Vaccine 28 (2010) 35403547

Contents lists available at ScienceDirect

Vaccine
journal homepage: www.elsevier.com/locate/vaccine

Production and efcacy of an Aeromonas hydrophila recombinant S-layer protein vaccine for sh
Saravanane Poobalane a, , Kim D. Thompson a , Lszl Ard b , Noel Verjan c , Hyun-Ja Han c , Galina Jeney b , Ikuo Hirono c , Takashi Aoki c , Alexandra Adams a
Institute of Aquaculture, University of Stirling, Stirling, FK9 4LA, UK Research Institute for Fisheries, Aquaculture and Irrigation, Anna liget 8, H-5540 Szarvas, Hungary Laboratory of Genome Science, Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato, Tokyo 108-8477, Japan
b c a

a r t i c l e

i n f o

a b s t r a c t
A recombinant protein for the S-layer protein of Aeromonas hydrophila was produced and its ability to protect common carp Cyprinus carpio L. against six virulent isolates of A. hydrophila was assessed. A group of 120 carp (3040 g) were vaccinated intra-peritoneally with 0.1 ml of adjuvanted vaccine (30 g protein per sh). Another group of 120 carp were injected with 0.1 ml of PBS-adjuvant mixture to serve as controls. Twenty sh from each group were challenged with each one of six virulent isolates of A. hydrophila 35 days post-vaccination. The sh were maintained in 12 separate tanks before terminating the experiment at 16 days post-challenge. The relative percentage survival (RPS) for the six isolates of A. hydrophila ranged from 56 to 87%. The difference in survival rate of sh challenged with four of the isolates was statistically signicant in vaccinated sh compared to control sh, when analysed using a Chi-square test. The results of the study suggest that the recombinant S-layer protein of A. hydrophila could be useful as a vaccine antigen to protect sh against different isolates of this pathogenic bacterium. 2010 Elsevier Ltd. All rights reserved.

Article history: Received 25 November 2009 Received in revised form 6 March 2010 Accepted 8 March 2010 Available online 20 March 2010 Keywords: Aeromonas hydrophila Recombinant S-layer protein vaccine Efcacy testing Common carp

1. Introduction Aeromonas hydrophila is an important sh pathogen in aquaculture systems, and millions of dollars are estimated to be lost per annum due to the diseases caused by this bacterium [1]. The pathogen is responsible for causing a number of different diseases including motile Aeromonas septicaemia [2]. The symptoms of A. hydrophila infections include swelling of tissues, dropsy, red sores, necrosis, ulceration and haemorrhagic septicaemia [3,4], and the pathogen can affect a variety of sh species including common carp [3], cat sh [5], tilapia [6], eel [7] and goldsh [8]. The use of vaccines in the aquaculture industry has been important in reducing economic losses which occur as a result of disease [9,10] and in the reduction in use of antibiotics [11]. A number of different types of vaccines have been developed against A. hydrophila for use in sh, such as whole cell (WC) [12,13], outer membrane protein (OMP) [14], extracellular products (ECPs), lipopolysaccharide (LPS) preparations [15] and also biolms [16]. Although these different preparations have provided varying degrees of protec-

Corresponding author. Tel.: +44 1786467994; fax: +44 1786472133. E-mail address: saroandlogu@yahoo.com (S. Poobalane). 0264-410X/$ see front matter 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2010.03.011

tion in sh, there is still no commercial vaccine available for A. hydrophila [1]. This could be due to an inability of these vaccines to cross-protect against different isolates of A. hydrophila. This bacterium is very heterogeneous in nature (both biochemically and serologically), and this has been one of the greatest obstacles in developing an effective vaccine against A. hydrophila [17]. It might be possible to overcome this problem if a common antigen(s) could be identied among different isolates of A. hydrophila that could serve as a vaccine candidate(s) [13]. Proteomics combined with Western blotting (i.e. immunoproteomics) is a useful tool for identifying proteins of interest for vaccine development [18]. Separation and characterisation of complex mixtures of proteins by two-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis (2D SDS-PAGE) provides information about the expression of proteins by bacterial pathogens [19]. Further analysis by Western blotting using serum from infected sh, or from sh which have recovered from the disease, allows identication of antigens recognised by the immune system of the infected host [19]. Together, these two techniques can help identify potential candidates for vaccine development [20]. Although it is possible to identify a variety of immunogenic antigens on the bacterium using this method, the antigen must also be protective against a wide range of A. hydrophila isolates in order

S. Poobalane et al. / Vaccine 28 (2010) 35403547

3541

to be considered as a suitable vaccine candidate [21]. It is possible to evaluate the level of protection elicited by a target antigen by vaccinating the sh with the antigen and then subsequently experimentally infecting the sh with live pathogen and establishing the level of survival in vaccinated sh [22]. Another important factor in vaccine development is the ability to produce sufcient quantities of the protective proteins for commercialisation of the vaccine. Researchers are now using recombinant DNA technology to develop protein vaccines because it provides a means of economically producing sufcient quantities of the immunoprotective antigen [23,24]. Such vaccines have enormous potential in the aquaculture industry as they provide an alternative approach to traditional formalin-killed WC vaccines, which are not always efcacious, and they are safe compared to live attenuated bacteria used in vaccines which can possibly revert to becoming pathogenic [25]. Recombinant protein vaccines have been reported to confer protection against a variety of human and animal pathogens (Yersinia pestis [26], rabies virus [27], Plasmodium falciparum [28]) including sh (Ichthyophthirius multiliis [29], Piscirickettsia salmonis [23]). We previously examined the differential expression of cellular proteins (WC and OMP) and ECPs of six isolates (four virulent and two avirulent) of A. hydrophila, cultured either in vitro in tryptone soy broth or in vivo in dialysis tubing implanted within the peritoneal cavity of common carp [30]. Using 1D SDS-PAGE of WC, OMP and ECP preparations and 2D SDS-PAGE of the WC preparation, unique and up-regulated proteins were observed in bacteria grown in vivo. In a subsequent study, common carp were infected with the same six isolates of A. hydrophila in order to obtain antibodies elicited by the sh against proteins of various bacterial isolates expressed in vivo during infection [31]. The immune-recognition pattern of these antibodies against WC, OMP and ECP preparations of the six isolates grown either in vitro or in vivo was compared by the Western blot analysis. A common antigen found on all the isolates at around 50 kDa, was identied as an S-layer protein by MALDI TOF mass spectrometry. The aim of the present study was to produce the S-layer protein of A. hydrophila by recombinant technology to ensure sufcient quantity of the protein for a vaccination trial to assess the level of protection elicited by the recombinant protein, and to verify if this recombinant protein was capable of cross-protecting against different isolates of A. hydrophila. 2. Materials and methods 2.1. Recombinant S-layer protein production Recombinant S-layer protein of A. hydrophila was produced in order to have sufcient protein for a vaccination trial. 2.1.1. Extraction of DNA from A. hydrophila A. hydrophila isolate T4 was grown overnight according to Poobalane et al. [30] and centrifuged at 5000 g for 5 min at 4 C. The pellets were resuspended in 567 l Tris ethylenediaminetetraacetic acid (EDTA) (TE) buffer (10 mM TrisCl and 1 mM EDTA, pH 8), 30 l of 10% (w/v) SDS and 3 l of 20 mg ml1 proteinase K. The bacteria were thoroughly mixed and incubated for 1 h at 37 C before adding 100 l of 5 M NaCl. The pellets were mixed again and incubated for 10 min at 65 C after adding 80 l cetyltrimethylammonium bromide (CTAB) in NaCl solution (10%, v/v, CTAB in 0.7 M NaCl). The DNA was extracted from the sample with an equal volume of chloroform: isoamyl alcohol (24:1 ratio) (780 l). The tube was inverted a couple of times and centrifuged at 5000 g for 5 min at 4 C. The aqueous phase was transferred to a new tube and extracted with phenol: chloroform: isoamyl alcohol (25:24:1 ratio). The contents of the tube was thoroughly mixed and centrifuged

at 5000 g for 10 min at 2022 C before transferring the aqueous phase to a new tube. The DNA was precipitated with an equal volume of isopropanol. The contents of the tube were then thoroughly mixed by inverting the tube a couple of times and centrifuged at 5000 g for 10 min at 4 C. The precipitate was washed with 70% ethanol by centrifuging at 5000 g for 10 min at 4 C. The supernatant was removed and the pellets were briey dried at 2022 C for 10 min. The pellets were resuspended in 100 l TE buffer and stored at 20 C until used. 2.1.2. Polymerase chain reaction (PCR) of A. hydrophila S-layer protein gene Specic primers were designed to amplify the S-layer protein gene based on the DNA sequence data for the S-layer protein of A. hydrophila published by Thomas and Trust [32]. Restriction sites NcoI and BglII were added to the forward (5 ccatgggagttaatctggacactggtgc 3 ) and reverse (3 gacttgtggtacttgcgtaagtctaga 5 ) primers, respectively, to assist its cloning into the expression vector pQE 60 (Qiagen, Tokyo, Japan). The PCR mixture, composed of genomic DNA (3 l containing 50 ng), the forward and reverse primers (2 l containing 200 pmol), dNTP (5 l containing 200 M), MgCl2 buffer (4 l containing 1 mM), Taq DNA polymerase (0.5 l) and TE buffer, was prepared for a 40 l reaction. The DNA was amplied with 32 cycles using the following conditions: preheating to 95 C for 5 min, denaturation at 95 C for 30 s, annealing at 55 C for 30 s, elongation at 72 C for 1 min and a nal elongation step at 72 C for 5 min. 2.1.3. Cloning of the S-layer protein gene The PCR products were run on a 1% agarose gel for 30 min at 100 V. The target bands were identied under ultraviolet (UV) light, excised from the gel and cut into small pieces. The DNA was extracted from the gel using a DNA purication kit (GE Life Science, Buckinghamshire, UK). Digestion of the PCR products and vector (pQE 60) were performed using restriction enzymes NcoI and BglII. The digested PCR products and the vector were run on an agarose gel and puried as described above, before ligating them together using ligation high, T4 DNA ligase enzyme (Cosmo Bio, Tokyo, Japan). The pQE 60 vector, carrying the amplied S-layer protein gene of A. hydrophila, was transformed into Escherichia coli, M15 (Quiagen, Tokyo, Japan). The bacteria were incubated in SOC medium (SigmaAldrich, Dorset, UK) at 37 C for 1 h with vigorous shaking. The pellets were centrifuged at 2000 g for 3 min and resuspended in 2 yeast tryptone broth (2YTB). The cells were grown on Luria Bertani (LB) agar plates containing ampicillin (100 g ml1 ) and kanamycin (25 g ml1 ). 2.1.4. Expression and purication of the recombinant S-layer protein in E. coli The positive clones containing the S-layer protein gene, were inoculated into LB broth containing antibiotics (ampicillin and kanamycin), and incubated overnight at 37 C. The culture was transferred into fresh LB broth (1:9 ratio, v/v) containing antibiotics and cultured at 37 C with vigorous shaking. The absorbance of the culture was measured every hour at 600 nm until it reached 0.6, after which, the culture was induced to express the recombinant protein by adding 1 mM isopropyl- -thiogalactoside (IPTG). After growing the bacteria for 4 h, the bacterial pellets were harvested at 4000 g for 30 min at 4 C. The pellets were resuspended in phosphate buffered saline (PBS: 0.02 M phosphate and 0.15 M NaCl) and stored at 80 C. The bacterial pellet was subjected to three rounds of freezethawing before resuspending in sterile PBS and sonicating 60 times at 150 W for 20 s with 10 s intervals. After sonication, the soluble (native protein) and insoluble materials (inclusion bodies) were

3542

S. Poobalane et al. / Vaccine 28 (2010) 35403547

separated by centrifugation at 4000 g for 30 min at 4 C. Inclusion bodies were solubilised in denaturing solution (8 M urea, 0.1% (w/v) SDS and 100 mM TrisHCl) with 10 mM imidazole. The pQE 60 vector used for cloning the S-layer protein gene has 6 repeated sets of DNA coding for amino acid, histidine, which will also be expressed by attaching with the protein encodes for the insert. The histidine-tag was used to assist in separating the S-layer protein from the other proteins of the E. coli. Nickel beads (Ni Sepharose 6 fast ow, Amersham Bioscience) were added to the inclusion bodies to bind the histidine-tag present in the proteins. The beads were poured into a column (XK 16/20 empty lab scale column, Amersham BioScience) and washed three times with 20 mM wash buffer (Imidazole 20 mM, NaH2 PO4 50 mM and NaCl 300 mM) pH 8. The proteins were eluted from the beads with elution buffer (imidazole 250 mM, NaH2 P04 50 mM and NaCl 300 mM) pH 8.5. The beads in the column were washed again before loading the soluble protein mixed with imidazole (10 mM), and the protein was eluted after washing as described above. The eluted protein was concentrated using a Millipore membrane (10,000 MW cut-off, Amicon). The concentration of the protein was measured using a Pierce protein determination kit (Pierce ScienticCo., Rockford, USA) after dialysing the protein overnight in sterile PBS using seamless cellulose tubing (12,000 MW cut-off, Union Carbide Corporation, Tokyo, Japan). The WC preparation of recombinant E. coli with and without IPTG induction, and the recombinant S-layer protein preparation were separated on a 12% SDS-PAGE and Western blot was then performed according to Poobalane [31] with modications using an anti-histidine-tag antibody, which can bind to the histidinetag attached to the S-layer protein. Briey, after electroblotting the gels onto a nitrocellulose membrane (ATTO Co., Tokyo, Japan), the membranes were blocked with casein, and incubated with an anti-histidine-tag antibody (GE life science, Buckinghamshire, UK) diluted 1:6000 in TBS for 1 h. Mouse anti-rabbit conjugated to IgGalkaline phosphatase (Promega, Madison WI, USA) was used at a concentration of 1:7500 and incubated for 1 h. The reaction was developed using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP-NBT) alkaline phosphatase substrate (1 tablet dissolved in 10 ml of double distilled water, SigmaAldrich Co, St. Louis, MO, USA). 2.2. Vaccination of common carp with recombinant S-layer protein 2.2.1. Vaccination The recombinant S-layer protein of A. hydrophila, prepared above, was diluted in PBS and mixed with montanide adjuvant (Intervet Schering-Plough Aquaculture, Saffron Walden, UK) at a ratio of 30:70 (v/v) to give a nal antigen concentration of 300 g ml1 . PBS was mixed with the adjuvant at the same ratio as the antigen to serve as a negative control. Mixing was carried out by vortexing until the antigen was emulsied, and it was then stored overnight at 4 C to ensure that the emulsion was stable. Common carp, weighing 3040 g, were obtained from the indoor sh culture system of Research Institute for Fisheries, Aquaculture and Irrigation, Hungary. The sh were maintained in a breglass tank in an indoor aquarium at a water temperature of 2022 C. The tanks were supplied with water, which was passed through a biological recirculatory system and ultraviolet (UV) irradiation. The sh were anaesthetised according to Poobalane et al. [30] before start vaccinating them. One hundred and twenty common carp (3040 g) were vaccinated intra-peritoneally (IP) with 0.1 ml of the vaccine preparation, and another 120 sh were injected with the PBS-adjuvant mixture. The right-hand side pectoral ns of control sh were clipped for identication. All the sh were maintained for 35 days in 1 m 1 m (diameter depth)

tanks before challenging them with six different isolates of A. hydrophila. 2.2.2. Challenge studies Six virulent isolates of A. hydrophila (T4, 98140, 98141, Hh, B2/12 and Vds) were passaged twice through common carp (3040 g) to determine their lethal dose 50% (LD50 ) value in carp. Initially, the concentration of the bacteria was adjusted to an OD of 1.0 at 610 nm, equivalent to 1 108 bacteria ml1 , before preparing three different doses of bacteria, at 2 107 , 5 107 and 2.5 107 ml1 . The sh were injected IP with 0.1 ml of these suspensions and placed in a separate glass tank for each strain. The concentration of bacteria was adjusted accordingly and injected into a new group of sh to obtain the LD50 value for all isolates. Twenty vaccinated and 20 control sh were challenged IP with each isolate after anaesthetising the sh according to Poobalane et al. [30]. The concentrations of the bacteria used in the challenge were 1 108 , 2 107 , 2 107 , 5 107 , 7.5 106 and 2 107 bacteria ml1 for T4, 98140, 98141, Hh, B2/12 and Vds, respectively. All 40 sh within each group were placed in separate glass tanks (90 cm length 47 cm height 40 cm depth) and the water temperature was maintained at 2022 C. The dead sh from the tanks were removed three times a day and a kidney swab taken was streaked onto TSA plates. At the end of the trial, Day 16 post-challenge, 6 sh surviving the challenge (3 vaccinated and 3 control sh for each bacterial strain) were killed by overdosing with benzocaine (0.01% w/v). The appearance of the internal organs of the killed sh was examined before sampling their kidney. Gram staining and serum agglutination using rabbit anti-A. hydrophila polyclonal antibodies diluted in PBS 1/100 (v/v) were used to conrm the presence of A. hydrophila to ensure the mortalities were specic to the infection caused by the bacteria. The relative percentage survival (RPS) was calculated to determine the efcacy of the vaccine using the following formula [33]. RPS = 1 (% vaccinated mortality) 100 (% control mortality)

2.2.3. Statistical analysis The results obtained were analysed statistically using Chisquare test for survival, comparing the mortality of vaccinated sh with the control group sh after challenging with bacteria. 3. Results 3.1. Production of the recombinant S-layer protein of A. hydrophila isolate The amplication of the gene encoding the S-layer protein from A. hydrophila isolate T4 was successfully achieved, indicated by the production of the 1353 bp PCR product on a 1% agarose gel as shown in Fig. 1 (lanes 2 and 3), while successful ligation of the digested Slayer protein gene into the pQE60 vector was conrmed by the band obtained at around 4.8 kb (Fig. 1 (lane 4)). Expression of an abundant S-layer protein (45.5 kDa) was conrmed in the IPTG induced E. coli, transformed with the pQE60 vector containing the S-layer gene insert, by SDS-PAGE analysis (Fig. 2a). The protein also gave a strong positive reaction in Western blot with the anti-histidine antibody (Fig. 2b). A nal yield of 15 mg of puried protein was recovered from a 1 litre E. coli culture, and it was conrmed as Slayer protein by SDS-PAGE analysis (Fig. 3a) and Western blotting using serum produced against a WC preparation of A. hydrophila T4 isolate (raised in common carp) (Fig. 3b).

S. Poobalane et al. / Vaccine 28 (2010) 35403547

3543

Fig. 1. Amplication of the S-layer gene of A. hydrophila isolate T4 shown on a 1% agarose gel. Lanes: (1) standard markers; (2) S-layer protein gene; (3) puried Slayer protein gene; (4) pQE60 vector carrying S-layer protein gene.

Fig. 2. Expression of S-layer protein of A. hydrophila with E. coli WC protein. (a) 12% SDS-PAGE stained with Coomassie blue and (b) Western blot of protein using an antihistidine-tag antibody. Lanes: (1) standard protein marker; (2) WC preparation of recombinant E. coli without IPTG induction; (3) WC preparation of recombinant E. coli with IPTG induction showing S-layer protein.

3.2. Efcacy of recombinant S-layer protein as a vaccine against A. hydrophila in common carp 3.2.1. Standardisation of the challenge dose of A. hydrophila All six strains of A. hydrophila, T4, 98140, 98141, Hh, B2/12 and Vds, were passaged two times through common carp and the bacteria were successfully recovered on each passage. During the rst passage, no mortalities occurred in any of the sh, while most sh died when passaging bacteria were used with the exception of sh passed with isolate T4. The LD50 values obtained for each strain are presented in Table 1. The highest LD50 value obtained was for isolate T4 with a dose of 1 108 bacteria ml1 , while the lowest dose was

obtained with isolate B2/12 with a value of 7.5 106 bacteria ml1 . An LD50 value of 2 107 bacteria ml1 was obtained for isolates 98140, 98141 and Vds, while an LD 50 value of 5 107 bacteria ml1 was obtained for Hh. 3.2.2. Vaccination of common carp with the recombinant S-layer protein of A. hydrophila The cumulative mortality that occurred in the control sh after challenging with the different isolates of A. hydrophila ranged from 40 to 75%, while the mortalities of vaccinated sh ranged between 10 and 20% (Table 1). The mortalities ceased in the control groups by Day 8 post-challenge, whereas no mortality was found after Day 5 post-challenge in the vaccinated groups (Fig. 4). A higher percentage of mortalities were recorded in control sh challenged

Fig. 3. Recombinant S-layer protein of A. hydrophila puried from E. coli. (a) 12% SDS-PAGE stained with Coomassie blue and (b) Western blot against anti-A. hydrophila T4 isolate antibody from carp. Lanes: (1) standard protein marker; (2) WC protein of A. hydrophila; (3 and 4) protein separated from insoluble fractions of recombinant E. coli; (5 and 6) protein separated from soluble fractions of recombinant E. coli.

3544

S. Poobalane et al. / Vaccine 28 (2010) 35403547

Fig. 4. Cumulative percentage mortality of carp vaccinated with recombinant S-layer protein and challenged with A. hydrophila isolates. Different letters indicate a statistical difference between vaccinated and unvaccinated sh.

with isolate T4 than in sh challenged with the other isolates of A. hydrophila (Fig. 4a). The relative percentage survival (RPS) value of sh challenged with isolate T4 was found to be the highest compared with the sh challenged with other A. hydrophila isolates, while the lowest RPS value was obtained in sh challenged with isolate B2/12 (Table 1). Statistically, survival after challenging with isolates T4, 98140, 98141 and Hh was signicantly higher in vaccinated sh compared to control sh, while levels of survival were not statistically different between vaccinated and control sh challenged with isolates B2/12 and Vds (Table 1). A. hydrophila was recovered from all kidney swabs taken from dead sh over the course of the trial. In contrast, no A. hydrophila was cultured from kidney swabs taken from sh surviving at the end of experimental challenge except swabs of one sh in the vaccinated group challenged with isolate 98140, and another sh in the control group challenged with isolate 98141, with a few colonies obtained from both sh.

4. Discussion A. hydrophila infections have been difcult to treat in aquaculture systems due to the resistance of this pathogen to a number of different antibiotics [34]. Researchers have, therefore, examined the effects of different types of A. hydrophila vaccine preparations, to protect sh against diseases caused by this bacterium. However, the efcacy of these vaccines was not tested against a variety of different A. hydrophila isolates, and it is therefore unknown if they would cross-protect against other isolates of the bacterium [1315]. Most of these vaccines do not appear to have been eldtested for commercialisation, possibly due to the fact that the quantity of vaccine required for a eld trial is much greater, and the licensing of vaccines is a long and complicated process. In previous work, we used immunoproteomics to try to identify a common antigen between several isolates of A. hydrophila that could be used to cross-protect sh from infection caused by vari-

S. Poobalane et al. / Vaccine 28 (2010) 35403547

3545

ous strains of this pathogen [30,31]. Using bacteria cultured both in vitro and in vivo, an immunogenic S-layer protein was identied which was common to all virulent isolates of A. hydrophila. In a small scale preliminary vaccination study, the protein was electroeluted from an SDS-PAGE gel and the level of protection elicited by this protein examined using a low number of goldsh. The protein was found to confer protection against the bacterium in the vaccinated goldsh as the RPS value was 66.7%. However, the process for eluting the protein from the gel was time consuming, and very small yields of the protein were obtained which were insufcient for larger scale vaccination studies. It was, therefore, decided to use recombinant protein technology to produce sufcient quantities of the S-layer protein to enable large-scale vaccine trials to be carried out to examine the ability of this protein to elicit protection against a variety of different A. hydrophila isolates. Recombinant protein vaccines have a number of advantages over traditional bacterin vaccines, including being inexpensive to produce and safer to use [25]. One of the other major advantages is that this method of vaccine preparation avoids the presence of unwanted antigens from the pathogen in the vaccine, which could lead to suppression of the hosts immune system. For example, some of the surface proteins of Renibacterium salmoninarum (i.e. p22 and p57) have been found to suppress the immune system of sh, and therefore, a WC preparation of this bacterium is not ideal to use as a bacterin vaccine [35]. Recombinant protein vaccines, on the other hand, can induce specic immunity against a particular antigen which can protect the host from infection [36]. The reason for differences in the virulence between different isolates of A. hydrophila is due to a wide variation in the expression of genes between various isolates, which in turn leads to different levels of expression of the virulence factors, such as those found in the ECP or as surface proteins [37]. In this study, the lowest virulence was seen with isolate T4 and the highest with isolate B2/12. The rate of mortality was high with all six isolates in both vaccinated and control sh within the rst 2 days post-challenge, compared with the level of mortality obtained over the rest of the trial (Fig. 4). The sudden mortality that occurred in the rst 2 days post-challenge was most likely due to toxic shock [38]. This rate of mortality is unlikely to occur during a natural infection because the concentration of the pathogen gradually increases during the infection, whereas a large number of bacteria are introduced at the same time in the experimental infection. The recombinant S-layer protein vaccine may therefore have a greater ability to protect sh against natural infections by A. hydrophila, when bacterial concentrations are low. The S-layer protein is a predominant cell surface protein seen in the SDS-PAGE proles of WC lysates and outer membrane fractions of A. hydrophila [39]. The presence of S-layer protein among highly virulent strains of A. hydrophila has previously been reported by Thomas and Trust [32] and Dooley et al. [40]. Diseases caused by A. hydrophila possessing S-layers are often associated with invasive systemic infection [41]. Being on the outermost layer of the bacterium, the S-layer protein has more chance of rapidly interacting with the host than other protein components of the bacterium [32]. The S-layer binds to many host proteins such as bronectin, laminin and vitronectin [42], which could be one reason why the S-layer protein appears to be more immunogenic than other proteins in the bacterium. Kokka et al. [43] suggested that the S-layers may provide protection for bacteria in their natural environment or provide a selective advantage in the ability of bacterium to cause infection. The protein was also found to confer resistance to serum killing and protease digestion [42]. The study indicated that the S-layer protein antigen of A. hydrophila is able to confer protection in common carp against a range of different isolates of the bacterium, although the RPS values obtained for the carp did vary between the different challenge

P-value (Chi-square test)

Relative percentage survival (%)

0.006 0.028 80 75 50 40 10 10 Haemorrhagic lesion Ayuthaya Province, Thailand (1998) 2 107 2 107

Table 1 The details of the A. hydrophila isolates used and relative percentage survival of carp vaccinated with recombinant S-layer protein of A. hydrophila then challenged with the bacterium.

Control sh

Total mortality (%)

Vaccinated sh

LD50 value (bacteria ml1 )

Lesion/infection

EUS lesion

1 108 5 107

Bangladesh (1994) IOA

EUS lesion Abbreviations: IOA, Institute of Aquaculture; EUS, epizootic ulcerative syndrome. Vds B2/12 Catsh (Ictulurus puctatus) India Bangladesh

Country/date

A. hydrophila isolates

98140 98141

T4 Hh

Black shark (Morulius chrysophekadion)

Rohu (Labeo rohita) Hedgehog (Erinaceus europaeus)

Isolated from

Host species

2 107 7.5 106

15 20

10 10

40 45

75 65

62.5 56

87 85

0.077 0.091

0.000 0.000

3546

S. Poobalane et al. / Vaccine 28 (2010) 35403547 [9] Ebanks RO, Dacanay A, Goguen M, Pinto DM, Ross NW. Differential proteomic analysis of Aeromonas salmonicida outer membrane proteins in response to low iron and in vivo growth conditions. Proteomics 2004;4:107485. [10] Thompson KD, Adams A. Current trends in immunotherapy and vaccine development for bacterial diseases of sh. In: Leung KY, editor. Molecular Aspects of Fish and Marine Biology, vol. 3. Singapore: World Scientic Publishing Co.; 2004. p. 31362. [11] Samuel M, Lam TJ, Sin YM. Effect of laminaran [beta (1,3)-d-glucan]on the protective immunity of blue gourami, Trichogaster trichopterus against Aeromonas hydrophila. Fish Shellsh Immunol 1996;6:44354. [12] Lamers CHJ, De Haas MJH, Van Muiswinkel WB. The reaction of the immune system of sh to vaccination: development of immunological memory in carp, Cyprinus carpio L., following direct immersion in Aeromonas hydrophila bacterin. J Fish Dis 1985;8:25362. [13] Leung KY, Wong LS, Low KW, Sin YM. Mini-Tn5 induced growth- and proteasedecient mutants of Aeromonas hydrophila as live vaccines for blue gourami, Trichogaster trichopterus (Pallas). Aquaculture 1997;158:1122. [14] Rahman MH, Kawai K. Outer membrane proteins of Aeromonas hydrophila induce protective immunity in goldsh. Fish Shellsh Immunol 2000;10:37982. [15] Baba T, Imamura J, Izawa K, Ikeda K. Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas hydrophila crude lipopolysaccharide. J Fish Dis 1988;11:23744. [16] Azad IS, Shankar KM, Mohan CV, Kalita B. Protective response of common carp orally vaccinated with biolm and free cells of Aeromonas hydrophila challenged by injection and immersion routes. J Aquac Trop 2000;15:6570. [17] Khashe S, Hill W, Janda JM. Characterization of Aeromonas hydrophila strains of clinical, animal, and environmental origin expressing the O:34 antigen. Curr Microbiol 1996;33:1048. [18] Connolly JP, Comerci D, Alefantis TG, Walz A, Quan M. Proteomic analysis of Brucella abortus cell envelope and identication of immunogenic candidate proteins for vaccine development. Proteomics 2006;6:376780. [19] Chen Z, Peng B, Wang S, Peng X. Rapid screening of highly efcient vaccine candidates by immunoproteomics. Proteomics 2004;4:320313. [20] Chakravarti DN, Fiske MJ, Fletcher LD, Zagursky RJ. Application of genomics and proteomics for identication of bacterial gene products as potential vaccine candidates. Vaccine 2000;19:60112. [21] Makela PH. Vaccines, coming of age after 200 years. FEMS Microbiol Rev 2000;24:920. [22] Irie T, Watarai S, Iwasaki T, Kodama H. Protection against experimental Aeromonas salmonicida infection in carp by oral immunisation with bacterial antigen entrapped liposomes. Fish Shellsh Immunol 2005;18:23542. [23] Wilhelm V, Miquel A, Burzio LO, Rosemblatt M, Engel E, Valenzuela S, et al. A vaccine against the salmonid pathogen Piscirickettsia salmonis based on recombinant proteins. Vaccine 2006;24:508391. [24] Sun K, Zhang WW, Hou JH, Sun L. Immunoprotective analysis of VhhP2, a Vibrio harveyi vaccine candidate. Vaccine 2009;27(21):273340. [25] Clark TG, Cassidy-Hanley D. Recombinant subunit vaccines: potential and constraints. In: Midtlyng PJ, editor. Progress in sh vaccinology. Basel: Karger; 2005. p. 15364. [26] Williamson ED, Eley SM, Grifn KF, Green M, Russell P, Leary SEC, et al. A new improved sub-unit vaccine for plague: the basis of protection. FEMS Immunol Med Microbiol 1995;12:22330. [27] Rupprecht CE, Hanlon CA, Blanton J, Manangan J, Morrill P, Murphy S, et al. Oral vaccination of dogs with recombinant rabies virus vaccines: Rabies in the Americas. Virus Res 2005;111:1015. [28] Saul A, Lawrence G, Allworth A, Elliott S, Anderson K, Rzepczyk C, et al. A human phase 1 vaccine clinical trial of the Plasmodium falciparum malaria vaccine candidate apical membrane antigen 1 in Montanide ISA720 adjuvant. Vaccine 2005;23:307683. [29] He J, Yin Z, Xu G, Gong Z, Lam TJ, Sin YM. Protection of goldsh against Ichthyophthirius multiliis by immunization with a recombinant vaccine. Aquaculture 1997;158:110. [30] Poobalane S, Thompson KD, Diab A, Ard L, Jeney G, Adams A. Protein expression by Aeromonas hydrophila during growth in vitro and in vivo. Microb Pathog 2008;45:609. [31] Poobalane S. Aeromonas hydrophila vaccine development using immunoproteomics. University of Stirling, PhD Thesis; 2007. [32] Thomas SR, Trust TJ. Tyrosine phosphorylation of the tetragonal paracrystalline array of Aeromonas hydrophila: molecular cloning and high-level expression of the S-layer protein gene. J Mol Biol 1995;245:56881. [33] Amend DF. Potency testing of sh vaccines. International symposium on sh biologics: serodiagnostic and vaccines. Dev Biol Stand 1981;49:44754. [34] Shariff M. Impact of diseases on aquaculture in the Asia-Pacic region as exemplied spizootic ulcerative syndrome (EUS). J Appl Ichthyol 1998;14: 13944. [35] Fredriksen A, Endresen C, Wergeland HI. Immunosuppressive effect of a low molecular weight surface protein from Renibacterium salmoninarum on lymphocytes from Atlantic salmon (Salmo salar L.). Fish Shellsh Immunol 1997;7:27382. [36] Potter AA, Babiuk LA. New approaches for antigen discovery, production and delivery: vaccines for veterinary and human use. Curr Drug Targets Infect Disord 2001;1:24962. [37] Zhang YL, Ong CT, Leung KY. Molecular analysis of genetic differences between virulent and avirulent strains of Aeromonas hydrophila isolated from diseased sh. Microbiology 2000;146:9991009.

isolates. No mortalities occurred in any of the groups of sh after Day 8 post-challenge and no colonies of A. hydrophila grew from the kidney swabs taken from surviving sh at the end of experiment except for two sh. This suggests that most of the surviving sh in the control group had managed to clear the bacterium. It is known that a healthy sh can produce an antibody response against different components of the bacterium and clear it from its circulatory system within 7 days post-infection, if the level of infection caused by the pathogen is not sufcient to kill the sh [44]. Other proteins of A. hydrophila have been produced as recombinant antigens for use in vaccination studies. For example, Fang et al. [1] found signicant protection against two isolates of A. hydrophila in blue gourami, Trichogaster trichopterus (75 and 87.5% RPS) immunised with a recombinant 43 kDa OMP, while a recombinant 37 kDa OMP of A. hydrophila has been shown to be immunogenic in rohu carp [45]. Fish vaccinated with this recombinant OMP had a RPS value of 57% after challenging the sh with a virulent isolate of A. hydrophila [46]. However, cross-protection of these vaccines against a range of A. hydrophila isolates has not been reported. Amend [33] proposed that a RPS value of more than 60 with vaccinated and experimentally infected sh was necessary to ensure protection from natural infection in eld. The author also recommended a minimum mortality of 60% in the control group using two replicate groups of 25 sh for both the vaccinated and the control groups. Though not all the criteria suggested by Amend were followed in the present study, the level of protection obtained with the recombinant protein against six different isolates of A. hydrophila, suggests that it is able to protect against a range of different A. hydrophila isolates despite the fact that two of the challenge isolates resulted in low RPS values due to slightly increased mortalities in vaccinated groups (15 and 20%). In summary, the results of this study, and the smaller preliminary study with goldsh mentioned above, suggest that the S-layer protein of A. hydrophila may be an important antigen for conferring protection in common carp against a variety of virulent isolates of this pathogenic bacterium. Efcacy testing of this vaccine is currently in progress in the aquarium and in the eld to establish if it can protect a variety of sh species against different isolates of this bacterium. Acknowledgements Authors would like to thank Intervet Schering-Plough Aquaculture, Overseas Research Students Awards Scheme and the Paul Foundation for funding this work. References
[1] Fang HM, Ge R, Sin YM. Cloning, characterisation and expression of Aeromonas hydrophila major adhesin. Fish Shellsh Immunol 2004;16:64558. [2] Esteve C, Amaro C, Garay E, Santos Y, Toranzo AE. Pathogenicity of live bacteria and extracellular products of motile Aeromonas isolated from eels. J Appl Microbiol 1995;78:55562. [3] Karunasagar I, Rosalind GM, Karunasagar I, Gopal Rao K. Aeromonas hydrophila septicaemia of Indian major carps in some commercial sh farms of West Godavari District, Andhra Pradesh. Curr Sci 1989;58:10445. [4] Azad IS, Rajendran KV, Rajan JJS, Vijayan KK, Santiago TC. Virulence and histopathology of Aeromonas hydrophila (Sah 93) in experimentally infected tilapia, Oreochromis mossambicus (L.). J Aquac Trop 2001;16:26575. [5] Llobrera AT, Gacutan RQ. Aeromonas hydrophila associated with ulcerative disease epizootic in Laguna de Bay, Philippines. Aquaculture 1987;67:2738. [6] Yambot AV. Isolation of Aeromonas hydrophila from Oreochromis niloticus during sh disease outbreaks in the Philippines. Asian Fish Sci 1998;10:34754. [7] Esteve C, Biosca EG, Amaro C. Virulence of Aeromonas hydrophila and some other bacteria isolated from European eels Anguilla anguilla reared in fresh water. Dis Aquat Org 1993;16:1520. [8] Maji S, Mali P, Joardar SN. Immunoreactive antigens of the outer membrane protein of Aeromonas hydrophila, isolated from goldsh, Carassius auratus (Linn.). Fish Shellsh Immunol 2006;20:46273.

S. Poobalane et al. / Vaccine 28 (2010) 35403547 [38] Perez MJ, Rodriguez LA, Fernandez-Briera A, Nieto TP. A 45-kDa acetylcholinesterase protoxin of Aeromonas hydrophila: purication and immunogenicity in sh. FEMS Microbiol Lett 2002;211:237. [39] Murray RGE, Dooley JSG, Whippy PW, Trust TJ. Structure of an S layer on a pathogenic strain of Aeromonas hydrophila. J Bacteriol 1988;170:262530. [40] Dooley JSG, Lallier R, Shaw DH, Trust TJ. Electrophoretic and immunochemical analyses of the lipopolysaccharides from various strains of Aeromonas hydrophila. J Bacteriol 1985;164:2639. [41] Janda JM, Kokka RP, Guthertz LS. The susceptibility of S-layer-positive and Slayer-negative Aeromonas strains to complement-mediated lysis. Microbiology 1994;140:2899905. [42] Noonan B, Trust TJ. The synthesis, secretion and role in virulence of the paracrystalline surface protein layers of Aeromonas salmonicida and A. hydrophila. FEMS Microbiol Lett 1997;154:17.

3547

[43] Kokka RP, Velji AM, Clark RB, Bottone EJ, Janda JM. Immune response to S layer-positive 0:11 Aeromonas associated with intestinal and extraintestinal infections. Immunol Infect Dis 1992;2:1114. [44] Chandran MR, Aruna BV, Logambal SM, Dinakaran MR. Immunisation of Indian major carps against Aeromonas hydrophila by intraperitoneal injection. Fish Shellsh Immunol 2002;13:19. [45] Khushiramani R, Girisha SK, Karunasagar I, Karunasagar I. Cloning and expression of an outer membrane protein ompTS of Aeromonas hydrophila and study of immunogenicity in sh. Protein Expr Purif 2007;51:3037. [46] Khushiramani R, Girisha SK, Karunasagar I, Karunasagar I. Protective efcacy of recombinant OmpTS protein of Aeromonas hydrophila in Indian major carp. Vaccine 2007;25:11578.