Aus dem Universittsklinikum Mnster Medizinische Klinik und Poliklinik A Direktor: Univ.-Prof. Dr. Wolfgang E.

Berdel

Tumor growth inhibition by RGD peptide directed delivery of truncated tissue factor to the tumor vasculature

INAUGURAL DISSERTATION Zur Erlangung des doctor medicinae der Medizinischen Fakultt der Westflischen Wilhelms Universitt Mnster

Vorgelegt von Federico Ludwig Herrera Alemn aus Tegucigalpa / Honduras 2004

Gedruckt mit Genehmigung der Medizinischen Fakultt der Westflischen Wilhelms-Universitt Mnster

Dekan: Univ.-Prof. Dr. H. Jrgens Berichterstatter: Prof. Dr. R. M. Mesters. Berichterstatter: Priv.- Doz. Dr. J. Vormoor Tag der mndlichen Prfung 29.11.04

Aus dem Universittsklinikum Mnster Medizinische Klinik und Poliklinik A Direktor: Univ.-Prof. Dr.Wolfgang E Berdel Referent: Prof. Dr. R. M. Mesters Korreferent: Priv. Doz. Dr. J. Vormoor ZUSAMMENFASSUNG Antivaskulre Therapie von malignen Tumoren mittels Fusionspolypeptiden bestehend aus Gewebefaktor und RGD Peptiden Federico Herrera Alemn
Die selektive Aktivierung der Blutgerinnung in Tumorblutgefen ist ein

vielversprechender antivaskulrer Therapieansatz zur Behandlung bsartiger Tumoren. Aus der Thrombusbildung resultiert eine konsekutive Tumornekrose. Fr eine solche Strategie wurden Fusionsproteine generiert, die aus lslichem Gewebefaktor (truncated tissue factor, kurz tTF, welcher die Blutgerinnung aktiviert) und Oligopeptiden bestehen, die die selektive Bindung an Rezeptoren der Tumor-Endothelzelle vermitteln. Das tTF-Fusionspolypeptid tTF-GRGDSP (kurz: tTF-RGD) wurde stabil exprimiert, gereinigt, biochemisch umfassend charakterisiert und anschlieend an Transplantaten menschlicher Tumoren (humanes Lungenkarzinom, malignes Melanon) im Mausmodell evaluiert. Die Tumoren der mit tTF-RGD Fusionsprotein behandelten Muse wurden im Vergleich zu tTF oder NaCl in ihrem Wachstum signifikant gehemmt. Histologische untersuchungen belegen den Wirkungsmechanismus der Induktion einer selektiven Tumorgefthrombose mit konsekutiver Tumornekrose. Eine relevante Organtoxizitt wurde auch bei Dosen der tTF-Fusionsproteine, die das mehrfach der therapeutisch effektiven Dosis berschrieten, weder makroskopisch noch mikroskopisch beobachtet. Genehmigung durch die Bezirksregierung Mnster am 2000 Aktenzeichen.: 50083510; G67 / 2000 Tag der mndlichen Prfung 29.11.04

Contents :

Page

Introduction

Angiogenesis Definition of angiogenesis The coagulation system and angiogenesis 10 10

Angiogenesis in cancer Role of angiogenesis in cancer Regulators of tumor angiogenesis Metastasis Mediators of tumor angiogenesis 11 13 14 15

Anti-angiogenesis The process of anti-angiogenesis Anti-angiogenic treatment strategies Angiogenesis inhibitors Anti-angiogenic factors and pro-angiogenic factors Gene treatment approaches 17 17 19 20 22

Vascular targets Targeting the tumor vasculature 23

The V3 and V5 integrins as natural endothelial markers 26 Recombinant fusion proteins 27

Objectives General objectives 30

Material and Methods Cell lines and antibodies 31

Construction of the E coli expression vector for soluble TF 31 Expression, refolding and purification of tTF and tTF RGD fusion proteins. Characterization of tTF and tTF -RGD peptide SDS-PAGE and western blot analyses Binding of tTF-RGD fusion proteins to FVIIa Factor X activation by tTF and tTF-RGD fusion proteins Binding of tTF-RGD fusion protein to its targets Tumor xenotransplantation models Histological studies 33 33 34 35 36 37 39 32

Statistical Analysis

40

Results Functional characterisation of tTF and tTF-RGD fusion proteins Factor X activation by tTF and tTF-RGD Binding of tTF-RGD to purified v3 Binding of tTF-RGD on endothelial cells Antitumor activity of tTF-RGD in murine tumor models Histological analyses 42 43 44 45 48 41

Discussion

52

Literature

56

Abbreviations

73

Acknowledgements

74

Curriculum Vitae

75

Introduction Angiogenesis, i.e., the proliferation of new blood vessels from preexisting ones, is a characteristic feature of aggressive solid tumors (Folkman et al, 1989). Molecules capable of inhibiting angiogenesis or of selectively targeting and destroying new blood vessels, would be promising agents for the treatment of angiogenesis-related diseases. Tissue factor (TF) is a cell-surface glycoprotein and a major initiator of blood coagulation. At sites of injury, blood comes in contact with the membrane-bound TF, which forms a complex with the serine protease FVIIa present in blood. The resulting complex activates factors IX and X, which leads to thrombin activation and ultimately to blood clotting. Truncated tissue factor (tTF) consisting of only the extra cellular soluble domain (residues 1219), exhibits an ability to activate the clotting cascade in solution that is five orders of magnitude lower than full length tissue factor incorporated in a phospholipid membrane. When tTF is relocated to a phospholipid membrane, tTF regains full activity like native tissue factor. New approaches are targeting not the tumor cells but the endothelial cells on tumors. Vascular targeting requires the identification of target molecules that are present at sufficient density on the surface of vascular endothelium in solid tumors but absent from endothelial cells in normal tissues. Such molecules could be used to target cytotoxic agents to the vascular endothelium of the tumor rather than to the tumor cells themselves. Promising candidate molecules include bFGF (basic fibroblast growth factor), VEGF (vascular endothelial growth factor) and VEGF receptor 2

(VEGFR-2), endoglin, endosialin, a fibronectin isoform (ED-B domain), the integrins V3, V5, 11, 21, amino peptidase N, NG2 proteoglycan and the matrix metalloproteinases 2 and 9 (MMP 2 and 9) (Dvorak et al, 1991 and 1995; Burrows et al, 1995; Carmemolla et al, 1989; Arap et al, 1998; Bhagwat et al, 2001; Burg et al, 1999; Kessler et al 2002; Morrissey et al, 1993; Olson et al, 1997; Rettig et al, 1992; Sengeer et al, 1997; Pfeifer et al, 2000). A novel approach to cancer therapy based on targeting of the human coagulation-inducing protein tTF to tumor vasculature has recently been proposed ( Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al, 2002; Peisheng et al, 2003). The approach is based on the concept that thrombosis of tumor vessels may stop the supply of nutrients and oxygen to tumor cells, thereby causing their death. The targeted delivery of tTF would be of significant therapeutic relevance if it is directed against a naturally occurring marker of tumor angiogenesis, and if it mediates the selective thrombosis of tumor blood vessels sufficiently to inhibit the tumor growth or to generate tumor infarction. In this work we show that a protein consisting of the RGD peptide fused to tTF mediates the selective tumor growth inhibition of two different types of solid human tumors; the lung cancer (CCL185) and the malignant melanoma (M21) in murine tumor models.

10

Angiogenesis Angiogenesis is defined as a process of vascular neoformation out of existing ones, that occurs during development, menstruation and several pathological conditions such as rheumatoid arthritis, age-related macular degeneration, proliferative retinopathies, and psoriasis as well as tumor growth and metastasis. Compensatory angiogenesis is demonstrated in the formation of collateral blood vessels when there is oxygen or nutrient deprivation in normal tissues. Despite the fact that angiogenesis refers to the derivation of blood vessels of all types (micro and macro vessels), the term is usually restricted to the neoformation of capillary blood vessels. Angiogenesis requires the coordinated activation of genes that are responsible for proliferation, migration and differentiation of endothelial cells to form capillary-like structures. The activation of these genes is thought to occur through paracrine factors also, the genes activated by these factors encode autocrine/intracrine secondary regulators, proteolytic enzymes, and molecules that are direct downstream substrates of endothelial cytokine receptors (Bikfalvi, 1995).

The coagulation system and angiogenesis

Angiogenesis is the process of sprouting and configuring new blood vessels from pre-existing blood vessels, whereas the haemostatic system maintains the liquid flow of blood by regulating platelet adherence and fibrin deposition. Both systems normally appear quiescent. With vessel injury, a rapid sequence of reactions must occur to occlude the vessel wall defect and prevent hemorrhage. Activated platelets link the margins of the defect

10

11

and form a provisional barrier that is quickly enmeshed with polymerized fibrin. This clot structure initially requires immobilized vascular endothelial cells to anchor the clot and prevent further bleeding. Thereafter, endothelial cells at the clot margins become mobile, dismantling and invading the cross-linked fibrin structure to rebuild a new vessel wall. Although the positive and negative regulators that control the delicate balance of platelet reactivity and fibrin deposition have been elucidated over the past four decades, analogous proteins that control endothelial cell growth and inhibition have only been discovered within the past decade. Hemostasis and angiogenesis are becoming increasingly inter-related pathways generated by the haemostatic system, coordinating the spatial localization and temporal sequence of clot / endothelial cell stabilization followed by endothelial cell growth and repair of a damaged blood vessel. To date, a limited number of these proteins have been identified (Browder et al, 2000).

Role of angiogenesis in cancer

Angiogenesis performs a critical role in the development of cancer, solid tumors smaller than 1 to 2 cubic millimeters are nor vascularized to spread, they need to be supplied by blood vessels that bring oxygen and nutrients and remove metabolic wastes. New blood vessel development is an important process in tumor progression. It favors the transition from hyperplasia to neoplasia i.e. the passage from a state of cellular multiplication to a state of uncontrolled proliferation characteristic of tumor cells.

11

12

100 years ago researchers observed that angiogenesis occurs around tumors (Kerbel et al, 2000; Algire et al, 1945). In 1971 it was proposed that tumor growth beyond 1 to 2 mm in size and metastasis are angiogenesis dependent and hence blocking angiogenesis could be a strategy to arrest tumor growth (Folkman, 1971and 1990), thus tumor cells that undergo the phenotypic switch are able to induce changes in endothelial cells, leading to angiogenesis and to a growing tumor (Polverini, 1996). Tumor cells and infiltrating cells such as macrophages and fibroblasts activate the endothelial cells, thus initiating angiogenesis by expressing factors such as VEGF and bFGF. Once neovascularization occurs, the tumor experience rapid growth and an increased metastatic potential (Poon et al, 2001; Mattern et al, 1996; Toi et al, 1994). Angiogenesis involves a series of steps, including endothelial cell proliferation, differentiation, migration, and organization to form tubules (Dvorak et al, 1995), because of this stepwise process anti-angiogenic therapy can be developed against any of several steps in the process and can be used to stop or to inhibit pathologies that involves such processes (Lee, 2002). Recent data strongly suggest an important role of angiogenesis in hematological malignancies. Thus anti-angiogenic therapy could constitute a novel strategy not only for the treatment of solid tumors or inflammatory disorders but also malignancies like acute myeloid leukemia (Padr et al, 2000; Mesters et al, 2001).

12

13

Regulators of tumor angiogenesis At the site of vessel injury, adhered platelets secrete both positive and negative regulators of angiogenesis, mainly from internal granules. The positive regulators include: vascular endothelial growth factor-A (VEGF-A), vascular endothelial growth factor-C (VEGF-C), basic fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), angiopoietin-1, insulin-like growth factor-1 and 2 (IGF-1-2), epidermal growth factor (EGF), platelet-derived growth factor (PDGF) and sphingosine 1 phosphate (Mohle et al, 1997; Wartiovaara et al, 1998; Brunner et al, 1993; Nakamura et al, 1986; Karey et al, 1989; Ben-Ezra et al, 1990; Hwang et al, 1992; Bar et al, 1989; Lee et al, 1999). Numerous investigators have evaluated the presence of angiogenic peptide, in particular bFGF and VEGF in clinical body fluids in an effort to explore the usefulness of these measurements as potential clinical parameters. Most of these studies are exploratory and suggest a correlation between detectable levels of these peptides and clinical outcome. There was a relatively good correlation between serum but not urinary bFGF levels and tumor stage or grade in a small number of patients with renal cell carcinoma (Rippmann et al, 2000). More recently, a significant over expression of VEGF and its cellular receptor KDR (VEGFR-2) and bFGF in the bone marrow of patients with acute myeloid leukemia was found (Padr et al, 2002; Bieker et al, 2003). An increased presence of matrix metalloproteinases (MMPs) may be related to increased invasive, metastasis, and angiogenic potential of tumors.

13

14

The hepatocyte growth factor (HGF) secretes also negative regulators that suppress the inducement of angiogenesis. The anti-angiogenic HGF fragments consisting of either the NK1 or NK2 cringle domains suppresses HGF induced endothelial cell migration. This anti-angiogenic fragments inhibit tumor growth in vivo by increasing tumor cell apoptosis without affecting the proliferation rate of tumor cells (Date et al, 1998). Thrombospondin (TSP-1) re-adjusts growth factor and integrin signaling pathways between endothelial cells and the fibrin clot and prevent endothelial cell motility induced by fibrin, also blocks the chemotactic response of endothelial cells to bFGF (Good et al, 1990). Plasminogen activator inhibitor type 1 (PAI-1), alpha 2 antiplasmin and alpha 2-macroglobulin suppress angiogenesis by limiting plasmin generation within the clot structure (Blei et al, 1993).

Metastasis

New blood vessel development is an important process in tumor progression. Neovascularization also influences the dissemination of cancer cells throughout the entire body eventually leading to metastasis formation. It has been suggested in the past that the growth of primary solid tumors is strictly dependent on their ability to induce angiogenesis from the surrounding vasculature, so that tumor progression including invasion and metastasis, involves the different phases pre-vascular and vascular (Gimbrone et al, 1972). It has been also observed that removal of primary tumor can be followed by a rapid onset of metastasis. This would suggest that a primary tumor can

14

15

inhibit its metastasis growth, then the switch to an angiogenic phenotype depends upon the net balance of angiogenic stimulators and inhibitors. The development of metastasis is then greatly influenced by angiogenesis (Bikfalvi, 1995). Also since primary tumor growth is often controlled with surgery and/or irradiation, anti-angiogenic agents may be most beneficial in the treatment of widespread metastasis disease. However, several principles must be understood; anti-angiogenic therapy may need to be delivered on a chronic basis since this type of therapy is not cytotoxic but rather only prevents further growth of a tumor. Secondly, the endpoint of anti-angiogenic therapy would not be tumor shrinkage, but rather tumor stabilization (Ellis et al, 1996), recognizing that angiogenesis is one step in the multistep process of metastasis (Fidler et al, 1994). Some researchers selectively targeted tumor blood vessels in vivo, using artificial or naturally occurring markers of angiogenesis with results of therapeutic relevance (Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al, 2002; Peisheng et al, 2003). Also it has been assumed that anti-angiogenic therapy of any type might have to be delivered for the rest of a patients life, or at least for many years (Boehm et al, 1997).

Mediators of tumor angiogenesis

A large number of angiogenic factors produced by tumor cells themselves and by accessory host cells such as macrophages, mast cells and lymphocytes have been identified.

15

16

Recent attention has been focused on members of the fibroblast growth factors (FGF) and vascular endothelial growth factors (VEGF) families as the most common tumor angiogenic factors (Fernig, 1994; Dvorak et al, 1995; Claffey et al, 1996), (See table 1). These cytokines stimulate migration and proliferation of endothelial cells (ECs). The biological effect of VEGF is mediated by the binding to two different receptors, VEGFR-1 (flt-1) and VEGFR-2 (flk-1/KDR), that are mainly expressed on ECs (Terman et al, 1996). Recently, neuropilin 1 has been identified as a third VEGF receptor that exclusively binds to the VEGF165 splice variant and modulates binding of VEGF to VEGFR-1 and VEGFR-2 (Soker et al, 1990). VEGF and its receptors are over expressed in the vast majority of human tumors. The importance of VEGF is underscored by the fact that blocking of VEGF function results in suppression of angiogenesis and growth of a variety of tumors in vivo (Kim et al, 1993; Millauer et al, 1994; Warren et al, 1995; Cheng et al, 1996; Millauer et al, 1996; Skobe et al, 1997). Integrins have been identified as additional key molecules of tumor angiogenesis. These integrins play a pivotal role in mediating cell to cell and cell to matrix interactions, essential components for tumor angiogenesis and metastasis (Brooks et al, 1994a and 1994b; Yun et al, 1996; Senger et al, 1997; Ruegg et al, 1998). Certain integrins (e.g. V3, V5 and others) are specifically and selectively expressed on the tumor vasculature in high density, but outside

16

17

of the female reproductive tract these integrins are not expressed under physiological conditions on ECs.

The process of anti-angiogenesis

Based on observations that expansion of a tumor mass was limited in the absence of angiogenesis, considerable experimental supporting evidence for this concept has been assembled from inhibition of angiogenesis by: Mechanical separation of tumor cells from their nearest vascular bed (Gimbrone et al, 1972) Blockade of tumor-derived angiogenic factors (Kim et al, 1993) Administration of angiogenesis inhibitors (Boehm et al, 1997) Endogenous production of angiogenesis inhibitors from tumor cells (Bouck, 1990; Cao et al, 1998). Demonstration of the pre angiogenic phenotype in spontaneous tumors (Hanahan et al, 1996).

Anti-angiogenic treatment strategies

The principal target for anti-angiogenic therapy is represented by proliferating ECs, which with the exception of the female reproductive tract are in a quiescent state in normal tissues.

17

18

Only one of 10.000 ECs (0,01%) is in cell division at a certain point (Engerman et al, 1967; Hobson et al, 1984). As a response to a certain stimulus ECs leave the quiescent state and proliferate as fast as haematopoietic cells from the bone marrow or epithelial cells from the mucosa of the gastrointestinal tract. Based on the current knowledge of angiogenesis, which is a complex process of EC proliferation, selective degradation of the basement membrane, extracellular matrix and subsequent EC migration (Folkman et al, 1992).The following anti-angiogenic strategies are currently under investigation: Interfering with receptor binding or activation of a particular angiogenic factor. Inhibiting the release of a particular angiogenic factor by tumor cells. Enhancing the production or action of an angiogenic inhibitor. Being similar or identical to a particular angiogenic inhibitor. Interfering with signal transduction processes in an autocrine / intracrine activation of capillary endothelial cells. Inhibiting the matrix degradation by protease matrix degrading enzymes (Bikfalvi, 1995; Sato et al, 1990).

18

19

Angiogenesis inhibitors

Numerous angiogenic inhibitors have been identified (Hagedorn et al, 2000) and many are now in clinical trials. Whereas some agents, such as antibodies to VEGF and VEGFR2, continue to show promise, a few drugs have proved disappointing (Coussens et al, 2002). Nevertheless, there is still intense interest in angiogenesis inhibitors as future clinical tools and much work is in progress (Novak, 2002). There are two classes of angiogenesis inhibitors direct and indirect: Direct angiogenesis inhibitors, such as vitaxin, angiostatin and others, prevent vascular endothelial cells from proliferating, migrating or avoiding cell death in response to a spectrum of proangiogenic proteins, including VEGF, bFGF, IL-8 and plateletderived growth factor (PDGF). Indirect angiogenesis inhibitors generally prevent the expression of or block the activity of a tumor protein that activates angiogenesis also blocking the expression of its receptor on endothelial cells. Direct angiogenesis inhibitors are the least likely to induce acquired drug resistance, because they targeted genetically stable endothelial cells rather than unstable mutating tumor cells. (See table 1).

19

20

Pro-angiogenic factors Angiogenin Angiopoetin-1 Del-1 Fibroblast growth factor, acidic (bFGF) Antiangiogenic antithrombin III Fibroblast growth factor, basic (bFGF) Follistatin Granulocyte colony-stimulating factor (GCSF) Hepatocyte growth factor (HGF) Interleukin-8 (IL-8) Leptin Midkine Placental growth factor (PiGF) Platelet-derived endothelial cell growth factor (PD-ECGF) Platelet-derived growth factor-BB(PDGFBB) Pleiotrophin (PTN) Proliferin Transforming growth factor-alpha (TGFalpha)

Anti-angiogenic factors Angiostatin (plasminogen fragment) Endostatin (collagen XVIII fragment) Cartilage-derived inhibitor (CD1) CD59 complement fragment Fibronectin fragment Gro-beta Heparinases Transforming growth factor beta (TGF- ) Heparin hexasaccharide fragment Human chorionic gonadotropin (hCG) Interferon inducible protein (IP-10) Interferon alpha, beta, gamma Interleukin 12 (IL-12) Cringle 5 (plasminogen fragment) Tissue inhibitors of metalloproteinases (TIMPs) 2-Methoxyestradiol Placental ribonuclease inhibitor Plasminogen activator inhibitor Platelet factor 4 (PF4)

Transforming growth factor beta (TGF-beta) Prolactin 16kD fragment Tumor necrosis factor-alpha (TNF-a) Vascular endothelial growth factor (VEGF) Retinoids Tetrahydrocortisol-S Thrombospondin-1 (TSP-1) Vasculostatin Vasostatin (calreticulin fragment) Table 1 Pro-angiogenic and Anti-angiogenic factors.

20

21

In this way two approaches have been adopted: first, the use of antibodies to either VEGF or VEGF receptors, and second, the development of specific inhibitors of the VEGF receptor tyrosine kinase. Ferrara and colleagues were the first to show that antibodies to VEGF slowed tumor growth (Kim et al, 1993), and humanized forms are now in Phase III clinical trials for the treatment of solid tumors. Because of the difficulties and expense of using biological agents in the clinic, others set out to identify low-molecular-weight inhibitors of the tyrosine kinase activity of KDR (VEGFR2 in humans), also with promising results in hematological malignancies. In this way several compounds have been identified and are undergoing clinical evaluation (Bikfalvi et al, 2002; Mesters et al, 2000). Inhibitors of the KDR VEGF receptor tyrosine kinase Developer Compound Clinical stage Pharmacia (Sugen) Pharmacia (Sugen) Pharmacia (Sugen) AstraZeneca Novartis SU101 SU5416 SU6668 ZD4190 PTK787ZK222584 No longer in development No longer in development Phase II Phase II Phase II

21

22

Gene treatment approaches in anti-angiogenesis

Based on inhibition of angiogenesis by gene therapy Lin et al, used an adenoviral vector to deliver a recombinant Tie2 receptor (tirosine kinase receptor) that blocked activation of the Tie2 receptor on endothelial cells. Most important, delivery of the soluble Tie2 receptor-adenoviral construct at the time of surgical excision of primary tumors also inhibited subsequent metastasis growth, demonstrating that gene therapy directed against the Tie2 receptor on endothelial cells will inhibit tumor angiogenesis (Lin et al, 1998). Goldman et al, reported the use of an ex vivo gene transfer method to transfect stable human tumor cells with the cDNA encoding a truncated form of native soluble FLT-1, a receptor for the angiogenic factor VEGF. Soluble FLT-1 inhibited VEGF function (Goldman et al, 1998). Moreover, researchers have to consider the local vs. systemic antiangiogenic gene therapy, and direct vs. indirect anti-angiogenic gene therapy (Folkman, 1998). Also, combinations of angiogenesis inhibitors and conventional cytotoxic chemotherapy cured tumors in mice when either therapy alone could not accomplish this (Teicher et al, 1994).

22

23

In the future, systemic anti-angiogenic therapy may be used: After surgery or after radiotherapy to prevent recurrence of distant metastases. In combination with conventional chemotherapy In combination with vaccine therapy or immunetherapy In combination with others types of gene therapy, for example delivery of tumor suppressor genes.

Vascular targets

Two types of vascular target agents (VTAs) are currently being developed for cancer treatment: a) The ligand-directed VTAs, which use antibodies and peptides to target toxins, pro-coagulants, and pro-apoptotic effectors to tumor endothelium. b) The small molecules that do not specifically localize to tumor endothelium, but which exploit pathophysiological differences between tumor and normal tissue endothelia to induce selective occlusion of tumor vessels (Ching et al, 1999), (See table 2).

23

24

Vascular targeting of malignant tumors has been shown to be a new potential approach for the treatment of cancer (Huang et al, 1997), and some of the advantages over conventional anti-tumor cell therapies are: 1. target antigen is directly accessible, and penetration of drugs through the tumor tissue, which has been defined as a major problem in the treatment of solid tumors is not necessary.(Baxter et al, 1989; Fujimori et al, 1989; Jain, 1990). 2. There is a potentiation effect because the killing of one endothelial cell results in the death of thousands of tumor cells (Denekamp, 1990), and the coagulation process is a cascade in which one molecule of initiating coagulation factors results in the generation of millions of molecules fibrin per minute. 3. The target cells are unlikely to acquire genetic mutations and to develop a drug resistance (Boehm et al, 1997). The same targeted drug can be used for a variety of solid tumors because the target antigen should be present in many different tumors, also a surrogate marker of biological activity (i.e., blood flow) is measurable in the clinic and temporary effects on vascular function may be sufficient. Studies indicate that > 99 % of tumor cells in vivo can be killed during a 2hrs period of ischemia (Chaplin et al, 1994).

24

25

Finally, unlike angiogenesis inhibitors, VTAs should require only intermittent administration to synergize with conventional treatments rather than chronic administration over months or years.
VTA approach Ligand-directed Compound Antibody-TF Anti-VCAM1-TF L19 scFv-TF VEGF-gelonin Anti-endoglin linked to ricin A Anti-TES-23 linked to Neocarzinostatin L19 scFv-IL-12 L19 scFv-TNF-a Anti-PS Targeted ATP-Raf gene DNA encoding Flk-1 fused to Fas Small molecules CA4P ZD6126 AVE8062A Oxi4503 DMXAA Phosphate prodrug of CA4P Phosphate prodrug of Nacetylcolchinol Combrestastatin analogue Combrestastatin analogue Flavonoid Table 2. Philip Thorpe et al, The first International Conference on Vascular Targeting: Meeting Overview. Antibody-cytokine Antibody-cytokine Naked antibody Gene therapy, blocks signaling Gene therapy, induces apoptosis Comments TF induces coagulation VCAM-1 is a cell adhesion marker L19 scFv targets fibronectin ED-B domain Gelonin is a plant toxin Antibody-toxin Antibody-cytotoxic

25

26

THE V3 and V5 integrins as natural endothelial markers

In the past decade, many molecules have been described to be up-regulated on angiogenic endothelial cells, which can in theory be therapeutically exploited (Schraa et al, 2002). Some of these molecules are the integrins V3 and V5, which recognizes RGD (Arg-Gly-Asp) motifs in extracellular matrix components (Brooks et al, 1994a), and are essentially absent from the normal tissues of an adult animal and are also selectively up-regulated in angiogenesis related diseases. Several members of the integrin family of adhesion receptors are expressed on the surface of cultured smooth muscle and endothelial cells. Among these integrins is V3, the endothelial cell receptor for vitronectin, von Willebrand factor, fibrinogen and fibronectin (Cheresh, 1987). Cheresh showed that in both human and chick, blood vessels involved in angiogenesis have enhanced expressions of V3, playing a key role in angiogenesis and suggesting that integrin V3 will be a therapeutic target for diseases characterized by neovascularization (Brooks et al, 1994a). The V3, V5, 51 and other integrins are each up-regulated in angiogenic vessels and play a role in angiogenesis (Eliceiri et al, 1999). In the fetus, 51 is necessary for the development of the vasculature (Yang et al, 1993), whereas fetal or adult angiogenesis can occur without the V integrins.

26

27

However, V3 and V5 are somehow important in adult angiogenesis because peptides and antibodies that perturb their function block angiogenesis (Ruoslahti, 2002).

Recombinant fusion proteins

General advantages of recombinant fusion proteins are: 1 Easy production of defined homogeneous proteins 2 Protein engineering can be performed on the DNA level 3 The constructs can be produced as entirely human proteins, which addresses the previously described problem of immunegenicity (Kuus-Reichel et al, 1994). 4 Easy experimentation on mice. The anti-tumor efficacy of tTF targeted to tumor vessels has already been proved; Huang et al, 1997, targeted the TF molecule to a class II antigen in a mouse neuroblastoma model through a bispecific antibody, transfecting first the mice with the IFN-y gene, to generate the expression of MHC class II antigens on the tumor vascular endothelium in mice. To target tTF to tumor vascular endothelium, a mixture of tTF and the bispecific F(ab)2 antibody was injected in tumor allografted mice. The binding of tTF to MHC class II antigen on endothelial cells induced selective coagulation activation with tumor infarction. The treatment induced thrombosis of tumor vessels with 38% of complete regression. (Huang et al, 1997).

27

28

One year later Sophia Ran et al, from the same group used a coaguligand consisting of a monoclonal antibody to murine VCAM-1 (vascular cell adhesion molecule-1) covalently linked to tTF. By antibody directed targeting of tTF to the tumor vasculature selective infarction of solid Hodgkin's tumors in mice was mediated. The treatment induced thrombosis of tumor vessels and retarded tumor growth, complete tumor regression was not observed. A 50% reduction in tumor growth occurred, although VCAM-1 was present only in a minority of vessels (larger vessels within the tumor mass) (Ran et al, 1998). Dario Neri et al, used a similar approach by fusing an antibody fragment (scFv) specific for the oncofetal ED-B domain of fibronectin to tTF. The fusion protein mediated the complete and selective infarction of three different types of solid tumors in mice. In this approach 30% of mice exhibited a complete tumor regression in a single dose treatment, but showing also signs of toxicity and the animals were not cured (Nilsson et al, 2001). Liu C et al, coupled tTF to an inhibitor of prostate-specific membrane antigen. This protein induced selective local in vivo infarctive necrosis of the rat Mat Lu prostate tumor when administered intravenously (i.v.). The combined administration of this fusion protein with low-dose doxorubicin produced a profound tumoricidal effect, resulting in complete eradication of some tumors (Liu et al, 2002). Another group induced extravascular coagulation targeting a highly selective tumor stroma associated marker, they constructed a fusion protein comprising of a single-chain molecule of a fibroblast activation protein

28

29

(FAP)-specific humanized antibody [single chain fragment variable(scFv)OS4] and the extra cellular domain of human tissue factor. The fused protein scFv-tTF targeted to FAP induced an extravascular coagulation of the tumor stroma in an antigen-specific manner (Rippmann et al, 2000). Recently P. Hu et al 2003, generated three MAb fusion proteins that selectively block the blood flow to tumors by targeting different antigens; the first one the RGD/tTF, targets endothelial V3 and V5 integrins exposed on tumor vessels, the second fusion protein, chTV-1/tTF, targets a vessel antigen, fibronectin, which is located in the basement membrane of vessels and the third fusion protein, chTNT-3/tTF, targets necrotic regions of the tumor in which conserved and abundant intracellular antigens are exposed in degenerating cells.

29

30

OBJECTIVES

The present study focuses on the fact that the human coagulation inducing protein tissue factor, is the major initiator of blood coagulation. The aim of this work was to investigate the feasibility of treating human solid tumors by selective delivery of human truncated tissue factor fused to RGD peptide sequences to the tumor vascular endothelium in a mouse model, as a new approach for cancer therapy.

The objectives are:

To demonstrate that the tTF-RGD fusion proteins selectively induce coagulation in the tumor vasculature in an animal model. To demonstrate the anti-tumor activity of tTF-RGD fusion proteins in a mouse xenotransplantation model. To demonstrate that the selective thrombosis of treated solid tumors in our approach should lead to regression and inhibition of tumor growth. To demonstrate the safety of this anti-vascular treatment strategy.

30

31

Material and methods

Cell lines and antibodies: Lung cancer cell line (CCL185) were described earlier (Topp et al, 1993) and the melanoma tumor cell line (M21) as described was kindly provided by Dr. Silletti, University of California San Diego (USA)(FeldingHabermann et al, 1992). Anti-tTF was obtained by Diagnostic international (Karlsdorf, Germany), Integrin V3 and GRGDSP-peptide was obtained by Chemicon (Temecula, California, USA). Anti-Histag antibody (Santa Cruz Biotechnology). Construction of the E. coli expression vector for soluble TF (truncated TF [tTF1-219]) The c-DNA coding for tTF1-219 and tTF1-219-GRGDSP (short tTF-RGD) was amplified by polymerase chain reaction (PCR) using the primers : 5CATGCCATGGGATCAGGCACTACAAATACTGTGGCAGCATATA AT.3(5Primer)5CGGGATCCTATTATCTGAATTCCCCTTTCTCCTG GCCCAT3(3`Primer) for tTF and 5CATGCCATGGGATCAGGCACTA CAAATACTGTGGCAGCATATAAT3(5Primer)5CGGGATCCTATT ATGCATGTGCTCTTCCGTTACCTCTGAATTCCCC-3(3-Primer) for tTF-RGD (primers from Oligofactory PE Applied Biosystems Germany). The RGD sequence was ligated to the carboxyl terminus of the tTF. This would allow the tTF-RGD to adopt an orientation perpendicular to the

31

32

phospholipid membrane of the cell similar to native tissue factor (Banner et al, 1996). On the other hand, ligation of the peptide to the carboxyl terminus of tTF should not result in a sterical hindrance for the interaction of tTF and its substrate FX.

Expression, refolding and purification of tTF1-219 and tTF1-219 RGD peptide.

With the DNA-Ligation Kit (Novagen, Madison, Wisconsin, USA), the cDNA were cloned into the expression vector pET-30(+)a (Novagen), using the Bam H 1 and NCO I restriction sites of the vector. The vectors were introduced into competent Escherichia coli cells (BL21 DE3) according to the manufacturers protocol (Novagen). After stimulating with IPTG (Novagen) the cells were harvested and 5-7 ml lysis buffer (10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 1 mM MgCl2; 10 g/ml Aprotinin; 2 mg/ml Lysozym) per gram wet weight and 20 l Benzonase (Novagen) were added to the pellet. Then the cells were incubated for 90 minutes at RT and centrifuged at 12,000 g for 20 min at 4C. The pellet was resuspended and homogenized by sonicating in washing buffer (10 mM Tris/Hcl, pH 7,5; 1 mM EDTA; 3% Triton X-100). To solubilize the inclusion bodies, 2-4 ml Guanidinium buffer (6 M GuCl; 0,5 M NaCl; 20 mM NaH2PO4; 1 mM DTT) per gram wet weight was added. After incubation over night at RT, the suspension was centrifuged at

32

33

5,000g for 30 min at 4C. The supernatant was filtered through a 0,22 m filter. Purification and refolding was done with the His Bind Buffer Kit (Novagen) according to the manufacturers protocol. To remove the salt, the suspension was dialyzed in a Slide-A-LyzerR 10 K dialysis cassette (Pierce, Rockford, Illinois, USA) against TBS buffer.

Characterization of tTF1-219 and tTF1-219 RGD peptide For chemical characterization, sequences of the coding cDNA in the expression plasmids are confirmed in an automatic sequencer equipped with laser and CCD-camera (ABI PRISM 310, Perkin Elmer). N-terminal amino acid sequences of proteins are confirmed by Edman degradation and amino acid analyses is performed additionally ( Applied Biosystems Sequencer Model 477A and AS-Analyzer 120A). Subsequently, SDS/PAGE and Western Blot analyses are carried out with antibodies against tTF

SDS-PAGE and Western blot analysis The purified tTF-RGD fusion proteins were analysed by SDS-PAGE as described above.The presence of the tTF moiety for each fusion protein was further confirmed by western blotting analyses. The protein samples were diluted trying to obtain a similar concentration between them. Using a precision protein standard (Bio-rad) the electrophoresis was runned at 120 volts and later stained with Gel code

33

34

blue stain reagent (PIERCE). The tTF-RGD fusion proteins in the SDSPAGE gel (ready gel Bio-rad, 4C) were transferred to a PVDF membrane overnight at 30 volts and 90 mA. To identify those bands containing the tTF and tTF-RGD fusion proteins, the protein immunoblotting (Opti-4CN amplified, Bio-Rad) was done incubating the fusion proteins with a primary antibody (anti-Histag Santa Cruz biotechnology) biotin conjugated and a HRP antibody (streptavidin HRP).
Figure 1. Schematic representation of the binding of the fusion protein tTF-RGD, to av3-integrin. This receptor is selectively expressed in high density on tumor endothelial cells, but with few exceptions not in quiescent endothelial cells in normal tissues. Tumor endothelial cells

Binding of tTF1-219 and tTF1-219 RGD peptide to FVIIa The apparent dissociation constant (Kd) for the interaction of the tTF constructs with FVIIa are calculated employing a published method based on the amidolytic activity of the tTF:VIIa complex towards the chromogenic substrate Spectrozyme Factor Xa (American Diagnostica) (Ruf et al, 1991a and b). Into each well of a microtiter plate the following reagents are added: a) 26 l 0.05 M Tris/HCl, 0.15 M NaCl, pH 7.4, 0,1 % bovine serum albumin

34

35

(TBS-BSA). b) 26 l tTF 1-219 and the tTF 1-219-RGD peptide, respectively, diluted in TBS-BSA in concentrations ranging from 300 pM to 25 M and c) 26 l 8 nM recombinant FVIIa (Novo-Nordisk) in TBS-BSA. After 15 min at RT, 26 l of Spektrozyme Factor Xa are added and the initial reaction is monitored by change in absorption at 405 nm on a microplate reader (Bio-Rad, Hercules, California, USA). Rates are converted into concentrations of tTF:VIIa. On the basis of calculated free and bound ligand, the apparent Kd is determined by fitting these data to the single-site-binding equation: (number of bindings sites x [free ligand]) ________________________________________ ([free ligand] + Kd) Factor X activation by tTF and tTF-RGD The ability of tTF and tTF-RGD to enhance the specific proteolytic activation of Factor X by Factor VIIa was assessed as described by Ruf et al (104). Briefly, to each well in a microtiter plate was added 20 l of: (a) 50 nM recombinant FVIIa (Novo-Nordisc) in TBS-BSA; (b) 0,16 nM 1,6 M tTF/tTF-RGD in TBS-BSA; (c) 25 nM CaCl2 and 500 M phospholipids (phosphatidylcholine/ phosphatidylserine, 70/30, MM; Sigma). After 10 min at room temperature, 20 l of the substrate Factor X (Enzyme Research Laboratories) was added in a concentration of 5 M. Aliquots were removed from the reaction mixture every minute and stopped in 100 nM EDTA. Spectrozyme FXa was added and rates of Factor Xa were monitored by the development of color at 405 nm.

[Bound ligand] =

35

36

The activity of tTF-RGD bound to microvascular endothelial cells (MVEC) was determined in vitro by using a chromogenic assay to detect FXa as described by Ran et al, 1998. Briefly, MVEC were grown in a 96 well plate to confluence. The cells were washed two times with PBS-buffer containing 2mg/ml BSA. The cells were incubated with different concentrations of tTF-RGD (0,025-0,4 nM) for 20 min at 37C. To each well in the microtiter plate was added: (a) 50 l of Tris/HCl, 0,15 M NaCl, pH 7,4, 0,1% BSA (TBS-BSA); (b) 25 l of 10 nM recombinant FVIIa (Novo Nordisk, Bagsvrd, Denmark) in TBS-BSA; (c) 25 l of 5 mM CaCl2 in TBS-BSA. After an incubation time of 20 min at room temperature, 100 l of each well was transferred to a new 96-well plate. 50 l of 1,1 M EDTA and 25 l of Spectrozyme FXa (5nM) were added. The breakdown of substrate was measured by reading the absorbance in a microplate reader (Bio-Rad, Hercules, California, USA) at 405 nM. The cells were detached and counted. The results are expressed as the amount of FXa generated per 104 cells.

Binding of tTF-RGD fusion proteins to its targets The binding of tTF-RGD to purified immobilized v3 (Chemicon) was analyzed by ELISA (enzyme linked immunoadsorbent assay) techniques as described earlier (Silleti et al, 2001). Binding steps were performed in the

36

37

absence and presence of the synthetic peptide GRGDSP (Chemicon) as competitive ligand in order to show the specificity of this interaction. Subsequently, the specific binding of tTF-RGD to v3 on endothelial cells was evaluated. To this end, the differential binding of biotinilated tTF and tTF-RGD on endothelial cells in suspension was analyzed by FACS. Streptavidinphycoerythrin has been employed for detection of bound protein (See fig.4).

Tumor Xenotransplantation models All procedures on animals were performed in agreement with german regulations (Tierversuchsgesetz 8 Abs. 2) and specifically approved in form of a project license. Single cell suspension (2 x 106 in 100l) of CCL185 (human adenocarcinoma of the lung) or M21 (human melanoma) were injected subcutaneously (s.c.) into the right anterior flank of male BALB/c nude mice (9-12 weeks old). Tumor growth was allowed to a volume of approximately 50-100 mm3 (CCL185) and 500-700 mm3 (M21), respectively. At this point, mice were randomly assigned to different experimental groups. Group 1 received 0.9% NaCl (100 l), group 2 tTF (30g in 100l 0.9% NaCl) and group 3 tTF-RGD (30g in 100l 0.9% NaCl) via tail vein injection.

37

38

Depending on the growth kinetics injections were repeated twice weekly for five times (CCL185) or daily for five times (M21). Tumor size in vivo was evaluated using a standard caliper measuring tumor length and width in a blind fashion. Tumor volumes were calculated using the standardized formula (length x width x /6). According to our project license, animals had to be euthanazed when tumors became too large, if mice lost >20% of body weight, or at signs of pain. Representative photographs of animals and tumors were taken at the end of each experiment (data not shown). Next, mice were sacrificed by cervical dislocation in deep CO2 anesthesia in agreement with standard regulations and project license. Immediate debleeding was achieved by injection of NaCl 0,9 % and heparinized solutions directly into the left cardiac ventricle and opening femoral vessels. Tumors and organs (heart, lung, liver, kidney) were excised and fixed in 4% buffered formaldehyde solution before embedding in paraffin. For toxicity studies an extra set of animals was injected with a higher dose of tTF-RGD (50g) and analyzed for signs of thrombosis in heart, lung, kidney or liver 1h, 4h or 24 hrs after injection in a similar manner.

38

39

Histological studies Histological analyses, was performed as described earlier (31). Briefly, to assess the toxicity of treatment by histological analysis, organs (heart, lung, liver and kidney) were collected 1h, 4 hrs and 24 hrs after injection of 2.0 mg/kg/body weight of tTF-RGD, tTF and saline, fixed in 4 % buffered paraformaldehyde and embedded in paraffin. Four m sections were cut and transferred onto glass slides. At least, 10 sections per sample were available for evaluation. Hematoxylin-Eosin (H&E) stained sections from organs were analyzed using conventional light microscopy for signs of necrosis and thrombosis in a blinded fashion. Mice were sacrificed at different time points after injection of 2.0mg/kg/body weight. The tumors were excised, fixed in 4 % buffered paraformaldehyde and embedded in paraffin. Sections were cut and stained with H&E. Thrombosis of vessels was defined as complete or incomplete occlusion of intratumoral vessels by closely packed red blood cells.

39

40

STATISTICS

The data are presented as medians and interquartile ranges. The binding differences between tTF and tTF-RGD and the differences in tumor growth rates between treated tTF-RGD mice and control mice (tTF or NaCl) were tested for statistical significance using a nonparametric test (Mann-Whitney rank sum test) for independent samples that makes no assumptions about tumor size being normally distributed. P values of <0.05 were considered significant. In the tumor growth analyses the data are presented as means, standard deviation (SD) and standard error.

40

41

RESULTS Characterization of tTF and tTF-RGD After expression and purification, tTF and tTF-RGD were analyzed under denaturing conditions on SDS-PAGE and Western-blot (See fig. 1-2 and 3).

37 kd

25kd M 1=tTF, 2=tTF-RGD, 3=tTF-RGD 1 2 3

Figure.2. SDS-PAGE ( Electrophoresis ready gel-Bio rad) M=molecular weight marker,

Western-blotting, of tissue factor fusion proteins.

37 kd 25 kd
M 1 2 3 4 5 6

Fig. 3 Western-blot analyses of recombinant tTF and tTF fusion proteins. The purity and identity of tTF and tTF fusion proteins was verified using SDS-PAGE (Gel code blue ) and Western-blotting (monoclonal anti-tissue factor antibody clone VIC7 American Diagnostics, anti-Histag ab. Santa Cruz) following extraction from E. coli (BL21 DE3) and refolding with a linear urea-gradient (6M 1M). M=molecular weight marker, 1-4 = tTF, 5=tTF-RGD, 6=tTF-NGR.

41

42

Factor X activation by tTF and tTF-RGD

The ability of tTF and the tTF fusion proteins to enhance the specific proteolytic activation of factor X (FX) by Factor VIIa (FVIIa) is demonstrated by Michaelis-Menten analyses. The calculated Michealis constants (Km) for tTF and the tTF-RGD was within the range of 0.15 nM as reported in the literature (104a) (Figure 4). Thus, the ligation of the RGD peptide sequence at the carboxyl terminus of tTF does not affect its functional activity.

100 90 80

100 90 80

mOD / min

60 50 40 30 20 10 0
0,0016 0,016 0,16 1,6 16 160 1600

mOD / min

70

70 60 50 40 30 20 10 0
0,0016 0,016 0,16 1,6 16 160 1600

tTF (nM)

tTF-RGD (nM)

Km = 0,16

Km = 0,12

Figure 4. Determination of the Michaelis constant (Km): For the activation of FX by FVIIa / tTF and FVIIa / tTF fusion proteins the MichaelisMenten kinetics were calculated according to a published method (104).

42

43

Binding experiments of tTF fusion proteins (tTF-RGD) to purified v3 The specific binding of tTF-RGD to immobilized v3 is shown in a purified receptor binding assay (Figure 5.a-b). Binding of our construct to immobilized v3 was dose-dependent and saturable. The specificity of this RGD-dependent interaction is underlined by the competition of the synthetic peptide GRGDSP. In the presence of 10-100 fold molar excess of synthetic RGD peptide our construct showed merely no significant binding capability to v3.
Figure 5 a Binding of tTF, tTF-RGD to the integrin v3. The binding of 0.1M tTF, tTFRGD to immobilized v3 was detected with a polyclonal antibody against human TF by ELISA. The results are presented as median and interquartile range. The difference in binding between tTF-RGD
tTF tTF -RGD

1,4 1,2

Binding.to v3 (mOD)

10 08 06 04 02 00

and tTF was significant (p<0.005, MannWhitney-Test).

1 00

Figure 5b Specificity of the binding of tTF-RGD to integrin v3 . The binding of tTF-RGD (0.1M) to immobilized av3 was significantly inhibited by the synthetic peptide GRGDSP (p<0.005, MannWhitney test for both RGD peptide
tTF-RGD tTF-RGD + 1 M RGD tTF-RGD + 10 M RGD

Binding to v3 (% )

80

60

40

20

concentrations).

43

44

Binding of tTF-RGD on endothelial cells Subsequently, the specific binding of tTF-RGD to receptors on endothelial cells (MVEC) was evaluated by FACS. Differential binding of biotinilated tTF and tTF-RGD on endothelial cells in suspension is shown.(Figure 6A). Indeed, the measured fluorescence intensity was eight fold higher for tTFRGD compared to tTF. Furthermore, the binding of 0,1 M tTF-RGD to endothelial cells was reduced to 25% in the presence of 1 M synthetic peptide GRGDSP. These results underscore again the RGD-dependency of tTF-RGD binding to receptors on endothelial cells such as integrins v3 or v5 (See fig. 6B).
A Cell B

count Fluorescence intensity Fluorescence intensity Figure 6. Binding of tTF and tTF-RGD to human endothelial cells. A) FACS analyses of endothelial cells that were incubated with 0.1 M (2) or with 0.1 M tTFRGD (3)for 60 min. at 4C. B) By the addition of 1 M GRGDSP the binding of the tTF-RGD fusion protein to endothelial cells was reduced by 75% due to competitive inhibition (4). Line 1 in A and B shows the negative control.

44

45

Anti-tumor activity of tTF-RGD in human malignant melanoma tumors

The anti-tumor activity of the tTF-RGD fusion protein was determined in BALB/c nude mice bearing 500-700 mm3 M21 tumors (human malignant melanoma). The saline solution, tTF (20g) and tTF-RGD (20g) in 200 l saline solution respectively, were administered i.v. five times at intervals of 24 hours. The pooled results of two independent experiments are presented (Figure 7). The tumor growth was significantly retarded at the 4th day of the treatment (P=0,001) in comparison to tTF and saline treatment. The tumor weight was in the tTF-RGD treated group significant lower in comparison to the control groups (P=0,001). During treatment tumors showed macroscopic signs of necrosis within 24 hours of treatment start similar to the results published by other groups (Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al, 2002; Peisheng et al, 2003). Besides, histological studies revealed substantial amount of tumor vessels which were thrombosed and confirmed the macroscopic impression of gross tumor necrosis. Thus, the presumable mode of action of the tTF-RGD fusion protein, i.e. the thrombotic occlusion of tumor vessels is underlined by these observations. The high selectivity of the tTF-RGD for tumor blood vessels is demonstrated by the fact that no visible thrombosis or necrosis occurred in normal tissues such as heart, kidney, liver, and lung (see fig 8). Even

45

46

repeated high doses of tTF-RGD (4 mg/kg body weight) did not cause any thrombosis or visible organ damage.

1200

Saline tTF tTF-RGD

900

TUMOR VOLUME [mm ]

600

300

0 1 2 3 4 5 6 7

TIME [days]

Figure 7. Anti-tumor activity of tTF-RGD on growth of M21 tumors in mice The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c nude mice bearing M21 tumors. The tTF, saline solution and tTF-RGD respectively, were administered i.v. five times at intervals of 24 hours. The tumor growth was significantly retarded at the 4th day of the treatment (P=0,001) in comparison to tTF and saline treatment. The tumor weight in the tTF-RGD treated group was significantly lower in comparison to the control group (P=0,001).

Anti-tumor activity of tTF-RGD in human lung cancer tumors in mice Furthermore, we determined the anti-tumor activity of the tTF-RGD protein in BALB/c/nude mice bearing 50-100 mm3 CCL185 (human lung cancer) tumors. Because of the slower tumor growth in the experiment, the

46

47

tTF-RGD (20g) and the controls tTF(20g) and saline solution were administered five times at intervals of 3-4 days. The pooled results of two independent experiments are represented (Fig.8). After the 5th injection of tTF-RGD, we could show a significant growth inhibition of the CCL185 tumors in comparison to the control groups (P=0,001).
Saline tTF tTF- RGD 500

600

TUMOR VOLUME [mm ]

400

300

200

100

10

TIME [days]

13

16

19

22

25

Figure 8. Anti-tumor activity of tTF-RGD on growth of CCL-185 tumors in mice The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c nude mice bearing CCL185 tumors. Because of the slower tumor growth in the experiment, the tTF-RGD, the tTF and the saline solution, respectively, were administered at intervals of 3-4 days. After the 5th injection of the tTF-RGD, we could show a significant growth inhibition of the CCL185 tumors in comparison to the control groups (P=0,001).

47

48

Histological analyses from mice organs treated with tTF-RGD All animals were macroscopically and histologically analyzed after treatment. The organs (heart, kidney, liver and lung) from the tTF-RGD treated mice didnt show any sign of thrombosis or necrosis (See figure 9).

Figure 9. Representative H&E sections of heart (A), kidney (B), liver (C) and lung (D), 1 hour after injection of 4 mg/kg/body weight of tTF-RGD in the mice. No visible thrombosis or necrosis was observed in these organs (magnification x 200).

The high selectivity of tTF-RGD for tumor blood vessels is demonstrated by the fact that no visible thrombosis or necrosis occurred in normal tissues such as heart, kidney, liver and lung (Fig. 10).

48

49

Histological analyses of the effect of tTF-RGD on tumor tissue The microscopic studies revealed that tumor vessels of the malignant melanoma and lung cancer were thrombosed (Fig. 10 A-B). Thus, the presumable mode of action of tTF-RGD, i.e. the thrombotic occlusion of tumor vessels is confirmed by these observations.

Figure 10. Representative Hematoxylin/eosin (H&E) sections of the malignant melanoma (M-21) tumor bearing mouse, 1 hour after injection of tTF-RGD (A and B) or saline control (C and D) in the tail vein of the mice. Blood vessels in tumors treated with tTF-RGD fusion proteins appear thrombosed (arrows). In the area surrounding an occluded blood vessel extensive tumor cell necrosis is observed (A-B). Photographs are from representative areas of the tumor (A and C: magnification x 200; B and D magnification x 400).

49

50

Macroscopic experiment showing the effect of the tTF-RGD on tumor treated mice In order to prove the mode of action that thrombotic occlusion of tumor vessels does really occur, the following experiment was performed: The human melanoma cell line M-21 was injected into the flank of two male balb/c/nude mice. After having reached a tumor volume of approximately 500 mm3, 2.0 mg/kg/body weight of tTF-RGD or 0,9 % NaCl was injected in the tail vein of the mice. See the photograph of the tumor bearing mouse 20 minutes after injection of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side) respectively (Figure 11 A). The tumor was bruised and blackened indicating apparent massive tumor ischemia after injection of tTF-RGD. The mice were sacrificed 60 min. after injection and the tumor was completely removed for histological studies (data not shown). We could see areas of hemorrhage and ischemia in the tumor of the mouse treated with tTF-RGD in contrast to the apparent vital appearance of the tumor treated with saline solution after injection. (Figure 11 B-C).

50

51

Figure 11. A, Representative photographs of the malignant melanoma (M-21) tumors bearing mice 20 minutes after injection of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side), respectively. The tumor was bruised and blackened indicating massive tumor ischemia after injection of tTF-RGD. B, shows areas of hemorrhage in the tumor of the mouse treated with tTF-RGD in contrast to the vital appearance of the tumor treated with 0.9 % NaCl solution C.

51

52

DISCUSSION The initial reports on the selective induction of intratumoral thrombosis using tTF fused to antibodies or antibody fragments directed to artificial or natural markers of angiogenesis showed impressive efficacy in terms of tumor growth inhibition. The first report by Huang et al, on the targeted induction of intraluminal blood coagulation in tumor blood vessels using an artificial marker of angiogenesis generated a great interest to learn whether the same strategy would work in tumor models carrying natural markers of angiogenesis. The second report on this strategy, featuring the targeting of the VCAM-1, was less impressive because only a 50% reduction in the tumor growth rate was observed. The third report by Nilsson et al, featuring the targeting of the mice ED-B domain sequence in the vasculature of aggressive growing tumors observed a complete remission in 30 % of the mice treated, however animals were not cured (Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001). One last report by Peisheng Hu et al 2003, shows the results of three different targeted tissue factor fusion proteins for inducing tumor vessel thrombosis; the chTNT-3/tTF which targets the antigens exposed in necrotic regions of the tumor, the chTV-1/tTF targets a vessel antigen, fibronectin and RGD/tTF similar to the fusion protein constructed in our approach. Of interest, a comparison of the three targeting approaches from Hu et al, to deliver the tTF to the tumor site demonstrated that chTNT-3 and chTV-1 were found to be the most effective vehicles. Interestingly, RGD/tTF alone

52

53

did not display significant anti tumor effects on its own. The authors explained this by the fact that the receptor for RGD, V3 , is mainly associated with endothelial cells undergoing angiogenesis known to occur principally in newly formed capillaries and small sized vessels, not larger sized, mature vessels. Moreover, they argued that the RGD receptors have a relative low affinity for a ligand compared with antigen-antibody interactions, thus explaining the less impressive results obtained with this fusion protein (Peisheng Hu et al, 2003). Antibody fusion proteins highly depend on the appropriate formulation to prevent protein aggregates associated side effects. The bigger size of even single-chain antibody fragments which are fused to tTF may be of sterical hindrance to tTF in terms of inducing coagulation. Promising candidates to target tTF to the tumor vasculature without the above mentioned drawbacks include small peptide fusion proteins selective for natural markers on tumor endothelium (Baxter et al, 1989). Integrins V3, V5 as well as other integrins have been identified as markers of activated endothelium and seem to play a crucial role in developmental and tumor angiogenesis (Fujimori et al, 1989; Jain, 1990; Denekamp, 1990). RGD-peptide fusion proteins which bind to these endothelial ligands have been identified as promising agents to target the tumor endothelium (Arap et al, 1998). In this study, we show the ability of tTF and tTF-RGD fusion protein to enhance the specific proteolytic activation of factor X (FX) by Factor VIIa (FVIIa). The calculated Michaelis constants (Km) for tTF and the tTF-RGD

53

54

were within the range of 0.15 nM as reported in the literature, demonstrating the efficacy of our tTF to activate coagulation. The specific binding of tTF-RGD to immobilized v3 is shown in a purified receptor binding assay. Binding of our construct to immobilized v3 was dose-dependent and saturable. The specificity of this RGDdependent interaction is underlined by the competition using the synthetic peptide GRGDSP. In the presence of 10-100 fold molar excess of unlabeled synthetic RGD peptide, our construct showed merely no significant binding capability to v3, thus suggesting the specificity of tTF-RGD binding to v3. The anti-tumor activity of the tTF-RGD fusion protein was evaluated in BALB/c nude mice bearing 500-700 mm3 M21 tumors (malignant melanoma) and 50-100 mm3 CCL185 tumors (lung cancer). The tumor growth was significantly retarded in comparison to tTF alone and saline treatment. Moreover, the tumor weight was significant lower in the tTFRGD treated group in comparison to the control group. In the groups of control mice, there was no statistically significant difference between mice injected with saline or with tTF protein alone, no macroscopically signs of ischemia or occluded vessels by histological analyses, confirming that the selective targeting of tTF-RGD was necessary for the anti-tumor effect. In our approach, the injection of the tTF-RGD fusion protein in mice through the tail vein shows the efficacy of the fusion protein without significant side effects in vivo.

54

55

Our effective tumor growth inhibition may be explained by the fact that the receptors for RGD, V3, V5 are associated with endothelial cells undergoing angiogenesis. Moreover, by the suggestion that for optimal effects tTF needs to be targeted to the luminal surface of the tumor endothelium in all regions of the tumor mass, probably because platelet activation, assembly of coagulation factors, or both occur most efficiently on the luminal side (Brooks, PC et al, 1994b). The mechanism of vessel thrombosis with the reagent is readily understood because RGD receptors are located on the luminal side of tumor vessels (Ran et al, 1998; Nilsson et al, 2001). According to that and based on the known crystal structure of the tTF:FVIIa complex (Banner et al, 1996), the fusion to RGD would allow the tTF-peptide fusion proteins to adopt an orientation perpendicular to the phospholipid membrane of the endothelial cell similar to native TF. On the other hand, ligation of the peptide to the carboxyl terminus of tTF, as done in our work, should not result in a sterical hindrance for the interaction of tTF with FVIIa and its substrate FX. This work shows for the first time an effective in vivo inhibition of human tumor growth by selectively targeting the tTF-RGD fusion protein to natural markers of angiogenesis. The selective induction of intraluminal blood coagulation in the tumor vasculature, results in effective anti tumor therapy in two experimental solid tumor mice models. However, future preclinical studies are necessary to optimize this antivascular treatment strategy, e.g. by combining tTF-RGD with cytotoxic agents or other antiangiogenic drugs.

55

56

LITERATURE
1 Algire, GH., and Chalkley, HW. Vascular reactions of normal and

malignant tissues in vivo I. Vascular reactions of mice to wounds and to normal and neoplastic implants. J Natl Cancer Inst USA; 6: 73-85, 1945.
2 Arap, W., Pasqualini, R., and Ruoslahti, E. Cancer treatment by

targeted drug delivery to tumor vasculature in a mouse model. Science 279:377-380, 1998.
3 Bader, BL., Rayburn, H., Crowley, D., and Hynes, RO. Extensive

vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all alpha v integrins. Cell, 95: 507-519, 1998.
4 Banner, DW., DArcy, A., Chene, C., Winkler, FK., Guha, A.,

Konigsberg,WH., Nemerson, Y., Kirchhofer, D. The crystal structure of the complex of blood coagulation factor VIIa with soluble tissue factor.Nature 380:41-46, 1996.
5 Bar, RS., Boes, M., Booth, BA., Dake, BL., Henley, S., & Hart, MN.

The effects of platelet-derived growth factor in cultured microvessel endothelial cells. Endocrinology 124, 1841-1848, 1989.
6 Baxter, LT., and Jani, RK. Transport of fluid and macromolecules in

tumors.I. Role of interstitial pressure and convection. Microvasc Res 37:77-104, 1989.

56

57

7 Ben-Ezra, J., Sheibani, K., Hwabg, D L., & Lev-Ran, A. Megakaryocyte

synthesis is the source of epidermal growth factor in human platelets. Am. J. Pathol. 137, 755-759, 1990.
8 Bhagwat, S V., Lahdenranta, J., Giordano, R., Arap, W., Pasqualini, R.,

and Shapiro, L H. CD13/APN is activated by angiogenic signals and is essential for capillary tube formation. Blood 97: 652-659, 2001.
9 Bieker R, Padr T, Kramer J, Steins M, Kessler T, Retzlaff S, Herrera F,

Kienast J, Berdel WE, Mesters RM. Overexpression of basic fibroblast growth factor and autocrine stimulation in acute myeloid leukemia. Cancer Research nov 1;63:7241-7246, 2003.
10 Bikfalvi, A. Significance of Angiogenesis in Tumour Progression and

Metastasis. European Journal of Cancer Vol.31A; Nos 7/8: 1101-1104, 1995.

11 Bikfalvi, A., Bicknell, R. Recent advances in angiogenesis,

anti-angiogenesis and vascular targeting. Trends in Pharmacological Sciences 23;12: 576-582, 2002.
12 Blei, F., Wilson, EL., Mignatti, P., Rifkin, DB. Mechanism of action of

angiostatic steroids: suppression of plasminogen activator activity via stimulation of plasminogen activato inhibitor synthesis. J Cell Physiol; 155:568-578, 1993.

57

58

13 Boehm, T., Folkman, J., Browder, T., OReilly, MS. Antiangiogenic therapy

of experimental cancer does not induce acquired drug resistance. Nature ;390:404-407, 1997.
14 Boger, DL., Goldberg, J., Silletti, S., Kessler, T., and Cheresh, DA.

Identification of a novel class of small-molecule antiangiogenic agents through the screening of combinatorial libraries which function by inhibiting the binding and localization of proteinase MMP2 to integrin alpha(V)beta(3). J Am Chem Soc, 123: 1280-1288,2001.
15 Bouck, N. Tumor angiogenesis: the role of oncogenes and tumor suppressor

genes. Cancer Cells 2: 179-185,1990.

16 Brooks, PC., Silleti, S., von Schalscha, TL., Friedlander, M., Cheresh, DA.

Integrin av3 antagonists promote tumor regression by infuscing apoptosis of angiogenic blood vessels. Cell;79:1157-1164, 1994b.
17 Brooks. PC., Clark, RAF., Cheresh, DA. Requirement of vascular integrin

av3 for angiogenesis. Science;264:569-571, 1994a.

18 Browder, T., and -Folkman, J. The hemostatic system as a regulator of

angiogenesis. The Journal of Biological Chemistry, Jan 21;275(3):1521-4, 2000.

19 Brunner, G., Nguyen, H., Gabrilove, J., Rifkin, DB., & Wilson, EL. Basic

fibroblast growth factor expression in human bone marrow and peripheral blood cells. Blood 81, 631-638, 1993.

58

59

20 Burg, M A., Pasqualini, R., Arap, W., Ruoslahti, E., and Stallcup, W B.

NG2 proteoglycan-binding peptides target tumor neovasculature. Cancer Res 59: 2869-2874, 1999.
21 Burrows, F J., Derbyshire, E J., Tazzari, P L., Amlot, P., Gazdar, A F.,

King, S W., Letarte, M., Vitetta, E S., and Thorpe, P E., Up-regulation of endoglin on vascular endothelial cells in human solid tumors: implications for diagnosis and therapy. Clin Cancer Res 1: 1623-1634, 1995.
22 Cao, Y., OReilly, MS., Marshall, B., Flynn, E., Jie, R-W., & Folkman, J.

Expressions of angiostatin cDNA in a murine fibrosarcoma suppresses primary tumor growth and produces long-term dormancy of metastases. J Clin Invest 101:1055-1063, 1998.
23 Carnemolla, B., Balza, E., Siri, A., Zardi, L., Nicotra, M R., Bigotti, A.,

and Natali, PG. A tumor-associated fibronectin isoform generated by Alternative splicing of messenger RNA precursors. J Cell Biol 108:1139-1148, 1989.
24 Chaplin, DJ., and Horsman, MR. The influence of tumor temperature on

ischemia-indued cell death: potential implications for the evaluation of vascular mediated therapies. Radiother Oncol 3,0: 59-65, 1994.
25 Cheng, S-Y., Huang, HJ., Nagane, M., Ji, XD., Wang, D., Shih, CC.,

Arap, W., Huang, CM., Cavenee, WK. Suppression of glioblastoma angiogenicity and tumorigenicity by inhibition of endogenous expression

59

60

of vascular endothelial growth factor. Proc Natl Acad Sci USA 93:8502-8507, 1996.
26 Cheresh, DA. Human endothelial cells synthesize and express an

Arg-Gly-Asp-directed adhesion receptor involved in attachment to Fibrinogen and von Willebrand factor. Proc Natl Acad Sci USA Sep; 84 (18):6471-5, 1987.
27 Ching, LM., Goldsmith, D., Joseph, WR., Komer, H., Sedgwick, JD., and

Baguley, BC. Induction of intratumoral tumor necrosis factor (TNF) synthesis and hemorrhagic necrosis by 5,6-dimethylxanthenone-4-acetic acid (DMXAA) in TNF knockout mice. Cancer Res 59:3304-3307, 1999.
28 Claffey, KP., Robinson, GS. Regulation of VEGF / VPF expression in

tumor cells: consequences for tumor growth and metastasis. Cancer Metastasis Rev 15: 165-176, 1996.
29 Coussens, LM., Fingleton, B., Matrison, LM. Matrix metalloprotienase

inhibitors and cancer: trials and tribulations. Science; vol: 295(5564): p. 2387-2392, 2002.
30 Date, K., Matsumoto, K., Kubs, K., Shimura, H., Tanaka, M., &

Nakamura, T.Inhibition of tumor growth and invasion by a four kringleantagonist (HGF/NK4) for hepatocyte growth factor. Oncogene 17:. 3045-3054, 1998

60

61

31 Denekamp J. Vascular attack as a therapeutic strategy for cancer. Cancer

Metastasis Rev. 9:267-282, 1990.

32 Dvorak, H F., Brown, L F., Detmar, M., and Dvorak, A M. Vascular

permeability factor/vascular endothelial growth factor, microvascular hyper permeability, and angiogenesis. Am J Pathol 146: 1029-1039, 1995.
33 Dvorak, H F., Sioussat, T M., Brown, L F., Berse, B., Nagy, J A., Sotrel, A.,

Manseau, E J., Van de Water, L., and Senger, D R. Distribution of vascular permeability factor (vascular endothelial growth factor) in tumors: concentration in tumor blood vessels. J Exp Med 174: 1275-1278, 1991.
34 Eliceiri, BP., and Cheresh, DA. The role of alphav integrins during

angiogenesis: insights into potential mechanisms of action and clinical development. J Clin Invest 103: 1227-1230, 1999.
35 Ellis, LM., and Fidler, IJ. Angiogenesis and Metastasis. European Journal

of Cancer 32A; 14: 2451-2460, 1996.

36 Engerman, RL., Pfaffenbach, D., Davis, MD. Cell turnover of capillaries.

Lab Invest 17:738-743, 1967.

37 Felding-Habermann, B., Mueller, B. M., Romerdahl, C. A., and Cheresh,

D. A. Involvement of integrin alpha V gene expression in human melanoma tumorigenicity. J Clin Invest, 89: 2018-2022, 1992.

61

62

38 Fernig DG , Fibroblast growth factors and their receptors: an information

network controlling tissue growth, morphogenesis and repair. Prog Growth Factor Res. 5: 353-377, 1994.
39 Fidler, IJ., and Ellis, LM. The implications of angiogenesis to the biology

and therapy of cancer metastasis. Cell; 79:185-188, 1994.

40 Folkman Judah. Antiangiogenic gene therapy, Proc Natl Acad Sci USA

95: 9064-9066, 1998.

41 Folkman, J. Tumor angiogenesis: therapeutic implications. N Engl J Med

Nov 18;285(21):1182-6, 1971.

42 Folkman, J. What is the evidence that tumors are angiogenesis dependent.

Journal Natl Cancer Inst, Jan 3;82(1):4-6, 1990.

43 Folkman, J., Shing, Y. Angiogenesis. J Biol Chem 267:10931-10934, 1992.

44 Folkman, J., Watson, K., Ingber, D., and Hanahan, D. Induction of

angiogenesis during the transition fromhyperplasia to neoplasia. Nature 339: 58-61, 1989.
45 Fujimori, K., Covell, DG., Fletcher, JE., and Weinstein, JN. Modeling

analysis of the global and microscopic distribution of immunoglobulin G, F(ab')2, and Fab in tumors.Cancer Res 49:5653-5656, 1989.

62

63

46 Gimbrone, MA Jr., Leapman, S., Cotran, R., Folkman, J. Tumor dormancy

in vivo by prevention of neovascularization. J Exp. Med. 136:261-276, 1972.

47 Goldman, CK., Kendall, RL., Cabrera, G., Soroceanu, L., Heike, Y.,

Gillespie, GY. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate. Proc Natl Acad Sci USA 95:8795-8800, 1998.
48 Good, DJ., Polverini, PJ., Rastinejad, F., Le Beau, MM., Lemons, RS.,

Frazier, WA., Bouck, NP. A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc. Natl. Acad. Sci U.S.A. 87,6624-6628, 1990.
49 Hagedorn, M., Bikfalvi, A. Target molecules for antiangiogenic therapy:

from basis research to clinical trials. Crit Rev Oncol Hematol 34:89-110, 2000.
50 Hanahan, D., Folkman, J. Patterns and emerging mechanisms of the

angiogenic switch during tumorigenesis. Cell 86:353-364, 1996.

51 Hobson, B., Denekamp, J. Endothelial proliferation in tumors and

normal tissues: continuous labeling studies. Br J Cancer 49:405-413, 1984.

52 Huang, X., Molema, G., King, S., Watkins, L., Edgington, T S., and Thorpe,

P E. Tumor infarction in mice by antibody-directed targeting of tissue factor

63

64

to tumor vasculature. Science 275: 547-550, 1997.

53 Hwang, DL., Lev-Ran, A., Yen, C F., & Sniecinski, I. Release of different

fractions of epidermal growth factor from human platelets in vitro: preferential release of 140 kDa fraction. Regul Pept; 37: 95-100, 1992.
54 Hynes, R. O. Integrins: versatility, modulation, and signaling in cell adhesion.

Cell, 69: 11-25, 1992.

55 Jain RK. Vascular and interstitial barriers to delivery of therapeutic agents

In tumors. Cancer Metastasis Rev 9:253-266, 1990.

56 Karey, K.P., Marquardt, H., & Sirbasku, DA. Human platelet-derived

mitogens.I. Identification of insulinlike growth factors I and II by purification and N alpha amino acid sequence analysis. Blood 74, 1084-1092, 1989.
57 Kerbel, RS. Tumor angiogenesis: past, present and the near future.

Carcinogenesis Mar;21(3):505-15, 2000, Review.

58 Kessler, T., Pfeifer, A., Silletti, S., Mesters, R M., Berdel, W E., Verma, I.,

and Cheresh, D. Matrix metalloproteinase/integrin interactions as target for anti-angiogenic treatment strategies. Ann Hematol 81;Suppl 2: S69-70, 2002.
59 Kim, KJ., Li, B., Winer, J., Armanini, M., Gillet, N., Phillips, HS.,

Ferrara, N. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumor growth in vivo. Nature 362: 841-4, 1993.

64

65

60 Kuus-Reichel, K., Grauer, LS., Karavodin, LM., Knott, C., Krusemeier, M.,

Kay, NE. Will immunogenicity limit the use, efficacy, and future development of therapeutic monoclonal antibodies? Clin Diagn Lab Immunol 1:365-372, 1994.
61 Lee S Rosen, Clinical Experience with Angiogenesis Signaling

Inhibitors: Focus on Vascular Endothelial Growth Factor Blockers. Cancer control vol. 9; suppl. 2: 36-44, 2002.
62 Lee, OH., Kim, Y-M., Lee, YM., Moon, E-J., Lee, D-J., Kim, J-H.,

Kim, K-W., & Kwon,YG. Sphingosine 1-phosphate induces angiogenesis: its angiogenic action and signaling mechanism in human umbilical vein endothelial cells. Biochem Biophys Res Commun 264: 743-750, 1999.
63 Lin, P., Buxton, JA., Acheson, A., Radziejewski, C., Maisonpierre, PC.,

Yancopoulos, GD. Antiantiogenic gene therapy targeting the endotheliumspecific receptor tyrosine kinase tie2. Proc Natl Acad Sci USA; 95:8829-8834, 1998.
64 Liu, C., Huang, H., Donate, F., Dickinson, C., Santucci, R., El-Sheikh, A.,

Vessella, R., and Edgington, T. S. Prostate-specific membrane antigen directed selective thrombotic infarction of tumors. Cancer Res 62: 5470-5475, 2002.
65 Mattern, J., Koomgi, R., Volm, M. Association of vascular endothelial

growth factor expression with intratumoral microvessel density and tumor cell proliferation in human epidermoid lung carcinoma. Br J Cancer; 73:931-934, 1996.

65

66

66 Mesters, RM., Padr, T., Bieker, R., Steins, M., Kreuter, M., Goener, M.,

Kelsey, S., Scigalla, P., Fiedler, W., Buechner, T., Berdel, WE. Stable remission after administration of the receptor tyrosine kinase inhibitor SU5416 in a patient with refractory acute myeloid leukemia. Blood Jul 1;98(1):241-3, 2000.
67 Mesters, RM., Padr, T., Steins, M., Bieker, R., Retzlaff, S., Kessler T.,

Kienast, J., Berdel, WE. Angiogenesis in patients with hematologic malignancies. Onkologie sep;24 Suppl 5:75-80, 2001.
68 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.

Dominant-negative inhibition of flk-1 suppresses the growth of many tumor types in vivo. Cancer Res 56:1615-1620, 1996.
69 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.

Glioblastoma growth inhibited in vivo by a dominant-negative flk-1 mutant. Nature 367:576-579, 1994.
70 Mohle, R., Green, D., Moore, MA., Nachman, RL., and Rafii, S.

Constitutive production and thrombin-induced release of vascular endothelial growth factor by human megakaryocytes and platelets. Proc Natl Acad Sci USA, 94: 663-668, 1997.
71 Morrissey, JH., Macik, BG., Neuenschwander, PF., and Comp, PC.

Quantitation of activated factor VII levels in plasma using a tissue factor mutant selectively deficient in promoting factor VII activation. Blood 81: 734-744, 1993.

66

67

72 Nakamura, T., Teramoto, H., & Ichihara. Purification and characterization

of a growth factor from rat platelets for mature parenchymal hepatocytes in primary cultures. Proc Natl Acad Sci USA;83: 6489-6493, 1986.
73 Nilsson, F., Kosmehl, H., Zardi, L., and Neri, D. Targeted delivery

of tissue factor to the ED-B domain of fibronectin, a marker of angiogenesis, mediates the infarction of solid tumors in mice. Cancer Res 61: 711-716, 2001.
74 Novak, K. Angiogenesis inhibitors revised and revived at the AACR.

Nat Med 8: 427, 2002.

75 Olson, T A., Mohanraj, D., Roy, S., and Ramakrishnan, S. Targeting the

tumor vasculature: inhibition of tumor growth by a vascular endothelial growth factor-toxin conjugate. Int J Cancer 73: 865-870, 1997.
76 Padr, T., Bieker, R., Ruiz, S., Steins, M., Retzlaff, S., Brger, H.,

Bchner, T., Kessler, T., Herrera, F., Kienast, J., Mller-Tidow, C., Serve, H., Berdel, WE., and Mesters, RM. Overexpression of vascular endothelial growth factor (VEGF) and its cellular receptor KDR (VEGFR-2) in the bone marrow of patients with acute myeloid leukemia. Leukemia 16: 1302-1310, 2002.
77 Padro, T., Ruiz, S., Bieker, R., Burger, H., Stein, M., Kienast, J.,

et al, Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia. Blood Apr 15;95(8):2637-44, 2000.

67

68

78 Peisheng, Hu., Jianghua, Yan., Jahangir, Sharifi., Thomas, Bai., Leslie, A.,

Khawli, and Alan, L, Epstein. Comparison of Three Different Targeted Tissue Factor Fusion Proteins for inducing Tumor Vessel Thrombosis. Cancer Research ;63: 5046-5053, 2003.
79 Pfeifer, A., Kessler, T., Silletti, S., Cheresh, D A., and Verma, I M.

Suppression of angiogenesis by lentiviral delivery of PEX, a noncatalytic fragment of matrix metalloproteinase 2. Proc Natl Acad Sci U S A, 97: 12227-12232, 2000.
80 Philip Thorpe ., David, J Chaplin., and David, C Blakey. The first

International Conference on Vascular Targeting: Meeting Overview. Cancer Res 63, 1144-1147, 2003.
81 Polverini, PJ. How the extracellular matrix and macrophages contribute

to angiogenesis-dependent diseases. Eur. J Cancer, Dec; 32A(14): 2430-7, 1996.

82 Poon, RT., Fan, ST., Wong, J. Clinical implications of circulating

angiogenic factors in cancer patients. J Clin Oncol Feb 15;19(4): 1207-25, 2001, Review.
83 Ran, S., Gao, B., Duffy, S., Watkins, L., Rote, N., and Thorpe, P E.

Infarction of solid Hodgkin's tumors in mice by antibody-directed targeting of tissue factor to tumor vasculature. Cancer Res, 58: 4646-4653, 1998.

68

69

84 Rettig, W J., Garin-Chesa, P., Healey, J H., Su, S L., Jaffe, E A., and

Old, L J. Identification of endosialin, a cell surface glycoprotein of vascular endothelial cells in human cancer. Proc Natl Acad Sci U S A 89:10832-10836, 1992.
85 Reynolds, LE., Wyder, L., Lively, JC., Taverna, D., Robinson,

SD., Huang, X., Sheppard, D., Hynes, RO., and Hodivala-Dilke, KM. Enhanced pathological angiogenesis in mice lacking beta 3 integrin or beta 3 and beta 5 integrins. Nat. Med. 8: 27-34, 2002.
86 Rippmann Pfizenmaier, K., Mattes, R., Rettig, WJ., and Dieter

Moosmayer. Fusion of the tissue factor extracellular domain to a tumor stroma specific single-chain fragment variable antibody results in an antigen-specific coagulation promoting molecule. Biochem J 349: 805-812, 2000.
87 Ruegg, C., Yilmaz, A., Bieler, G., Bamat, J., Chaubert, P.,

Lejeune, F. Evidence for the involvement of endothelial cell integrin av3 in the disruption of the tumor vasculature induced by TNF and IFN-y. Nature Medicine 4: 408-414, 1998.
88 Ruf, W., Rehemtulla, A., Morrissey, JH., and Edgington, TS.

Phospholipid independent and dependent interactions required for tissue factor receptor and cofactor function. J Biol Chem 266 : 2158-2166, 1991a.

69

70

89 Ruf, W., Kalnik, MW., Lund-Hansen, TS., Edgington, TS:

Characterization of factor VII association with tissue factor in solution. J Biol Chem 266:15719-15725, 1991 b.
90 Ruoslahti, E. Specialization of tumor vasculature. Nat Rev Cancer

2: 83-90, 2002.
91 Sato, Y., Abe, M., Takaki, R. Platelet factor-4 blocks the binding

of basic fibroblasts growth factor to the receptor and inhibits the spontaneous Migration of vascular cells. Biochem biophys Res Commun, 172: 595-600, 1990.
92 Schraa, AJ., Everts, M., Kok, RJ., Asgeirsdottir, SA., Meijer, DK.,

de Leij, LF., Molema, G. Development of vasculature targeting strategies for the treatment of cancer and chronic inflammatory diseases. Biotechnology annual review; vol 8:133-165, 2002.
93 Senger, D R., Claffey, K P., Benes, J E., Perruzzi, C A., Sergiou, A P.,

and Detmar, M. Angiogenesis promoted by vascular endothelial growth factor: regulation through alpha1beta1 and alpha2beta1 integrins. Proc Natl Acad Sci U S A; 94: 13612-13617, 1997.
94 Silletti, S., Kessler, T., Goldberg, J., Boger, DL., and Cheresh, DA.

Disruption of matrix metalloproteinase 2 binding to integrin alpha v beta 3 by an organic molecule inhibits angiogenesis and tumor growth in vivo. Proc Natl Acad Sci U S A 98: 119-124, 2001.

70

71

95 Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., Fusenig, NE.

Halting angiogenesis suppresses carcinoma cell invasion. Nature Medicine 3:1222-1227,1997.

96 Soker, S., Takashima, S., Miao, HQ., Neufeld, G., Klagsbrun, M.

Neuropilin-1 is expressed by endothelial and tumor cells as an Isoform-specific receptor for vascular endothelial growth factor. Cell;92: 735-745, 1998.
97 Table 1Pro-angiogenic and Anti-angiogenic factors

(Angiogenesis Foundation). Understanding angiogenesis, 2002.

http://www.angio.org/understanding/content understanding.html.

98 Teicher, BA., Holden, S A., Gulshan, A., Sotomayor, A., Huang, ZD.,

Chen, YN. Potentiation of cytotoxic cancer therapies by TNP-470 alone and with other anti-angiogenic agents. Int J Cancer, Jun 15; 57(6): 920-5, 1994.
99 Terman, BI., Dougher-Vermazen, M. Biological properties of

VEGF / VPF receptors. Cancer Metastasis Rev 15:159-163, 1996.

100 Toi, M., Hoshima, S., Takayanagi, T., Tominaga, T. Association of

Vascular Endothelial Growth Factor Expression with tumor angiogenesis and with early relapse in primary breast cancer. Jpn J Cancer Res Oct;85(10):1045-9, 1994.

71

72

101 Topp, MS., Koenigsmann, M., Mire-Sluis, A., Oberberg, D.,

Eitelbach, F., von Marschall, Z., Notter, M., Reufi, B., Stein, H., Thiel, E., and Berdel, WE. Recombinant human interleukin-4 inhibits growth of some human lung tumor cell lines in vitro and in vivo. Blood 82: 2837-2844, 1993.
102 Warren, RS., Yuan, H., Matli, MR., Gillett, NA., Ferrara, N.

Regulation by vascular endothelial growth factor of human colon cancer tumorigenesis in a mouse model of experimental liver metastasis. J Clin. Invest 95:1789-1797, 1995.
103 Wartiovaara, U., Salven, P., Mikkola, H., Lassila, R., Kaukonen, J.,

Joukov, Vl., Orpana, A., et al. Peripheral blood platelets express VEGF-C and VEGF which are released during platelet activation. Thromb. Hemostats 80, 171-175, 1998.
104 Yang, JT., Rayburn, H., Hynes, RO. Embryonic mesodermal defects

in alpha 5 integrin-deficient mice. Development 119: 1093-1105, 1993.

105 Yun, Z., Menter, DG., Nicolson, GL. Involvement of integrin av3

in cell adhesion, motility and liver metastasis of murine RAW117 large cell lymphoma. Cancer Res;56: 3103-3111, 1996.

72

73

ABBREVIATIONS TF = Tissue Factor tTF= truncated form of tissue factor RGD = specific peptide sequence PS = phosphatidylserene VEGF = vascular endothelial growth factor VCAM-1 = vascular cell adhesion molecule B-FN = fibronecting containing ED-B FACS = fluorescence activated cell sorting MVEC = microvascular endothelial cells Kd = dissociation constant ELISA = enzyme linked immunoadsorbent assay Ang1 = angiopoietin-1 ED-B= domain extra domai-B of fibronectin FVIIa= activated factor VII TNF-= Tumor necrosis factor alpha

73

74

ACKNOWLEGMENTS I would like to express my gratitude to Prof. Dr med. Rolf M. Mesters for providing me with opportunity and scientific environment to carry out the studies. I am grateful to Dr. Teresa Padr for her commitment, enthusiasm and guidance throughout this investigation. I also thank Dr. Ralph Bieker and Dr. Torsten Keler for their educational advice. I would also thank Mrs Sandra Ruiz, Dr. med. R Lttmann, Mrs C Wilken, Ms H Hintelmann who have contributed to a very pleasant atmosphere, for their support and friendship in these 3 years. Finally, I am particularly indebted to Jennifer George, mi wife, for her emotional support, and friendship. Moreover, my family that after all, without their, I would have never persisted in achieving this MD.

74

75

75