1

Characterization Microbial Mobile Bay Characterization of Mobile Bay Microbial Oxygenic and Anoxygenic Photosynthesis using qPCR Maria M. Ortiz1, Alice Ortmann PhD2
1 2

California State University Long Beach, Long Beach, CA 90840 Dauphin Island Sea Lab, University of South Alabama , Mobile, Al 36688

Abstract Factors that affect hypoxia in shallow estuarine systems can vary but biological factors, like microbes, could be driving this phenomenon in Mobile Bay. Aerobic anoxygenic photosynthetic bacteria (AAPB) and cyanobacteria could be driving high oxygen demand and stratification in Mobile Bay given a possible ecological niche overlap. Elucidation of a relationship between these microbes and hypoxia as well as determining the relationship between cyanobacteria and AAPBs could explain hypoxic summer events. To decipher a relationship it would be necessary to enumerate these bacteria from samples of surface and deep water that exhibit low to hypoxic oxygen conditions. We expect real -time qPCR would show that cyanobacteria abundance increases in anoxic conditions and AAPB abundance stays constant at lower oxygen levels. Use of pufM 557F and 750R primers for AAPBs and CYA359F and equimolar CYA781(a+b)R primer for cyanobacteria 16S gene. These primers formed more dimers than product at or less than 103 template concentration suggesting the high G-C rich primer sequences have higher affinity to each other and non-specific amplification than target gene products. The optimization process resulted in dissociation curves that suggests it may be more worthwhile to invest in cleanamp primers, alternative primers like pufLM67 or CYA106F, or to make own custom qPCR master mix. Key words: Aerobic Anoxygenic Phototrophic bacteria, Cyanobacteria, Hypoxia, Mobile Bay

Characterization Microbial Mobile Bay Introduction Mobile Bay is an estuarine system that has seasonal summer hypoxic events (direct quote Alice Ortmann). Hypoxia in Mobile Bay is unique because there is strong summer stratification along with high oxygen demand (Park et al., 2007). Most shallow estuaries and coasts have short hypoxic events since turnover occurs and dissolved oxygen concentrations can be more evenly distributed in surface and deep water (Rabalais et al., 2010; Zhang et al., 2010). This is not the case in mobile bay and a factor that could be driving the high oxygen demand and stratification in Mobile Bay is photosynthetic bacteria. A relationship between cyanobacteria and aerobic anoxygenic photosynthetic bacteria could explain such low oxygen concentrations in the bay. Though Lake Erie is a different aquatic system from the estuarine environment of Mobile Bay, it indicates consortia exist in eutrophic areas prone to hypoxia (Wilhelm et al., 2006). In order to illuminate if this relationship exists in the bay we have to investigate cyanobacteria and AAPB abundance in Mobile Bay. Cyanobacteria are known to be abundant in higher temperatures and to bloom in eutrophic areas. These autotrophic photosynthesizers can tolerate hypoxic and even anoxic conditions while producing oxygen (Yurkov & Beatty, 1998). Aerobic anoxygenic photosynthetic bacteria (AAPB) are not well understood and they have not been studied in Mobile Bay. It is known that when oxygen is available they perform aerobic respiration, repress formation of photo complexes, and assimilate organic carbon to grow (Gregor & Klug, 1999). In contrast, when oxygen and energy is low they become photosynthetic (no oxygen produced). Their photosynthetic apparatus develops during these bad conditions (even in absence of light and during respiration) via invagination of the cytoplasmic membrane and intracytoplasmic membranes that carry photosynthetic complexes. Therefore, we hypothesize that cyanobacteria cause hypoxic events in mobile bay leading to conditions that favor AAPB photosynthetic

Characterization Microbial Mobile Bay activity. This allows for the AAPBs to survive, not grow, during hypoxia. Hypoxia is when oxygen concentrations drop below 2 ppm and it indicates greater respiration than photosynthetic production. During the hypoxic event cyanobacteria are continuously producing oxygen and eventually the bays oxygen levels pass the compensation point. When oxygen levels return to normal, AAPBs likely return to heterotrophic mode and assimilate carbon and grow. This relationship may be why hypoxic events are long lasting in the mobile bay Methods The sites sampled were areas within Mobile bay that have experienced past hypoxic events (Park et al., 2007) (Figure 1). Monthly samples for each site included surface and three meter deep water. Eighty samples were collected between May to October of 2011. (how samples were stored) We used PCR protocols from Du et al. (2006) for the pufM optimization and Nubel et al. (1999) for cyanobacterial 16s gene optimization. The pufM gene is highly conserved amongst AAPBs and they only have one copy. This gene encodes a protein for the M subunit of the photosynthetic reaction center of photosystem II in AAPBs (Gregor & Klug 1999). The cyanobacteria 16s gene is found twice in each cell. The primers chosen for this study were CYA359F and CYA781R(a+b), pufM557F and pufM750R (Achenbach et al. 2001; Beja et al., 2002; Schwalbach & Fuhrman 2005; Hu et al., 2006; Du et al., 2006;). Sequences: pufM 557 forward 5 CGCACCTGGACTGGAC 3, pufM750 reverse 5CCCATGGTCCAGCGCCAGAA 3, CYA359 forward 5GGG GAATYTTCCGCA ATG GG 3, and an equimolar mixture of CYA781 reverse (a) 5 GACTACTGGGGTATCTAATCCCAT T 3 and CYA781 reverse (b) 5GACTACAGGGGTATCTAATCCCTT T 3.

Characterization Microbial Mobile Bay The biggest change for PCR optimization of both primers resulted in reduction of BSA in PCR mix by 50% given that the basic protocol was for environmental soil samples while we used water samples. Optimization of the cyanobacteria primer focused on elimination of primer dimer formation. Initial gels showed brighter primer dimer at the bottom of wells than the 422 bp product we were looking for. Therefore, we tried reducing primer dimer and found that 50% less primer than the one listed in the base protocol reduced the brightness of the primer dimer on gels. Hot start PCR was used to eliminate non-specific primer annealing and yielded good results (Figure 2a). The pufM gene was optimized by gradient PCR using an eppendorf Mastercycler Gradient and the optimal annealing temperature was found to be 57C. This resulted in good isolation of a 193 bp product (Figure 2b). Promega pGEM-T Easy vector cloning kit was used to get clones for qPCR standard curve. EcoR1 restriction digest of the best plasmids for cyanobacteria 16s and pufM gene were done to verify correct plasmid size was cloned. After plasmids were purified (Figure 3), we attempted to optimize the qPCR standard curve for both primers. Real time PCR is very sensitive and we had primer dimer issues for cyanobacteria 16s and pufM gene. We used a three step qPCR, using the Agilent Technologies Stratagene Mx3005P, which resulted in some amplification compared to no amplification with the two-step setting. Manipulation of primer concentration helped determine least primer interaction at .15m. MgCl concentration in 2X GoTaq qPCR master mix was (1mm) and was adjusted with the addition of .4l of 25mM MgCl stock in 20l reactions. We tried experimenting with the cyanobacteria primer (had highest primer dimer yield) by collecting fluorescence data at the end of a 74C extension (73C primer dimer melting point) step to reduce readings of non-specific primer interaction during the annealing step. This reduced some primer dimer fluorescence but it

Characterization Microbial Mobile Bay was not enough to eliminate it. Similarly, pufM primers had high primer dimer formation even at annealing temperature of 58C. Real time PCR successful product amplification is limited by primer quality and affinity (Osborn & Smith, 2008) Results Optimization of cyanobacteria primer with settings of annealing temperature of 64 C and extension at 76C yielded product amplification. The best results for pufM were at an annealing temperature of 58C and extension at 72C. Final primer concentration for both primer reactions was .15M. Amplification and Dissociation plot comparison was necessary to decipher the amount of fluorescence due to product amplification. The template concentration of 105 resulted in cyanobacteria 433bp product amplified up to 9932 fluorescence at a 88.2 Tm (melting temperature) which was greater than primer dimer fluorescence. Concentrations of 105 and 108 resulted in fluorescence up to 610 at 88 Tm attributed to the product and greater amplification of primer dimer, up to 1324 at 76C Tm. The pufM dissociation curve shows that there is high amplification of primer dimers and nonspecific amplification since there is a plateau that extends from 59-87C Tm. This evidence suggests the primers used are not optimal and they do not result in good gene amplification. The peak Tm for pufM was produced at 91C, but production was below fluorescence of 2000 even in the highest template concentration of 108. The dissociation curves for 103 and the no template control have equivalent amounts of primer dimer formation. Discussion The inability to optimize qPCR due to primer dimer formation suggest that our primers where not specific enough. Also, with G-C rich sequences there is an inherent risk of primers annealing to themselves or to each other. The first step in addressing the shortfalls of our qPCR protocol

Characterization Microbial Mobile Bay would be to redesign primers. Alternative primers that can replace ones used in this study include the CYA106R instead of CYA359F (Nubel et al., 1997) and pufLM67F instead of pufM557F (Nagashima et al., 1997). It would be best to target regions with lower G-C richness and to avoid thymidine on the primer ends for cyanobacteria 16s. Another option is to use the same primer region but to try cleanamp DnTPs that gradually activate in small amounts so the GoTaq efficiently polymerizes every cycle (Shore & Paul 2010), similar to hot start PCR but through a different means. Clean amp primers and related products may solve the primer dimer issues of this reaction since a gradual activation of select PCR reagents could reduce primer-primer interactions at lower temperatures. Unlike Hot start PCR, which gradually increases the temperature, the gradual release of primer is more efficient and optimal at all temperatures. At each interval activation of a small quantity of primer would discourage dimer formation since the primers would not have to compete for free DNA. Another option would be to make or to order the individual reagents for qPCR. This gives greater flexibility and allows for Hot start PCR methods to be applied to qPCR. Hot Start was used in previous studies and it was necessary to reduce primer dimer formation in PCR optimization of our cyanobacterial primers. It is unknown if this method will fully eliminate all primer dimer formation. However, it may reduce the primer dimers below the lowest fluorescence value of the qPCR standard curve. Using new real time PCR software, the primer dimers could be excluded and compensated for in fluorescence readings. Though the 80 samples from Mobile Bay were not run, it is important to continue studying the microbial ecology dynamics in the shallow hypoxic area. The niches that different bacteria play in this aquatic system are necessary to understand and incorporate to hydrologic and oceanographic studies. Tying together the multiple dimensions in estuarine eutrophic systems

Characterization Microbial Mobile Bay can help us understand how anthropogenic inflation of nutrients causes hypoxia in areas like Mobile bay as well as coasts. The functional roles of AAPBs in these ecosystems are important to research because we do not know how abundant they are in the eutrophic areas we usually inhabit. Cyanobacteria are usually indicators of high eutrophication and they bloom when all other photosynthesizers die out. The cyclical oxygen depletion and production of this single celled photosynthesizer in the summer and during hotter temperatures indicates future applications to blooms due to global warming and urban runoff. Until we know the links between cyanobacteria and AAPBs we cannot fully understand the dynamics of hypoxia in Mobile Bay.

Literature Cited Du H, Jiao N, Hu Y, Zeng Y (2006) Real time PCR for quantification of aerobic anoxygenic phototrophic bacteria based on pufM gene in marine environment. Experimental Marine Biology and Ecology 329: 113-121 Waidner LA and Kirchman DL (2008) Diverity and Distribution of Ecotypes of the Aerobic Anoxygenic Phototrophy Gene pufM in the Delaware Estuary. American Society for Microbiology 74: 4012-4021. Beja O, Suzuki MT, Heidelberg JF, Nelson WC, Preston CM, Hamadas T, Elsen Jam Fraser CM, DeLong EF (2002) Unsuspected diversity among marine aerobic anoxygenic phototrophs. Letters to Nature 415: 630-633 Hu Y, Du H, Jiao N, Zeng Y (2006) Abundant presence of the gamma-like Proteobacterial pufM gene in oxic seawater. FEMS Microbial Lett 263: 200-206

Characterization Microbial Mobile Bay Achenbach LA, Carey J, Madigan MT (2001) Photosynthetic and Phylogenetic Primers for the Detection of Anoxygenic Phototrophs in Natural Environments. Environmental Microbiology 67:2922-2926 Schwalbach MS, Fuhrman JA (2005) Wide-ranging abundances of aerobic anoxygenic phototrophic bacteria in the world ocean revealed by epiflourescence microscopy and quantitative PCR. Limnol Oceanogr 50: 620-628 Gregor J, Klug G (1999) Regulation of bacterial photosynthesis genes by oxygen and light. FEMS Microbiology Letters 179: 1-9 Nubel U, Garcia-Pichel F, Muyzer G (1997) PCR Primers To Amplify 16S rRNA Genes from Cyanobacteria. Applied and Environmental Microbiology 63:3327-3332 Wilhelm SW, Bullerjahn GS, Eldridge ML, Rinta-Kanto JM (2006) Seasonal Hypoxia and the Genetic Diversity of Prokaryote Populations in the Central Basin Hypolimnion of Lake Erie: Evidence for abundant Cyanobacteria and Photosynthesis. J Great Lakes Res 32:657-671 Nubel U, Garcia-Pichel F, Kuhl M, Muyzer G (1999) Quantifying Microbial Diversity: Morphotypes, 16S rRNA Genes, and Caratenoids of Oxygenic Phototrophs in Microbial Mats. Applied and Environmental Microbiology 65: 422-430 Martins A, Moreira C, Vale M, Freitas M, Regueiras A, Antunes A, Vasconcelos V (2011) Seasonal Dynamics of Microcystis spp. And Their Toxigenicity as Assessed by qPCR in a Temperate Reservoir. Mar Drugs 9: 1715-1730 Park K, Kim C, Schroeder WW (2007) Temporal Variability in Summertime Bottom Hypoxia in Shallow Areas of Mobile Bay, Alabama. Estuaries and Coasts 30: 54-65 Applied and

Characterization Microbial Mobile Bay Yurkov VV, Beatty JT (1998) Aerobic Anoxygenic Phototrophic Bacteria. ASM Microbiology And Molecular Biology Reviews 62:695-724 Rabalais NN, Diaz RJ, Levin LA, Turner RE, Gilbert D, Zhang J (2010) Dynamics and distribution of natural and human-caused hypoxia. Biogeosciences 7: 585-619 Zhang J, Gilbert D, Gooday AJ, Levin L, Naqvi SWA, Middelburg JJ, Scranton M, Ekau W, Pena A, Dewitte B, Oguz T, Monteiro PMS, Urban E, Rabalais NN, Ittekkot V, Kemp WM, Ulloa O, Elmgrem R, Escobar-Briones E, Vand der Plas AK (2010) Natural and human-induced hypoxia and consequences for coastal areas: synthesis and future development. Biogeosciences 7: 1443-1467 Smith CJ, Osborn AM (2008) Advantages and limitations of quantitative PCR (Q-PCR)based approaches in microbial ecology. FEMS Microbial Ecol 67: 6-20 Shore S, Paul N (2010) Robust PCR amplification of GC-rich targets with Hot Start 7deaza-dGTP. BioTechniques 49: 841-843 Nagashima KVP, Hiraishi A, Shimada K, Matsuura K (1997) Horizontal transfer of genes coding for the photosynthetic reaction centers of purple bacteria. J Mol Evol 45:131-136