Sie sind auf Seite 1von 24

BREVE RESEÑA DE ALGUNOS CONTENIDOS TEÓRICOS

Concepto de Ácidos y bases. Disociación. Fuerzas relativas de ácidos y bases.

Ácido es toda sustancia (molécula o grupo de átomos) capaz de ceder un protón. El tipo de
reacción mediante la cual es cedido un protón se denomina “reacción de disociación del
ácido”.
Ácidos fuertes
Son los que disueltos en agua liberan los protones disociándose totalmente y el fenómeno
es prácticamente irreversible.
HCl + H2O Cl- + H3O+
ác.clorhídrico agua cloruro hidronio

Generalmente al escribir las ecuaciones de disociación, se prescinde del agua y se escribe


directamente:
HCl Cl- + H+
ác.clorhídrico cloruro protón

H2SO4 SO4= + 2 H+
ác.sulfúrico sulfato protones

Repare y recuerde el cambio en la terminación del nombre del ácido cuando se disocia.

Ácidos débiles
Son compuestos ácidos que tienen poca tendencia a disociarse de sus protones y el
fenómeno es francamente reversible.
H2CO3 CO3H- + H+
ác.carbónico bicarbonato
Esta es la disociación del ácido carbónico que se produce cuando este ácido se disuelve en
agua. Ocurre en nuestro organismo.

Bases fuertes y débiles


Bases: Son todas las sustancias que disueltas en agua son capaces de captar H+ o de
liberar OH-
Ejemplos
Na(OH) Na+ + OH-
NH3 + H2O NH4+ + OH-

Bases fuertes: son las bases con alta tendencia a disociarse.


Bases débiles: son las que tienen baja tendencia a disociarse.

pH. Su significado
Es indispensable que conozca los criterios para definir si una solución es ácida, neutra o
alcalina: esto le ayudará a comprender las respuestas de la célula, y de todo el organismo
en general ante modificaciones, de hecho muy pequeñas, en la acidez o alcalinidad del
medio interno.
La acidez de una solución está relacionada con la concentración de protones de la misma.
Para facilitar su comprensión se definió de la siguiente manera:
pH = - log [H+]
Obtenemos así una escala de números enteros, con una cifra decimal o a lo sumo dos,
dependiendo de la precisión con que se necesite trabajar. Esta es la escala de pH. Los
valores varían en un rango desde 0 a 14, ya que abarca todos los valores posibles para la
concentración de protones en soluciones acuosas.
Ejemplos
Si [H+ ] = 10-7 M -log 10-7 = 7
.................... Neutro
Si [H+ ] = 1 M o sea 100 M -log 10 0 = 0 ........ Extremo ácido
Si [H+ ] = 10-14 M -log 10-14 = 14 ..................... Extremo alcalino
Para el agua, en la que la concentración de protones es igual a 10-7, el pH será 7 y ese
mismo pH tendrá toda solución acuosa en la que no se haya disuelto ninguna sustancia
ácida ni básica aunque esté presente cualquier otro soluto. En estos casos la concentración
de OH- será igual a la de los H+ como ya vimos, condición a la que nos referimos como
neutra.
En resumen pH = 7 → solución neutra
Siempre que la concentración de protones aumenta, el pH, por ser una función inversa
disminuye y viceversa: al disminuir la concentración de protones, el pH aumenta. Recuerde
que no excede los límites de 0 como mínimo y 14 como máximo.
Cuando el pH se encuentra en algún valor entre 0 y 6,99 hablamos de pH ácidos o
soluciones ácidas y desde 7,01 hasta 14 nos referimos a pH básicos o alcalinos.

Química orgánica.

El carbono es un elemento estrechamente relacionado con la vida. La composición química


de un ser vivo demuestra que la mayoría de sus constituyentes primarios incluye átomos de
carbono. Casi el 18% del total de la materia viva es carbono. Este porcentaje resulta muy
elevado si se tiene en cuenta que el resto es principalmente agua. Los compuestos
orgánicos contienen átomos de carbono (C), hidrógeno (H), oxígeno (O), nitrógeno (N), y
muy pequeñas proporciones de otros átomos. El elemento común a todos estos
compuestos es el carbono.
Las sustancias orgánicas se pueden agrupar por sus propiedades químicas o grupos
funcionales, responsables de las propiedades que las caracterizan. Las principales
funciones químicas orgánicas son: alcoholes, aldehídos, cetonas, ácidos carboxílicos,
éteres, ésteres, aminas y amidas.

Hidrocarburos: alcanos, alquenos y alquinos


Son los más simples. Formados por C e H. Pueden ser: alifáticos y cíclicos.
Alifáticos
Alcanos: Cuando sus átomos de carbono presentan sólo ligaduras simples, se los clasifica
como alifáticos saturados. (terminación ano).
Para dar el nombre de los alcanos la Unión Internacional de química pura y aplicada
(IUPAC) ha establecido las siguientes normas:
a) Los cuatro primeros términos tienen nombres particulares: metano, etano, propano,
butano.
b) Del quinto en adelante, se designa con el prefijo que indica el número de átomos de
carbono. Por ejemplo: pentano, hexano, etc.
c) En todos los términos la terminación es ano . Generalmente cuando el número de
átomos de carbono es elevado, se los nombra indicando ese número. Por ejemplo: alcano
de 23 átomos de carbono.

Fórmula molecular Nombre Fórmula molecular Nombre


CH4 metano C7H16 heptano C2H6
etano C8H18 octano C3H8
propano C9H20 nonano C4H10 butano
C10H22 decano C5H12 pentano C11H24
undecano
Además de los alcanos con cadenas cuyos átomos de carbono son consecutivos (cadenas
lineales), existen otros de cadena ramificada. Los hidrocarburos ramificados se consideran
formados por dos partes: la cadena principal es la más larga.
Así, por ejemplo: CH3

CH3- CH-CH3
Metil propano
Los radicales alquilo son grupos atómicos monovalentes que resultan de eliminar un
átomo de hidrógeno de un hidrocarburo.
En el ejemplo anterior puede considerarse que la ramificación metilo se ha originado por la
eliminación de un átomo de hidrógeno del metano. Las ramificaciones son consideradas
como radicales alquilo y su nombre propio resulta de sustituir la terminación ano por ilo en
la denominación del alcano del cual provienen.
Los átomos de carbono que forman las cadenas se pueden diferenciar en primarios,
secundarios, terciarios y cuaternarios, según estén unidos a uno, dos, tres, o cuatro átomos
de carbono vecinos respectivamente.
Hidrocarburos alifáticos no saturados: Alquenos y alquinos.
Alquenos: Al menos presentan una doble ligadura entre dos átomos de carbono. Los
alquenos se nombran igual que los alcanos pero cambiando la terminación ano por eno.
Alquinos: Se caracterizan por presentar por lo menos dos átomos de carbono unidos
entre si por una unión covalente triple (terminación ino)
Cuando las cadenas tienen cuatro o más átomos de carbono, el doble o el triple enlace
puede estar en distintas posiciones. Para diferenciarlos se enumeran los átomos de
carbono comenzando por el extremo más próximo a la doble o a la triple ligadura.
Ejemplo: CH3-CH=CH-CH2-CH3 2-penteno
Hidrocarburos cíclicos:
Son aquellos que presentan cadenas carbonadas cerradas, formando anillos o ciclos.
a)Ciclo alcanos. Ejemplo:
CH2
H2C CH2 ciclo propano
b)Hidrocarburos bencénicos o aromáticos
Son compuestos constituidos por carbono e hidrógeno que se caracterizan por presentar
uno o más anillos de seis átomos de carbono, unidos entre sí por enlaces dobles enlaces y
simples, alternados.
Ejemplo:

benceno

Funciones orgánicas oxigenadas


Son un numeroso grupo de sustancias orgánicas constituidas por carbono, hidrógeno y
oxígeno. Se pueden subdividir en varias funciones químicas: alcoholes, éteres, aldehídos,
cetonas, ácidos carboxílicos, anhídridos de ácido, ésteres, etc.

Alcoholes: poseen un –OH que se halla unido a un carbono de una cadena carbonada.
Se los clasifica en primarios, secundarios o terciarios según en qué C (1rio, 2rio o 3rio) el
grupo se encuentre.
Ejemplos: CH3 – CH2OH etanol ( alcohol primario)

Fenoles: Son compuestos en los que el grupo -OH está unido directamente a un anillo
aromático.
Polioles: cuando tienen más de un grupo OH
Ejemplo:
CH2OH – CH2OH etanodiol
• La cadena carbonada que contiene el grupo hidroxilo es la principal. Se nombran
cambiando la terminación del nombre del hidrocarburo por ol
• La cadena se numera a partir del extremo más próximo al grupo hidroxilo.
• En los alcoholes secundarios y terciarios, se antepone el número correspondiente
al átomo de carbono en que se encuentre el hidroxilo.

Ejemplo:
CH3
CH3 -- C-CH2-CH3 2-metil-2-butanol ( alcohol terciario)

OH
En los alcoholes simples se pueden emplear sus nombres comunes, los cuales están
constituidos por el nombre del grupo alquilo, con la terminación ico, precedido por la
palabra alcohol. Por ejemplo: alcohol metílico = metanol.
Éteres: Son compuestos orgánicos en los que un átomo de oxígeno se une directamente a
dos radicales alquilo (R-O-R´) y que resultan de la reacción de dos funciones alcohólicas
con pérdida de una molécula de agua. Ejemplo
CH3 -CH2 -OH + HO- CH2 -CH3 CH3 -CH2 -O- CH2 -CH3 + H2O
etanol etanol etil oxi etil (éter etílico) agua

Aldehídos: Los aldehídos se obtienen por oxidación suave de un alcohol primario.


H -C=O Este grupo funcional siempre está en un C primario

Convencionalmente se ha establecido que la fórmula molecular se escribe -CHO


Los aldehídos se nombran como los alcoholes primarios de donde provienen, pero
cambiando la terminación ol por al. Por ejemplo: metanol metanal.
Si hay dos grupos funcionales en una misma molécula se usa el sufijo dial
Ejemplos: CH3-CH2-CHO propanal CHO-CH2-CH2-CHO butanodial
Cetonas: Se originan por oxidación de los alcoholes secundarios.
El grupo que las identifica está unido a un carbono secundario y es el siguiente >C= O. Las
cetonas se designan como los alcoholes secundarios de los que provienen pero cambiando
la terminación ol por ona Si en la molécula hay dos grupos cetona, se agrega el sufijo
diona.
Ejemplos: CH3 – CO - CH2 –C H2 –CH3 2-pentanona
CH3 – CO - CO –CH3 butadiona

Cuando se comparan las fórmulas generales de aldehído y cetona se observa que ambas
funciones presentan el grupo carbonilo:
H -C=O >C= O

Ácidos carboxílicos: son los que poseen en su estructura el grupo carboxilo o función
ácido. La palabra carboxílico resulta de la condensación de carbonilo e hidroxilo que son
los grupos que se encuentran simultáneamente en el mismo átomo de carbono.
C=O o bien -COOH
OH

Una misma molécula puede tener uno, dos o más grupos carboxilo por lo cual estos
ácidos se clasifican en monocarboxílicos, dicarboxílicos, tricarboxílicos, etc.

Los ácidos orgánicos monocarboxílicos se designan como los alcoholes o los aldehídos
de los cuales provienen pero cambiando la terminación por oico. Los di y tricarboxílicos,
agregándoles el sufijo di o tri. Ejemplos:

CH3-COOH ácido etanoico COOH-CH2-COOH ácido propanodioico o


malónico.
El ácido metanoico se conoce comúnmente como ácido fórmico (por haberse obtenido de
las hormigas) y el ácido etanoico suele denominarse ácido acético ( por encontrarse en el
vinagre)

Ésteres: La reacción de un alcohol con un ácido origina un éster


CH3 -C = O + CH3 -CH2 -OH → CH3 -C= O + H2O
 
OH O  CH2 -CH3
ácido etanoico etanol etanoato de etilo
La molécula de agua que se pierde durante la reacción se forma con los átomos en
negrita: el ácido cede el H+ y el alcohol el grupo OH -.
La observación atenta de la fórmula permitirá deducir que la fórmula general de los
ésteres es:
R –COO –R´ R y R´son radicales alquilo
Los ésteres se forman cambiando la terminación “ico” del ácido por “ato”
(etanoicoàetanoato) y agregando del nombre del radical alcohólico (etanolàetilo).En
el ejemplo, etanoato de etilo.
En numerosas oportunidades encontrará que el ácido que participa es el ácido fosfórico. Al
producto se lo denomina “éster fosfórico”
H3C OH H3C
 
H2C + HO −P =O → H2C + H2O
  OH
H2C − OH HO H2C  O  P = O

OH
propanol ác. fosfórico fosfato de propilo agua
La molécula de agua se forma con los átomos en negrita.

Anhídridos
Resultan de la reacción entre dos ácidos con pérdida de una molécula de agua.
CH3 -C -OH + CH3 - CH2 - C-OH CH3 -C -O - C -CH2- CH3
// // // //
O O O O
Ácido etanoico ácido propanoico anhídrido etan propanoico
La observación atenta de la fórmula permitirá deducir que la fórmula general de los
anhidridos es: R –CO-O-CO –R´ R y R´son radicales alquilo

Funciones orgánicas nitrogenadas


Entre los compuestos orgánicos existe un grupo que se caracteriza por tener nitrógeno en
su estructura molecular. Estos son:

Aminas: Pueden considerarse como derivadas del amoníaco por sustitución de uno, dos
o los tres átomos de H por radicales alquilo.
H

H–N–H amoníaco
Ejemplo:
a) CH3 - NH2 metil amina (amina primaria)
CH3
b) CH3 – N –H dimetil amina (amina secundaria)

c) CH3 – N –CH3 trimetil amina (amina terciaria)

CH3

Amidas
Se consideran como compuestos que resultan de la sustitución del grupo hidroxilo de un
ácido carboxílico por un grupo amino (-NH2).
Ejemplo:
CH3 – CO –NH2 Etan amida
El nombre de las amidas resulta de reemplazar el sufijo”oico” de los ácidos carboxílicos
por “amida”
Estos grupos de átomos pueden reaccionar entre sí dando tipos de enlace que Ud.
necesitara reconocer en los compuestos biológicos que los poseen para comprender
porqué esos compuestos se comportan dentro de la célula de una manera u otra.
Por ejemplo, Aminoácidos:
Los aminoácidos son compuestos orgánicos nitrogenados fundamentales para los seres
vivos porque se unen entre sí para formar las proteínas, que son sustancias indispensables
para la vida. Todos los aminoácidos tienen un grupo amino y otro carboxílico (ácido) por lo
cual se denominan aminoácidos.
En el caso de los aminoácidos que forman las proteínas, el grupo amino se encuentra unido
al átomo de carbono vecino al grupo carboxilo. Como a ese átomo de carbono se lo
identifica con la letra griega α (alfa), a estos aminoácidos se los denomina alfa-
aminoácidos. Ejemplo:
R
NH2 - C –H o bien R – CHNH2 - COOH

COOH
Los aminoácidos importantes para la vida humana son alrededor de veinte.
En el siguiente cuadro se resumen los grupos funcionales más comunes y los nombres
que adoptan de acuerdo con el sufijo correspondiente:
Función orgánica Estructura gral. Grupo funcional Sufijo Ejemplo
Alcohol R - OH -OH hidroxilo ol CH3-CH2-CH2OH
Propanol
Éter R –O –R´ -O- éter CH3-CH2-O –CH3
Etil oxi metil
Aldehído RCHO -C = O Al CH3-CH2-CHO
H Propanal
Cetona R –CO-R´ > C =O ona CH3-CH2-CO- CH3
butanona
ácido carboxílico R - COOH -C=O oico CH3-CH2-COOH
OH Ácido propanoico
Éster R –COO-R´ -C=O ato de R CH3-CO-O-CH3
´
O- Etanoato de metilo
Anhídrido R –CO-O-CO-R´ -CO-O-CO- An-oico CH3-CO-O-CO-CH3
Anhid.etán etanoico
Amina R – NH2 -NH2 amina CH3-CH2-NH2
Etilamina
Amida R-CO-NH2 -CO-NH2 amida CH3-CO-NH2
Etanamida
El orden de prioridad de los grupos funcionales es: ácido carboxílico, éster, aldehído,
cetona, alcohol, amina, éter, doble enlace, triple enlace, radical, etc.
Ejemplos: OH
CH3 – C – CH2 – CH3 2-metil-2-butanol
CH3
CH3 – CH – COOH ácido –2-aminopropanoico
NH2

Reacciones químicas. Balance de ecuaciones químicas.


Reacción química: es un fenómeno en el cual una o más sustancias, llamadas reactivos se
transforman en una o más sustancias con propiedades diferentes llamadas productos.
La ecuación química es la representación matemática de una reacción.
Para que la transformación química ocurra será necesario que las moléculas de reactivos
choquen entre sí, situación que se ve favorecida cuando estas sustancias son líquidas o
bien están disueltas en un medio adecuado o cuando por aumento de la temperatura del
sistema las moléculas aumentan su energía cinética. Con esto, además de incrementarse
la probabilidad de choques aumentará la posibilidad de que en la colisión se descargue la
energía suficiente como para destruir los enlaces químicos existentes en los reactivos y
se establezcan los nuevos enlaces que dan origen a los productos. Cuando se dan estas
condiciones se dice que se produjeron choques efectivos.
Energía de activación es la energía que se descarga en el choque y que es necesaria
para que se inicie la reacción.
Para que una ecuación química esté correctamente expresada se deberán escribir con
exactitud las fórmulas de todas las sustancias intervinientes afectadas de sus
correspondientes coeficientes estequiométricos. Recordemos que coeficiente
estequiométrico es el número de moléculas de cada una de las sustancias intervinientes
con los que se logra igualar el número y la calidad de los átomos a ambos lados de la
ecuación. Como consecuencia de este ajuste se verifica simultáneamente la igualdad de
masas para ambos miembros de la ecuación.

Equilibrio químico. Constante de equilibrio. Principio de Le Chatelier. Reacciones


exergónicas y endergónicas.
Veamos el siguiente ejemplo:
Ca (OH)2 Ca++ + 2 OH-
Al disolver hidróxido de calcio en agua se disocia en cationes calcio y aniones oxhidrilos, a
medida que van apareciendo esos iones pueden volver a dar moléculas de hidróxido de
calcio no disociadas. El fenómeno lo graficamos con una doble flecha en la escritura de la
ecuación y aunque generalmente no se hace, deberíamos diferenciar ambas flechas de
alguna manera, ya que a una dada temperatura la velocidad con que se verifica la reacción
en un sentido es mayor que en sentido contrario.
Cuando se inicia la disociación de la base (reacción directa) la velocidad de la misma es
máxima y disminuirá a medida que vaya desapareciendo la forma sin disociar Ca (OH) 2 . A
su vez la velocidad con que los iones Ca++ y OH- se asocian (reacción inversa) es mínima
al principio y aumentará a medida que vayan apareciendo esos iones en el medio. Veamos
el gráfico:
vd
velocidad

v
tiempo (t)

La línea de puntos ( )nos muestra cómo la velocidad de disociación


(reacción directa: vd) va disminuyendo a medida que transcurre el tiempo (t). La línea de
rayas ( ) representa el aumento de la velocidad de asociación (reacción inversa:
vi).Vemos que transcurrido un tiempo las velocidades en ambos sentidos (línea ) se
igualan y son constantes. Los valores vd y vi pueden ser muy diferentes, dependiendo de
cada reacción y de las condiciones de la misma, y a cualquier tiempo que se las mida
serán proporcionales a la concentración de reactivos para vd o de productos para vi, lo
que se expresa:
Vd = kd. [Ca(OH)2] Vi = ki . [Ca++] . [OH-]2
Es decir que serán proporcionales al producto de las concentraciones (de reactivos o
productos según el caso) elevados cada uno a sus respectivos coeficientes
estequiométricos.
Cuando ambas velocidades se igualan como vemos en el gráfico que ocurre, es muy
probable que las concentraciones de reactivos y productos no sean iguales pero
permanecerán constantes a lo largo del tiempo ya que con la misma velocidad que los
reactivos se transforman en productos, los productos se están transformando en reactivos.
Hemos llegado así a un equilibrio dinámico que llamamos
Equilibrio químico

Una reacción química alcanza el equilibrio cuando la velocidad directa se hace igual
a la velocidad inversa.

En este punto en que:


Vd = Vi o sea para nuestro ejemplo kd. [Ca(OH)2] = ki . [Ca++] . [OH-]2
haciendo pasaje de términos kd = [Ca++] . [OH-]2
ki [Ca(OH)2]
Como kd y ki son constantes , al dividirlas obtenemos otra constante que denominamos Ke
= constante de equilibrio y que la definimos así:
Ke, constante de equilibrio, es la relación entre el producto de las concentraciones
de los productos y el producto de las concentraciones de los reactivos, elevadas
cada una , a sus respectivos coeficientes estequiométricos.
¿Qué significado tiene Ke?
Nos informa si en la mezcla de reacción, al llegar al equilibrio, predominan los productos o
los reactivos. Ejemplo:
Si Ke = 20.000 (o sea 2 x 104) En el equilibrio predominan los productos.
Si Ke = 0,0001 (o sea 1 x10-4) En el equilibrio predominan los reactivos.
En todos los casos en que es posible lograr un equilibrio dinámico entre las reacciones
directa e inversa de la reacción, se dice que la reacción es reversible. Sin embargo existen
casos en que la reacción está tan desplazada en uno de los dos sentidos que decimos que
es una reacción irreversible.
Es poco probable que ambos, numerador y denominador de la expresión de Ke sean
iguales, en ese caso Ke sería igual a uno y en el equilibrio la concentración de reactivos y
productos sería la misma.

Principio de Le Chatelier

Este principio se refiere a la forma de reaccionar de un sistema en equilibrio cuando lo


perturba un factor externo y dice:

Cuando un sistema en equilibrio es perturbado por una fuerza externa, el


sistema evolucionará en el sentido de contrarrestar el efecto de esa fuerza.

Veamos que ocurrirá con una reacción que está en equilibrio y es afectada por factores
externos:
A +B C+D [C].[D]
Ke =
[A] . [B]
a) Si se aumenta la concentración de A, como [A] se encuentra en el denominador de la
expresión de Ke, para que siga manteniendo el valor, la reacción se desplazará hacia la
derecha consumiendo el exceso de A. Igual consideración haríamos en caso de aumentar
la concentración de B.
b) Si disminuye la concentración de A, como [A] se encuentra en el denominador de la
expresión de Ke, para que siga manteniendo el valor, la reacción se desplazará hacia la
izquierda. Igual consideración haríamos en caso de disminuir la concentración de B.
c) Si se aumenta la concentración de C, como [C] se encuentra en el numerador de la
expresión de Ke, para que siga manteniendo el valor, la reacción se desplazará hacia la
izquierda consumiendo el exceso de C. Igual consideración haríamos en caso de aumentar
la concentración de D.
d) Si se disminuye la concentración de C, como [C] se encuentra en el numerador de la
expresión de Ke, para que siga manteniendo el valor, la reacción se desplazará hacia la
derecha. Igual consideración haríamos en caso de disminuir la concentración de D.

En nuestro organismo las reacciones metabólicas nunca llegan al equilibrio aunque siempre
estén evolucionando en el sentido de poder alcanzarlo. Las modificaciones constantes en
las concentraciones de los compuestos hacen que las reacciones se desplacen en un
sentido u otro, según las necesidades de la economía celular.

Conclusiones generales
• Al llegar al equilibrio una reacción, las velocidades directa e inversa se hacen iguales y
las concentraciones de reactivos y productos constantes (no necesariamente iguales).
• La Ke de una reacción es un valor constante a una temperatura dada
• El valor de Ke permite decir si una reacción estará desplazada hacia la derecha o
izquierda cuando alcance el equilibrio.
• El agregado de reactivos o productos o la eliminación de parte de ellos producirán
desplazamientos sobre el equilibrio, que serán predictibles.

Reacciones exergónicas y endergónicas


Supongamos que tenemos un sistema, que pondremos en condiciones adecuadas como
para que sufra una transformación química. Llamaremos Ei al contenido de energía inicial
de este sistema. Una vez producida la mencionada transformación el contenido de energía
final del sistema, que llamaremos Ef, será leve, moderada o marcadamente diferente a Ei.
Puede ser que Ef sea menor que Ei , Ef < Ei
El sistema ha perdido energía como consecuencia de la transformación producida: vemos
que ha quedado con un contenido de energía menor que el que poseía en estado inicial.
En estos casos se dice que el fenómeno (la transformación química para este ejemplo) es
exergónico. El sistema ha liberado energía. Cuando un fenómeno es exergónico se
produce espontáneamente (proceso espontáneo). Esto quiere decir que no habrá que
entregarle energía para que suceda.
Si se trata específicamente de una reacción química, el sistema evolucionará
espontáneamente con mayor velocidad hacia la formación de productos y aunque sea
reversible, al llegar al equilibrio tendremos una relación entre concentración de productos y
concentración de reactivos mayor que uno.([P] / [R] > 1)
Puede ser que Ef sea mayor que Ei , Ef > Ei
El sistema ha ganado energía como consecuencia de la transformación producida: vemos
que ha quedado con un contenido de energía mayor que el que poseía en estado inicial.
En estos casos se dice que el fenómeno (la transformación química, para este ejemplo) es
endergónico. El sistema ha absorbido energía. Cuando un fenómeno es endergónico NO se
produce espontáneamente. Esto quiere decir que habrá que entregarle energía al sistema
para que suceda la transformación.
Si se trata específicamente de una reacción química, el sistema no evolucionará
rápidamente hacia la formación de productos, y si es reversible, apenas aparecido el
producto el sistema tenderá a recuperar reactivos. Así al llegar al equilibrio tendríamos una
relación entre concentración de productos y concentración de reactivos menor que uno ([P]
/ [R]< 1)
Cuando la energía en juego es energía calórica en lugar de endergónico y exergónico
pueden usarse los términos endotérmico y exotérmico respectivamente.
De lo anterior podemos predecir que para las reacciones exergónicas en el equilibrio
predominan las concentraciones de los productos sobre la de los reactivos y por lo tanto su
Ke será mayor que la unidad, lo contrario ocurrirá en las reacciones endergónicas.
Resumiendo: a toda reacción exergónica le corresponderá un valor de Ke mayor que la
unidad, y toda reacción endergónica tendrá un valor de Ke menor que la unidad.
Reacción en eq. [P] > Ke mayor que
exergónica
espontánea [R] 1

Reacción no en eq. [P] < Ke menor que


endergónica
espontánea [R] 1
EJERCITACIÓN

1) Indicar cuáles de las siguientes afirmaciones son verdaderas, colocando las letras
V o F respectivamente:
a) La unión covalente puede ser múltiple...............
b) La unión iónica se produce cuando dos elementos tienen valores de
electronegatividad muy similares……………..
c) Una unión covalente pura se obtiene al unirse dos átomos del mismo
elemento...........

Química orgánica

1.- Marcar la respuesta correcta:



• Los hidrocarburos son compuestos formados por:
a) C e H b) C,H, y O c) C,H,O y N d) C,H,O,N y S
• El propano presenta una cadena carbonada:
a) cíclica b) saturada c) ramificada d) no saturada
• Los átomos de C que se unen a 2 átomos de C vecinos son:
a)primarios b) secundarios c) terciarios d) cuaternarios

2.- Marcar la respuesta correcta:


• El grupo carbonilo se encuentra en:
a) aldehídos b) cetonas c) ácidos carboxílicos d) todos los anteriores
• Los ésteres se forman por la reacción de un alcohol y :
a) un aldehído b) una cetona c) un ácido d) una amina
• Entre las funciones nitrogenadas se encuentran:
a) aminas b) amidas c) éteres d) a+b e) b+c
• La sustitución del OH de un ácido por un grupo amino origina:
a) un aldehído b) una cetona c) una amida d) una amina
3.- Relacionar con una flecha cada fórmula general con la función química a la que
corresponde.

Fórmula general Función química


R-CHO alcohol
R-COOH éter
R-CO-NH2 aldehído
R-COO-R´ cetona
R-CO-R´ ácido carboxílico
R-OH éster
R-CH2-NH2 amina
R-O-R´ amida

4.- En los siguientes compuestos, encierre con un círculo la función carboxilo, con un
cuadrado la función alcohol y con un triángulo la función cetona .

COOH CHO

H - C –OH ……………….. C=O ……………………………


CH3 CH3

5.- a) Cuando un ácido orgánico reacciona con un grupo funcional........................... se


obtiene un enlace llamado ........................... cuya estructura es - COO-CH2-
b) En cambio la estructura - CO-NH2 , que se llama ....................... y resulta de reemplazar
el ...................... del grupo -COOH, por un grupo .................... .

6.- Complete las líneas de puntos con el nombre de las funciones que participan en la
reacción y el del enlace que se origina:

a) CH3 – COOH + CH3 –OH CH3 – COO- CH3 + H2O


………………. ………….. …………………..

b) CH3 –CH2 –OH + CH3 –OH CH3 –CH2 –O-CH3 + H2O


………………… ………….. ...............................

c) CH2-OH OH CH2OH
 
H COH + HO −P =O → HC OH + H2O
  OH
H2C − OH HO H2C  O  P = O
OH
........................ ...................... ....................................................................

OH
d) CH3- COOH + H3PO4 CH3 –COO-P=O
OH

........................... ................. .............................

Lea el párrafo siguiente:

Las propiedades de la cadena de cada aminoácido permiten predecir su


comportamiento. El grupo sulfhidrilo de cisteínas es altamente reactivo y con facilidad se
combina con otro similar para formar uniones disulfuro. Dos cisteínas ligadas por este tipo
de enlace covalente forman cistina.
El grupo carboxilo adicional de ácidos aspártico y glutámico, además de
otorgarles carácter ácido, da a estos aminoácidos la propiedad de interactuar con
sustancias básicas para formar uniones de tipo salino. También pueden establecer
atracciones electrostáticas de este tipo los aminoácidos diaminados.

Preguntas:

1.- Nombre un aminoácido que formando parte de un péptido otorgue características ácidas
al mismo. ¿Qué grupo funcional participa de esta propiedad?
2.- Un aminoácido diaminado, por la característica de cadena lateral puede originar uniones
electrostáticas. Diga la naturaleza ácido-base del grupo funcional presente en el
aminoácido y la de la otra sustancia con la que actuaría para originar esa unión.
3.- ¿Cuál sería la diferencia entre el tipo de unión que se origina entre dos cisteínas ligadas
entre si por el grupo –SH y la unión a la que se refiere la pregunta 2.

4. En el párrafo siguiente

Los aminoácidos son moléculas que a pH fisiológico tienen cargas negativas y positivas.
Las primeras se deben a los grupos carboxilos ionizados mientras que las segundas se
pueden atribuir a los grupos amino. En sus cadenas laterales pueden encontrarse otros
grupos funcionales como son los grupos oxhidrilos, amida, sulfhidrilo, anillos aromáticos,
cadenas carbonadas ramificadas, grupos aminos y grupos carboxilos. A través de estos
grupos se establecerán interacciones intermoleculares como ser uniones electrostáticas,
uniónes dipolo-dipolo, fuerzas de Van der Waals y puentes disulfuro

Indique:
1- la variable que indica el grado de acidez del medio.
2- la palabra que indica que una estructura tiene carga.
3- grupos que puedan establecer puente de hidrógeno
4- grupos que puedan establecer puente disulfuro
5- fuerzas intermoleculares de carácter covalente
6- grupos funcionales con nitrógeno en su estructura
7- estructuras químicas con alto grado de comportamiento apolar
8- uniones químicas que impliquen la interacción de estructuras con cargas
9- grupos funcionales oxigenados

Equilibrio Químico
1.- Completar los espacios en blanco:
En las reacciones reversibles se llega a un estado de equilibrio dinámico caracterizado por
una constante de....................... Cuando se llega al equilibrio la concentración de
los .....................y de los productos permanece.......................Si se produce un cambio en la
...................de alguno de ellos, el equilibrio se................tratando de oponerse a la
modificación.
2.- Considerando la siguiente ecuación:
2 CO + O2 2 CO2
a) Expresar la cte. de equilibrio........................................................................................
b) Señalar cómo se desplaza la reacción (hacia la izquierda o derecha) al:
aumentar la concentración de oxígeno .............................................................................
disminuir la concentración de CO.....................................................................................
aumentar la concentración de CO2.............................................................................................................................
3.- Indicar en cuáles reacciones, al llegar al equilibrio, se encuentra favorecida la formación
de productos (desplazada hacia la derecha), formación de reactivos (desplazada hacia la
izquierda) o ambos
a) A + B C+D Ke= 2 x 10-7 ………………............
b) 2 A + 3 B 2D + X Ke = 3 x 1045 ……..........................
c) 2 AB2 M+2C Ke= 1 ……………………… ……..
4.- La siguiente ecuación se lleva a cabo en un sistema cerrado:
X + 2Y Z + W
a) Escriba la expresión de la Ke para esta reacción..................................................
b)¿Qué compuestos tendrán mayor concentración en el equilibrio si el valor de la Ke es
superior a 1? ........................................................................
c)¿Qué compuestos agregaría al sistema cuando llegó al equilibrio para desplazarlo hacia la
izquierda?..................................................
d) ¿Hacia dónde se desplazará el equilibrio si se abre el sistema y escapa el compuesto W
que es gaseoso? ............................................................
5.- Dada la siguiente ecuación:
CO2 + H2O CO3H- + H+
La reacción se desplazará hacia la izquierda:
a) si aumenta o si disminuye la concentración de protones...........................................
b) si se pierde el gas dióxido de carbono o si aumenta la presión del mismo...........
6.- Clasificar las siguientes reacciones desde el punto de vista energético:
a) C + O2 à CO2 + energía ..........................................................................
b) 2 H2O2 + energía à 2 H2O + O2 .............................................................................................................
7.- Completar:
a) Si el proceso A à B es ................... EA < EB
b) Si el proceso B à C es exergónico EB.............EC
8.- Dada la siguiente ecuación:
CO2 + H2O CO3H- + H+
a) Si sólo tiene posibilidad de trabajar con elementos gaseosos, cómo desplazaría este
equilibrio hacia la derecha? .........................................................................................
b)¿ y hacia la izquierda?....................................................................................
c) ¿qué pasará con el desplazamiento de la reacción si se aumenta la concentración de
protones...................
d) si a una dada temperatura Ke es igual 10-6 , en el equilibrio [P] ........ [R]
9.-
Na2CO3 + 2HCl 2 ClNa + CO2 + H2O
a)¿ Cómo modificaría la presión de CO2 para desplazar esta reacción hacia la
derecha? ............................................................
b)¿Qué haría para desplazar esta reacción hacia la derecha modificando la concentración
del ácido?......................................................
c) Si la Ke de esta reacción a una dada temperatura es igual 10 3 ¿qué esperaría encontrar
respecto de las concentraciones en el equilibrio? …………………………
10.- 3 Na2CO3 + 2 H3PO4 2 Na3PO4 + 3 CO2 + 3 H2O
Si la Ke de este equilibrio a una dada temperatura es 2 x 102 ¿Hacia dónde evolucionaría
espóntaneamente el sistema si las concentraciones de todos los miembros de la ecuación
son iguales?................................
11.- C6H12O6 6 CO2 + 6 H2O
En esta reacción, la energía de los productos es mucho menor que la de los reactivos por lo
tanto:
a) desde el punto de vista energético es una reacción ..........................................
b) Su Ke en un sistema cerrado será ...........................que la unidad.
c) En el equilibrio el número de moles totales de ........................será mayor que el
de .................................
d) Esta reacción ....................una cantidad de energía que podría impulsar otra
e) reacción de tipo.......................................
ÁCIDOS NUCLEICOS. DUPLICACIÓN DE ADN. TRANSCRIPCIÓN.

1. ¿Cómo está constituido el ADN?. Indique como se encuentran unidos dichos


constituyentes. Construya un esquema de un trozo de ADN que contenga 10 G, 10
A, 10 C y 10 T. Las 2 cadenas, ¿son idénticas?¿Qué dirección tienen las
cadenas? ¿Qué tipos de enlaces unen ambas cadenas? Analice la disposición
espacial que adoptan las bases, los grupos fosfato y los hidratos de carbono.

2. Describa comparativamente la estructura del ADN y del ARN remarcando las


características distintivas. Describa los distintos tipos de ARN. Analice la función
que cumple cada uno de ellos y relaciónelos con su estructura.

3. Describa el proceso de replicación del ADN. Represente dicha replicación en un


esquema sencillo. ¿Cómo es provista la energía para esta síntesis?

4. Describa el proceso de transcripción. La síntesis de ARN, ¿sólo puede ocurrir a


partir de ADN? ¿Cómo actúa la transcriptas inversa?

5. ¿Qué enzimas fundamentales intervienen en los procesos de duplicación y de


transcripción y cuáles son los sustratos de las reacciones antes mencionadas?

6. Explique en términos generales el fenómeno de transmisión de la información


genética: ¿cómo a partir de una estructura de nucleótidos se obtiene una
secuencia de aminoácidos?

7. La ovoalbúmina de gallina está codificada por un gen de 7700 pares de bases.


¿Cómo explica el hecho de que solo 1158 pares correspondan a los que codifican
a la proteína madura?

8. Explique sintéticamente cuales son las transformaciones que sufre el ARN hasta
que se transforma en ARN maduro.

SÍNTESIS DE PROTEÍNAS

1. Describa sintéticamente las 4 etapas en la síntesis de proteínas ¿cuál es el gasto


energético para la formación de un enlace peptídico?

2. La hebra molde de una muestra de DNA duplohelicoidal contiene la secuencia:


(5’) CTTAACACCCCTGACTTCGCGCCGTCG
a) ¿Cuál es la secuencia de bases del mRNA que puede ser transcrito a partir de esta
hebra?
b)Suponga que la otra hebra (no molde) de esta muestra de DNA es transcrita y
traducida ¿sería la secuencia de AA igual a la producida a partir de la hebra molde?

3. Diversas enzimas deben ser fosforiladas en algunos restos aminoacídicos para


poder llevar a cabo su función. ¿cuándo ocurre dicha fosforilación en el proceso de
síntesis de la proteína? ¿Existe algún otro cambio que puedan experimentar las
proteínas y que afecte su función?. Dé ejemplos.

4. Defina mutación y describa los distintos tipos de mutaciones puntuales. En la


hemoglobina de la anemia falciforme hay un residuo VAL en la posición 6 de la
cadena de beta-globina en lugar del residuo GLU encontrado en esta posición en
la HbA normal. Esto resulta de una mutación puntual en el gen que codifica para
dicha cadena de globina. ¿Puede predecir que cambio tuvo lugar en el codón del
glutamato en el DNA que justifique su sustitución por VAL?

Datos: codones que codifican para GLU: GAA y GAG


Codones que codifican para VAL: GTT, GTC, GTA y GTG

5. Los antibióticos son sustancias producidas por microorganismos que tienen la


propiedad de inhibir el desarrollo de otros microorganismos afectando, en muchos
casos, las etapas de la síntesis de ácidos nucleicos y de proteínas. Dé ejemplos.

RESOLUCIÓN DE LAS PREGUNTAS Y PROBLEMAS PLANTEADOS

1) Indicar cuáles de las siguientes afirmaciones son verdaderas, colocando las letras
V o F respectivamente:
a) La unión covalente puede ser múltiple.....V..........
b) La unión iónica se produce cuando dos elementos tienen valores de
electronegatividad muy similares ...F......
c) Una unión covalente pura se obtiene al unirse dos átomos del mismo
elemento....V.......

1.- Marcar la respuesta correcta:


• Los hidrocarburos son compuestos formados por:

a) C e H b) C,H, y O c) C,H,O y N d) C,H,O,N y S


• El propano presenta una cadena carbonada:
a) cíclica b) saturada c) ramificada d) no saturada
• Los átomos de C que se unen a 2 átomos de C vecinos son:
a) primarios b) secundarios c) terciarios d) cuaternarios

2.- Señalar la respuesta correcta:


• El grupo carbonilo se encuentra en:
a) aldehídos b) cetonas c) ácidos carboxílicos d) todos los anteriores

• Los ésteres se forman por la reacción de un alcohol y :


a) un aldehído b) una cetona c) un ácido d) una amina
Entre las funciones nitrogenadas se encuentran:
a) aminas b) amidas c) éteres d) a+b e) b+c
• La sustitución del - OH de un ácido por un grupo amino origina:
a) un aldehído b) una cetona c) una amida d) una amina

3.- Relacionar con una flecha cada fórmula general con la función química a la que
corresponde.

Fórmula general Función química


R-CHO alcohol
R-COOH éter
R-CO-NH2 aldehído
R-COO-R´ cetona
R-CO-R´ ácido carboxílico
R-OH éster
R-CH2-NH2 amina
R-O-R´ amida

4.- En los siguientes compuestos, encierre con un círculo la función carboxilo y con un
cuadrado la función alcohol y con un triángulo la función cetona

COOH CHO

H-C –OH … C=O …

CH3 CH3

5.- a) Cuando un ácido orgánico reacciona con un grupo funcional...alcohólico............. se


obtiene un enlace llamado .....éster......... cuya estructura es - COO-CH2-
b)En cambio la estructura - CO-NH2 , que se llama ....amida.......... y resulta de reemplazar
el .........-OH......... del grupo -COOH, por un grupo .............NH2...
6.- Complete las líneas de puntos con el nombre de las funciones que participan en la
reacción y el del enlace que se origina:
a) CH3 – COOH + CH3 –OH CH3 – COO- CH3 + H2O
……ácido…….. alcohol…. …éster…..
b) CH3 –CH2 –OH + CH3 –OH CH3 –CH2 –O-CH3 + H2O
…… alcohol ……… alcohol ….. ...éter................
c) CH2-OH OH CH2OH
 
H COH + HO −P =O → HC OH + H2O
  OH
H2C − OH HO H2C  O  P = O

OH
........ alcohol.......... ácido fosfórico........ ...........éster fosfórico.......................
OH
d) CH3- COOH + H3PO4 CH3 –COO-P=O
OH

ácido carboxílico ácido fosfórico.. anhídrido de ácido fosfórico....

Lea el párrafo siguiente:

Las propiedades de la cadena de cada aminoácido permiten predecir u


comportamiento. El grupo sulfhidrilo de cisternas es altamente reactivo y con facilidad se
combina con otro similar para formar uniones disulfuro. Dos cisternas ligadas por este tipo
de enlace covalente forman cistina.
El grupo carboxilo adicional de ácidos aspártico y glutámico, además de
otorgarles carácter ácido, da a estos aminoácidos la propiedad de interactuar con
sustancias básicas para formar uniones de tipo salino. También pueden establecer
atracciones electrostáticas de este tipo los aminoácidos diaminados.

Preguntas:

1- Nombre un aminoácido que formando parte de un péptido otorgue características ácidas


al mismo. ¿Qué grupo funcional participa de esta propiedad?
Pueden ser: ácido glutámico o ácido aspártico. El grupo que participa es el carboxilo.
2.- Un aminoácido diaminado, por la característica de cadena lateral puede originar uniones
electrostáticas. Diga la naturaleza ácido-base del grupo funcional presente en el
aminoácido y la de la otra sustancia con la que actuaría para originar esa unión.
Esos aminoácidos tienen una función amina adicional (-NH3+) en su cadena lateral y
pueden originar uniones electrostáticas con grupos de signo opuesto (-COO-).
3.- ¿Cuál sería la diferencia entre el tipo de unión que se origina entre dos cisternas ligadas
entre si por el grupo –SH y la unión a la que se refiere la pregunta 2.
Los grupos sulfhidrilo de dos cisteinas se combinan originando un puente disulfuro,
ésta es una unión covalente a diferencia de la pregunta 2 que es electrostática.

5. En el párrafo siguiente

Los aminoácidos son moléculas que a pH fisiológico tienen cargas negativas y positivas.
Las primeras se deben a los grupos carboxilos ionizados mientras que las segundas se
pueden atribuir a los grupos amino. En sus cadenas laterales pueden encontrarse otros
grupos funcionales como son los grupos oxhidrilos, amida, sulfhidrilo, anillos aromáticos,
cadenas carbonadas ramificadas, grupos aminos y grupos carboxilos. A través de estos
grupos se establecerán interacciones intermoleculares como ser uniones electrostáticas,
uniónes dipolo-dipolo, fuerzas de Van der Waals y puentes disulfuro.
Indique:
1- la variable que indica el grado de acidez del medio. El pH
2- la palabra que indica que una estructura tiene carga. Ionizados
3- grupos que puedan establecer puente de hidrógeno. Grupos oxhidrilos, carboxilos,
aminos y amidas.
4- grupos que puedan establecer puente disulfuro. Grupo sulfhidrilo
5- fuerzas intermoleculares de carácter covalente. Puentes disulfuro
6- grupos funcionales con nitrógeno en su estructura. Grupos amino
7- estructuras químicas con alto grado de comportamiento apolar. Cadenas carbonadas,
anillos aromáticos.
8- uniones químicas que impliquen la interacción de estructuras con cargas. Uniones
electrostáticas.
9- grupos funcionales oxigenados. Oxhidrilos, carboxilo.

1.- Completar los espacios en blanco:


En las reacciones reversibles se llega a un estado de equilibrio dinámico caracterizado por
una constante de ..equilibrio... Cuando se llega al equilibrio la concentración de
los ..reactivos....y de los productos permanece...constante...Si se produce un cambio en
la .concentración..de alguno de ellos, el equilibrio se..desplaza....tratando de oponerse a
la modificación.
2.- Considerando la siguiente ecuación:
2 CO + O2 2 CO2
a) Expresar la cte. de equilibrio
[CO2 ] 2
Ke =
[ CO ] 2 [O2 ]
b) Señalar cómo se desplaza la reacción (hacia la izquierda o derecha) al:
aumentar la concentración de oxígeno.......... a la derecha
disminuir la concentración de CO..................a la izquierda
aumentar la concentración de CO2................ a la izquierda

3.- Indicar en cuáles reacciones, al llegar al equilibrio, se encuentra favorecida la formación


de productos (desplazada hacia la derecha), formación de reactivos (desplazada hacia la
izquierda) o ambos.
a) A + B C+D Ke= 2 x 10-7 a reactivos
45
b) 2 A + 3 B 2D + X Ke = 3 x 10 a productos
c) 2 AB2 M+2C Ke= 1 igualmente favorecida

4.- La siguiente ecuación se lleva a cabo en un sistema cerrado:


X + 2Y Z + W
a)Escriba la expresión de la Ke para esta reacción
[Z ] . [ W ]
Ke =
[ X ] [ Y ]2
b) ¿Qué compuestos tendrán mayor concentración en el equilibrio si el valor de la Ke es
superior a 1?
Los productos: Z y W
c) ¿Qué compuestos agregaría al sistema cuando llegó al equilibrio para desplazar la
reacción hacia la izquierda?
Agregaría Z o W, o ambos
d) ¿Hacia donde se desplazará la reacción si se abre el sistema y escapa el compuesto W
que es gaseoso?
Hacia la derecha
5.- Dada la siguiente ecuación:
CO2 + H2O CO3H- + H+
La reacción se desplazará hacia la izquierda:
a) si aumenta o si disminuye la concentración de protones…...si.aumenta...................
b) si se pierde el gas dióxido de carbono o si aumenta la presión del mismo..si se pierde el
gas....
6.- Clasificar las siguientes reacciones desde el punto de vista energético:
a) C + O2 à CO2 + energía ....................Exergónica
b) 2 H2O2 + energía à 2 H2O + O2 ........Endergónica

7.- Completar :
a) Si el proceso A àB es ....endergónico........ EA < EB
b) Si el proceso B à C es exergónico EB..>...........EC
8.- Dada la siguiente ecuación:
CO2 + H2O CO3H- + H+
a) Si sólo tiene posibilidad de trabajar con elementos gaseosos, cómo desplazaría este
equilibrio hacia la derecha? Aumentando la concentración de CO2............................
b) y hacia la izquierda?................ Disminuyendo la concentración de CO2.
c) ¿qué pasará con el equilibrio si se aumenta la concentración de protones....se desplaza
a la izquierda..............
d) si a una dada temperatura Ke es igual 10-6 , en el equilibrio [P] ...<..... [R]
9.-
Na2CO3 + 2HCl 2 ClNa + CO2 + H2O
a)¿ Cómo modificaría la presión de CO2 para desplazar la reacción que está en equilibrio
hacia la derecha? ..........la. disminuiría............................................
b)¿Cómo modificaría la concentración de ácido para desplazar la reacción, que está en
equilibrio, hacia la derecha ?............lo aumentaría.....................................
c)Si la Ke de esta reacción a una dada temperatura es igual 103 ¿qué esperaría encontrar
respecto de las concentraciones en el equilibrio?....... [P] ...>..... [R] ...........
10.- 3 Na2CO3 + 2 H3PO4 2 Na3PO4 + 3 CO2 + 3 H2O
Si la Ke de este equilibrio a una dada temperatura es 2 x 102 ¿Hacia dónde evolucionaría
espontáneamente el sistema si se parte de concentraciones iguales de reactivos y
productos ?........hacia la derecha
11.- C6H12O6 6 CO2 + 6 H2O
La energía de los productos es mucho menor que la de los reactivos por lo tanto:
a) desde el punto de vista energético es una reacción ..................exergónica
b) Su Ke en un sistema cerrado será ...........>................que la unidad.
c) En el equilibrio el número de moles totales de ....producto............será mayor
que el de ..................reactivo........
d) Esta reacción ...libera....una cantidad de energía que podría impulsar otra
reacción ................endergónica........

ACIDOS NUCLEICOS. DUPLICACIÒN DE ADN. TRANSCRIPCION

1.-¿Cómo está constituido el ADN?. Indique como se encuentran unidos dichos


constituyentes. Construya un esquema de un trozo de ADN que contenga 10 G, 10 A,
10 C y 10 T. Las 2 cadenas, ¿son idénticas?¿Qué dirección tienen las cadenas? ¿Qué
tipos de enlaces unen ambas cadenas? Analice la disposición espacial que adoptan
las bases, los grupos fosfato y los hidratos de carbono.
Ver página 99 y 100 del libro de Química Biológica de Antonio Blanco. 7ª.
edición
2.-Describa comparativamente la estructura del ADN y del ARN remarcando las
características distintivas. Describa los distintos tipos de ARN. Analice la función que
cumple cada uno de ellos y relaciónelos con su estructura.
Ver página 106 a 108 del libro de Química Biológica de Antonio Blanco. 7ª.
edición

3.- Describa el proceso de replicación del ADN. Represente dicha replicación en un


esquema sencillo. ¿Cómo es provista la energía para esta síntesis?
Ver página 339 a 344 del libro de Química Biológica de Antonio Blanco. 7ª.
edición

4.- Describa el proceso de transcripción. La síntesis de ARN, ¿Cómo actúa la


transcriptasa inversa?
Ver página 346 a 350 del libro de Química Biológica de Antonio Blanco. 7ª.
edición

5.- ¿Qué enzimas fundamentales intervienen en los procesos de duplicación y de


transcripción y cuáles son los sustratos de las reacciones antes mencionadas?
Enzimas
Duplicación Transcripción
-Proteína separadora o desenrrollante -ARN polimerasa (dependiente de
(helicasa) ADN) :
- Proteínas fijadoras de ADN -ARN pol.I:cataliza transc. ARN r
-topoisomerasas - “ “ II: cataliza trasc. ARN m
- primasa - “ “ III: “ “ genes ARN t
- ADN polimerasa
-ADN ligasa
- ADN polimerasa
Sustratos
dATP, dGTP, dCTP, dTTP ATP, GTP, CTP, UTP
Es necesario: ARN iniciador Es necesario: ADN molde
Cadena molde ADN Mg++
+
Mg

6.- Explique en términos generales el fenómeno de transmisión de la información


genética: ¿cómo a partir de una estructura de nucleótidos se obtiene una secuencia
de aminoácidos?
Ver página 359 del libro de Química Biológica de Antonio Blanco. 7ª. edición

7.- La ovoalbúmina de gallina está codificada por un gen de 7700 pares de bases.
¿Cómo explica el hecho de que solo 1158 pares correspondan a los que codifican a la
proteína madura?
Los eucariotes no tienen la información genética dispuesta en trozos continuos
de ADN, sino divididos en segmentos denominados exones, entre ellos se
extienen porciones de ADN sin información llamadas intrones.

8.-Explique sintéticamente cuales son las transformaciones que sufre el ARN hasta
que se transforma en ARN maduro.
Ver página 364 del libro de Química Biológica de Antonio Blanco. 7ª. Edición
SINTESIS DE PROTEINAS

1.- Describa sintéticamente las 4 etapas en la síntesis de proteínas ¿cuál es el gasto


energético para la formación de un enlace peptídico?
Ver páginas 365 a 368 del libro de Química Biológica de Antonio Blanco. 7ª.
Edición

2.-La hebra molde de una muestra de DNA duplohelicoidal contiene la secuencia:


(5’) CTTAACACCCCTGACTTCGCGCCGTCG
a) ¿Cuál es la secuencia de bases del mRNA que puede ser transcrito a partir de esta
hebra?
GAAUUGUGGGGACUGAAGCGCGGCAGC
b)Suponga que la otra hebra (no molde) de esta muestra de DNA es transcrita y
traducida ¿sería la secuencia de AA igual a la producida a partir de la hebra molde?
NO

3.- Diversas enzimas deben ser fosforiladas en algunos restos aminoacídicos para
poder llevar a cabo su función. ¿cuándo ocurre dicha fosforilación en el proceso de
síntesis de la proteína? ¿Existe algún otro cambio que puedan experimentar las
proteínas y que afecte su función?. Dé ejemplos.
Ver página 370 del libro de Química Biológica de Antonio Blanco. 7ª. Edición

4.- Defina mutación y describa los distintos tipos de mutaciones puntuales. En la


hemoglobina de la anemia falciforme hay un residuo VAL en la posición 6 de la
cadena de beta-globina en lugar del residuo GLU encontrado en esta posición en la
HbA normal. Esto resulta de una mutación puntual en el gen que codifica para dicha
cadena de globina. ¿Puede predecir que cambio tuvo lugar en el codón del glutamato
en el DNA que justifique su sustitución por VAL?

Datos: codones que codifican para GLU: GAA y GAG


Codones que codifican para VAL: GTT, GTC, GTA y GTG
Cambia GAA por GTA y GAG por GTG

5. Los antibióticos son sustancias producidas por microorganismos que tienen la


propiedad de inhibir el desarrollo de otros microorganismos afectando, en muchos
casos, las etapas de la síntesis de ácidos nucleicos y de proteínas. Dé ejemplos.
Ver páginas 372 y 373 del libro de Química Biológica de Antonio Blanco. 7ª.
Edición