tripletes 3.36%
GGT: 8 tripletes 1.68%
GTA: 4 tripletes 0.84%
GTC: 12 tripletes 2.52%
GTG: 20 tripletes 4.2%
GTT: 4 tripletes 0.84%
TAA: 0 tripletes 0%
TAC: 8 tripletes 1.68%
TAG: 8 tripletes 1.68%
TAT: 3 tripletes 0.63%
TCA: 8 tripletes 1.68%
TCC: 4 tripletes 0.84%
TCG: 0 tripletes 0%
TCT: 8 tripletes 1.68%
TGA: 8 tripletes 1.68%
TGC: 24 tripletes 5.04%
TGG: 8 tripletes 1.68%
TGT: 12 tripletes 2.52%
TTA: 7 tripletes 1.47%
TTC: 0 tripletes 0%
TTG: 8 tripletes 1.68%
TTT: 0 tripletes 0%

3) Indica la dirección (o direcciones) de internet que usaste para


resolver el ejercicio.
http://www.dnai.org/geneboy/