TheNatureoftheGene,Alleles,andMutation Todaysquestions:Atthemolecularlevel,whatisa gene?Anallele?Amutation? I. Themolecularnatureofthegene II. Thecentraldogmaofmolecularbiology III.

Themolecularnatureofmutation

I. I

Themolecularnatureofthegene The molecular nature of the gene

Thecurrentdefinitionofthegene: g
-We're not really sure. -Genes are made of DNA. -"Blueprint of life". -A chromosome is one long DNA molecule.

Whatdoweknowaboutgenes? What do we know about genes? 1.GenesaremadeofDNA 1 Genes are made of DNA ATGTGTGTGG CC GTATGCTGG TATGCTC ATGTGTGTGGCCGTATGCTGGTATGCTC TACACACACC GG CTAA CGACC ATACGAG

(achromosomeisonelongDNAmolecule,wrappedaroundproteins)

2.Setsof3bases inDNAcanspecifyanaminoacida 2 Sets of 3 bases in DNA can specify an amino acida buildingblockofaprotein ATGTGTGTGG CC GTATGCTGG TATGCTC TACACACACC GG CTAA CGACC ATACGAG
Start Cysteine Valine Alanine Aspartic Cysteine Trypto Tyrosine Alanine acid phan

Whatdoweknowaboutgenes? 3.GenesincluderegionsthatcodeforRNAorprotein 3 Genes include regions that code for RNA or protein productsthatfunctioninthecell

4.aswellasregulatoryregions(involvedinturninggenes on,off,up,ordown) , , p, )

Theimportanceofregulatorysequences: 1. Musclecellsandnervecellscontainthesame chromosomes.Whyarethecellssodifferent? h Wh th ll diff t?

Same genes (and regulatory regions). But the regulatory regions regulate what genes are expressed and what aren't.

2. Dr.Freemanhasthegenesrequiredtomakeauterus. Whydoesnthehaveone?
Because of male-specific regulatory factors.

3. Inmanycases,theproteinsproducedbyhomologous h d db h l genesinchimpsandhumansareidenticalornearly identical.Whyarethetwospeciessodifferent? identical Why are the two species so different?
Key change in regulatory regions.

II.Thecentraldogmaofmolecularbiology II The central dogma of molecular biology DNA

mRNA

siRNA,tRNA, rRNA, snRNA, et al.

Protein
(enzymes,fibers, (enzymes fibers receptors,motors, pumps,channelsetc.)

Genes(DNA)representthegenotype ( ) h (g p ) p ProteinsandRNAs(geneproducts)representthe phenotype 1.Atthemolecularlevel,whatisthe geneforflower 1 At the molecular level what is the gene for flower color?
Coding + regulatory regions in DNA with a gene.

2.Atthemolecularlevel,whatisanallele? ,
Different in base sequences.

3.Whathappenstothegenotypeandphenotypeifthere isachangeinthesequenceofbasesinthecodingregion ofagene?

There will be a change in both the genotype (changes for sure)and phenotype (if the point mutation isn't silent).

4.Whathappenstothegenotypeandphenotypeifthere 4 What happens to the genotype and phenotype if there isachangeinthesequenceofbasesintheregulatory regionsofagene? g g
Genotype will change. But now a gene can be expressed more or less, leading to changes in a phenotype.

III.Themolecularbasisofmutation III The molecular basis of mutation A.Whenchromosomesreplicate,DNAiscopiedby p p y enzymes. Theenzymesmakemistakes,atrandom. The enzymes make mistakes at random 1.Whataretheconsequencesofthesemistakes, forthegenotype?
Changes the base sequence which changes the allele.

2.ManycopyingerrorschangetheDNAbasesequence, h h b andalsochangetheRNAorproteinproduct.
Mutation is change in DNA sequence.

Howdotheseerrorsaffectthephenotype?
The mutation changes the product (mRNA), the protein created may change which means that the phenotype might change.

Dotheseerrorscreatealleles? or an allele. Yes, they can create a new version of a gene,

3.SomecopyingerrorschangetheDNAbase h h b sequence,butdoNOTchangetheproteinproduct. Howdotheseerrorsaffectthephenotype?

Dotheseerrorscreatealleles?

B.Mistakesinmeiosiscanleadtoadoublingofthe k l d d bl f h numberofchromosomesorotherchangesin chromosomenumber(e.g.ifhomologs failtopullapart). chromosome number (e g if homologs fail to pull apart) g yp Dotheseerrorsaffectthegenotype?
Yes, because there are now more genes.

Dotheseerrorsaffectthephenotype?
Usually, like 21st extra chromosome is equal to Down Syndrome.

C.Damagefromultravioletradiationortoxic f l l d chemicalscanbreakchromosomes. Dothesechangesaffectthegenotype?

Dothesechangesaffectthephenotype?

Keydefinition(fromthereadingquiz): AmutationisanychangeinanorganismsDNA. A i i h i i DNA Why doesnt Lamarckian inheritance (acquired Whydoesn tLamarckianinheritance(acquired characters)work?
It doesn't change the DNA.