HelixClone

PCR Cloning Kit

Simple and Fast technique for Cloning

www.nanohelix.net

Contents
1. Kit Contents
1) 2) 3) Product Types of HelixCloneTM PCR Cloning Kit HelixCloneTM PCR Cloning Kit Reagents Contents of Competent Cell 3 3 3

2. Methods
1) 2) 3) 4) Introduction Preparation of PCR Product Setting up the Cloning Reaction - Procedure General Guidelines of Transformation - Chemical Transformation Method - Electroporation Method Analysis of Transformants Map of pHelix vector Control Reaction Factors Affecting Cloning Efficiency Ordering Information

4 4 4 5 6 7 7 7 8 9 10 11 12

5) 6) 7) 8) 9)

www.nanohelix.net

Co ontents

1) Product Types of HelixCloneTM PCR Cloning Kit

Product TA Cloning kit Blunt Cloning kit Size Cat. No. Contents
- pHelix vector - 6x Reaction Buffer - M13 F(-47) Primer - M13 R(-48) Primer - Control Insert DNA - DW

20 rx 20 rx

HCK-T HCK-B

2) HelixCloneTM PCR Cloning Kit Reagent

Contents Reagents & Concentration
1 mM DTT 1 mM EDTA 100 g/ml BSA 0.1% Triton X-100 50 mM Tris-HCl, pH7.4 (at 25) 10 ng/ l Plasmid DNA in 50% Glycerol 1.2 M NaCl, 0.06 M MgCl2 10 pmoles/l l / l 10 pmoles/l 20 ng/l in TE buffer (pH8.0)

Volume

pHelix TA vector or pHelix Blunt vector

20 l

6x Reaction Buffer M13 F( 47) P i F(-47) Primer M13 R(-48) Primer Control Insert DNA (720 bp) Distilled water

100 l 200 l l 200 l 20 l 1 ml

Primer sequence
Primer
M13 F(-47) primer M13 R(-48) primer

Sequence (53)
CGCCAGGGTTTTCCCAGTCACGA AGCGGATAACAATTTCACACAGGA

3) Contents of Competent Cell

Contents
E. coli DH5 pUC19 control DNA

Components
Chemically competent cell 10 pg/l in TE buffer (pH8 0) (pH8.0)

Volume
50 l x 21 ea 50 l

HelixCloneTM PCR Cloning Kit Handbook

Kit Contents t

1. Kit Contents

2. Method 2 M th d
1) Introduction
HelixCloneTM PCR Cloning Kit provides a fast and efficient one-step cloning strategy f di t i for direct insertion of 3A blunt-end l i t t ti f 3A-overhang or bl t d PCR h products into a plasmid vector without ligase. The pHelix vector is a linearlized DNA bound with topoisomerase I at 3-end of each strand. The pHelix vector contains a lethal gene (ccdB) fused to the C-terminus of the lacZ-ccdB gene fusion permitting growth of only positive recombinants upon transformation into E. coli. On the other hand, cells that contain non-recombinant vector are killed upon plating. So this vector allows direct selection of recombinants recombinants. LacZ fragment and insertion of a PCR product disrupts expression of fragment,

2) Preparation of PCR product

HelixCloneTM TA Cloning Kit is suitable to the cloning of PCR product with 3 A-overhang amplified by Taq DNA polymerase and HelixCloneTM Blunt Cloning Kit is suitable to the cloning of blunt-ended PCR product amplified by DNA polymerase with the proofreading function such as Pfu DNA polymerase.
Note : Dont add 5-phosphates to PCR primers. PCR product with 5-phosphate will not clone into pHelix vector.

PCR Reaction
Template DNA (10 ~ 100 ng) 10x PCR reaction buffer Each 10 mM dNTP Mix Forward Primer (10 pmoles/l) Reverse Primer (10 pmoles/l) DNA polymerase (2.5 unit/l) Distilled water Final reaction volume 1 l 5 l 1 l 1 l 1 l 0.5 l 40.5 l 50 l

HelixCloneTM PCR Cloning Kit Handbook

Introduction

Me ethod

Checking the PCR products

The quality and quantity of amplified PCR products are verified by agarose gel electrophoresis. Be sure you have a single discrete band of the correct size. size If you do not have a single discrete band we recommend that you single, band, follow the manufacturers recommendations for optimizing your PCR with the polymerase of your choice. Alternatively, you may gel-purify the desired products.

3) Cloning Reaction using HelixCloneTM PCR Cloning Kit

The inclusion of salt (200 mM NaCl, 10 mM MgCl2) in the cloning reaction using HelixCloneTM PCR Cloning Kit increases the number of transformants. Enough numbers of colony are obtained in only 5 minutes incubation time. But the extension of incubation time up to 20 minutes can also increase the number of transformants. Inclusion of salt prevents that topoisomerase I rebinds and potentially nick the DNA after ligating the p g g PCR product. The result is more intact molecules leading to higher transformation efficiencies. Note
When performing the transformation by electroporation, we recommend to use the 4 fold-diluted 6x reaction buffer for the prevention of arcing and increasing p g g of transformation efficiency.

HelixCloneTM PCR Cloning Kit Handbook

Cloning

Procedure
1. Mix the PCR products with the components of HelixCloneTM PCR Cloning Kit according to the following table.
Components
PCR product 6x Reaction Buffer Dilute Reaction Buffer pHelix TA or Blunt vector Distilled water Chemically competent cell Electrocompetent cell

0.5 ~ 4 l 1 l

0.5 ~ 4 l

1 l 1 l add to a total volume of 6 l

1 l add to a total volume of 6 l

Dilute Reaction Buffer : 4-fold diluted 6x Reaction Buffer

2. 2 Mix well and incubate at room temperature (23 ~ 25) for 5 ~ 20 minutes minutes. Note
The prolonged incubation up to 20 minutes will produce more colonies (transformants). For the cloning of PCR product above 1 kb size, we recommend to incubate the reaction for 20 ~ 30 min min.

Figure 1. Effect of various incubation time on the cloning efficiency.

Figure 2. Effect of various temperatures on the cloning efficiency.

Chloramphenicol resistant gene (720 bp) amplified with Taq DNA polymerase was used as control insert. Ligation mix (6 l) was used to transform E. coli DH5 cells. Transformation efficiency of DH5 : 1.0 X 108 colonies/ g pUC19 DNA.

3. Place the reaction mixture on ice and perform the transformation. p

HelixCloneTM PCR Cloning Kit Handbook

Procedure

4) Transformation into E. coli competent cell

Transformation using the chemically competent cell
1) Add 3 ~ 6 l of cloning reaction i 50 l of chemically competent cell and l f l i ti in l f h i ll t t ll d mix well. Note : Do not mix by pipetting 2) Incubate on ice for 5 ~ 30 minutes. 3) Heat-shock the cells at 42 for 30 seconds without shaking. 4) I Immediately t di t l transfer th t b t i f the tubes to ice. 5) Add 250 l of sterilized LB broth or S.O.C medium. 6) Incubate at 37 for 1 hour with shaking (200 rpm). ampicillin and/or kanamycin and incubate overnight at 37 37. 8) Pick ~ 10 colonies for analysis, such as colony PCR or plasmid isolation. (see Analyzing transformants page 8).

Transformation using the electrocompetent cell

1) Add 1 ~ 2 l of cloning reaction in 50 l of electrocompetent cell and mix well. Note : Do not mix by pipetting 2) Carefully transfer mixture to a pre-chilled cuvette. 3) Electroporate your samples according to your electroporation protocol. 4) Immediately add 250 l of sterilized LB broth or S.O.C medium. 5) Transfer the solution to a 15 ml culture tube and incubate at 37 for 1 hour with shaking (200 rpm). 6) S Spread 50 l of culture solution on an LB agar plate i l di th ampicillin d l f lt l ti l t including the i illi and/or kanamycin and incubate overnight at 37. 7) Pick ~ 10 colonies for analysis, such as colony PCR or plasmid isolation (see Analyzing transformants page 8).

HelixCloneTM PCR Cloning Kit Handbook

Transformat tion

7) Spread 150 ~ 300 l of culture solution on an LB agar plate including the

5) Analyzing transformants
Colonies or the isolated plasmid DNAs can be analyzed by following methods.

Restriction enzymatic digestion

1) Pick ~ 10 colonies and incubate in LB broth including the ampicillin (50 ~ 100 g/ml) and/or kanamaycin (50 g/ml) overnight at 37. 2) Isolate the plasmid DNA from the culture cell. 3) Cut the plasmid DNA with EcoRI or an appropriate restriction enzyme referred to the vector map.

Sequencing analysis
You may sequence the isolated plasmid DNA to confirm the correct clone. M13 F(-47) and M13 R(-48) primers can be used for the sequencing analysis of your insert DNA.

You may directly analyze positive transformants by PCR.

1) Pick one colony and mix in a PCR cocktail with M13 F(-47)/R(-48) or insert specific primer sets Dont forget to make a patch plate to preserve the colonies sets. Don t for further analysis. 2) Perform PCR reactions for 20 ~ 30 cycles. 3) Analyze the PCR product by agarose gel electrophoresis.

Long-term storage of transformants If you want to store the correct clone for a long time, you may prepare glycerol stock.
1) Streak the positive transformant on LB agar plate containing ampicillin (50 ~ 100 g/ml) and/or kanamycin (50 g/ml) and incubate overnight at 37. 2) Inoculate a single colony in 1 ~ 2 ml of LB broth containing ampicillin (50 ~ 100 g/ml) and/or kanamycin (50 g/ml). 3) Incubate overnight at 37 with shaking (200 rpm). 4) Mix well the 0.85 ml of culture with 0.15 ml of sterile glycerol in a cryotube. 5) Store at -80.
HelixCloneTM PCR Cloning Kit Handbook

Analyzing

Colony PCR analysis

6) Map of pHelix vector

pHelix TA

pHelix Blunt

pHelix vector map Comments for pHelix 3807 nucleotide

Lac promoter/operator : 95 216 95-216 M13 R(-48) Primer binding site : 186-209 LacZ ORF : 217-534 MCS, Multiple Cloning Sites : 234-357 M13 F(-47) Primer binding site : 401-423 ccdB ORF : 544-846 Kanr gene : 1057-1989 Ampr gene : 2007-2867 2007 2867 pUC origin : 3012-3685

HelixCloneTM PCR Cloning Kit Handbook

7) Control Reaction
pHelix control reaction
1) Set up pHelix control reaction according to the following table.
Reagent Distilled water 6x Reaction buffer Control insert DNA (20 ng/l) pHelix vector Final volume Vector only 4 l 1 l Vector + Control insert 3 l 1 l 1 l 1 l 6 l

1 l 6 l

2) Incubation at room temperature for 5 ~ 20 min. 3) Transform 3 ~ 6 l of each reaction into competent cell. 4) Spread 100 l of each transformation mix on an LB plate containing ampicillin and/or kanamycin. 5) Incubate overnight at 37.

Analyzing Results A l i R lt
There should be > 100 colonies on the Vector + Control insert plate, and 95% of the colonies should contain the 750 bp insert when analyzed by colony PCR and agarose gel electrophoresis (Figure 3).

Figure 3. The cloning efficiency of HelixCloneTM PCR Cloning Kit.

HelixCloneTM PCR Cloning Kit Handbook

10

Transformation Control
- pUC19 DNA is included to check the transformation efficiency. - Transform with 10 pg of the plasmid DNA per 50 l of competent cell protocol). (See transformation protocol) - Just before plating the transformation mix, dilute 10 l of the mix with 90 l of LB broth.
Cell Chemically competent cell Volume to Plate 10 l + 90 l LB broth Transformation Efficiency > 1 x 109 cfu/g pUC19 DNA

8) Factors Affecting Cloning Efficiency

Variables
Incomplete extension during PCR

Solutions
Be sure to include a final extension step of 7 to 30 minutes during PCR. Longer PCR products will need a longer extension time. HelixCloneTM PCR Cloning kit is optimized to cloning for 2 kb size of DNA. Large PCR products (>3 kb) may necessitate gel extraction. Reduce the amount of PCR Product. Product Smearing, multiple banding, primer-dimer artifacts may necessitate gel extraction.

Cloning large inserts (>3 kb) Excess PCR product

PCR cloning artifacts

Large PCR products (>3 kb) or smearing, multiple banding, primer-dimer artifacts affect the cloning efficiency of target DNA. We recommended to purify the PCR products using PureHelixTM Gel Extraction kit (Cat. No. GE50, GE200).

HelixCloneTM PCR Cloning Kit Handbook

11

Affecting Fa actors

9) Ordering Information
Product
TA cloning kit l i
HelixClone TA Cloning Kit HelixClone TA Cloning Pack 1 [TA Cloning Kit, Competent Cell ] HelixClone TA Cloning Pack 2 [TA Cloning Kit, LOP LB Agar Plate(Amp+, Kan+)] HelixClone TA Cloning Pack 3 [TA Cloning Kit, Competent Cell, LOP LB Agar Plate(Amp+, Kan+)]

Size

Cat. no.

20 rx 20 rx 20 rx 20 rx

HCK-T HCP1-T HCP2-T HCP3-T

Blunt cloning kit

HelixClone Blunt Cloning Kit HelixClone Blunt Cloning Pack 1 [TA Cloning Kit, Competent Cell ] HelixClone Blunt Cloning Pack 2 [TA Cloning Kit, LOP LB Agar Plate(Amp+, Kan+)] HelixClone Blunt Cloning Pack 3 [TA Cloning Kit, Competent Cell, LOP LB Agar Plate(Amp+, Kan+)]

20 rx 20 rx 20 rx 20 rx

HCK-B HCP1-B

HCP3-B

Components
HelixClone LOP LB Agar Plate (Amp+, Kan+) HelixClone LOP LB Agar Plate (Amp+, Kan+)

50 plates 200 plates

HLOP50 HLOP200

Related Product
Fast-n-Pure Plasmid Kit (Spin column based)
PureHelix Fast-n-Pure Plasmid Kit ver 2.0 PureHelix Fast-n-Pure Plasmid Kit ver 2.0

Size

Cat. no.

50 preps/kit 200 preps/kit

FPL50 FPL200

Gel Extraction Kit (Spin column based)

PureHelix Gel Extraction Kit PureHelix Gel Extraction Kit

50 preps/kit 200 preps/kit

GE50 GE200

PCR Purification Kit (Spin column based)

PureHelix PCR Purification Kit PureHelix PCR Purification Kit

50 preps/kit 200 preps/kit

PCR50 PCR200

HelixCloneTM PCR Cloning Kit Handbook

12

Ordering Information

HCP2-B

USA
NanoHelix USA, Inc. (Tel : +1-443-854-7102) 1952 Gallows Rd. Suite 110 Vienna, VA 22182

Korea
Head Office (Tel : +82-42-867-9055) #505 Daejeon Bioventure Town, 1662 Yuseong-Daero, Yuseong-Gu, Daejeon 305-811

International Distributor
Australia Canada China Egypt
: Evolve Life Science Pty Ltd : Omnibiosystems Inc. : Beijing Netlink Co., Ltd. : DELTA Trading & Development SAE

New Zealand : Evolve Life Science Pty Ltd Romania Singapore Taiwan Turkey Thailand UK & Ireland USA
: Redox Lab : Precision Technologies Pte. Ltd. : Gene Research Lab. Co. Ltd : Intron Healthcare Products Company : GIBTHAI CO., LTD : Bioquote Limited : Omnibiosystems Inc.

CV. Indonesia : CV Kristalindo Biolab

Israel Jordan Malaysia

: Talron Biotech LTD : Global for lab & Scientific supplies CO. LTD : NANO LIFE QUEST SDN. BHD.

www.nanohelix.net

Distributor

NanoHelix Co Ltd. Co., Ltd