Effects of flooding and drought stress on Solanum dulcamara resistance to herbivore by Colorado potato beetle (Leptinotarsa decemlineata)

Author

Tamara Jimnez Gngora

Co-supervisors

P Prof. Dr. Nicole van Dam P PhD Student Duy Nguyen

Institute for Water and Wetland research Radboud University Nijmegen (The Netherlands)

-- Nijmegen, February 2012

Table of Contents
2

Abstract .............................................................................................................. ................................ 5 1. Introduction ....................................................................................................... .......................... 6 1.1. Plant response to drought stress ...... 7 1.2. Plant response to flooding stress ............................................................................................... 7 1.3. Protease inhibitors .............................................................................................................. ....... 8 1.4. Research question and hypotheses ............................................................................................. 9 1.5. The model system ................................................................................................................. ... 10 2. Material and methods ............................................................................................................ 11 2.1. Solanum dulcamara accessions ................................................................................................ 11 2.2. Water regimes and herbivore induction ................................................................................... 11 2.3. Detached leaf assay ................................................................................................................. 12 2.4. mRNA extraction ............................................................................................................. ....... 13 2.5. cDNA construction ......................................................................................................... ......... 13 2.6. qPCR set up ......................................................................................................................... .... 13 2.7. Processing data 3

.................................................................................................................... 14 2.8. Measurements of eaten leaf area ............................................................................................ 14 2.9. Statistics .............................................................................................................. ................... 15 3. Results ................................................................................................................ ....................... 16 3.1. Water volumetric percentages ................................................................................................ 16 3.2. Efficiency of conversion of ingested food .......................................................................... 17 3.3. PIN gene expression ............................................................................................................ 19 3.3.1. PIN 40 ......................................................................................................................... ... 19 3.3.2. PIN 16469 ................................................................................................................... ... 20 3.3.3. PIN 19273 ................................................................................................................... ... 21 3.3.4. PIN 20346 ................................................................................................................... ... 22 3.3.5. PIN 44969 ................................................................................................................... ... 23 3.3.6. PIN 50173 ................................................................................................................... 24 4. Discussion .......................................................................................................... ...................... 25 4.1. Conclusions .......................................................................................................... ................. 25 4

4.1.1. Hypothesis 1; drought increases direct defences ............................................................. 25 4.1.2. Hypothesis 2; waterlogging decreases direct defences .................................................... 26 4.1.3. The impact of origin; differences between two populations ............................................ 26 4.2. Discussion ............................................................................................................ ................. 26 4.2.1. Recommendations for future studies .............................................................................. 27 5. Literature ........................................................................................................... ...................... 29 6. Acknowledgements .......................................................................................... ....................... 31

Abstract
5

Insect attack is considered one of the principal stresses that plants have to face. For this purpose, they have developed numerous defence responses, among which is the production of protease inhibitors that interfere with the digestive process of insects. These protease inhibitors are regulated by different phytohormones, the main one is the jasmonic acid (JA), but may be affected by different levels of ABA or ethylene. Due to this, we postulate that, in response to excess of water antagonist effects of ethylene in the production of JA would decrease the levels of protease inhibitors. Instead an induction of water stress would raise the levels of ABA, which positively regulates JA signalling pathway, producing an increase in proteases inhibitors levels in the plant. In order to test this, we subjected the model plant Solanum dulcamara to an induction with the specialist herbivore Colorado potato beetle under different treatments in the absence and excess of watering. Afterwards was measured the levels of expression of some genes encoding various types of protease inhibitors in order to analyse the relationship between their levels and the different treatments to which the plants were subjected.

1. Introduction
Plants have been always exposed to numerous biotic and abiotic stresses since they cannot move to change their environment. Therefore, they have to adapt to their environment by modifying their molecular and phenotypic responses. One of these stresses is the herbivore. Plants and herbivores have been co-evolving for thousands of years, and as a result, plants have defence mechanisms that offer protection against many herbivores such as nematodes or insects. Some of the mechanisms are the trichomes, spines and compounds like plant cyanogenic glycosides, saponins or alkaloids (Vetter, 2000; Osbourn, 1996; Hartmann and Ober, 2008). However, they cost a lot of energy for the plant since they are formed even when the plant is not attacked. There are other induced defences which act only when the plant need them, such as pathogenesis related proteins (Belhadja et. al 2007) or released volatile compounds attracting natural enemies of the herbivores. Only when a herbivore has managed to adapt to these defence mechanisms does it have the potential to become a pest (Jongsma and Bolter, 1997). Nowadays, it is well known that these defence responses are regulated by a complex group of different hormones and molecules. One of the molecules is the lipidic phytohormone jasmonic acid (JA), an oxygenated derivative of linoleic and linolenic fatty acids. JA mainly act as signalling molecules in plant responses to many stress situations and engages in various developmental processes. Among the governing stress are the wounds, exposure to ozone, drought and attack by pathogens and pests (Creelman and Mullet, 1997). When an insect wounds the plant, it triggers a series of signals that are received by the cells and thus initiates the production of JA in the peroxisome from chloroplast-derived linoleic acid (Figure 1). This production of JA in response to herbivores activates a cascade of reactions that ends with the expression of different genes involving in plan defence, such as protease inhibitors genes.

Figure 1. Schematic view of the induction of jasmonic acid against herbivores.

Besides, this signalling produced by JA is affected by other hormones such as ABA or ethylene, which are regulated by abiotic stress such as drought and flooding, respectively.

1.1. Plant responses to drought stress

The plant perceives the lack of water and triggers a rapid response to mitigate its effects on plant growth. The precise mechanism remains largely unknown. But there are candidates to receive the signal, as the Arabidopsis AtHK1 receptor (Tran et al. 2007) or the induction of a phospholipase D or phospholipase C type (Zhu, 2002). Some responses are independent of ABA with a very quick route to activate the expression of genes containing DRE boxes in their promoters (Harb et al. 2010). The ABA-dependent transduction pathway signal is slower, because it needs the synthesis of ABA (Seki et al. 2007). After this signalling, it promotes root growth, reduce the apex, which together with the induction of stomatal closure, helps increase the absorption of liquid surface and reduce water stress. Abscisic acid has been show to affect JA-mediated response to insect herbivores (Thaler and Bostock 2004), in the way that it positively regulates JA signalling pathway, because it is required for JA production. However, it is good to consider that it takes many levels of regulation to calibrate how big and continuous is the stress. For this reason, is good to consider all of that, since the ABA cannot begin to interact with the JA until a certain level of stress in the plant.

1.2. Plant responses to flooding stress

It is also interesting to consider the role of ethylene in JA-dependent responses. The ethylene and jasmonate pathways converge in the transcriptional activation of Ethylene Response Factor 1 (ERF1), which encodes a transcription factor that regulates the expression of pathogen response genes that prevent disease progression. The expression of ERF1 can be activated rapidly and synergistically by both hormones (Fukao et al. 2008). In contrast, it has also been demonstrated in some studies that ethylene negatively regulates JA signalling pathway. This can be explained looking carefully gene responses produced by JA signalling pathways. JA up regulates AtMYC2, a transcription factor that differentially regulates the expression of two groups of JAinduced genes. The first group includes genes involved in defence responses against pathogens and is repressed by AtMYC2. AtMYC2 activates the second group, involved in JA-mediated systemic responses to wounding. Conversely, ERF1 positively regulates the expression of the first group of genes and represses the second (Lorenzo et al. 2004). This would explain the alternative responses activated by JA and ET to two different stresses, pathogen attack and wounding. This antagonistic effect is also supported to be indirectly based on the role of ET in negative regulation of ABA signalling pathway (Lorenzo et al. 2003). So is expected that if we submit a plant to waterlogged stress accompanied by insect attack we will get

different responses. Besides the expected excess water adaptations (as are the emergence of aerenchymas or the emergence of adventitious aerial roots), this will produce an increase in levels of ET that will decrease the levels of JA. In the end, it will result in a decrease in plant defences. An effective way to measure this level of plant defence is by looking at protease inhibitors levels.

1.3. Protease inhibitors (PIs)

Since insects are unable to synthesize a number of amino acids, they depend on digestive proteases and plant proteins to meet their nutritional requirements (Zavala et al, 2008). These proteases are enzymes that catalyse the hydrolytic cleavage of specific peptide bonds in their target proteins. These enzymes are widely distributed in nearly all plants, animals and microorganisms. Despite the fact that these enzymes are indispensable, they may be potentially damaging when overexpressed. Therefore, they need to be strictly regulated both in time and in place by two dominant mechanisms. The first is that almost all proteases are biosynthesized as largely inactive precursors called proproteins. These are stored and then activated on demand. The activation involves proteolysis of a peptide bond. Another mechanism is needed to control the active enzymes once activated. This is accomplished with the interaction with proteins that inhibit their activities, called protease inhibitors (PIs). These inhibitors form complexes with proteases to make them completely or less inactive (Laskowski and Qasim, 1999). Plants have developed the ability to produce PIs that interfere with the digestive process of insects. PIs are induced in response to injury or attack by insects or pathogens. They inhibit the proteases present in insect guts causing a reduction in the availability of amino acids necessary for their growth and development (Lawrence and Kendal, 2002). Protease inhibitors may be classified by the type of protease they inhibit, by their mechanism of action, or by so many other ways. A database for PIs coordinated by Luigi R Cecil at Centro di studio sui Mitochondria and Metabolismo Energetico-C.N.K. describes nine families of PPIs based on sequence similarities (Habib and Majid, 2007): -Serpin (Serine PI) family -Bowman Birk inhibitors (BBIs) family -Kunitz family -Squas inhibitors -Cereal trypsin/alfa-amylase inhibitors -Mustard (Sinapis) trypsin inhibitor (MSI) -Potato type I PIs (PI 1) -Potato type II PIs (PI 2) -Cysteine Pis (CYS), the cystatin superfamily

-Family-1 cystatins (stefin family) -Family-2 cystatins (cystatin family) -Family-3 cystatins (kininogen family) -Family-4 cystatins (phytocystatins) -Aspartyl and metallocarbopeptidase inhibitors

Potato type II PIs have been extensively studied in species such as Solanum tuberosum (Greenblatt et al. 1989, Keil et al. 1986) or Solanum lycopersicum (Graham et al 1985, Barrette-Ng et al. 2003). Likewise PIs like Potato type I or Kunitz inhibitors have been also characterized in Solanum tuberosum (Richardson 1974 and Gruden et al. 1997). Actually, it has been found that the cysteine protease activity of Colorado potato beetle guts, which is insensitive to potato protease inhibitors, is inhibited by some members of the cystatin superfamily (Gruden et al. 1998). In the other hand, some species of insects are adapted to circumvent the adverse effects of plants PIs. It is necessary to develop a comprehensive understanding of digestion physiology in insects and how they respond to the ingestion of inhibitors to optimize the use of these defence proteins in crop protection (Ortego et al. 2001).

1.4. Research question and hypotheses

Up to now, little is known about the effects produced in the plants under multiple stresses specifically the effects of drought stress or flooding on plant responses against insect herbivores. Increasing evidence suggests that the set of defences activated in plants depends on the type of interaction (positive or negative) between the hormonal signalling pathways regulating plant responses under different stresses. For this reason, we want to see if the condition of deficit or excess of water in affects the levels of induced defences in response to attack by insects.

The main question in this study is:

Does water stresses (drought or waterlogging) influence the induction of direct defences, with expression of PIN genes as the studied trait in Solanum dulcamara in response to feeding by larvae of the specialist Colorado potato beetle?
This result in two testable hypotheses: 1. Plants under drought stress treatment will have increased expression of PIN genes, compared to the ones under control treatment, when infested by CPBs resulting a lower feeding and performance of CPBs. 2. Plant under waterlogging treatment will have decreased expression of PIN genes, compared to the ones under control treatment, when infested by CPBs resulting a higher feeding and performance of

10

CPBs.

1.5. The model system

To verify these response interactions we used the plant model species Solanum dulcamara, and the insect Colorado potato beetle. Solanum dulcamara is a very good plant model to investigate the ecological effects of water stresses on plant development, because it presents a natural variation in stress exposure, biotic and abiotic (Clough et al. 1979), and adaptations in extremely different environments. It belongs to the family Solanaceae and is native to Europe and Asia, and widely invasive in other continents, including North America. Solanum dulcamara is also a good example in the studies of plant defences against pathogens or herbivores, since it produces numerous defence compounds, like a high content of alkaloids (Kumar et al., 2009). It also serves as an alternative host for many agriculturally important diseases (Viswanathan et al 2008). All of this combined with the close relatedness to its solanaceous model species, such as tomato and potato, makes it an ideal model plant for the study of plant response to different biotic and abiotic stresses and to measure their levels of induced defences against attack by different herbivores. This knowledge would give important insights on how to improve other economically important species. Solanum dulcamara accessions used in this study are from wet habitat collected in Voorne (Accession 73, Ag 4750089), and from dry habitat collected in Limburg (Accession 202, Ag4750154) and in Goeree (Accession 312). The differences in their habitats (different adaptations to the water level of their environments) make the selected accessions a nice representation of wild S. dulcamara.

The Colorado potato beetle [CPB, Leptinotarsa decemlineata (Say). Coleoptera: Chrysomelidae] is an important pest of potato crops (Susan et al. 2007). They can cause significant damage to the species from the family Solanaceae, including tomatoes and eggplants. Normally, the beetles overwinter in the soil as pupae, in woody areas next to fields where they have spent the previous summer. Because of this, if fields are not rotated, they are easily colonized by overwintered adults that walk to the field from their pupating sites (Weber and Ferro, 1993). The beetles feed and then oviposit within 5-6 days depending on temperature (Ferro et al., 1991). The eggs of CPBs are placed on the underside of potato leaves and the larvae start feeding within 24 hours of eclosion. Development until adult eclosion for pupae takes between 14-56 days (Logan et al., 1985; Ferro et al., 1985). Between one and three generations may occur each growing season. Insecticides are currently the main method of beetle control. However, the Colorado potato beetle has easily developed resistance to all major insecticide classes. For this reason, it is increasingly important to investigate the mechanisms of resistance in plants against this herbivore.

11

2. Methodology
2.1. Solanum dulcamara accessions
For the experiments I used a selection of three Solanum dulcamara accessions, collected in Limburg, Voome and Goere (Table 1). The seeds were incubated in the dark at 4-5 in the cold room for 2 weeks (I spread them in a petri disk with wet filter paper). After that, they were putted in small pots in the net house with controlled temperature at 20C during 16h light/ 8h dark. Three weeks after sowing, seedlings are transferred to individual pots until the treatments began.
Genotype Accession number Population Habitat Number of plants 73 Ag4750089 Voorne Wet 45 312 Goeree Dry 45 202 Ag4750154 Limburg Dry 45 Table 1. Solanum dulcamara accessions with genotype number, accession number and collection site.

2.2. Water regimes and herbivore induction

The plants were submitted to three watering treatments: drought, waterlogged and a control (Figure 2). These treatments started 3 days before herbivore induction. In the case of drought treatment, these plants were stopped watering four days before the treatment started, (Figure 3). In Table 2, we can see the final number of plants of each accession that I used for each treatment.

Figure 2. Schematic overview of stress treatments in Solanum dulcamara.; A. Normal watering treatment; B. Waterlogged treatment; C. Drought treatment.

12

Figure 3. Schedule of treatments. Green bar mean four days before treatments started. Drought and waterlogged were started in day 1 until the end. Herbivore induction were started third day. (*) mean water potential measurements of the soil in the plants of drought treatment.

Treatments Flooding Drought Control

CPB 5 5 5

No CPB 5 5 5

Control 5 5 5

Table 2. Number of plants in each treatment for each Accession.

For the herbivore induction, one CPB larva was put on one of the intermediate leaves, number 6 counting from the base, and confined to a clip-cage (Figure 4). The starting weights of the insects were measured before putting them in the clip-cages. Each larva was fed on this leaf for one day and moved to the adjacently upper leaf (number 7) to feed for another day. All larvae were weighed everyday after feeding. To calculate their relative weight gain % for each day: (ending weight - starting weight) / starting weight.

Figure 4. Set up of the herbivore induction with the cip-cages.

This 6 and 7 leaves for the plants of the herbivore induction were cut and photographed with a white background and a centimetre scale draw in to be calculated for the leaf area consumed by the larvae. Four leaf disks (d=15mm, ~100mg in total), two from each side of the main vein, were excised from each leaf for molecular assays. From locally damaged leaves, number 6 and 7, the leaf disks were pooled into two samples to eliminate variation. In addition, two samples were taken from an upper undamaged leaf, the number 9, to test for systemic responses.

13

These samples were taken for all the plants and placed in 2 l eppendorfs and quickly frozen in liquid nitrogen and stored in -80C until further analysis.

2.3. Detached leaf assay

Another experiment was set with the 8 leaf of all the plants. Each leaf was cut from the plant, attached to a piece of oasis moistened with water and put on a plastic petri disk with lid. One CPB larva was put on each leaf to feed for one day. The weight of the insects was measured before and after feeding to calculate their relative weight gain (%): (final weight - starting weight) / starting weight. All leaves were photographed like before to measure leaf area consumed by the larvae. These data together with the weight data were used to calculate the efficiency of CPB larvae in conversion of ingested food as mg weight gain per cm2 leaf consumed.

2.4. mRNA extraction

Frozen leaf material (100 mg), from leaf 9, was ground with two metal beads for each eppendorf in the TissueLyser with two rounds of 30 seconds at 25 Hz, in pre-cooled the adapters. Once the tissue was homogenized it was used for RNA extraction using Trizol protocol. A volume of 50 l total RNA solution was obtained for each sample. An additional purification step using phenol/chloroform was done since the samples were not clean enough according to Nanodrop measurements. Finally, all samples were submitted to a DNase treatment with TURBOTM DNase to get the samples free of genomic DNA contamination.

2.5. cDNA construction

Four out of five of the total RNA samples were subsequently used for double-stranded cDNA synthesis, employing the iScript cDNA synthesis Kit. It was used a total volume of 20 l, in which 15 l of them were a mix between water and the RNA solution to get a concentration of 1 l RNA per 20 l reaction. In samples that this volume from RNA solution exceeded 15 l, only 15 l or RNA solution was added to the cDNA synthesis reaction. The incubating conditions to complete the reaction were 5 minutes at 25C, 30 minutes at 42C, 5 minutes at 85C and hold at 4C. All cDNA samples were diluted with water to the concentration of 2.5 ng/l and kept at -20C until qPCR.

2.6. RNA mix

From the final RNA solutions used in cDNA synthesis, an RNA mix was made from 4 samples of each treatment to be used as a control for cDNA contamination during qPCR. 100 ng RNA of each sample were added to a total volume of 160 l water to make the final concentration of 2.5 ng/l.

2.7. qPCR set up

For each transcript a standard curve was constructed using the purified PCR product generated for each specific primer pair. Single Reactions were prepared for each cDNA using the SYBR Green Master Mix in a BioRad iCycler machine. Non-reverse transcription controls (RNA mixes) were included to confirm the absence of genomic DNA. And a non-template negative control (in duplicate) for each primer pair was

14

included to check for primer-dimer and possible contamination. Each reaction consisted of 25 l containing 5 l of cDNA (2,5ng/ l) and 1 l of each primer (5 M). The cycling conditions were 1 cycle of denaturation at 95C/3 min, followed by 45 two-step cycles of amplification (95C/15 sec, 61C/45 sec) where the fluorescence was automatically measured during PCR and the step for melting curve calculation (95C/1 min, 60C to 95C in 0,5C increments for 10 sec). As internal controls of amplification, primers for the following reference genes were used for all cDNA samples: Ef1-alfa (elongation factor 1-alfa), CAC (Clathrin adaptor complex), GAPDH (glyceraldehyde 3phosphate dehydrogenase) and UBI (ubiquitin C). The genes that were measured with this process were:
Contig 01240 16469 19273 20346 49969 50173 Primer name PIN_01240 PIN_16469 PIN_19273 PIN_20346 PIN_49969 PIN_50173 Sequence (5' --- 3') F R F R F R F R F R F R CCATCTTCTGGATTGGCCAAGC TCTGAGGCTCCCCACGTACAAAG CGGCTATTCCTTTCGGACCA CATCGTAACCTCCGACTTTCCA ATATGCCCGCGTTCACAAGG GGTCAGATTCTCCTTCGCAAACA AGCGCTGATGGAACTTTCATTT CATCAATGGAATCATCATTGTGC CCCGGATTGGTTAAGGGTAAA GAGCGCGCACTAACCATACG TTTGGGTGAAGAAATGGGAGGA TGGGCATGGAACGTCGATAA Product (bp) 116 117 121 128 101 101 PI type Proteinase Inhibitor Type II Kunitz-type protease Protease Inhibitor Type IIb Serine Protease Inhibitor Serine Protease Inhibitor Cysteine Protease Inhibitor

2.8. Processing data

The program LinRegPCR was used to calculate quantification cycle (Cq) and primer average efficiencies (E) from raw data exported from the iCycler. Relative quantity (RQ) of template in each sample was calculated as: RQ = 1/(E^Cq). For the analysis of expression stabilities of references genes and calculating normalisation factors (NFs) for all cDNA samples RQ values were used in the geNorm software. The M value for each reference gene is the average pairwise variation for that gene with all the other tested control genes (VanGuilder et al., 2008). Stepwise exclusion of the gene with the highest M value allows ranking of the tested genes according to their expression stability. According to this UBI gene was discarded for the analysis and NFs calculated from the other three reference genes was used for normalizing the expression (RQ) of PIN genes: NRQ=RQ/NF. The NRQ of each sample was then rescaled to the average NRQ of control treatment (normal watering and without CPB) of one accession. These rescaled NRQs were used to compare PIN gene expressions between treatments and accessions. For statistical analysis, a log2 transformation of the rescaled NRQ was done to homogenize the replicate variance.

2.9. Measurements of eaten leaf area

The procedure has been the same for measuring the area, both in leaves 6 and 7 treated by insects, as in the leaf number 8 of all plants, to quantify the amount of leaf the herbivores ate. The pictures were taken with a Canon camera (Figure 5). At the background, a centimetre scale was added. To process them, all the pictures has been made black and white, cleaning all the shadows, and the perimeter has been completed for each leaf when has been necessary using Adobe Photoshop CS4. Then, the scale

15

was set in each of the pictures. And they were made binary so the total area and the % of eaten leaf area could be measure using the ImageJ64.

Figure 5. Example of pictures procedure. A is the original one and B is after all the processes previous to measure the eaten leaf area.

2.10. Statistics
The effect of treatments (drought, waterlogging and intermediate watering), accessions (Voorne, Goeree and Limburg) and insect performance on the measured traits is tested using a factorial ANOVA (to find the interacting effect between them) using SPSS.

16

3. Results
3.1. Water volumetric percentages
Before to start herbivore induction, plants were submit to three different treatments related to water stress (Drought, Control and Waterlogged). In the plants of drought treatment, measurement of volumetric percentage of the soil should be done control for a dry condition after some days without watering. The water percentage was decreasing at the same level in general; lower ones were corrected with the addition of 25-50 mL water (Table 3).

1 3 J a nu a ry1 6 J a nu a ry A c c es s io n 73 T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 3 4,4 3 6,0 4 0,4 3 3,1 3 8,5 3 3,3 3 5,8 3 3,0 3 1,2* 3 2,3 3 4,8 3 0,7* 2 8,3* 3 4,5 3 6,4 3 3,4 3 2,9 3 0,4* 3 2,3 3 9,6 4 2,2 3 4,07 1 7,4** 2 2,6 2 2,9 1 6,8** 2 3,5 1 9,5* 2 5,6 2 2,5 2 1,0 1 7,4** 2 0,9 2 2,2 1 7,9** 2 3,2 1 8,2* 1 8,3* 2 3,6 2 2,5 2 1,5 2 9,3 2 7,7 2 2,43 A c c es sion 31 2 T 5 1 T52 T53 T54 T55 T56 T57 T58 T59 T60

1 3 J a nu a ry6 J a nu a ry 1 3 4,5 3 2,8 3 1,3* 3 3,7 3 2,7 3 2,6 3 5,1 3 5,6 3 4,7 3 8,2 2 2,3 2 3,7 2 3,6 2 2,0 2 0,8 2 0,9 2 5,6 2 5,7 2 1,5 2 3,8 2 2,9

AVE R A G E A c c es s io n 20 2 T 8 1 T82 T83 T84 T85 T86 T87 T88 T89 T90 AVE R A G E

A V E R A G E 3 4,1

C o ntrol C o ntrol C o ntrol C o ntrol C o ntrol

1 2 3 4 5

4 5,4 5 0,0 4 0,0 4 6,4 4 3,5 45

AVE R A G E

Table 3. Measurements of water potential in the plants of water stress treatment on the fourth day after stop watering them, and three days after treatment begins, compared with Control measurements. * = add 50 mL ** = add 100 mL

As can be seen on the table, there is a clear different between the percentage of the control watering and the plants under dry treatment, since they are 30% lower the first day and approximately 50% lower on the second day of measurement. Whereby, can be ensure that plants were under a strong drought stress at the moment to proceed with induction by insect.

3.2. Efficiency of conversion of ingested food (mg weight gain per cm2 leaf consumed) 17

The efficiency of the insects feeding on the leaves analysed in each one of the accessions, showed that CPB larvae feeding leaf 6 always had significantly higher efficiencies compared with leaf 7 (Figure 6). CPS feeding on plants exposed to flooding and drought treatments showed a lower efficiency but without significant differences between treatments. Neither between different accessions there were differences.

Figure 6. Mean insect efficiency ( standar deviation) in the three different accessions of Solanum dulcamara comparing leaf 6 and 7 subjected to different treatments.

According to Figure 6, in all the graphics there is a tendency to have less efficiency in insects feeding in plants with both, drought or waterlogged stresses.

18

Furthermore, we cannot infer a clear difference in efficiency when we compare plants that have previously had treatment with the insect and plants that do not (Figure 7). Even between different treatments within each accession we see no difference.

Figure 7. Mean insect efficiency ( standar deviation) in the three different accessions of Solanum dulcamara comparing plants previously treated with the insect Colorado potato beetle, and plants that have never experienced the insect attack.

3.3. PIN Gene expression

19

The expression levels for the six different PIN genes that have been tested in Solanum dulcamara are showed in the Figures 8, 9, 10, 11, 12 and 13. For each gene, the expression level for each treatment has been compared with the control treatment without herbivore induction of accession 73 so it can be seen how many times genes are expressed more or less comparing between accessions. The main trend that can be found is looking at the accession 73. For all the genes except PIN 49969, we can see clearly that there is a tendency to increase gene expression under flooding treatment.

3.3.1. PIN 40
Even though it is not significant between treatments, Figure 8 shows that for all the accessions there is a clearly higher expression of this gene in flooding treatment with CPB induction. Therefore there is a tendency for the control, as in the drought treatment at a slightly higher expression in the case of untreated plants with insect induction.

Figure 8. Effect of different water treatments and the feeding of the Colorado potato beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation

3.3.2. PIN 16469

20

There seems to be differences between Accession 73 and the other two. There is a high expression of this gene in accession 312 during drought treatment and insect induction, compared with accession 73 and 202 in the same treatment, although these differences were not significant. Furthermore, there is a high level of gene expression for flooding treatment, again for all the accessions. But in Accessions 312 and 202, this is less clear since the expression without insect induction is also enhanced.

Figure 9. Effect of different water treatments and the feeding of the Colorado potato

beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation

3.3.3. PIN 19273

21

The PI19273 gene is slightly expressed in all conditions. In Accession 73, gene expression differences between CPB induced plants and not subjected to the previous attack by the insect are barely perceptible, as well as differences between Control and Drought stress. In Flooding treatment, gene expression is slightly higher than drought treatment. For the Accession 312, gene expression levels in both drought and flooding treatments after induction by the insect are lower than in the control situation. In Accession 202, we could affirm that levels of gene expression are significantly different between flooding treatment and the others. However, we do not see differences between plants with insect induction and those without.

Figure 10. Effect of different water treatments and the feeding of the Colorado potato

beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation

3.3.4. PIN 20346

22

For this gene, each Accession has a very different expression pattern for each treatment. In accessions 73 there is a clear and high difference of expression in flooding treatment of almost 35 times more than control expression. Even though the error bar (SE) is large, this is an evident tendency. In Accession 312 the expressions in all the treatments are too low compared with the control situation. Under all watering regimes, gene expression level of Accession 202 is up regulated after herbivore feeding. But in this accession the gene expression under treatment is lower than in the control situation with CPB induction.

Figure 11. Effect of different water treatments and the feeding of the Colorado potato

beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation.

3.3.5. PIN 49969

23

For Accessions 73 and 312 although there is a small increase in expression after induction with the insect, the gene expression levels in each water treatment is lower than the control situation without insect induction. This effect is much more evident in the Accession 73, where the control after insect attack and Drought treatment, levels of expression are too low to be considered (Figure 12). In contrast, in the Accession 202, we can see a clear trend in the increased expression after induction with the insect. The expression has a similar trend in response to every treatment, without clear differences between control and flooding treatment.

Figure 12. Effect of different water treatments and the feeding of the Colorado potato

beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation.

3.3.6. PIN 50173

24

There are very different patterns depending on the Accession (Figure 13). For the Accession 73 we can find the same pattern of expression as in some previous genes. In plants that have previously been subjected to the herbivore induction, expression is increased for all the treatments. Even with a large variation, there is a very marked increase in the case of plants under flooding treatment with the insect attack compared with the flooding treatment without insect induction. For Accession 312, the sharp increase is mainly in the case of Drought treatment, with a really high level of expression even without significant differences. For flooding treatment the trend can be observed is the increased expression in the plants that are not induced by insect attack compared with the ones with insect induction. And finally, in Accession 202 we can see the completely opposite response of the Accession 73. There is an increased gene expression in plants with previous insect induction, compared with the ones without insect induction in case of flooding treatment.

Figure 13. Effect of different water treatments and the feeding of the Colorado potato

beetle in different accessions of Solanum dulcamara (mean fold changes in gene expression levels compared with the control treatment). The error bar means standard error for each situation.

4. Discussion
25

The following study was carried out to find possible interactions between plant responses to water stresses and the resistance to the herbivore Colorado potato beetle in Solanum dulcamara. For this purpose, we analysed, on one side the insect efficiency of feeding on the plant, and on the other, the induction of defence through measuring the level of expression of various genes of protease inhibitors and how they are affected by different water stress situations.

4.1 Conclusions 4.1.1 Insect efficiency

Insects have lower efficiency on the second day feeding on the plant; this is an expected response according to our arguments. In response to attack by insects, the plant produces a group of compounds to defend them, including PIs (Ryan, 1990). This PIs induce the inhibition of proteases present in insect guts and cause a reduction in the availability of amino acids necessary for their growth and development (Lawrence and Koundal, 2002). Thus, the second day efficiency of insects was lower due to the action of the defences of the plant that have previously been activated. However, in the experiment conducted with the leaf number 8 was not found significant differences between those plants that had been previously induced by insect and those without. This could be because when using a specialist insect, such as Colorado potato beetle, they can be adapted to the plant defence responses in different ways. For example by overproducing PI-sensitive proteases (De Leo et al. 1999), and/or upregulating the expression of proteases that are insensitive to the PIs produced by that plant (Cloutier et al. 2011), or inducing the production of PI-degrading enzymes (Zhu-Salzman et al. 2003). This difference in results between the two experiments may indicate that the decrease in efficiency in insects in the leaf 7 of the first experiment could not be due to the activation of plant defences, but different reasons. More likely is that since the experiment on leaf 8 shows more variation, the difference is due to incorrect set up of the experiment (such as lack of homogeneity in the selection of the insect).

4.1.2 Hypothesis 1: drought increases direct defences

Since we can state that the plants show drought stress at the moment of insect induction without any doubt, it was expected that these plants positively regulated defence-related genes, due to stimulation of JA-mediated enhancement of ABA (Thaler and Bostock 2004). But according to the results, PI levels are unaffected in plants under water stress. This could be because of the varied and numerous methodological problems that could happen in the present study, as discussed in section 6.2 No differences can be seen in the efficiency of the insects fed on water stressed plants. It would be expected that plants subjected to this treatment would have negatively affected the insects. Even when the Colorado potato beetle is a specialist for this plant and is adapted to its defences, the adaptation appears to be incomplete. Numerous proteases of this herbivore have been shown to be sensitive to potato PIs and compensation for inhibited activity is only partial (Jongsma et al. 1997). Thus, our first hypothesis stating that plants under drought stress treatment will have increased expression of PIN genes, compared to the ones under control treatment, can not be confirmed in view of the results obtained. Further analysis would be required in the future to clarify.

4.1.3 Hypothesis 2: flooding decreases direct defences 26

Plants subjected to treatment with flooding should result in lower levels of PIs because of the antagonistic interaction between JA and ET (Rojo et al. 1999). However, gene level expression pattern of PIs in the results have not seen negatively regulated its expression level, even showed just the opposite in some cases. Because of that, this results are much more complex to analyse. Looking at the insect performance, in leaves 6 and 7 of some accessions, we can see a tendency to reduce efficiency in water-stressed plants (either by absence or default), when it would be expect to see an increase in efficiency on flooding treatment (Rojo et al. 1999). But we cannot see a clear significant difference in herbivore growth or the eaten leaf area they ate between this watering regime and the control. Trying to explain the causes of this, we refer back to methodological errors when performing the experiments, later explained in section 6.2. However, according to the results, our second hypothesis stating that plants under flooding treatment will have increased expression of PIN genes, compared to the ones under control treatment, would be rejected. A gain, to clarify this, more experiments will be needed in the future.

4.1.4 Differences between the Accessions

Differences between the accession 312 (population of Goeree) and the accession 202 (population of Limburg), that are common populations in dry environment, and the accession 73 (population of Voorne), more habituated to a humid environment, are not very important as would be expected at first, since they show different genotypes. However, it could be seen a very pronounced tendency to increase expression of PIs in conditions of flooding in the population of Voorne, tendency that is not so clear in the other two accessions. This population used to wet conditions, was expected to perform best under that flooding conditions with a lower impact of this treatment in the production of PIs, which is just the opposite to these results. By contrast, in the populations adapted to the absence of water, they should have shown a greater impact on the defences as a result of treatment with excess water, and in such cases the evidence is much lower. This unspecific response of different accessions may be due to the condition in which these plants were at the time of the assay.

4.2 Discussion
In this study, in which we compared the relationship between inductions of defences against herbivores under different water stress in the plant, have been found results that, not only not confirm our hypothesis, but also provide little information to help us understand how does this mechanism works. This is why these experiments should be repeated taking into account the possible errors made in an attempt to obtain more reliable and concrete results. In most cases, for the PIs analysis, in the results we cannot see an increase in gene expression upon induction with the insect and this does not correspond to expectations. These results may be due to errors during the herbivore induction of the plants. The size and stage of development of all larvae was not homogeneous at the time of induction. Due to the shortage and late growth of the insects we were forced to use larvae with different sizes, especially in the experiment on leaf 8. Furthermore, the experiment may need a higher induction to get a clearer answer. For example, by using two different insects at the same time in different plant leaves instead of just one, or keeping them longer feeding on the plant. Something else to be considered is that due to the methodology and the large number of insects, there are variations in time of putting the beetles on the leaves and this makes that herbivores are not feeding accurately the same time on them. The possibility of limiting these fluctuations may reduce standard errors and make the results even more reliable.

27

Since Solanum dulcamara is a plant that is easily adapted to different ecological environments, may be necessary in this case that the different watering treatments were established for a longer time before induction with insect to see more variations between them. We could also consider that the state of the plants at the moment of the induction was not the best. Because of transplanting them on different dates, many of them were growing at different rates. And it is known that the state of development of the plant affects the levels of production of protease inhibitors (Van Dam et al. 2001). Also, they were affected by numerous thrips in their leaves. These factors can stress the plants and produce a certain disturbance in the results. It is interesting to consider that, at first, the experiment was prepared for use a generalist herbivore (Spodoptera exigua) and other specialist (Colorado potato beetle) in order to compare results. But the lack of plants due to problems in the state of many of them, as previously discussed, together with low number of available S. exigua, prevented that the essay could take place with the generalist. Perform this entire essay with both herbivores, surely it would have provided more complete and interesting results to compare with each other. In the RNA extraction, were found difficulties to obtain contamination-free samples at sufficient concentration to perform the assay. This forced to perform numerous steps to clean the samples, in which the RNA could be damaged, affecting the subsequent measures of expression levels. Moreover, we may consider that this genes do not have a clear role in the defence response in Solanum dulcamara, or they are not the ones how are induced by CPB in this plant. To analyse this more accurately, we need a positive control for the PIN gene expression in Solanum dulcamara. A gene with a huge level of induces expression in this plant when is feeding by this insect. This could said as for sure that there is or there is not a methodology problem in the experiment performance. Finally, it should be noted that the process of collecting samples and taking pictures took a long time that may have skewed the results. As the plants were not collected in a random order, runs the risk that the time difference between them has affected the production of PI. It would be necessary to optimize this process so such fluctuations were reduced.

4.2.1. Recommendations for future studies

As a final clasp, and after dwelling on such an array of problems that are hindering an optimal functioning of the experimental essay, I must add, nevertheless, a brief promising reflection. Although the results are not very conclusive, these experiments stand as a starting point on the run towards a successful answer for the main question of this study. It is required a better set up of the insect feeding. It would be interesting to put the control plant feeding by the insect in different situations, and then, analyse the different gene expression of them. Like placing the insect on the leaf more time, or in more leaves. Treat plants with gaseous methyl jasmonate to obtain leaves with high-induced levels of proteinase inhibitors, and thus obtain a greater effect on the insects that can be more easily analysed. Another strategy to see direct and indirect effects on plant responses to insects is to use JA-deficient mutants plants to harvest them. Another interesting strategy to use for more in-depth analysis of the efficiency of insect feeding on the plant, it is to compare the growth of larvae feeding on leaf tissue obtained from wild type and transgenic plants, which contain an inducible promoter linked to the gene expression of specific protease inhibitors previously selected. Might also be analysed the levels of protease inhibitors from the protein point of view, measuring inhibitory enzyme levels to know which are present and at what levels. Furthermore, it would be interesting to know the degree of inhibition of proteinase activity in insects extracts.

28

Such molecular analysis more accurate could help us learn in more detail the routes of interaction among the different hormones induced in response to these stresses and the respective levels of protease inhibitors produced.

5. Literature
29

Barrette-Ng, I., Kenneth K.-S. , Cherney, M. M., Pearce, G., Ryan, C. A. and James, M. (1985). Structural Basis of Inhibition Revealed by a 1:2 Complex of the Two-headed Tomato Inhibitor-II and Subtilisin Carlsberg, The Journal of Biological Chemistry, 278, 24062-24071. Belhadja, A., Telefa, N., Saignea, C., Cluzeta, S., Barrieub, F., Hamdib, S. and Mrillon, J.M. (2007). Effect of methyl jasmonate in combination with carbohydrates on gene expression of PR proteins, stilbene and anthocyanin accumulation in grapevine cell cultures, Plant Physiology and Biochemistry, 46(4), Pages 493499. Cipollini, D., Enright, S., Traw, M.B. and Bergelson, J. (2004). Salicylic acid inhibits jasmonic acidinduced resistance of arabidopsis thaliana to spodoptera exigua. Molecular Ecology, 13(6), 1643-1653. Clough, J.M., Alberte, R.S., Teeri, J.A. (1979) Photosynthetic Adaptation of Solanum dulcamara L. to Sun and Shade Environments. Plant Physiology, 64, 25-30. Creelman, R.A., and Mullet, J.E. (1997). Biosynthesis and action of jasmonates in plants. Annual Review of Plant Physiology and Plant Molecular Biology, 48, 355-381. Ferro, D.N., Tuttle, A.F., Weber, D.C. (1991) Ovipositional and Flight Behavior of Overwintered Colorado Potato Beetle. Environmental Entomology, 20 (5), 1309-1314. Fukao, T. and Bailey-Serres, J. (2008). Submergence tolerance conferred by Sub1A is mediated by SLR1 and SLRL1 restriction of gibberellin responses in rice, PNAS, 105 (43), 16814-16819. Graham, J. S., Pearce, G., Merryweather, J., Titani, K., Ericsson, L. and Ryan, C. A. (1985). Wound-induced proteinase inhibitors from tomato leaves. I. The cDNA-deduced primary structure of pre-inhibitor I and its post-translational processing, The Journal of Biological Chemistry, 260, 6555-6560. Greenblatt, H. M., Ryan, C.A. and James, M. (1988). Structure of the complex of Streptomyces griseus proteinase B and polypeptide chymotrypsin inhibitor-1 from Russet Burbank potato tubers at 2.1 resolution, Journal of Molecular Biology, 205 (1), 201228. Gruden, K., trukelj, B., Ravnikar, M., Poljak-Prijatelj, M., Mavri, I., Brzin, J., Pungerar, J. and Kregar, I. (1997). Potato cysteine proteinase inhibitor gene family: molecular cloning, characterisation and immunocytochemical localisation studies, Plant Molecular Biology, 34 (2), 317-323. Grudena, K., trukelja, B., Popovia, T., Lenaria, B., Beveca, T., Brzina, J., Kregara, I., Herzog-Velikonjac, J., Stiekemab, W. J., Boschb, D. and Jongsmab, M. A. (1998). The cysteine protease activity of Colorado potato beetle (Leptinotarsa decemlineata Say) guts, which is insensitive to potato protease inhibitors, is inhibited by thyroglobulin type-1 domain inhibitors, Insect Biochemistry and Molecular Biology, 28(8), 549560. Habib, H. and Majid, K. (2007). Plant protease inhibitors: a defense strategy in plants. Biotechnology and Molecular Biology Review, 2(3), 068-085. Harb,A., Krishnan, A., Ambavaram, M.R. and Pereira, A. (2010), Molecular and Physiological Analysis of Drought Stress in Arabidopsis Reveals Early Responses Leading to Acclimation in Plant Growth, Plant Physiology, 154, 12541271. Hartmann, T. and Ober, D. (2008). Defense by Pyrrolizidine Alkaloids: Developed by Plants and Recruited by Insects, Biomedical and Life Sciences, 10, 213-231. Keil, M. Sanchez-Serrano, J. Schell, J. and Willmitzer, L. (1986). Primary structure of a proteinase inhibitor II gene from potato (Solanum tuberosum), Nucleic Acids Research, 14 (14), 5641-5650. Kumara, P., Sharmaa, B., Bakshia, N. (2009) Biological activity of alkaloids from Solanum dulcamara L. Natural Product Research, 23 (8), 719-723. Laskowski Jr M, Qasim MA (1999). What can the structures of enzyme-inhibitor complexes tell us about the structures of enzyme substrate complexes? Biochemistry and Biophysics Acta, 1477, 324-337. Lawrence, P.K., Koundal, K.R. (2002). Plant protease inhibitors in control of phytophagous insects. Electronic Journal of Biotechnology, 5(1), 93-109. Lorenzo, O., Piqueras, R., Snchez-Serrano, J.J. and Solano, R. (2003). Ethylene Response Factor 1 Integrates Signals from Ethylene and Jasmonate Pathways in Plant Defense. The Plant Cell, 15, 165-178. Lorenzo, O., Chico, J.M., Snchez-Serrano, J.J. and Solano, R. (2004). JASMONATEINSENSITIVE1 Encodes a MYC Transcription Factor Essential to Discriminate between Different Jasmonate-Regulated Defense Responses in Arabidopsis, The Plant Cell, 16, 1938-1950.

30

Ortego, F., Novillo, C., Snchez-Serrano, J.J., Castaera, P. (2001). Physiological response of Colorado potato beetle and beet armyworm larvae to depletion of wound-inducible proteinase inhibitors in transgenic potato plants. Journal of Insect Physiology, 47, 1291-1300. Osbourn, A. (1996). Saponins and plant defence a soap story, Trends in Plant Science, 1(1), 49. Penninckx, I.A.M.A., Thomma, B.P.H.J., Buchala, A., Metraux, J.-P., Broekaert, W.F. (1998). Concomitant activation of jasmonate and ethylene response pathways is required for induction of a plant defensin. Plant Cell, 10, 2103-2113. Richardson, M. (1977). The proteinase inhibitors of plants and micro-organisms, Phytochemistry, 16(2), 159169. Seki, M., Umezawa, T., Urano, K., and Shinozaki, K. (2007). Regulatory metabolic networks in drought stress responses, Current Opinion in Plant Biology, 10, 296302. Thaler, J.S. and Bostock, R.M. (2004). Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology, 85, 4858. Tran, L. P., Urao, T., Qin, F., Maruyama, K., Kakimoto, T., Shinozaki, K. and YamaguchiShinozaki, K (2007). Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis, PNAS, 104 (51), 20623-20628. Van Dam, N.M., Horn, M., Mare, M. and Baldwin, I.T. (2001). Ontogeny Constrains Systemic Protease Inhibitor Response in Nicotiana attenuata, Journal of Chemical Ecology, 27 (3), 547-568. Van Guilder, H.D., Vrana, K.E., Willard M. Freeman, W.M. (2008). Twenty-five years of quantitative PCR for gene expression analysis, BioTechniques, 44, 619-626. Vetter, J. (2000). Plant cyanogenic glycosides, Toxicon, 38 (1), 1136. Viswanathan, D. V., Mc Nickle, G. and Thaler, J. S. (2008). Heterogeneity of plant phenotypes caused by herbivore-specific induced responses influences the spatial distribution of herbivores, Ecological Entomology, 33, 8694. Weber, D.C., Ferro, D.N. (1993). Distribution of overwintering Colorado potato beetle in and near Massachusetts potato fields, Entomologia Experimentalis et Applicata, 66, 191196. Zavala, J.A., Giri, A.P., Jongsma, M.A. and Baldwin, L.T. (2008). Digestive Duet: Midgut Digestive Proteinases of Manduca sexta Ingesting Nicotiana attenuata with Manipulated Trypsin Proteinase Inhibitor Expression, PLoS ONE, 3(4). Zhu, J.K (2002). Salt and Drought Stress Signal Transduction in Plants, Annu Rev Plant Biol., 53, 247273.

6. Acknowledgements
31

I would like to share some a few grateful words with the people that have helped me carry out this research study during the six months of this master internship, starting by both of the persons who have made this experience possible for me. To Nicole van Dam, thanks for giving me this possibility and believing in me to carry out all. To Duy Nguyen for his hospitality, his infinite helpfulness and patience with me, for his priceless point of view as a scientific researcher and for devoting his time and resources to make this project feasible and easier for me. I would also like to show my gratitude to all my fellow researchers of the Ecogenomics Department, for their hospitality and their valuable appreciations about my research. Finally, I would like to thank Conny Mooren, for her expert advice at the time of help me decide, as well as for her time and dedication, helping me to solve all bureaucratic problems. They all made this an important experience in my life.

32

33