Sie sind auf Seite 1von 246

EXAMEN de MECANIQUE ANALYTIQUE, L1 CIP janv 2010 aucun document autoris (sauf dictionnaire franais allemand), calculatrice autorise

e e c e total: 20 points Le texte des noncs est dabord donn en franais, gefolgt von der Aufgabenstellung in Deutsch. e e e c Points pour les exercises/Punkte pro Aufgabe: 1: 7, 2: 7, 3: 6 1. Deux particules de masse m sont relies par un baton totalement rigide, sans masse et de longueur e 2. Le centre du baton est contraint de se dplacer sur un cercle de rayon R. On admet que le e mouvement est contraint au plan xy. a) Faites un dessin qualitatif du syst`me. Combien des dgrs de libert a le syst`me ? e e e e e b) Trouvez le lagrangien et les quations de mouvement, en utilisant des coordonnes gnralises. e e e e e c) Comment interprtez-vous vos rsultats ? Voyez-vous une relation avec des lois de conservation ? e e Zwei Teilchen der Masse m sind durch einen vollkommen starren, masselosen Stab der Lnge 2 a verbunden. Der Mittelpunkt des Stabes ist gezwungen, sich auf einem Kreis mit Radius R zu bewegen. Die Bewegung ist auf die xy-Ebene beschankt. r a) Skizzieren Sie qualitativ das System. Wieviele Freiheitsgrade gibt es ? b) Bestimmen Sie die Lagrangefunktion und die Bewegungsgleichungen, wobei verallgemeinerte Koordinaten zu verwenden sind. c) Wie lassen sich Ihre Ergebnisse deuten ? Sehen Sie einen Zusammenhang mit Erhaltungsstzen ? a 2. On consid`re le fonctionnel (ici, y = y(x) et y = e
b dy ) dx

J(y, y, x) =

dx f (x) 1 + y 2

Rsolvez lquation dEuler associe pour une fonction f (x) arbitraire. Discutez ensuite les cas e e e spciaux f (x) = x et f (x) = x. e Man betrachte das Funktional (hier ist y = y(x) und y =
b dy .) dx

J(y, y, x) =
a

dx f (x) 1 + y 2

Lsen Sie die zugehrige Eulersche Gleichung f r eine beliebige Funktion f (x). Diskutieren Sie o o u anschlieend die Spezialflle f (x) = x und f (x) = x. a 3. On consid`re deux ressorts avec cocients de raideur k1 et k2 , et de masse negligable et attach e e e e ` un mur solide. On les arrange, soit en srie, soit en parall`le, voir les gures. On admet que la a e e bille ` lextremit des ressorts a la masse m. Nous admettons que la bille ne peut se dplacer que a e e dans la direction x. Man betrachte zwei Federn der Steigkeit k1 und k2 und vernachlssigbarer Masse, die an einem a Ende an einer festen Wand befestigt sind. Wir arrangieren diese Federn in Reihenschaltung oder in Parallelschaltung (vgl. Abbildung). Die Kugel am Ende der Federn habe die Masse m und wir setzen voraus, da sich die Kugel nur entlang der x-Achse bewegen kann. Ecrivez le lagrangien et ensuite les quations de mouvement (quations dEuler-Lagrange) pour e e ces deux syst`mes. Comment est le mouvement dans les deux cas ? e On peut remplacer les deux ressorts coupls par un seul ressort eectif de raideur k. Exprimez k e en fonction de k1 et de k2 dans les deux cas.

1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 a) 1 0

k2

k1

1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 b) 1 0

k1

k2

Indication: pour le cas b), on peut introduire une particule ctive, de masse nulle, ` lendroit a o` se termine le premier ressort. Ecrivez ainsi deux quations dEuler-Lagrange et utilisez-en une u e an dliminer la particule ctive. e Bestimmen Sie die Lagrangefunktion und die Bewegungsgleichungen (Euler-Lagrange Gleichungen) f r beide Systeme. Wie ist in beiden Fllen die Bewegung ? u a Man kann die gekoppelten Federn durch eine einzige eektive Feder der Steigkeit k ersetzen. Dr cken Sie, f r beide Flle, k durch k1 und k2 aus. u u a Hinweis: f r den Fall b) kann man ein ktives Teilchen der Masse Null am Ende der ersten Feder u einf hren. Bestimmen Sie zwei Euler-Lagrange Gleichungen und verwenden Sie eine davon, um u das ktive Teilchen zu eliminieren.

EXAMEN de ONDES, L1 CIP janv 2010 aucun document autoris (sauf dictionnaire franais allemand), calculatrice autorise e c e total: 20 points Le texte des noncs est dabord donn en franais, gefolgt von der Aufgabenstellung in Deutsch. e e e c Points pour les exercises/Punkte pro Aufgabe: 1: 8, 2: 12 1. En physique chimique, on consid`re souvent des molcules adsorbes ` une surface. Le spectre e e e a des frquences de vibrations peut ventuellement renseigner sur al structure de telles molcules. e e e Nous considrons une molcule, forme de deux atomes des masses m1 et m2 et qui se place sur e e e une surface plane comme indiqu dans la gure, o` z dcrit lhauteur sur la surface. e u e Dans le cadre des mouvements de faible amplitude autour de la position dquilibre, on remplacera e les forces entre les atomes et avec la surface par des ressorts eectifs, de raideur k et K. Calculez les frquences angulaires 2 et les modes individuelles dans ce cadre. e Indication: pour le faire, il faut dabord trouver la lagrangien du syst`me et en dduire les e e quations de mouvement (il y en a combien ?). Ensuite, un ansatz exponentiel donnera une e quation pour les 2 sous forme dune quation caractristique. e e e

K z 1 2

In der physikalischen Chemie betrachtet man oft auf Oberchen adsorbierte Molek le. Die a u Vibrationsfrequenzspektren knnen eventuell Informationen uber die Molek lstruktur enthalten. o u Wir betrachten ein aus zwei Atomen der Massen m1 und m2 bestehendes Molek l, das auf u einer ebenen Flche wie in der Abbildung angedeutet plaziert wird, wobei z die Hhe uber der a o Oberche bedeutet. a Solange man nur Bewegungen mit kleiner Amplitude um die Gleichgewichtspositionen herum betrachtet, kann man die Krfte zwischen den Atomen und mit der Oberche durch eektive a a Federkrfte (mit Steigkeit k und K) ersetzen. a Berechnen Sie die Kreisfrequenzen 2 und die einzelnen Bewegungsmoden in diesem Rahmen. Hinweis: um dies durchzuf hren, mu man zunchst die Lagrangefunktion des Systems bestimu a men und daraus die Bewegungsgleichungen ableiten (wieviele gibt es ?) Danach lieft dann ein Exponentialansatz eine Gleichung f r 2 , und zwar in Form einer charakteristischen Gleichung. u 2. Le molcule dthine (ou actyl`ne) est un des hydrocarbures les plus simples et se construit ` e e e e a partir de deux atomes dhydrog`ne (H) et deux atomes de carbone (C) qui sarrangent dans une e cha linire, voir la gure. ne a Nous nous intressons ` ses oscillations de faible amplitude autour des positions dquilibre des e a e atomes. Dasn ce cadre, on peut remplacer les vritables forces entre les atomes par des ressorts e eectifs, dont les raideurs k, K sont aussi indiqus dans la gure. e (a) Combien des dgrs de liberte a-t-on dans ce syst`me ? e e e

(b) Trouvez le lagrangien L et les quations de mouvement. Dans la suite, on nommra i , e e i = 1, 2, 3, 4 les carts par rapport aux positions dquilibre. e e (c) An de simplier les calculs, on va dabord eectuer un changement de variables, comme suit: si lon re`te le syst`me par la ligne en pointille dans la gure, il revient sur lui-mme et on peut e e e e constater une symtrie. An dy proter, on peut introduire les nouvelles variables: e 1 1 1 1 1 := (1 4 ) , 2 := (2 3 ) , 3 := (2 + 3 ) , 4 := (1 + 4 ) (1) 2 2 2 2 Si lon eectue le reexion par la ligne pointille, comment se transforment-ils les variables i ? e Classez ces variables en deux secteurs, dites de parit positive et ngative. e e (d) Exprimez le lagrangien L ` laide des i et obtenez des nouveau les quations de mouvement. a e Pouvez-vous constater une simplication ? (e) Eectuez, pour chaque secteur de parit sparamment, un ansatz exponential an de dterminer e e e 2 les frquences angulaires et les modes individuelles du mouvement. e

11 00 11 00
H 1 C 2 C 3

1 0 1 0
H 4

Das Athinmolek l (oder Azetylen) ist eines der einfachsten Kohlenwasserstoe und baut sich aus u zwei Wasserstoatomen (H) und zwei Kohlenstoatomen (C) auf, die in einer linearen Kette angeordnet sind, vgl. die Abbildung. Wir interessieren uns f r die Ozillationen mit kleiner Amplitude um die Gleichgewichtslage der u Atome. In diesem Rahmen kann man die veritablen Krfte zwischen den Atomen durch eektive a Federkrfte mit den Steigkeiten k, K ersetzen, wie es in der Abbildung angedeutet ist. a (a) Wieviele Freiheitsgrade gibt es im System ? (b) Bestimmen Sie de Lagrangefunktion und die Bewegungsgleichungen. Im Folgenden werden die Auslenkungen um die Gleichgewichtslage mit i , i = 1, 2, 3, 4 bezeichnet. (c) Um die Rechnungen zu vereinfachen, f hre man zunchst eine Variablentransformation wie u a folgt durch: falls man das Molek l an der gepunkteten Linie spiegelt, wird es auf sich selbst u zur ckgef hrt und man hat einen Symmetrie. Um diese auszunutzen, kann man die neuen Variu u ablen einf hren: u 1 1 1 1 1 := (1 4 ) , 2 := (2 3 ) , 3 := (2 + 3 ) , 4 := (1 + 4 ) (2) 2 2 2 2 Wenn man die Spiegelung an der gepunkteten Linie durchf hrt, wie transformieren sich die Variu ablen i ? Teilen Sie so die Variablen in zwei Sektoren ein, die Sektoren gerader und ungerader Paritt a genannt werden. (d) Dr cken Sie die Lagrangefunktion L mit Hilfe der i aus und bestimmen Sie von Neuem die u Bewegungsgleichungen. Haben sich die Dinge wirklich vereinfacht ? (e) F hren Sie, f r jeden Parittssektor getrennt, einen Exponentialansatz durch, um so die Kreisu u a 2 frequenzen und die einzelnen Bewegungsmoden zu bestimmen.

UNIVERSITE HENRI POINCARE, NANCY I FACULTE DES SCIENCES ET TECHNIQUES SUJET DEXAMEN DIPLOME Licence Physique-Chimie Dure du sujet 2 heures Epreuve de Mcanique du Point Session de Janvier Date Janvier 2009 Nom des rdacteurs : F. Favier, T. Gourieux, E. Aubert. Documents autoriss X Documents non autoriss X Calculatrices autorises Calculatrices non autorises

I) Questions de cours 1) i) Donner la relation gnrale reliant une force conservative et son nergie potentielle associe. ii) Rappeler lexpression des composantes du vecteur gradient en coordonnes cartsiennes. 2) i) Donner sous forme de schma la dfinition du systme de coordonnes cylindriques (on fera apparaitre les coordonnes ainsi que les vecteurs de base cylindriques). ii) Donner lexpression du vecteur position dans la base cylindrique.

3) Dmonstration de cours Donner lnonc du thorme de lnergie cintique. Dmontrer ce thorme en partant de la deuxime loi de Newton.

II) Energies potentielle et mcanique : Questionnaire choix multiple. Pour chaque question, recopiez sur votre copie uniquement le numro de la question et la lettre correspondant la rponse que vous jugez correcte (pas de justification demande). Pour chaque question, il y a toujours une rponse exacte, et une seule. Afin d'viter les rponses donnes au hasard, il sera retir, au-del de 3 rponses fausses, 1 point par rponse fausse. Il est donc prfrable de s'abstenir de rpondre plutt que de donner des rponses au hasard. 1) La formulation mathmatique de lnonc du thorme du moment cintique est : dM O, F d O a) M O, F b) O dt dt d O c) OM m.v d) il nexiste pas un tel thorme dt

2) Dans la base cylindrique et en utilisant les coordonnes cylindriques r , , z , le vecteur E a pour expression : E E E E r r r r E 1 E 1 E 1 E a) b) c) d) z r E E E E z z z z 3) Dans la base polaire et en utilisant les coordonnes polaires r , , le vecteur vitesse a pour

expression : a) v r.ur .u c) v r.ur r. .u

b) v r.ur r. .u dr d) v .ur r. .u d

4) Dans la base polaire et en utilisant les coordonnes polaires r , , le vecteur acclration a

pour expression : a) a r. .ur 2.r. r. .u r r c) a r. 2 .ur 2.r. r. .u

b) a .ur .u r r d) a r. 2 .ur 2.r. .u

5) Dans le cas dun problme force (acclration) centrale on dmontre que lon obtient la loi des aires ; cette loi a pour expression mathmatique (en utilisant les coordonnes polaires) : a) r 2 . constante b) r 2 . 0 2 c) r. constante d) il nexiste pas de loi des aires

III) Problme Mouvement hlicodal

Un point matriel M est anim dun mouvement dfini par les quations : x t a.cos .t y t a.sin .t z t b.t dans un systme daxes orthonorms directs Oxyz de base i , j , k et o a, b et sont des

constantes positives. 1) Nature du mouvement a) Ecrire les quations cartsiennes de la trajectoire de M sous la forme x f z ,
y f z .

b) Ecrire lquation de la projection de cette trajectoire sur le plan xOy

b) Caractriser en quelques mots les mouvements projets sur les axes et sur le plan xOy. 2) Vecteur vitesse a) Calculer les composantes du vecteur vitesse v dans la base i , j , k . b) Dterminer lexpression de la norme du vecteur vitesse v v .

c) Calculer langle form entre ce vecteur vitesse et la direction Oz ; en dduire que cet angle est indpendant du temps. ds d) En se rappelant que la vitesse scrit v , dterminer lexpression explicite de dt labscisse curviligne en fonction du temps t et de a, b et (on choisira lorigine des abscisses telle que s t 0 0 ). e) Rappeler la dfinition du vecteur de la base de Serret-Frenet et dterminer ses composantes dans la base i , j , k en fonction du temps t et de a, b et . f) Rappeler la dfinition du vecteur n de la base de Serret-Frenet et dterminer ses composantes dans la base i , j , k en fonction du temps t et de a, b et . g) Rappeler la dfinition du vecteur b de la base de Serret-Frenet et dterminer ses composantes dans la base i , j , k en fonction du temps t et de a, b et .

3) Vecteur acclration a) Calculer les composantes du vecteur acclration a dans la base i , j , k . b) Dterminer lexpression de la norme du vecteur acclration a a .

c) Rappeler les expressions gnrales des composantes tangentielle a et normale an de lacclration a en fonction de v et du rayon de courbure R. d) Montrer que a est nulle et en dduire que an est indpendante du temps. e) Dterminer lexpression du rayon de courbure R en fonction de a, b et et montrer que celui-ci est indpendant du temps. 4) Rayon de torsion a) Quelle est linformation apporte par la connaissance du rayon de torsion T dune courbe ? b) Dterminer lexpression du rayon de torsion en fonction de a, b et et montrer que celui-ci est le mme pour tout point de la trajectoire. On rappelle les formules de Serret-Frenet : d 1 dn 1 1 .n . .b ds R ds R T
db 1 .n ds T

UNIVERSITE HENRI POINCARE - NANCY I FACULTE DES SCIENCES ET TECHNIQUES DIPLOME : LPC (L1PC-S1) Epreuve de : Atomistique et Liaisons Chimiques Session de : janvier 2010 Date : Horaire :

SUJET DEXAMEN CODE APOGEE : LCPC1U04C1 Dur e du sujet : 1h30 e Nom du coordinateur : G. Monard Calculette autoris e e Documents non autoris s e

Exercice 1 1. Ecrire les structures de Lewis des mol cules suivantes en y d taillant, si besoin, toutes les e e formes m som` res : e e , HNO, NO , HNO , NO , et HNO NO 2 3 2 3 2. Etablir la g om trie des trois mol cules neutres autour de latome dazote en utilisant e e e le mod` le VSEPR (type AXn Em , gure de r pulsion, forme de la mol cule et angles e e e caract ristiques entre les liaisons). Indiquer dans chaque cas lhydridation de cet atome e dazote. Exercice 2 Soit un atome de b rylium Be : e ` e 1. Quelle est sa conguration electronique a l tat fondamental ? 2. Calculer selon le mod` le de Slater rappel en annexe du sujet l crantage dun electron e e e positionn dans une orbitale 1s du b rylium. Calculer l crantage dun electron positionn e e e e dans une orbitale 2s ? 3. Donner, toujours selon le mod` le de Slater, les valeurs des energies des orbitales atoe miques 1s et 2s. 4. Calculer l nergie de latome de b rylium dans son etat fondamental selon le mod` le de e e e Slater. 5. Sachant que l nergie exp rimentale dun atome de b rylium vaut -399.70 eV, calculer e e e ` lerreur relative du mod` le de Slater par rapport a la valeur exp rimentale. e e 6. Calculer l nergie dun ion Be+ selon le mod` le de Slater. e e 7. Quel est le potentiel dionisation du b rylium selon le mod` le de Slater ? e e 8. Sachant que le potentiel dionisation exp rimental du b rylium vaut 9.34 eV, calculer e e ` lerreur relative du mod` le de Slater par rapport a la valeur exp rimentale. e e 9. Dapr` s les deux erreurs relatives calcul es pr c demment, quen concluez-vous sur la e e e e validit du mod` le de Slater ? e e

Exercice 3 On consid` re latome de carbone (C) ainsi que la mol cule diatomique C2 : e e ` e 1. Quelle est la conguration electronique a l tat fondamental de latome de carbone ? 2. Quel est le nombre d lectrons de valence et de cur de latome de carbone ? e 3. Les orbitales mol culaires des electrons de valence (OM 1...8 ) de la mol cule diatomique e e C2 ont pour expression : 2 = 0.622(2sa ) + 0.335(2pa ) 0.622(2sb ) + 0.335(2pb ) z z 3 = 0.707(2pa ) + 0.707(2pb ) y y 4 = 0.707(2pa ) + 0.707(2pb ) x x 5 = 0.261(2sa ) + 0.657(2pa ) + 0.261(2sb ) 0.657(2pb ) z z 1 = 0.657(2sa ) 0.261(2pa ) + 0.657(2sb ) + 0.261(2pb ) z z

6 = 0.707(2pa ) 0.707(2pb ) x x 7 = 0.707(2pa ) 0.707(2pb ) y y

8 = 0.335(2sa ) + 0.622(2pa ) + 0.335(2sb ) + 0.622(2pb ) z z o` 2sa , 2pa , 2pa , et 2pa sont les orbitales atomiques de valence du premier carbone, et u x y z 2sb , 2pb , 2pb , et 2pb sont les orbitales atomiques de valence du deuxi` me carbone. e x y z Les energies de ces OM (en eV) sont report es dans le tableau suivant : e 1 -30.856 2 -14.879 3 -11.168 4 -11.168 5 -3.106 6 1.031 7 1.031 8 4.848

` Indiquer pour chacune des OM 1 . . . 8 a quel type dOM elle correspond ( ou ?, liante ou anti-liante). 4. Dessiner le diagramme des orbitales mol culaires en prenant soin : de nommer et classer e les OM par ordre d nergie croissante, de respecter (grossi` rement au besoin) les ecarts e e energ tiques et de placer les electrons de valence dans leurs OM respectives 1 . e 5. A partir du diagramme des OM, donner la conguration electronique de C2 . 6. La mol cule C2 est-elle paramagn tique ou diamagn tique (justiez) ? e e e 7. Calculer lordre de liaison dans la mol cule C2 e 8. Calculer la diff rence d nergie en eV entre lorbitale mol culaire occup e par des electrons e e e e la plus haute en energie et lorbitale mol culaire sans electron la plus basse en energie. e Calculer la longueur donde quaurait un photon qui permettrait deffectuer le transfert dun electron entre ces deux OM. Donn es : 1 eV = 1,6 .1019 J ; h = 6, 626 .1034 J.s ; c = 3 .108 m.s1 ; e
1 On

ne demande pas ici de repr senter la forme des OM. e

GROUPE

PRIODE

1 1

IA
1.0079

TABLEAU PRIODIQUE DES LMENTS


http://www.ktf-split.hr/periodni/fr/
NUMRO DU GROUPE RECOMMANDATIONS DE L'IUPAC (1985) NOMBRE ATOMIQUE SYMBOLE NUMRO DU GROUPE CHEMICAL ABSTRACT SERVICE (1986)

18 VIIIA 2 4.0026

1
3

H
HYDROGNE

He
13 5
10.811

6.941

2 4

IIA
9.0122

2
11

Li
LITHIUM

Be
BRYLLIUM

13 5

IIIA
10.811 MASSE ATOMIQUE RELATIVE (1)

IIIA 14 6

12.011

IVA 15 7

14.007

VA 16 8

15.999

VIA 17 9

VIIA
18.998

HLIUM

10

20.180

B
BORE

B
BORE

C
CARBONE

N
AZOTE

O
OXYGNE

F
FLUOR

Ne
NON

22.990

12

24.305

NOM DE L'LMENT

13

26.982

14

28.086

15

30.974

16

32.065

17

35.453

18

39.948

Na Mg
SODIUM MAGNSIUM

19

39.098

20

40.078

3 21

44.956

IIIB 4 22

47.867

IVB 5 23

50.942

VB 6 24

51.996

VIB 7 VIIB 8 25 54.938 26

VIIIB
55.845

Al
10 28
58.693

Si
SILICIUM

P
PHOSPHORE

S
SOUFRE

Cl
CHLORE

Ar
ARGON

9 27

58.933

11 29

63.546

IB 12 30

IIB
65.39

ALUMINIUM

31

69.723

32

72.64

33

74.922

34

78.96

35

79.904

36

83.80

4
37

K
POTASSIUM

Ca
CALCIUM

Sc
SCANDIUM

Ti
TITANE

V
VANADIUM

Cr Mn
CHROME MANGANSE

Fe
FER

Co
COBALT

Ni
NICKEL

Cu
CUIVRE

Zn
ZINC

Ga
GALLIUM

Ge
GERMANIUM

As
ARSENIC

Se
SLNIUM

Br
BROME

Kr
KRYPTON

85.468

38

87.62

39

88.906

40

91.224

41

92.906

42

95.94

43

(98)

44

101.07

45

102.91

46

106.42

47

107.87

48

112.41

49

114.82

50

118.71

51

121.76

52

127.60

53

126.90

54

131.29

Rb
RUBIDIUM

Sr
STRONTIUM

Y
YTTRIUM

Zr
ZIRCONIUM

Nb Mo
NIOBIUM

Tc
75
186.21

Ru
76
190.23

Rh
RHODIUM

Pd
PALLADIUM

Ag
ARGENT

Cd
CADMIUM

In
INDIUM

Sn
ETAIN

Sb
ANTIMOINE

Te
TELLURE

I
IODE

Xe
XNON

MOLYBDNE TECHNTIUM RUTHNIUM

55

132.91

56

137.33

57-71

72

178.49

73

180.95

74

183.84

77

192.22

78

195.08

79

196.97

80

200.59

81

204.38

82

207.2

83

208.98

84

(209)

85

(210)

86

(222)

Cs
CSIUM

Ba
BARYUM

La-Lu
Lanthanides

Hf
HAFNIUM

Ta
TANTALE

W
TUNGSTNE

Re
RHNIUM

Os
OSMIUM

Ir
IRIDIUM

Pt
PLATINE

Au Hg
OR MERCURE

Tl
THALLIUM

Pb
PLOMB

Bi
BISMUTH

Po
POLONIUM

At
ASTATE

Rn
RADON

87

(223)

88

(226)

89-103 104

(261)

105

(262)

106

(266)

107

(264)

108

(277)

109

(268)

110

(281)

111

(272)

112

(285)

114

(289)

Fr
FRANCIUM

Ra
RADIUM

Ac-Lr
Actinides

Rf
RUTHERFORDIUM

Db
DUBNIUM

Sg
SEABORGIUM

Bh
BOHRIUM

Hs
HASSIUM

Mt Uun Uuu Uub


MEITNERIUM UNUNNILIUM UNUNUNIUM

Uuq
UNUNQUADIUM Copyright 1998-2002 EniG. (eni@ktf-split.hr)

UNUNBIUM

(1) Pure Appl. Chem., 73, No. 4, 667-683 (2001)


La masse atomique relative est donne avec cinq chiffres significatifs. Pour les lments qui n'ont pas de nuclides stables, la valeur entre parenthses indique le nombre de masse de l'isotope de l'lment ayant la dure de vie la plus grande. Toutefois, pour les trois lments Th, Pa et U qui ont une composition isotopique terrestre connue, une masse atomique est indique.

Lanthanides 57 138.91 58

140.12

59

140.91

60

144.24

61

(145)

62

150.36

63

151.96

64

157.25

65

158.93

66

162.50

67

164.93

68

167.26

69

168.93

70

173.04

71

174.97

La
LANTHANE

Ce
CRIUM

Pr
PRASODYME

Nd Pm Sm Eu
NODYME PROMTHIUM SAMARIUM

Gd
96
(247)

Tb
TERBIUM

Dy
DYSPROSIUM

Ho
HOLMIUM

Er Tm Yb
ERBIUM THULIUM YTTERBIUM

Lu
LUTTIUM

EUROPIUM GADOLINIUM

Actinides 89 (227) 90

232.04

91

231.04

92

238.03

93

(237)

94

(244)

95

(243)

97

(247)

98

(251)

99

(252)

100

(257)

101

(258)

102

(259)

103

(262)

Ac
ACTINIUM

Th
THORIUM

Pa
PROTACTINIUM

U
URANIUM

Np

Pu Am Cm Bk
AMRICIUM CURIUM

Cf

Es

Fm Md No
FERMIUM MENDELVIUM

Lr

Editor: Michel Ditria

NEPTUNIUM PLUTONIUM

BERKLIUM CALIFORNIUM EINSTEINIUM

NOBLIUM LAWRENCIUM

Le mod`le de Slater e
` ` Contrairement a latome dhydrog` ne et aux ions hydrog nodes, l nergie totale dun atome a plusieurs e e e electrons nest pas calculable de mani` re analytique simple. John C. Slater a d velopp dans les ann es e e e e 1929-1930 un moyen calculatoire simple pour retrouver ces energies : le mod` le de Slater. Cette th orie e e empirique est bas e sur les hypoth` ses suivantes : e e pour tout atome poly lectronique, chaque electron dune sous-couche n, l constitue avec le noyau e Zn,l 2 ` de charge Z un syst` me hydrog node fournissant une contribution I 2 (avec I = 13.6eV) a e e n l nergie totale de latome. e
e e e e Zn,l est appel e la charge nucl aire effective vue par l lectron de la sous-couche n, l. Il est diff rent de Z car les autres electrons localis s sur la couche n, l ainsi que dans les sous-couches inf rieures e e ecrantent le noyau (effet d cran). On a donc Zn,l < Z, soit Zn,l = Z n,l avec n,l la constante e d cran (> 0). e

` l nergie totale de latome est egale a la somme alg brique des contributions de chaque couple e e 2 e Zn,l electron-noyau : E = i = gn,l n,l = gn,l I 2 n i n,l n,l (avec gn,l le nombre d lectron dans une sous-couche n, l). e J.C. Slater propose un moyen simple d valuer n,l : la constante d cran est la somme de contribue e e tions el mentaires (les coefcients d cran) calcul es selon : e e electron consid r ee 1s 2s, 2p 3s, 3p 3d 4s, 4p 4d 4f electron faisant ecran 2s, 2p 3s, 3p 3d 4s, 4p 0.35 0.85 1 1 1 1 0.35 1 0.85 1 1

1s 0.30 0.85 1 1 1 1 1

4d

0.35 0.85 1 1

0.35 1 1

0.35 1

UNIVERSITE HENRI POINCARE FACULTE DES SCIENCES ET TECHNIQUES SUJET D'EXAMEN DIPLOME : Licence Physique Chimie Spcialit Chimie organique UE Chimie gnrale LCPC1U04 Dcembre 2009 Nom du rdacteur : P. GERARDIN Documents non autoriss Calculettes non autorises Dure de l'preuve : 1h30 Enonc de 2 pages

Exercice 1 Reprsenter le (cis)-1,2-dimthylcyclohexane et le (trans)-1,4-dimthylcyclohexane dans leur conformation la plus stable. Justifier votre rponse en faisant apparatre les interactions striques responsables de la dstabilisation de la conformation la moins stable. Combien de conformations peuvent exister ? Exercice 2 Reprsenter les molcules dont le nom est indiqu ci-dessous : a) (S)-pentan-2-ol b) (R)-2-chloro-2-mthyl-3-(1-methylethyl)hexane c) heptanoate de methyl d) (Z)-2-chloropent-2-ne Prciser la formule brute de chacune des molcules prcdentes ainsi que le nombre de stroisomres auxquels elles peuvent donner lieu. Exercice 3
CH2OH H OH a) H OH CH2OH Me b) Me c) Me Me d) H H H CH3 H OH

Indiquer et prciser la configuration absolue des atomes de carbone asymtrique prsents dans chacune des molcules reprsentes ci-dessus. Indiquer si les molcules prcdentes sont chirales en justifiant clairement votre rponse. Exercice 4 Pour chacune des molcules ci dessous, donner les reprsentations manquantes.
CH2OH OH OH CH2OH

H a) H

........................ en reprsentation de Cram?

....................... en reprsentation cavalire?

H b) HOOC HOH2C H H Cl H H OH H OH OH

........................ en reprsentation de Fischer?

....................... en reprsentation cavalire?

c)

........................ en reprsentation de Fischer?

....................... en reprsentation de Cram?

Exercice 5 Lacide tartrique de formule brute C4H6O6 correspond la formule HOOC-CHOH-CHOH-COOH. - Combien de formes stroisomres peuvent-elles exister? - Reprsenter tous les stroisomres de lacide tartrique en dcrivant les relations strochimiques existant entre chacun de ces composs (nantiomre ou diastroisomre). - Attribuer la configuration absolue de chacun des carbones asymtriques de ces stroisomres. - Est-il possible de sparer les stroisomres prcdents? En faisant ragir le mlange dacides (R,R) et (S,S) tartrique avec la cinchonine (amine naturelle existant sous forme natiomriquement pure), Pasteur parvint en 1853 a sparer les sels diastroisomres par cristallisation fractionne. Les acides tartriques nantiomres sont ensuite obtenus facilement par acidification du mlange. Expliquer

Cinchonine

Exercice 6 Classer en justifiant votre rponse les composs suivants par ordre dacidit dcroissante. CH3COOH, CF3COOH, CF3CH2OH, CH3CH2OH, CH3OH Exercice 7 Le chlorure de benzyle (I) et le chlorure de paramthoxybenzyle (II) sont traits dans lthanol pour conduire aux thers correspondants selon un mcanisme de type SN1 :
CH2Cl X I : X=H II : X = OCH3 EtOH X CH2OEt

- Tracer le diagramme nergtique de ces deux ractions. - Expliquer en justifiant votre rponse pourquoi le chlorure de paramthoxybenzyle ragit mieux que le chlorure de benzyle.

# ( % )

!" $% & ' &! ! * ' %

./ %

. " !,/ % !,/ " & ! " $

# % &' % &' ! &

&. % 1 )

0 *

( ) ( ,

1. % 2
%

0 # +
%

% (

) % )

2. % 2 ) ) ) -. #

0 ) # , # -0 # . -1 . % -.

( ' - .#

-.

-. (/

". % 2 ) 4 5 #

2 ) # 56

# 3 489 7

L1 PC : UE douverture, le globe terrestre Examen 1re session, janvier 2009 Ccile FABRE
Dure une heure sans document, sans calculatrice

RENDRE LES FIGURES AVEC VOTRE COPIE


Les brouillons ne seront pas corrigs. La rdaction doit tre faite au stylo, le crayon papier nest pas valable pour une copie dexamen. Le crayon peut la rigueur tre utilis pour les schmas, lexception des lgendes, ainsi que des annotations portes sur ces schmas. Vous devez fournir une copie propre, des explications claires et des schmas soigns. Vous devrez notamment respecter les indications suivantes : vocabulaire scientifique prcis syntaxe claire respect de lorthographe et de la grammaire rdaction sans abrviation

ETUDE DE DOCUMENTS

14 points

Le document 1 prsente la rpartition des principaux tremblements de terre enregistrs la surface du globe. Sur ce document et en justifiant votre choix, vous devez : 1. Associer une zone gographique chacun des diffrents contextes godynamiques suivants : A subduction, B collision, C coulissage, D ocanisation, E rides ocaniques, F point chaud 2. Sur le document 1, dlimiter les diffrentes plaques lithosphriques et les numroter, les nommer sur votre copie de rdaction. 3. Identifier les zones colores en bleu clair.

Le document 2 prsente les variations des teneurs en gaz de CO2 et CH4 de latmosphre terrestre. Vous devez : 4. Prciser lchelle des abscisses 5. Commenter et expliquer les volutions des teneurs des gaz 6. Tracer sur le document les variations que lon peut attendre de la temprature, par rapport la temprature actuelle. Justifiez votre rponse. 7. Rappeler comment il a t possible de connaitre la composition de latmosphre passe.

QUESTIONS DE COURS

6 points

8. Quels sont les ges de lUnivers, de notre galaxie, la nommer et de la Terre ? 9. Nommez un grand bassin versant lchelle du globe 10. Quel est lge maximal de la crote ocanique ? justifier votre rponse.

Document 1

Document 2

UNIVERSITE DE NANCY I FACULTE DES SCIENCES ET TECHNIQUES SUJET D'EXAMEN

DIPLOME Epreuve :

L1SM Cursus Intgr UE LPC1U07 Epreuve de Chimie des Solutions

Nom des rdacteurs : M. Dossot Dure du sujet : 1 heure

Documents autoriss Session de Date Horaire Janvier 2010 Documents non autoriss Calculatrices autorises Calculatrices non autorises

Toutes les rponses doivent tre soigneusement justifies. Aucune formule non dmontre ne sera accepte.
Exercice 1 : On ralise le mlange 25C de deux solutions : V1 = 200 mL dune solution 1 d' ammoniaque (base faible) NH3 de concentration c1 = 0,020 mol L-1. V2 = 400 mL dune solution 2 de chlorure dammonium (acide faible) NH4Cl de concentration c2 = 0,015 mol L-1. On suppose qu'aprs le mlange, le volume final est V1+V2. On appelle solution 3 le mlange obtenu. a) Calculez, en prcisant vos hypothses et en les justifiant, le pH de la solution 1 d'ammoniaque. b) Quel nom donne-t-on la solution 3 ? c) Quelles sont les concentrations initiales (juste aprs le mlange) de NH3 et NH4+ dans la solution 3 ? d) Calculez, en prcisant vos hypothses et en les justifiant, le pH de la solution 3. e) Quelles sont les concentrations finales de NH3 et NH4+ dans la solution 3 ? Donnes : pKa(NH4+/NH3) = 9,2 ; pKe(25C) = 14.

Exercice 2 : On ralise une pile comprenant une lectrode de zinc (Zn) plongeant dans une solution C1 = 0,1 mol. L-1 de nitrate de zinc (Zn2+, 2 NO3-) et une lectrode d'argent (Ag) plongeant dans une solution C2 = 0,1 mol. L-1 de nitrate d'argent (Ag+, NO3-). a) Faire un schma de la pile en indiquant les polarits des lectrodes, les demi-ractions lectroniques mises en jeu aux lectrodes, le sens de parcourt des lectrons et le sens conventionnel du courant. Un pont salin ayant comme lectrolyte NH4+, NO3- relie les deux compartiments. b) La pile fonctionnerait-elle si on remplaait le pont salin par un fil de platine (justifiez la rponse) ? c) Calculer la fm de la pile 298 K. Donnes 298 K : E ( Ag+/Ag ) = + 0,80 V/ENH ; E ( Zn2+/Zn ) = - 0,76 V/ENH.

Exercice 3. Le potentiel standard du couple (MnO4-/Mn2+) vaut E0 = +1,51 V/ENH. a) Quel est le nombre d'oxydation de Mn dans MnO4-? Dans Mn2+? b) Ecrire la demi-quation lectronique associe ce couple. c) Donner l'expression thorique et calculer le potentiel de Nernst E de ce couple pour des concentrations de 0,2 mol L-1 en MnO4-, 0,5 mol L-1 en Mn2+ et un pH = 4.

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES EXAMEN DE JANVIER 2010 Licence LCMA - 1re anne
Analyse 1 - Semestre dautomne Calculatrices non autorises Dure du sujet : 3H Responsable : G. Eguether Documents non autoriss

Exercice 1 Calculer la drive nime de la fonction f dnie sur ] 0, + [ par 1 f (x) = . x On exprimera le rsultat nal avec des factorielles. Exercice 2 Soit f une fonction dnie et continue sur [ u, v ] , drivable sur ] u, v [ , telle que f (u) = f (v) = 0, et soit a un nombre rel nappartenant pas [ u, v ] . En introduisant la fonction g dnie sur [ u, v ] par g(x) = montrer quil existe c dans ] u, v [ tel que f (c) = Faire un dessin illustrant le rsultat obtenu. Exercice 3 Calculer les intgrales
/4 1

f (x) , xa f (c) . ca

I=
0

dx cos x(sin x + cos x)

et J =
0

x arctan x dx .

T.S.V.P
1

Exercice 4 Pour tout x rel on pose


2x

f (x) = x e a) Etudier les variations de f . b) Montrer que F est impaire.

2 x2

et F (x) =
x

f (t) dt .

c) Calculer F (x) pour tout x rel et tudier son signe. d) Montrer que pour x 1, on a En dduire la limite de F +. e) Trouver un encadrement analogue de F (x) lorsque 0 < x < 1/2 et en dduire quau voisinage de 0 on a F (x) = (x2 ). f) Donner lallure de la courbe reprsentative de F . Exercice 5 Etudier au voisinage de 0 la courbe paramtre par x(t) = 1 + t ln(1 + t) et y(t) = t2 1 et faire le dessin correspondant. Exercice 6 Etudier et reprsenter la courbe paramtre par x(t) = t 1 t2 et y(t) = t2 . 1t t 3 ch t

0 F (x) x3 ex .

On prcisera en particulier les trois asymptotes de la courbe et la position de la courbe par rapport lasymptote oblique.

UNIVERSITE HENRI POINCARE I. NANCY 1 FACULT DES SCIENCES


Diplme : L1- M/SPI/I & L1- PC- sujet commun Anne : 2009-2010 Matire :ANGLAIS Date : janvier 2010 Sujet : P.Collin-Metzger
Note / 20 Note / 80 APPRECIATIONS EXPLIQUANT LA NOTE CHIFFREE:

Green means go
I Dcidez si les affirmations suivantes sont vraies ou fausses. Inscrivez V ou F dans lespace prvu cet effet. (22 points) Attention ! Barme dgressif pour cet exercice ___ 1- Au Royaume-Uni, les voitures elles seules gnrent un quart des gaz effets de serre. ___ 2- Le gouvernement britannique vient dadopter officiellement une mesure qui vise diminuer les missions nocives provenant des transports dici 2050. ___ 3- Cette mesure va gnrer 1,2 millions demplois dici 2020. ___ 4- Le domaine des nergies vertes regorge de personnel qualifi. ___ 5- Rolls Royce et BAE Systems sont de trs bons exemples de compagnies vertes. ___ 6- Les mesures gouvernementales ne vont sappliquer quaux plus grosses firmes de transport routier dans un premier temps. ___ 7- Le Dpartement de lEnergie britannique privilgie le choix des voitures lectriques lavenir, telles que le modle Aptera. ___ 8- Malgr labsence dinfrastructure adquate, Jeff Hardy, du Centre de Recherche sur lEnergie Londres, est optimiste car le Royaume-Uni est dj en mesure lheure actuelle de fournir lnergie ncessaire tous les vhicules lectriques futurs du pays. ___ 9- Les piles combustibles reprsentent le procd nergtique le plus efficace ce jour mais restent dun cot lev, ce qui freine leur utilisation massive. ___ 10- Il existe aujourdhui un tout nouveau procd qui permet de crer des carburants verts pour les avions partir de CO2. ___ 11- Quant aux trains verts, ils sont galement inclus dans les projets gouvernementaux pour dsengorger le trafic arien des vols intrieurs courts.
PCM UHP Nancy 1 - January 2010

II Replacez les mots de liaison suivants, extraits du texte, en fonction de leur ordre logique dapparition dans le texte et traduisez-les en contexte: (16 points) as despite even for instance nevertheless whats more while yet - = - = - = - = - .. = . - .. = . - .. = . - .. = .

III Vocabulaire. (42 points) A] Trouvez les quivalents anglais des mots suivants dans les paragraphes dlimits : (10 points) 1- to give (offer)( intro) = ... 6- entire (l.70 80) = . 2- to announce (l.1 10) = .. 7- aim (l.80 90) = 3- to change (l.10 20) = 8- an apparatus (l.110 120) = ... 4- additional (l.10 20) = 9- a hurdle (l.130 140) = 5- big (l.40 50 ) = . 10- tight (l.140 150) = .. B] Trouvez les antonymes anglais des mots suivants dans les paragraphes dlimits : (10 points) 1- tiny (l.20 30) .. 2- a lack (l.20 30) ... 3- narrow (l.30 40) . 4- small (l.40 50) 5- to drop (l.160 170) . C] Traduisez les mots/groupes de mots suivants extraits du texte : (10 points) 1- greenhouse gas (l.7) : .... 2- sustainable development (l.51) : ... 3- funding (l.52) : .. 4- meet the CO2 reduction target (l.89-90) : . 5- a fuel cell (l.118) : . D] Trouvez lquivalent anglais des mots suivants dans les paragraphes dlimits : (12 points) 1- faonner (col.1) : .... 7- les cultures (col.4): . 2- une menace (col.1): 8- les dchets (col.4): . 3- le rservoir (col.3): . 9- alimenter (en nergie) (col.4) : ... 4- actuellement (col.3): .. 10- la croissance, lexpansion (col.6): 5- disponible (col.3): .. 11- une usine (col.6): .. 6- lancer (col.3): . 12- dpendant (col.6): .
PCM UHP Nancy 1 - January 2010

THE INSIDER

Green means go
From electric cars that resemble spaceships to fuels made using atmospheric carbon dioxide, the quest for greener transport offers some surprising vistas. Is this all wishful thinking, or is there a real career to be made out of providing green energy for the transport industry? Catherine de Lange investigates

10

15 17

SOCIETY has tended to be shaped by its modes of transport, from the horse and cart to the car and the plane. Now, though, our world and its transport systems are being shaped by the threat from climate change. In the UK, transport alone accounts for around a quarter of greenhouse-gas emissions, so the big question is how we can make it green. This challenge has become more pressing since the government released its white paper on energy and climate change in July. With slashing emissions by 80 per cent by 2050 now an official target, the focus of transport research has shifted from miles per hour to miles per gallon, says Roger Kemp, professor of engineering at Lancaster University. This shift has been helped by the white

18

Have your say


What will transport look like in 50 years?
"Planes might skim the ocean's surface and fly from harbour to harbour, like the Ekranoplan concept developed by the Russians during the cold war" John Barton, director of technology transfer at Air Fuel Synthesis in Uxbridge, Middlesex "Cars might travel down the motorway with no drivers, tracked by satellite, using biofuel or electricity to travel long distances" Barry Potier, co-founder of Resourcing Solutions, a renewable-energy recruitment consultancy in Ruscombe, Berkshire "Ferry speeds will be reduced and smoking funnels will be replaced with the whine of a fuel cell-powered electric motor whose waste product -water - can be safely discharged over the side" Tristan Smith, mechanical engineering research assistant at University College London

paper's focus on green transport, and boosted by its prediction that an estimated 20 1.2 million extra green energy jobs will be created by 2020. "Green energy for transportation is a huge marketplace," says Barry Potier from Resourcing Solutions, a recruitment consultancy based in 25 Ruscombe, Berkshire, that specialises in renewable energy. To sustain this marketplace, the UK will need a strong base in terms of expertise. Combine this with the fact that there is a 30 real shortfall in people with the technical skills required, says Potier, and those who have the qualifications can have their pick of the jobs. "Energy should be the career of choice for all scientists, technicians and 35 engineers at the moment it's a nobrainer," adds Kemp. So where should you begin? In such a broad industry the options can be overwhelming, so focus on getting a 40 grounding in an applied science or engineering, advises Tristan Smith, a mechanical engineering research assistant at University College London. "Employers are looking for excellent knowledge of first 45 principles, rather than someone who can just 'talk the talk' ". It doesn't necessarily pay to start with the greenest companies either. Large engineering firms, such as Rolls-Royce or 50 BAE Systems, might not be the poster boys of sustainable development at the moment, says Smith, but they do have the funding and graduate training schemes to give you the best start. 55 All transport methods will be affected by the government's target, with the Royal Society saying that "radical" changes in how we travel and the way we fuel our vehicles will be needed. So which area 60 should you specialise in? Road transport is ahead of the game, having received some of the biggest investments for green projects. Steven Chu, the US Secretary of Energy, has stated his 65 belief in the "inevitable transition to electricity as the energy for our personal 67 transportation". Even Google is investing

in green cars, bankrolling the futuristic Aptera which not only looks good, but 70 runs off electricity too. ...... despite this support there is still a long way to go. "Your electric car is only as green as your electricity supply," says Jeff Hardy, from the UK Energy Research Centre 75 in London. One of the biggest challenges will be to make sure the electricity we use to charge our cars is low-carbon. ...... , we will need a whole new infrastructure to charge them think 80 exchanging your battery when you stop at a service station rather than filling the tank. This infrastructure just doesn't exist yet. Then there is all the energy needed to run the new system: "Switching 23 million cars 85 to electric, that requires quite a large extra chunk of electricity that we don't currently produce," says Hardy. According to Smith, these challenges are no bad thing. "If we are going to meet any of our CO2 reduction 90 targets, there's so much for engineers to get stuck into. For anyone who enjoys a challenge, this is the most exciting time since the industrial revolution." electricity for cars is seen as a 95 winning
68

"Employers are looking for knowledge of first principles, rather than someone who can just 'talk the talk"
investment, biofuels are more contentious. A recent study by the European Commission predicts that, of all the renewables, biofuels will offer the most career opportunities in 100 the future. Yet confidence in this energy source is far from universal, as producing biofuel would involve encroaching on agricultural land. if you could power all cars with it, no one would be able to eat, 105 argues Kemp. these doubts, there is cash available for research. This year the Biotechnology and Biological Sciences Research Council invested 27 million in 110 biofuels by launching the
96

New Scientist September 2009

PCM UHP Nancy1

To search more opportunities go to www.NewScientistStudy.com

135

140

for young scientists? Not according to Brandon. "We absolutely have to address our emissions from the transport sector and there are very few ways we can do it," he says. "For young scientists and engineers in the years ahead there are tremendous opportunities to make a contribution. The challenges are there and fuel cells are part of the solution."

Green Flying
145

150

155

160

165

170

175

180 111

115

120

123

Sustainable Bioenergy Centre, a partnership between academia and industry. There is still hope for biofuels, says Hardy, because there is a lot of interest in what comes next second and third-generation technologies which move us away from crops as a fuel source and towards using agricultural waste, . Using fuel cells to power vehicles is another exciting and hotly debated prospect. "A fuel cell gives us the highest efficiency device for producing electricity that we know of. It produces very low emissions too, so it's efficient and it's clean," says Nigel Brandon,

Save the planet while looking chic in Google's electric car


124

130

134

director of the Energy Futures Lab at Imperial College London. , issues such as refuelling and ensuring the energy comes from renewable sources are proving problematic, as is the fact that fuel cells are still expensive to produce. "We need to work to make those fuel cells cheaper, and to do so we need to develop new materials," says Brandon. All these obstacles stand between fuel-cell cars and the mass market. So is it a career dead end

185

190

It's not just road traffic that needs to become greener. Flights are on the increase, with "startling growth" predicted for the next 20 or 30 years, says Hardy. "It is also incredibly difficult to decarbonise because you have very strict regulations," he says. So can we really make aviation green? Yes, says John Barton, director of technology transfer for Air Fuel Synthesis in Uxbridge, Middlesex. They are working on a method for capturing atmospheric C02 and combining it with hydrogen to make petrol, diesel and kerosene. The plan is to build pilot plants to demonstrate the technology, which could ultimately be installed on aircraft. "This is an excellent area for young scientists to work in," says Barton. "There are many avenues to explore, from different physical and chemical ways of capturing C02 to fuel production technologies." Rail is still one of the greenest modes of travel, with electric trains becoming greener the electricity grid decarbonises. And the number of electrified lines is due to increase. The government recently announced that 1.1 billion will be spent on electrifying the line from London to south Wales, and is planning to create more highspeed rail links as an alternative to domestic and short-haul flights. "That means big potential for jobs in the future," says Hardy. "If the government becomes more serious about high-speed rail then there are all sorts of challenges - track work, engines, cables so a lot of engineering needs to be done." The world will depend on scientists to help wean us off the internal-combustion engine on which we have grown so reliant, says Smith. "We need to rethink everything from commuting to work to the synthetic fibres that are used to make your office chair," he argues. engineering goes, there aren't many careers with such a great feel-good factor, as Barton points out: "I'm doing something good for the world, building the future and doing something new. It's a very exciting time."
Catherine de Lange is a science writer based in London

PCM UHP Nancy1

? # " * @@@@@@@@@@ @@@@@@@@@ ! * @@@@@@@@@@@@@ @@@@@@@@@@@@@ #! * @@@@@@@@@@@ @@@@@@@@@@@ # $ * @@@@@@@@@@@ @@@@@@@@@@@

" ! # " $" $ % # " $ ' $$ " & '

! " ! #

( ) * ! "
+ $ $ ! ,! 3 % " %! " ' - ! . % , # ! $ # 4 ! 5 # " % ! 6 72 8 4 " % !! /01 2 !

"
+ ! $ $ 9 : 4 "4 . " $;! 9 ! ! % 4 " " '< # "! #8 ( $& # %! . # # $# =( % !! ! $ ( " ! $& ! % ! ! # 3( % !! ! > $ ( 4 . " . 9 ' # % #$ $ ! ! $ ' "! % ! ! $$

% "

. 9

! "

$ %

$" # % "
(! )* * + B*% .!% $ ! " "5 # % ! $ " $" . 8

;" ! 5 3 & ' "& A & ' $" ! ;" 5 # 8 ! . ! % ##" $ ;" ! ' 4 9

7 3!

C7

- .

;" D E

"

. $

-! & $!

, 3

&
G - % HHH( * + $$ ' $ " "

"
(! & $" % "% ! % " # ! ! " (- $ E $"% & G " " $ $ " A %& & " 9 8 , " B(

'
! , $ I ;" % . E F %$

"
% 4 ! $ % !# & 9 " ,* ! C F '9", ( $ I # , # !( %! ! %

(
" $ ( =( ( 3(

"
$$ $ . $$ %. $ E ! # ! . $ -4 & % > # " ! '' '9 " 8

" ! 9 " I . $" ; 9 ! %D J ! "% 4 " ! - C $ - & " ; , ; $ "! ; % "

)
3" $! & $

"
" , I ;" % $$ . % ! % " "- , " & % 8

"
-. " $

3" %# " ! ! " I ! - ' " % " $ $! ! ; ! " " %" K & 9 # "! 9( ! % ' $ %! # 8 ) " " $ &" #" I " # " % % $ . $ $' $. "

+
! $; L

-# .

; ! $# ! . * $ * ! M ' (' " , * ! 7M ' (' " -.* ! FM ' (' " / * .L " 9 -4 ! " ;" " & ' $ ' ;" ! " 9 /0 . A B

B8

"
"$! A ' ". ! 4 #B ! " K ! ( C (

$ % " # % -# " .

! < " ! - # I ! $"% ! " % # ! $ E9 I "! ; 9"! % ! " # $ $ " )% )' (: ' $"' ! ! %4% " ( $ ! & ! " ;" %! ' ! $$ ! " $ - % " 9 " *
9$ #

#! 3 " "

! " % "! ' O! $$

FI NI I

" % 3 4 ! >"

$$ 60111 " 5 60/11 $$ 60671 " ! ,

5 % $ $ ' ! C =! I )

"" = = )

" 7110 711F 1

5 * $ I! % ' I! I 9 I P " - . " # ;" " " ' ' # * = D =! I =! I = = " * " # "- ' " ' #

" )4 J 0

0 $

1! I ' ! ( . ! !& ! " " $ " ! $ ;-9

J !

Q $ &" % ;" $" 9 ! # # 9 E ! # $$ $ % " 9 # ! ! % % "

F J 9 71 1 " ! I $$ C " # 9 &

1-E R !

# ! #( 9

0 D $

2 I . ! !& ! " " $ " ! $ ;-9

J !

Q $ &" % ;" $" 9 ! ' ! # # 9 E ! # $$ $ ( % " 9 # ! 3" $ ! % % "

F J 9 71 1 " ! I $$ C " # 9 & "" . C$

1-E R D "" 3$

! , . %! 9

# ! #( 9

"! ; 9"! % ! $"4 " ! # (

" "! I ' - % $ #* "

7 3" $ - % ! "

"! ; 9"! % ! "" " ! $( . C ! ! *

"! I '

4 3$

, . %! 9

! 1 E ! $

' C 9 % "! ! ! J % ! "" 5 ' '

I 9 $"' "" ! "2 # 4 ! !

%$ !

% " -

5 * %

D 4 "- 8 ! "

3
) ! D $"' $$

$ # %" # %" "


"$ 4 )% " $ % $ ! *

0 6 /

7 F

> F 7

O 0 1

3" $" $$ $ I " $"' ! % ! $ S T / U >T V T /( / OT ! $" ! " ! " . % " $" $$ $ > O ( 3! C $"' ! $ '& " " 7 $$ $ ( 3! C $ # $ " ! " $ F $$ $ ( W " % $ * % " 9 ! ## ! #" E 1 &$ $$ $ # " $ " $X $

7 3" $" $$ $ 0I " ! " " $ $ ! $ F 9$ " $"$ & 0 ! % $"' ! $ " ! ". " $ 7 $$ $ 6 / % $" ! ! 3! C $"' ! $ '& " 0 " $ $ 5 4$ U " $ ! ( - & " I ! O 8 ! $ . $$ 8 >

"$ "I 4 % $& 6 " $

/( $$ $

F 3" $" $$ $ 0I 9 ! % $" " $ 8 $

" $ $

$" ! 5

"

0I O0 >0I

0( 3!

C7' !

$ %" "
! J #( ) ! ! ; ! ! D $"' $$ I ! " ! #" $ 9 4 "$ 4 )% " $ % $ $" ! ' ! * ! ! 4 "-

= Q ! 7 F 0 6 / > "" $ ! '$ " " " $4 ! 4 && # % " N / 7 0 6 7 /

3 """ ! # 4 1 1

3" $" " 3 I ! " ! " ! " - + $$ ' ( !

" ! ". ! ! "

! 4 $$ $ 8

J !

"" "" ! # 5 4

! 9 $" ! % # E 0I !

" D " ! ". 9" ! ' 8 "

' !

!& " $

$$ $

"" 5

9$ "

Licence 1, semestre 2

Informatique pour les scientiques

Janvier 2010 dure : 2 heures Documents autoriss


Lnonc comprend deux pages. Le barme est indicatif. Les exercices sont indpendants, en revanche, les questions des exercices peuvent ne pas ltre. La concision, la clart et la lisibilit des rponses sont de rigueur (il en sera tenu compte lors de la correction). Par exemple, il est demand que les algorithmes soient soigneusement indents et que les notations dcrites en cours soient respectes. Les exercices 1 et 2 dune part et 3 et 4, dautre part, doivent tre rdigs sur des copies spares (un correcteur pour les exercices 1 et 2, un autre correcteur pour les exercices 3 et 4).

Ex. 1. (7 points) p Un rationnel est reprsent par deux entiers p et q, o q est non nul. On le note , p sappelle le numrateur et q, le dnominateur. q Cet exercice vise donner une implantation informatique des rationnels. On utilisera une notation mathmatique classique pour les entiers (0, +, , etc.). Q1 (1 pt) On veut reprsenter le type rationnel reprsentant les rationnels, par un enregistrement deux champs : num et dnom (numrateur et dnominateur). Par exemple, crire_num(6,crire_dnom(35,zro)) est une reprsentation du rationnel 0 6 . zro est une constante de type rationnel de valeur . Autrement dit, lire_num(zro) vaut 0 et lire_dnom(zro) 35 1 vaut 1. Les oprations primitives sur le type rationnel sont donc les constructeurs zro, crire_num et crire_dnom et les accs lire_num et lire_dnom. crire les prols de ces oprations primitives. Q2 (2 pts) crire un jeu daxiomes liant ces oprations primitives. 2 4 Q3 (1 pt) Deux rationnels peuvent tre gaux en ayant des numrateurs et dnominateurs diffrents. Par exemple, = . 3 6 a1 a2 De faon gnrale, on a = si et seulement si a1 b2 = a2 b1 (o dnote la multiplication entre entiers). b1 b2 crire un jeu daxiome(s) pour lgalit entre rationnels. Q4 (1 pt) Soit a2 a1 et deux rationnels. Leur somme et leur produit sont dnis par : b1 b2 a2 a1 b2 + a2 b1 a1 + = b1 b2 b 1 b2 crire un jeu daxiome(s) pour la somme de deux rationnels. crire un jeu daxiome(s) pour le produit de deux rationnels. Q5 (1 pt) En sappuyant sur les oprations ci-dessus, crire un algorithme pour la somme des lments dun tableau de rationnels. Q6 (1 pt) Comment modier lalgorithme de la question prcdente pour avoir le produit des lments dun tableau de rationnels? a1 a2 a1 a2 = b1 b2 b1 b 2

Ex. 2. (3 points) Soit le type liste des listes dont les lments sont des caractres. Il est muni des oprations primitives habituelles : cons, l_vide, est_vide, prem et reste. Soit le types arbre des arbres binaires dont les lments sont de type typlt. Il est muni des oprations primitives habituelles : cons, a_vide, est_vide, racine, filsG et filsD. Notons quil y a deux oprations cons et deux oprations l_vide et que lambigut est leve par le contexte : cons(x,L) est ncessairement une liste alors que cons(r,G,D) est ncessairement un arbre (2 ou 3 paramtres, respectivement) ; est_vide(X) est un boolen et il sagit de lopration est_vide sur les listes si X est une liste et sur les arbres si X est un arbre. Q1 (1 pt) Un chemin est une liste dont les lments sont tous lun des deux caractres G et D (pour gauche et droite , respectivement). Par exemple (G D G D D) est un chemin. Lopration est_chemin teste si une liste est un chemin.

Dnir lopration est_chemin soit par un jeu daxiome(s), soit par un algorithme (au choix). Q2 (2 pts) Soit L un chemin et A un arbre. L va permettre de slectionner un sous-arbre de A : il suft de suivre le chemin L en prenant les directions (gauche ou droite) successives de L pour parcourir larbre A. Par exemple, si L = (G D D), alors sous_arbre(L,A) = filsD(filsD(filsG(A))). Dcrire un exemple. Donner un jeu daxiome(s) pour lopration sous-arbre.

Ex. 3. (4 points) Un palindrome est une chane de caractres qui se lit de la mme faon dans les deux sens (de gauche droite et de droite gauche). Par exemple, "ANNA" et "RADAR" sont des palindromes. Q1 (2 pts) crire lalgorithme de la fonction est_palindrome qui prend en paramtre une chane de caractres ch et qui retourne VRAI si et seulement si ch est un palindrome. On notera longueur(ch) le nombre de caractres de ch et ch[i] le ime caractre de ch (0 i longueur(ch) 1). Q2 (1 pt) Traduire cet algorithme en C. Q3 (1 pt) Soit la fonction en_majuscule qui une chane de caractres ch1 associe la chane de caractres ch2 de mme nombre de caractres et telle que si ch1[i] est une lettre minuscule, alors, ch2[i] est la lettre majuscule correspondante et sinon, ch2[i] est gal ch1[i]. Par exemple, si ch1 prend les valeurs "Radar", "OTTO" et "aBc123", en_majuscule(ch2) prendra respectivement les valeurs "RADAR", "OTTO" et "ABC123". Soit la fonction est_palindrome_modulo_casse qui teste si une chane est un palindrome, modulo la casse (i.e., la diffrence majuscules-minuscules). Par exemple, est_palindrome_modulo_casse("Anna") retourne VRAI alors que est_palindrome("Anna") retourne FAUX. Donner un algorithme pour est_palindrome_modulo_casse en vous appuyant sur les fonctions est_palindrome et en_majuscule.

Ex. 4. (6 points) Soit ensemble, le type des ensembles nis de typlt (o typlt est un type donn). Ses oprations primitives sont : ens_vide : reprsente lensemble vide : . ajouter : ajouter(x,E) est lensemble obtenu en ajoutant x E. est_videens : est_videens (E) signie que E est lensemble vide. soit : soit(E) donne un lment de E si E est non vide et gnre une erreur sinon (la spcication nen dit pas plus). supprimer : supprimer(x,E) est lensemble obtenu en supprimant x de E (si x nappartient pas E, cette opration laisse E inchang). Par exemple, lalgorithme suivant dcrit la fonction qui teste lappartenance dun typlt un ensemble : fonction appartient (x : typlt, E : ensemble) : boolen var y : typlt dbut si est_vide (E) alors retourner faux fsi y := soit (E) retourner (x = y) ou appartient (x, supprimer (y, E)) fin Q1 (1 pt) Soit lopration cardinal qui un ensemble ni associe le nombre de ses lments. Donner un jeu daxiome(s) ou un algorithme de cette opration (au choix). Q2 (3 pts) Soit inter, lopration qui donne lintersection de deux ensembles. Donner un algorithme rcursif et un algorithme itratif de cette opration. Q3 (2 pts) Soit liste, le type des listes dont les lments sont des typlt, muni des oprations primitives habituelles (l_vide, cons, est_vide, prem et reste). On veut reprsenter un ensemble grce une liste. Par exemple, lensemble {a,b,c} pourra tre reprsent par lune des listes suivantes : (a b c), (c a b), (b a a c b), etc. Pour chacune des oprations primitives de ensemble, donner un jeu daxiomes(s) qui limplante en sappuyant sur les oprations primitives de liste.

S2 Automne Licence Maths / Informatique / SPI / Physique et Chimie: ANGLAIS Janvier 2009 A) Comprehension Questions Read the text and answer the questions. 1) What has been invented and by whom?
/2

2) Say if the following sentences are true or false and justify using the text. (Justifiez votre rponse en citant le texte.. Ne rcopiez pas plus d'une phrase. Les rponses du style : 2, l 2-4 ne seront pas acceptes.) a) Augmented Reality involves mixing digital information and the real world. b) At present, there are no other devices which use Augmented Reality. c) Parviz wears contact lenses. d) Parviz's main motivation was to make a miniature device. e) The lens will need a lot of electricity to function correctly. f) The image will appear directly on the lens. g) The product is safe for humans to use. h) This device may benefit the visually impaired. i) Deaf people may be able to use it . T/F T/F T/F T/F T/F T/F T/F T/F T/F T/F T/F
/22

j) Wolffsohn thinks the amount of space on the lens is the biggest problem. k) Wolffsohn thinks the device could be dangerous.

3) What alternative to contact lenses does Wolfsohn propose? Why?

B) Vocabulary 5) Find synonyms in the text for: paragraphs 1 to 4: to be a question of: to appear:

to permit: to mix: to share part of the same space: paragraphs 5 to 8: motivation: to adjust one's eyes on an object so that its image is clear: paragraphs 9 to 12 the person using the contact lens: in preparation / planned: paragraphs 13 to end a problem: to watch with special attention: 6) Find the English for: paragraphs 9 to 12 un appareil: faire mal la scurit contrler: la sant: plusieurs: malentendant ou sourd: 7) Linkwords. a) Find the English for: paragraphs 7 to 16 - evidemment: - en tout cas: - cependant: - bien que: - aussi: - par exemple: - nanmoins: b) Now choose a linkword from a) to put in these sentences: ____________ I have never worn contact lenses, I would love to try these ones! I would, ___________, be a little concerned about having an electronic device in my eyes.

/11

/7

/7

/2

A new kind of reality right before your eyes.


1 Since they first appeared, contact lenses have brought forth a new age in treating diseases of the eye and eliminating the need for glasses. Over the past decades, the production process related to these lenses has also evolved spectacularly. Now, with the advent of nanotechnology and advanced electronics, a new revolution in contact lenses may be at hand. 2 When you drive your car your dashboard instruments display the speed, amount of fuel left, and distance travelled. You can use Google Maps on your smart phone to find restaurants, post offices, or other important landmarks all around you. Why cant this sort of information be given to you all the time, streaming directly into your field of vision on a contact lens? Thats the question University of Washington Prof. Babak A. Parviz is asking. 3 Parviz and his team have been developing miniature circuits and simple LED (light-emitting diodes) displays and integrating these elements onto a contact lens. As Parviz points out, introducing Augmented Reality onto a contact lens is just a matter of time and effort. 4 Augmented Reality applications are starting to crop up everywhere, from table top games, to mobile phone applications. AR allows digital images and information to be blended with streaming video in real time. Using a computer screen or TV, the digital world and the real world overlap before your eyes. Pavik wants that statement to be literal: the overlap should be right before your eyes. As electronic elements become smaller and able to function at ultra-low power, there should be little reason why electronics cant function directly on your body. 5 So how did Parviz think of making a "bionic" contact lens? "Imagine a person with my kind of research expertise and background (he is a professor of electrical engineering, specializing in bio-nanotechnonlogy)," says Parviz. "Imagine also the same person waking up every morning and putting a contact lens in his eye." 6 Making the connection wasn't hard, as Parviz had also been thinking about unconventional displays. Contact lenses are made from flexible transparent polymers, just the sort of challenging material that Parviz likes to stick tiny electronic circuits on. "The driver is not to make something small. The driver is to make something that's cool and useful. Having a display in a contact lens is very useful." 7 Powering the contact lens is going to be interesting. Obviously, a wireless system would be best. The University of Washington team created an RF circuit that could pick up energy broadcast from a battery pack in the 900 MHz to 6 GHz bandwidth ideal for not frying your body with power. Parviz also suggests that a miniature solar cell could provide energy for the lens. In any case, the amounts of power supplied would be small (100 microwatts through RF, maybe 30 microwatts from the solar cell). The good news is that very little power is really needed. A LED situated directly on your eye shouldnt be very bright in order to be work. 8 Power, however, isn't the most complicated problem. A contact lens sits directly on the surface of the eye, much too close for the eye to focus on. "To create the focused image we have to manipulate the light rays," says Parviz. "You can create a focused image if you use lasers." Although he realises that shining very low power diode lasers on to the retina may be risky, he is hopeful: "We could generate a virtual image that could be 30cm or more away from the surface which our eyes could focus on." 9 All this raises questions of biocompatibility: will the electronics in the contact lens harm the eye?. They have recently tested them on rabbits who wore the devices without harm, so the signs are good. If the safety of the product is assured, then the idea of a fully functional wireless display on a contact lens will have many uses. 10 Parviz talks about augmented reality, such as superimposing text messages or direction arrows on your view of the world He also mentions putting biosensors on the lens which would be able to monitor the wearer's health and then display that data to them through the AR interface. The team has built several simple sensors that can detect the concentration of a molecule, such as glucose. Sensors built onto lenses would let diabetic wearers keep track of blood-sugar levels without needing to prick a finger. Since his work became widely known, Parviz has received emails from people wanting to test the contact lenses, while others have proposed ideas. He's also had emails from those with sight problems, an area he hopes to help with.

11 An 11-year-old student also wrote in describing a school competition involving an idea for an electronic contact lenses for the hearing-impaired. For instance, a fire alarm symbol appears when the alarm sounds, an idea Parviz now has in mind. We have a fair few possibilities in the pipeline, but we're particularly looking at medical applications. 12 However, Professor James Wolffsohn of Aston University in Birmingham isn't enthusiastic. As the head of optometry, his research interests include contact lenses. "I've never seen anyone try and print circuits on to a contact lens," says Wolffsohn. 13 He points out that a contact lens is around 14mm wide, compared to the pupil's diameter of between 4mm and 5mm. He reckons that doesn't leave a lot of space for electronics without interrupting vision; and it might be difficult to project an image from the periphery into the eye's central area. 14 "The focusing would be the real issue. These are incredibly close to the eye," says Wolffsohn. "There would have to be some projection technology for it to appear at a distance that you could then focus on. I can't really see them generating a projection through a contact lens." He also has another concern: "There would certainly be issues about laser damage to the retina." 16 Nevertheless, Wolffsohn is attracted to the idea of putting electronics on to glasses (as has been done with some products already). There's more space and no biocompatibility issues, while image projection is an easier proposition. His verdict on using contact lenses as a display device? "If I had this technology, they wouldn't be my starting point" says Wolffsohn. But whichever way this research goes, it's worth keeping an eye on. www.guardian.co.uk

UNIVERSITE HENRI POINCARE, NANCY I, FACULTE DES SCIENCES SUJET DEXAMEN Diplme : Licence SV1 Epreuve : De la cellule aux Ecosystmes : UE 1.01 1 Session, janvier 2010 Dure : 2 heures. H. Dumond, G. Jacquemin, R. Leborgne Calculatrices non autorises Documents non autoriss.

Les 3 sujets de cours sont traiter sur 3 copies spares. Sujet de H. Dumond Dure 40 minutes environ (20 points) Question 1 : Annoter le schma ci-dessous en recopiant sur votre copie les numros correspondants.

7 8

9 10

Question 2 : Dfinir les diffrents types de protines membranaires. Donner brivement les caractristiques de chacune des 3 catgories de protines intrinsques. Question 3 : Pourquoi la membrane plasmique est-elle considre comme une mosaque fluide ? Sujet de R. Leborgne (40mn, 20 points)

Les rponses attendues concernent lenseignement du rdacteur de ce sujet. Il sera tenu compte de la formulation, de la prsentation et concision des rponses. 1) Pourquoi qualifie-t-on les organes sensoriels de filtres priphriques ? 2) Dfinir le terme perception. 3) Dfinition des termes ontogense et phylogense 4) Dfinir la notion de systme, pourquoi peut-on dire quun organisme est un systme ouvert ? 5) Pour les dmarches de lhomme observateur scientifique quavons nous tir des illusions doptiques ? 1pt 1pt 2pts

2pts

2pts

6) A partir de lexemple de la vision, citer 4 niveaux dorganisation biologique embots dans cette rception sensorielle (donner les termes gnraux les dsignant et les termes particuliers la vision correspondant) 4pts 7) Caractristiques fonctionnelles compares des systmes endocriniens et nerveux 8) A partir de la prsentation des expriences et de leurs rsultats (graphes) de lexemple des crabes Carcinus maenas qui on propose des moules de tailles diverses, dfinir la notion de dcision conomique.

4pts

4pts

Sujet de G. Jacquemin (40mn, 20 points) Rpondez chacune des 10 questions suivantes en 6-8 lignes au maximum. Vos rponses seront donc concises, mais aussi claires, prcises, et rigoureuses que possible. (2 pts par question) 1. Qu'appelle-t-on biosphre? Quel volume occupe-t-elle? 2. Qu'est-ce qu'un organisme chimiotrophe? 3. En quoi le phosphore joue-t-il un rle-cl dans la vie de certains organismes marins? 4. Qu'est ce qu'un stromatolithe? Quel est l'ge des plus anciens connus, et que nous apprend-il d'important? 5. Quelle corrlation faites-vous entre la Pange et la phase d'extinction biologique la fin du Permien 6. Qu'est ce qui diffrencie en cologie un producteur primaire d'un producteur secondaire? 7. Quels sont les principaux biomes tropicaux? Quel facteur dterminant les diffrencie? 8. Les proportions d'O2 et de CO2 dans l'atmosphre ont fortement vari par le pass; pourquoi et comment? 9. Quelle est l'origine, la nature, et l'intensit de l'nergie reue de l'extrieur par la biosphre? 10. Quels sont les 4 lments chimiques les plus abondants (en masse): dans les tres vivants dans la lithosphre dans les ocans dans l'air

NOM :

Prnom :

GROUPE :

UE LSV 1. 01 - De la cellule aux cosystmes TP/TD Biologie Animale


Janvier 2010 (30 minutes environ) Calculatrices et documents non autoriss

1) Lgendez la photographie ci-dessous

- Titre :

- Calculez le grossissement de la photographie partir de lchelle indique en haut gauche :

- Dans quel organe peut-on trouver ce type de structure ?

2) Lgendez les diffrentes photos ci-dessous et donnez un titre gnral. Donnez brivement la fonction des diffrents types cellulaires.

3) Compltez le tableau suivant en indiquant les diffrentes caractristiques des microscopes optique, fluorescent et lectronique et ce quils permettent dtudier (10 min).

microscope optique

microscope fluorescent

microscope lectronique

source lumineuse

pouvoir sparateur

grossissement maximum

utilisation

UNIVERSITE HENRI POINCARE

LICENCE SCIENCES DU VIVANT L.SV.1.02 Session de janvier 2010

FACULTE des SCIENCES et TECHNIQUES

Epreuve de BIOCHIMIE Date : janvier 2010 Horaire :

Dure de lpreuve : 2 heures Documents non autoriss Calculatrices non autorises

LEPREUVE COMPORTE 3 PARTIES RENDRE SUR DES COPIES SEPAREES - PARTIE 1 : COURS DE F. TALFOURNIER (dure conseille : 30 minutes) - PARTIE 2 : COURS DE A. DRIOU (dure conseille : 30 minutes) - PARTIE 3 : TRAVAUX DIRIGS (dure conseille : 1 heure) ------------------------

A rendre sur une copie spare - Dure conseille 30 min

PARTIE 1 : Contrle terminal de Cours magistral : Sujet de F. TALFOURNIER

Soit le pentapeptide suivant : Ala-Ser-Gly-Tyr-Glu

1) Ecrire ce pentapeptide sous forme dveloppe. 2) Reprsenter chacun des acides amins selon la convention de Fischer sachant que, dans ce peptide, seule lalanine nappartient pas la srie naturelle. Indiquer la configuration des carbones asymtriques selon la nomenclature de Cahn-Ingold-Prelog (R/S). 3) Ce pentapeptide subit une hydrolyse chimique. Indiquer les liaisons coupes et les produits obtenus. Dcrire laide dun schma les caractristiques de la liaison peptidique en expliquant dune part sa stabilit, et dautre part son impact sur la gomtrie de la chane polypeptidique. 4) A quoi correspondent les diffrents niveaux dorganisation structurale ? A quel niveau appartiennent les hlices ? Quel type dinteraction permet la stabilisation de cette structure ? En rappeler les caractristiques.

PARTIE 2 : Contrle terminal de Cours : Sujet de A. DRIOU


A rendre sur une copie spare Dure conseille: 30 min
Vous rpondez par oui ou non aux 10 questions suivantes en justifiant brivement mais clairement votre rponse (explications crites, schmas, formules, exemples particuliers,)
1- Pour une molcule donne, le passage dune conformation une autre se ralise-t-il par rotation autour de liaisons simples ? 2- Soit une molcule ne prsentant quun atome de carbone substitu asymtriquement, la permutation de 2 de ses 4 susbtituants suffit-elle construire son nantiomre ? 3- Un objet chiral est-il superposable son image dans un miroir plan ? 4- La prsence dune double liaison entre 2 atomes de carbone cre-t-elle une isomrie particulire ? Si oui, donner son nom et un exemple de molcule prsentant cette isomrie. 5- Quelle interaction sexerce entre 2 molcules deau ? La reprsenter par un schma et en donner les caractristiques. 6- Soit un diacylglycrol homogne ; combien de diacylglycrol peut-on construire ? Justifier votre rponse. 7- Cette reprsentation de phospholipides en solution aqueuse vous semblet-elle cohrente ? Si non, proposer un autre modle en le justifiant.

8- Dans les noms systmatiques des molcules impliquant du glycrol, que signifie lexpression sn-glycrol ? 9- Les glycrophospholipides sont-elles des molcules ionisables ? Si oui, prciser par un exemple sur quelle partie de la molcule. 10- Soit lacide palmitolique (nom commun) Donner son nom systmatique. Indiquer les 2 nomenclatures systmatiques de cet acide gras. 2

PARTIE 3 : Contrle terminal de Travaux Dirigs : 2 exercices

A rendre sur une copie spare Dure conseille : 60 min


Exercice 1 O O H C O C OO

C O C H

H C O P O CH2

CH3 + CH2 N CH3 CH3

Donnez le nom de cette molcule. Dtaillez les diffrents lments qui la compose et donner leur formule semi-dveloppe. A quelle catgorie de biomolcules appartient-elle ? Peut-on distinguer une partie polaire dune partie apolaire ? Si oui, faites-le apparatre sur un schma. Donner le nom de ce type de molcules ? O retrouve-t-on ce type de biomolcules ? Faites un schma gnral. Exercice 2 Voici un ttrapeptide : Met Gly Cys Ala Ecrivez la formule biochimique de ce ttrapeptide Indiquez les liaisons peptidiques. Reprez les carbones asymtriques par une *; combien de stroisomres peut-on envisager ? Entourez les fonctions ionisables Calculez son pHi. On sintresse maintenant la fonction ionisable de la cystine. Calculez la valeur du pH auquel ce groupement est dissoci 25 %. Que deviennent les autres fonctions ionisables de ce ttrapeptide cette valeur de pH ? Ecrire le peptide ce pH. On fait agir une carboxypeptidase sur ce ttrapeptide. Quels produits de raction va-t-on obtenir ? Donnes : pKa ([NH3+]Met) = 9,21 pKa ([SH]Cys) = 8,33 pKa ([COOH]Ala) = 2,35

UNIVERSITE HENRI POINCARE, NANCY-I FACULTE DES SCIENCES ET TECHNIQUES SUJET DEXAMEN DIPLOME : Licence mention SV-1re anne 1re session UE.1.02 Epreuve de Chimie Organique Session 1 - Janvier 2010 Date : Horaire : Responsables : C. GERARDIN, J. BODIGUEL, N. BROSSE Documents non autoriss Calculatrices non autorises Dure de lpreuve : 1H30 Enonc de deux pages

Exercice 1 a) Donner les formules molculaires des molcules suivantes et retrouver leur degr d'insaturation.

b) Prciser si les formules suivantes sont possibles ou non. Calculer le nombre d'insaturations de celles qui sont possibles :

C10H15 ; C15H17NO3 ; C24H54Cl2O2 ; C8H16 ; C18H35N ; C10H17Br3

Exercice 2 1) Dessiner les molcules suivantes en projection de Newman selon l'axe Ca-Cb

2) Donner une reprsentation de Cram et une reprsentation cavalire des molcules suivantes :

3) Donner une reprsentation de Fischer du compos a) de la question prcdente

Exercice 3 Donner la reprsentation de Cram du (1S,2S ,4R)-1-tertiobutyl-2,4-dimthylcyclohexane et reprsenter dans l'espace (reprsentation cavalire) sa conformation la plus stable. Exercice 4 Indiquer et donner la configuration absolue des atomes de carbone asymtrique prsents dans les molcules suivantes :

Les molcules prcdentes sont-elles actives sur la lumire polarise ? Justifier la rponse.

Exercice 5 Le Chloramphenicol est un puissant antibiotique actif contre la fivre typhode. Indiquer le nombre de stroisomres de configuration du chloramphenicol. Reprsenter ces stroisomres dans l'espace par une reprsentation au choix.

UNIVERSITE HENRI POINCARE SUJET D'EXAMEN DIPLOME L1SV Epreuve d Atomistique et Liaison Chimique Session premire, janvier 2010 Date Horaire

FACULTE DES SCIENCES ET TECHNIQUES

Dure du sujet 1 heure Nom du rdacteur Xavier ASSFELD Documents autoriss Calculatrices autorises (1) Rayer la mention inutile OUI OUI NON NON (1) (1)

Indications : Le sujet comporte 1 page. Les rponses seront justifies et rdiges avec concision. En cas derreur dnonc, indiquer sur la copie les initiatives que vous tes amens prendre et continuer dans lnonc. Oxyde de Phosphine H3PO. 1) (/1,5) Donner la configuration de ltat lectronique fondamental des atomes suivants : 1H, 8O, 15P. 2) (/1,5) Indiquer les lectrons de valence de chacun des atomes 1H, 8O, 15P. 3) (/1) Construire un diagramme de Lewis classique qui respecte la rgle de loctet de la molcule H3PO, o latome de phosphore est central. 4) (/2) Donner le type VSEPR de latome de phosphore dans la molcule H3PO et en dduire la gomtrie. 5) (/1) Classer les atomes P et O en lectrongativit croissante. 6) (/2) Sachant que llectrongativit de P est gale celle de H ( (P) = (H)), indiquer si la molcule de H3PO possde un moment dipolaire lectrique permanent. Si oui, dessiner le vecteur moment dipolaire par rapport la molcule. 7) (/2) Donner lhybridation des atomes de P et de O dans la molcule H3PO. 8) (/3) Construire les orbitales molculaires (OM) de la molcule de H3PO laide du modle des orbitales hybrides et les placer dans un tableau rcapitulatif trois colonnes (OM liantes, OM non-liantes, OM anti-liantes). 9) (/2) Placer les lectrons dans les OM et en dduire un diagramme de Lewis. 10) (/1) Indiquer si les interactions de Keesom peuvent exister entre deux molcules de H3PO. Justifier votre rponse ! 11) (/1) Indiquer si les interactions de Debye peuvent exister entre deux molcules de H3PO. Justifier votre rponse ! 12) (/1) Indiquer si les interactions de London peuvent exister entre deux molcules de H3PO. Justifier votre rponse ! 13) (/1) Est-ce quun autre type dinteraction intermolculaire attractive peut exister entre deux molcules de H3PO ?

UNIVERSITE DE NANCY I

FACULTE DES SCIENCES ET TECHNIQUES SUJET D'EXAMEN

DIPLOME : L1 SV

Dure du sujet :

2 Heures

Nom des rdacteurs : B. HENRY Epreuve de : Chimie des solutions UE 103 Session de : Date : Horaire :

Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

janvier 2010 7 janvier 2010

Exercice 1 : Equilibrer les ractions REDOX en faisant apparatre les demi-quations et les nombres doxydation: IO3 + I + = I2 + NO3- + Pb2+ + Sn4+ + H2C2O4 = NO + PbO2 +

= Sn2+ + CO2 +

Exercice 2 : 1. Classez les solutions de concentration C = 0,1 mol.L-1 suivantes de la plus acide la plus basique : NH4Cl, NaOH, NaCl, NaCN, HCl 2) Quel est le pH dune solution dacide benzoque C6H5CO2H de concentration C = 0,03 mol.L-1? 3) On titre 20 cm3 dacide benzoque C6H5CO2H de concentration C = 0,03 mol.L-1 par une solution de NaOH 0.02 mol.L-1. a) Ecrire la raction du dosage et calculer la constante de la raction. b) Dterminer le pH de la solution aprs ajout de : b1) 20 cm3 de NaOH 0.02 mol.L-1 b2) 30 cm3 de NaOH 0.02 mol.L-1 b3) 40 cm3 de NaOH 0.02 mol.L-1 Donnes: pKa(C6H5CO2H/ C6H5CO2) = 4.20; pKa(NH4+/NH3) = 9.25; pKa(HCN/CN) = 9.30 TSVP

Exercice 3 : Soit lquilibre homogne en phase gazeuse : C2H6 = C2H4 + H2 Dans un rcipient maintenu t = 727C, on introduit de lthane (C2H6). A lquilibre la pression totale est de 1 atm et le degr de dissociation est de 0,485. a) Sachant que le volume du rcipient rigide est de 10 litres, calculer le nombre total de moles dans lenceinte. b) Calculer le nombre de moles dthane introduites initialement dans lenceinte. c) calculer les pressions partielles des gaz lquilibre et la constante dquilibre. d) Que se passe-t-il si on ajoute un gaz inerte dans le rcipient rigide? Combien de moles de gaz inerte faut-il ajouter pour obtenir une pression finale de 5 atm ? Donnes : 1 atm = 1,01325x105 Pa ; R = 0,082 L.atm.mol-1.K-1 = 8,314 J.mol-1.K-1

Exercice 4 : Calculer la solubilit de liodure de plomb PbI2 a) dans leau pure. b) dans une solution contenant des ions iodures de concentration C= 1 mol.L-1 Donne : Ks = 9 10-4 Exercice 5 : 1- Ecrire lquation de NERNST relatif au couple MnO4 /Mn2+. 2- Une solution contenant du permanganate de potassium (MnO4-) peut-elle oxyder les chlorures (Cl-) en milieu acide pH = 5. Toutes les concentrations sont molaires sauf (H+). Donnes: E0(Cl2/ Cl) = 1.36 V; E0(MnO4 /Mn2+)= 1.51 V

UHP, Nancy 1

1re Session 2009/2010.


Licence Sciences du Vivant-1re anne. Examen de Physique applique aux sciences de la vie (Code L.SV. 1.04. / Cours de Pascal Boulet)

Dure 2 heures. Documents interdits - calculatrice autorise. Le barme nest quindicatif. Le soin apport la rdaction sera pris en compte dans la notation.

Exercice 1 / 10 pts. Applications directes simples. 1. Dimensions a. Rappelez la dimension dune force. b. Lexpression suivante est une forme de la force de trane (action sur un obstacle par un fluide en mouvement) utilise en mcanique des fluides: F = C d 2V 2 o F dsigne une force, C est le coefficient de trane, une masse volumique, le nombre pi sans dimension, d une dimension caractristique de lobstacle, et V une vitesse de rfrence. Quelle est la dimension de C? c. Le champ lectrique sexprime aussi bien en N/C (newton par coulomb) ou en V/m (volt par mtre). En utilisant les quations aux dimensions dmontrez que ces units sont quivalentes. 2. Agitation thermique a. On considre un gaz parfait pression 1bar = 105 Pa, et temprature 300 K. Calculez le nombre de molcules par m3 dans ce gaz. Quelle est la vitesse moyenne des molcules ? b. On refroidit ce gaz 10 K. Si on considre la mme densit de molcules (mme nombre par m3) quelle est la pression du gaz ? Calculez nouveau la vitesse moyenne. Commentez les rsultats. Donnes : masse molaire du gaz : 29 g/mol, nombre dAvogadro : 6x1023 molcules/mol, constante de Boltzmann k = 1,38.10-23 J.K-1. 3. Statique des fluides On place un cube de ct a = 10 cm, de masse volumique = 500 kg/m3 la surface de leau. On suppose quil se stabilise en senfonant dans leau dune hauteur h (h est la hauteur entre la surface de leau et la face infrieure du cube : le cube nest pas compltement immerg). La masse volumique de leau est e = 1000 kg/m3. La pression atmosphrique est Patm = 105 Pa. Comme le cube nest pas compltement immerg, Patm

est la pression qui sexerce sur la face suprieure du cube. Soit Fsup la force de pression correspondante (on rappelle que la force de pression quivaut la pression multiplie par la surface

sur laquelle elle sexerce). Calculez Fsup .

r
Quelle est la pression qui sexerce sur la face infrieure du cube ? Quelle est la force Finf correspondante ? Ecrivez la rsultante des forces de pression qui sexercent sur le cube R = Fsup + Finf

En crivant que le cube est lquilibre sous laction de son poids P et de la rsultante R en dduire lexpression qui donne h et calculer sa valeur.

4. Incertitude On mesure un dbit volumique Q partir dun volume deau V scoulant par unit de temps t. On donne V = 0,05 0,002 m3 et t = 10 0,1 s. Calculez le dbit Q et lincertitude absolue sur la mesure Q.

Exercice 2 / 5pts. Evolution exponentielle. 1. On mesure la temprature T dune sphre, initialement T0 = 350C, qui se refroidit dans lair temprature Tair = 20C. On obtient le tableau de valeurs suivant en fonction du temps, o lon a inscrit en fait la diffrence (t ) = T(t) - Tair t en s 0 330 1 299 5 200 10 121 20 45 50 2 80 0.1

(t ) en C

Tracez la temprature (t ) en fonction du temps t. Que vous inspire le type de courbe obtenu ? Tracez maintenant ln ( (t )) en fonction du temps t ( ln dsigne le logarithme nprien). Quelle variation obtient-on ? Donnez lquation de la courbe obtenue et en dduire lvolution de (t ) en fonction de t. 2. La temprature volue en fait daprs une quation diffrentielle ordinaire du premier ordre que lon peut crire

d (t ) = a (t ) . Rsolvez cette quation en tenant compte qu linstant initial on a dt (t = 0) = T0 Tair .

3. En utilisant lanalyse des mesures la question 1., en dduire la valeur de a.

Exercice 3 / 5pts. Electrostatique. On considre trois charges dans un plan : une charge de valeur qA = 10-16 C place en un point A de coordonnes (-1,0) une charge de valeur qB = 10-16 C place en un point B de coordonnes (+1,0) une charge de valeur qC = -2.10-16 C place en un point C de coordonnes (0,2)

Soit M un point de coordonnes (0,1). 1. Calculez le potentiel cr par la charge qA en M. De mme, calculez le potentiel cr par la charge qB en M, et enfin par la charge qC en M. En dduire le potentiel rsultant en M li la prsence simultane des 3 charges qA, qB et qC. 2. Ecrivez maintenant le champ cr par la charge qA en M. De mme crivez successivement le champ cr par qB en M, puis par qC en M. Fates un schma en faisant figurer les charges et les vecteurs champs dus laction des charges en M. Calculez le champ rsultant de laction simultane des 3 charges. On place en M une charge qM = 10-16 C. Quelles sont les caractristiques de la force quelle subit ?

Dure de lpreuve : 2 heures. Rpondez sur le sujet et non sur une copie spare.
U.E. LCSV 1UL ANGLAIS
Janvier 2010
I. Comprhension (20 points). Daprs le texte, les affirmations suivantes sont-elles vraies ou fausses ? (Les questions sont dans lordre du texte). Attention : barme dgressif : +2 points par rponse correcte, -1 point par rponse incorrecte, 0 point si pas de rponse. Les points ngatifs ventuels ne seront pas reports sur les autres exercices. 1. Les lphants peuvent courir plus vite que les cervids.

2. Les missions mondiales de gaz effet de serre slvent 7,5 milliards de tonnes par an. 3. LIndonsie est troisime sur la liste des pays qui mettent des gaz effet de serre. 4. Le programme REDD devrait permettre aux pays en voie de dveloppement de prserver leurs forts. 5. La culture de palmiers huile en Indonsie permet de prserver la fort. 6. La religion joue un grand rle dans la volont de protger la fort.

7. Les critiques disent que le programme REDD permet aux pays riches de polluer. 8. Grce la prsence de rebelles opposs au rgime, la fort de la province dAceh a t protge. 9. La cration des community rangers a permis danciens guerilleros de se reconvertir. 10. Il ny a pas assez dargent disponible pour rduire la dforestation dans le monde. II. Vocabulaire (6 points). Trouvez dans le texte la traduction en anglais des mots franais suivants : 1. cervid : .. (lignes 1 22) 2. rinvestir : (l. 48 66) 3. soulager : ......... (l. 93 114) 4. labattage des arbres : ..... (l. 127 144) 5. motivation, incitation : ... (l. 196 216) 6. le sol : .... (l. 238 254)

III. Vocabulaire (6 points). Trouvez dans le texte les synonymes des mots suivants: 1. to avoid : ... (lignes 29 47) 2. an agreement, a contract : ........... (l. 78 100) 3. to ask (for food or money, etc.) : .. (l. 145 167) 4. to step on something repeatedly : (l. 187 207) 5. a trend, a fashion : ... (l. 208 228) 6. surveillance, control : ... (l. 251 276) IV. Vocabulaire (6 points). Trouvez dans le texte les antonymes (ou contraires) des mots suivants: 1. close to, near : ......... (lignes 5 28) 2. to prevent : .. (l. 29 47) 3. to expand : ................................. (l. 93 114) 4. deep : (l. 162 185) 5. small : ... (l. 196 216) 6. to doubt : .................... (l. 238 259) V. Mots de liaison (12 points). Le texte ci-dessous est extrait de larticle intitul Keep the Jungle Alive (lignes 194-195), mais certaines articulations logiques ont t retires. Compltez le tableau ci-dessous laide de la lettre correspondant au mot de liaison choisi pour chaque numro. Utilisez chaque mot de liaison une seule fois. Ncrivez pas les mots de liaison dans le tableau, crivez seulement la lettre correspondante. a : still b : now c : until d : after e : but f : before

A week ..(1).. the 2005 peace deal was signed, Kamarullah emerged from the jungle to rejoin his family, ..(2).. struggled to support them ..(3).. joining the rangers. In GAM, he says, "we had an ideology and a purpose." With the rangers, this expert navigator with an intimate knowledge of the area now feels like he is fighting for his homeland again. "I want to protect the animals," he says. "I'm worried they're dying out. We used to find deer near the village, but now they're gone." ..(4).. , the rangers are having an impact. "..(5).. , there were maybe 40 people logging in this area," estimates Kamarullah. "..(6).. there are only 10." (1) : (2) : (3) : (4) : (5) : (6) :

Keep The Jungle Alive


How the battle to save a remote rain forest in Indonesia can help the planet win the fight against global warming
BY ANDREW MARSHALL/ULU MASEN

70 promising much-needed revenue at a time when rich nations


still haggle over how much money to give poorer countries to help them adapt to climate change. REDD will likely be part of any global climate pact negotiated in Copenhagen. "Everyone has got a lot of hope in REDD," says Joe Heffernan, an expert in environmental markets at FFI. "It's a big one." The Money Tree Ulu Masen received a boost last year when U.S. bank Merrill Lynch pledged to invest $9 million over four years. "That gave the project a lot more certainty," says Dorjee Sun, chairman of Sydney-based firm Carbon Conservation, which is helping Aceh's provincial government devise the scheme. "It showed there was appetite from investment banks to buy these credits." Merrill Lynch calls Ulu Masen "the world's first commercially financed avoided deforestation project." Money has been followed by political muscle: a year later, Arnold Schwarzenegger of California, along with the governors of Wisconsin and Illinois, signed a deal committing the state to finding ways to incorporate forest credits within U.S. carbon-trading systems. Ulu Masen is expected to generate $26 million in carbon credits in its first five years. Humans won't be the only animals to benefit. Clearing land for palm-oil plantations is Indonesia's leading cause of deforestation, says a 2007 U.N. report, with Sumatra, Kalimantan and Papua the three worst-affected provinces. Thanks largely to the global appetite for palm oil, which is found in everything from chocolate bars to biofuels, the natural habitat of endangered animals such as the orangutan and Borneo rhino shrinks further each year. REDD could save them, said a recent study of Kalimantan by researchers from the University of Queensland in Australia. REDD could fundamentally change conservation [in tropical countries] and provide benefits for mammals at a scale weve never seen before, writes its lea author Oscar Venter. If REDDs champions seem almost religious in their support, it is partly because the scheme appears to contain so many holy grails. Done right, its advocates say, REDD will alleviate poverty, preserve rain forests, protect endangered species and do more to avert catastrophic climate change than grounding jets and banning coal. It also offers a rare partnership between two disparate and often conflicting worlds: capitalism and conservation. With REDD, you can save the planet and make money. Not so, say its equally passionate critics. Many are fundamentally opposed to a carbon-offset system that only safeguards forests by allowing rich nations to pollute. "We need to find ways to stop burning fossil fuels, not create massive new loopholes to allow the pollution to continue," says Jakarta-based Chris Lang, who runs the website REDDMonitor. "Carbon-trading does not reduce emissions." Lang believes funding REDD schemes through offsets or other market-based mechanisms would be a "disaster." Still, if all goes to plan, Ulu Masen could be the first REDD scheme to sell forest credits. Into the Wild There are several unique aspects to Aceh that have allowed the scheme's creators to blaze a trail. First, a decades-long separatist insurgency by the Free Aceh Movement (GAM) saved the province from the logging frenzy seen across the rest of Sumatra. "If you went into the forest back then there was a chance you'd get shot," says Matthew Linkie, an FFI technical manager based in the province's capital Banda Aceh. GAM signed a historic peace deal with the Indonesian government in 2005, in the wake of the devastating Indian Ocean tsunami, which claimed about 160,000 lives in Aceh alone. Today, Aceh's governor is a

5 THERE ARE two important things to know about tracking


wild elephants, and it's better to learn both of them before you're actually in the jungle, tracking wild elephants. First, elephants are fast. In thick forestin this case, the vast Ulu Masen ecosystem in the Indonesian province of Aceh, where leeches writhe beneath your feet and white-handed gibbons hoot from the treetopsthey can outpace even deer. Second, elephants can't climb trees. This is good, because that's precisely what you're meant to do if one of them charges. Or at least that's the advice of the jungle-hardened rangers who patrol just one corner of this 1.9 million-acre (7,700 sq km) wilderness. They are trained by the Londonbased conservation group Fauna and Flora International (FFI) to protect Ulu Masen from illegal loggers and poachers, who greedily eye its valuable hardwoods and teeming wildlife: elephants, gibbons, tigers, leopards, bears, pythons and scaly anteaters. The rangers' work might seem remote from the modern world, but it has implications far beyond Ulu Masen's frontiersfrom Africa and the Amazon, which along with Indonesia are home to what's left of our rain forests, to the meeting rooms of Copenhagen, where thousands of delegates will arrive for next month's historic climate-change conference. Green plants use light to transform carbon dioxide, absorbed from the atmosphere, and water into organic compounds, with oxygen as a by-product. The process is called photosynthesis, and it enables forests like Ulu Masen to play a critical role in regulating our climate. Forests store an estimated 300 billion tons of carbon, or the equivalent of 40 times the world's total annual greenhouse-gas emissions emissions that cause global warming. Destroy the trees and you release that carbon into the atmosphere, putting the great challenge of our ageaverting catastrophic climate changebeyond reach. Forest destruction accounts for 15% of global emissions by human activity, far outranking the total from vehicles and aircraft combined. Forests are disappearing so fast in Indonesia that, incredibly, this developing country ranks third in emissions behind industrial giants China and the U.S. Since 1950, estimates Greenpeace, more than 182 million acres (740,000 sq km) of Indonesian forests, the equivalent of more than 95 Ulu Masens, have been destroyed or degraded. The good news is that protecting forests "is one of the easiest and cheapest ways to take a big bite out of the apple when it comes to emissions," says Greenpeace spokesman Daniel Kessler. Ulu Masen will be one of the first forests to be protected under a pioneering U.N. program called REDDReducing Emissions from Deforestation and Forest Degradation in Developing Countries that offers a powerful financial incentive to keep forests intact. Here's how it works. Preserve Ulu Masen, and over the next 30 years an estimated 100 million tons of carbon are prevented from entering the earth's atmospherethe equivalent of 50 million flights from London to Sydney. Those savings can be converted into millions of carbon-offset credits, which are sold to rich countries and companies trying to meet their U.N. emissions-reduction targets. The revenue produced by the sale of credits is then ploughed back into protecting the forest and improving life in communities living along its edge, thereby giving people a reason to leave the trees standing. With schemes now proliferating across Indonesia and the globe, the U.N. estimates that REDD revenues could pump up to $30 billion a year into the developing world,

75

10

80

15

85

20

90

25

95

30

100

35

105

40

110

45

115

50

120

55

125

60

130

65

135

tsunami survivor and former GAM rebel called Irwandi

140 Yusuf, whose background seems tailor-made for REDD: he


was trained as a veterinarian and once worked for FFI. In June 2007 Irwandi banned commercial logging in his province, "an unprecedented environmental act" for Indonesia, says Linkie. Named after a 7,840-ft-high (2,390 m) mountain within its borders, Ulu Masen is only slightly smaller than Yellowstone National Park, or about 10 times the size of Singapore. It is patrolled by forest rangers employed by the provincial government and by FFI-funded community rangers, many of them once with GAM. Ulu Masen has helped solve a major challenge for postconflict Aceh: finding jobs for ex-combatants. "In theory," says Linkie, "you've got a pool of well-trained forest experts with jungle skills. They make great rangers." I joined the rangers near the remote village of Geumpang. It is a six-hour drive from the provincial capital Banda Aceh along a semipaved mountain road winding up through dense forest. In places, a line of vehicles backs up as mechanical diggers clear rockfalls. Troupes of long-tailed macaques tumble down from the trees to beg from passing motorists. Geumpang sits in a valley of rice fields at the heart of Ulu Masen. It is famous for its fertile soil and the gold sometimes found in its rivers. Raked by clouds, it is also famously wet: some people joke that the name Geumpang is a contraction of gerimis panjang, the Indonesian for "constant drizzle." An hour from Geumpang is an FFI camp manned by 10 so-called community rangers, all trained and salaried by FFI, all former poachers, loggers or GAM guerrillas. Keeping them company are five mahouts and their elephants, which are employed for jungle patrols. The camp was set up a year ago. Conditions are basic. The rangers live in tents near a shallow river flowing past overgrown farmland abandoned during the conflict but now slowly being recultivated by returning locals. FFI has already trained 45 community rangers and hopes to have a total of 150 protecting Ulu Masen by the end of next year. They are paid about $160 a month. Over 10 days, the recruits are taught survival skills, navigation, climbing and search and rescue. A graduation ceremony is held in a river at night, lit by flaming torches, where they are dunked beneath the water then hugged by their trainers. "It's like they've been cleansed, absolved of their pasts," says Linkie. The Human Touch Kamarullah, 43, once carried an AK-47 assault rifle through this forest. Today, he grips four fireworks in one hand and a disposable lighter in the other, to scare off wild elephants. Kamarullah, who goes by a single name, is a lithe, taciturn man who spent eight years fighting for GAM; one of his five daughters was born in hiding in the jungle. How many enemy troops did he kill? "I didn't count," he says, grinning shyly.
ICI, UN PARAGRAPHE A ETE EXTRAIT DU TEXTE. IL FIGURE DANS LEXERCICE V : MOTS DE LIAISON.

210

145

215

150

220

155

225

160

230

165

235

170

240

175

245

180

250

185

255

190

260

195

200

205

Wild elephants, not loggers, are the rangers' main problem right now. At a farm nearby, elephants have trampled banana and cacao trees, toppled betel-nut palms and left jumbo-size footprints in the fishponds. Protecting crops from marauding elephants might seem peripheral to the task of preserving Ulu Masen. So might FFIs nursery in Geumpang, where farmers can learn grafting techniques and buy fruit-tree saplings at bargain prices. But both activities are designed to improve the livelihoods of local people, who are key allies in any REDD scheme. "These communities have to benefit," says Linkie. "That's the whole idea. They're getting an incentive not to cut [the forest] down."

265

270

275

Few incentives are more tangible than cash. Conservationists are considering cash payments to farmers in the Brazilian state of Mato Grosso to stop them destroying the forest for agriculture. But with 120,000 households around Ulu Masen, even a multimillion-dollar sale of carbon credits might amount to only $100 to $200 a year per family, estimates Linkie. The money might be better pooled to build schools, bridges or other projects that would benefit the entire community. However it is distributed, a very clear message must be sent to the local communities, says Linkie: "You're getting this [money] because you're not cutting down the forest." That message is being heard across this vast archipelago and beyond. Indonesia alone has a dozen or more REDD projects. "It's this new fadeveryone needs to have one," says Linkie. "It's good that governors from other provinces are [saying], 'Must have a REDD project' rather than 'Let's log it all and convert it into oil palm.'" In partnership with the Australian investment bank Macquarie Group, FFI has six other REDD schemes: three in Indonesia and others in Cambodia, Ecuador and Liberia. Last month, governors Irwandi and Schwarzenegger joined 30 other subnational leadersincluding a dozen other U.S. governors and the leaders of forest-rich Brazilian states Amazonas and Mato Grossoat a climate summit in Los Angeles, where they called upon governments to include REDD within the global framework for combating climate change. Sun of Carbon Conservation hopes one day to see "a global infrastructure of forest factories, producing oxygen and absorbing carbon dioxide." But REDD has its risks. The first is so-called leakage: halting deforestation in one area might simply drive loggers into another. "Permanence is a huge problem," says Kessler of Greenpeace, citing another worry. "How do we know these areas are going to stay protected? What happens if a forest burns to the ground?" A third concern is calculating how much carbon is stored in a forest, and what emissions are actually avoided by preserving it. In September a multinational research team led by French landscape ecologist David Gaveau asserted that the Ulu Masen scheme might not significantly reduce deforestation in northern Sumatra because much of the ecosystem is upland, inaccessible and therefore unlikely to be logged anyway. FFI rebuts this. Ulu Masen borders another protected area called Leuser, also being developed as a REDD scheme, so leakage is not an issue within Aceh province. (The rest of Sumatra is another matter.) As for permanence, FFI has a "reserve pool" of forest to replace any lost to fire or disease, and promises "robust" accounting methods and monitoring by both satellite and field team. It says the calculations in the Gaveau report are incorrect and that Ulu Masen has "substantial lowland forests at risk." The Politics of Climate Change Greenpeace wants wealthy industrialized nations to pay into a U.N.-run REDD fund that would protect priority areas of deforestation in Indonesia, Congo and the Amazon. A $40 billion-a-year fund "could get us to zero deforestation by 2020globally," says Kessler. "The money is there. It's just a question of political will." Already that political will seems to be faltering. A legally binding pact will be impossible to achieve at the climate-change summit in Copenhagen, said U.S. President Barack Obama and other world leaders at the just-concluded APEC meeting in Singapore. Back in the U.S. a bill to cut, by 2020, emissions to 20% below 2005 levels faces a bruising and uncertain journey through the Senate. Washington and Copenhagen: whatever happens in the rain forests, it is in these two distinctly nontropical cities that the fate of our remaining rain forests, and our warming planet, lies.

LCTE.0.01 : Introduction aux gosciences Examen 1re session, janvier 2010 Rdacteur : Jean Cauzid
Dure une heure sans document, sans calculatrice Les brouillons ne seront pas corrigs. La rdaction doit tre faite au stylo, le crayon papier nest pas valable pour une copie dexamen. Le crayon peut la rigueur tre utilis pour les schmas, lexception des lgendes, ainsi que des annotations portes sur ces schmas. La correction de votre copie se fera sans interprtation de ce que vous souhaitez exprimer. Vous devez donc fournir une copie propre, des explications claires et des schmas soigns. Vous devrez notamment respecter les indications suivantes : - vocabulaire scientifique prcis - syntaxe claire - respect de lorthographe et de la grammaire - rdaction sans abrviation

I-

QUESTIONS DE COURS

10 pts

1- La Terre nest accessible lchantillonnage direct que sur quelques kilomtres dpaisseur. De quels outils dispose-t-on pour tudier la structure interne du globe terrestre ? Nommez ces outils et dites sur quel principe physique ils se basent. 2- Plusieurs facteurs influencent le climat : paramtres orbitaux, position des continents, composition atmosphrique, albdo, activit biologique. Donnez un ordre de grandeur des chelles de temps auxquelles ces facteurs peuvent influencer le climat global.

II-

ETUDE DE DOCUMENTS

10 pts

1- Les documents 1 et 2 donnent les ges absolus de la crote ocanique et de la crote continentale. Donnez le phnomne physique naturel permettant une datation absolue des roches. 2- Dans le document 1 : A quoi correspondent les zones rouge sombre ? Comment sappellent les zones gris-clair situes ct des terres merges ? Pourquoi ne sont-elles pas dates avec la crote ocanique ? 3- Sur les documents 1 et 2 : Relevez lge le plus ancien de la crote ocanique dune part et lge le plus ancien de la crote continentale dautre part Dessinez une coupe prsentant le fonctionnement dune zone de subduction et dune zone de collision. Un exemple de coupe est donn en document 3. A laide vos schmas et de vos connaissances en godynamique, expliquez la diffrence dge maximal observ entre la crote continentale et la crote ocanique.

Page 1/2

Document 1 : ge de la crote ocanique en millions dannes.

Document 2 : ge de la crote continentale.

Document 3 : Exemple de coupe. La zone o la crote ocanique (vert fonc) se soude avec la crote continentale (orange) correspond la marge passive.

Page 2/2

ANSWER SHEET
NOM : GROUPE : L2 PC / PMM

PRENOM :

NOTE :

When the moon lands 1 2 3 4 5 6 7 8 9 10

11

12

13

14

15

16

17

18

19

20

Find the vocabulary in the article for: Tenir / dtenir jeter avoir en commun fournir se passer, avoir lieu un indice une chelle une caractristique un chantillon un point de rfrence difficult in a liquid state due to great heat precise appropriate detached from the group grce au del de par la suite quasiment la fois

Fill in the gaps with the appropriate word(s) which start with the letters in bold.

1. How deep is this lake? What is the d.. of this lake? 2. The air strip is being made longer. The air strip is being l... 3. One of major disadvantages is the lack of space. One of the major d.. is the lack of Space. (Do not use disadvantages) 4. The club hasnt enough money to buy a new computer. The club cant a.. to buy a new computer. 5. Africa is in need of large quantities of food. Africa is in need of large a.. of food. 6. There will soon be no more coal. Coal resources will soon r.. (two words) 7. Are these results exact? Are these results a..? 8. This seat belt is too loose. Can you t.. it? 9. Please attach your seat belt. Please f.. your seat belt. 10. Our firm will provide all the necessary components. Our firm will s.. all the necessary components.

When the moon lands. Are the following statements true or false? Rpondez TRUE ou FALSE. Notez vos rponses sur la page 1 : ANSWER SHEET. 1. Its highly unlikely for lunar rock to be found without the use of specialised detecting equipment. 2. Moon rock is darker than the colour of the ground in deserts. 3. The lunar meteorite which has been named Dhofar 458 was found in the Dhofar region of southern Oman in 1997. 4. Luc Labenne has been a meteorite hunter for over ten years. 5. Each day it rains about 160 tonnes of debris from space falls on Earth. 6. Ian Franchi thought that the New Scientists prize rock was a little too dark to be moon rock. 7. Harvey Nininger found more than 200 meteorites on the Great Plains in the USA. 8. There are only about sixty genuine lunar meteorites in the world. 9. Most of the meteorites which have been studied originated from the cloud of dust and gas that formed the solar system. 10. Moon rock contains hardly any water or sodium. 11. It is thought that the Moon was formed after a planet the size of Mars collided with Earth. 12. Lunar rocks and rocks from Earth have a lot of features in common. 13. Greenwood and Higgins analysed the chemical composition of the New Scientists prize moon rock 14. Lunar rock and terrestrial rock are the most difficult to distinguish between. 15. It takes about ten years for material displaced by an impact on the Moon to reach Earth. 16. Scientists want to obtain specimens of lunar rock which come from regions that were not explored by the Apollo or robotic landers. 17. The physical appearance of a meteorite and the way it has changed over time is no indication whether it is moon rock. 18. The impact which creates meteorites can cause a colour change in many of its minerals. 19. It was impossible to slice the New Scientists moon rock because it was too hard. 20. The fragment of Dhofar 458 is worth a thousand pounds. 3

When the moon lands by Roger Highfield, Editor of New Scientist


New Scientist 20 June 2009

1. You dont have to visit the moon to hold a chunk of it in you hand. Every day around 160 tonnes of rubble from space rains down on Earth, and some of it comes from the moon. All you need to find a piece of moon rock is keen eyesight, patience and an expanse of ice or desert against which a dark little chunk of our neighbour will stand out. 2. In this issues Feedback youll find details of a competition to win just such a piece of the moon, worth more than 1000. The prize is part of a lunar meteorite found by French collector Luc Labenne, who has been scouring deserts for meteorites since 1997. 3. Labenne found the rock known as Dhofar 458, on 3 April 2001 in the gravel plains of southern Omans Dhofar (or Zufar) region, and it was authentificated as a lunar meteorite by researchers at the University of California, Los Angeles. Before handing our piece over we wanted to use this opportunity to find out first-hand just how tricky it can be to distinguish a fragment of moon rock from a common or garden meteorite. For this we turned to researchers at the Open University (OU) in Milton Keynes, UK. 4. Meteorite hunters like Labenne follow an approach pioneered in the 1930s by the American collector Harvey Nininger, working on the Great Plains that stretch west from the Mississippi river to the Rocky Mountains. Nininger taught local people to seek out black stones on the pale ground, and thanks to their efforts he bagged more than 200 meteorites over three decades. 5. Another rich source was identified in 1969 by the Japanese Antarctic Research Expedition, which found meteorites on a blue ice field near the Yamato Mountains in East Antarctica. Other deserts became a focus of interest in the early 1990s, including the one that yielded our moon rock. 6. Lunar meteorites are exceedingly rare: only around 60 have been identified. And they dont just interest collectors. Space scientists are also keen to get hold of them, because they hold clues to what the rock is like on parts of the moon beyond the areas explored by the Apollo and robotic landers. 7. The vast majority of the tens of thousands of meteorites that have been studied are not from the moon. Around 6 out of 7 of them are of a type known as chondrites, characterised by stony spheres called chondrules which grew from the vast cloud of dust and gas that gave birth to the solar system. Some 4.5 billion years ago, budding planets and asteroids formed by sweeping material up from this cloud. Rocky remnants of these asteroids are still orbiting the sun, mostly between Mars and Jupiter. As the solar system developed, chance collisions between the asteroids caused them to spiral into chaotic orbits, later to crash into planets and their moons. 8. Occasionally, collisions happened on a far more dramatic scale, and one of them is now believed to have given birth to the moon. The consensus is that a stray planet as large as Mars crashed into the infant Earth, flinging globs of molten rock into space that coalesced to form what became our companion. 9. Small asteroids continue to smash into the moons surface every day because there is no atmosphere to destroy them by frictional heating. If the impact is hard enough, the ejected material escapes the moons weak gravity and can land on earth after tens of thousands or perhaps millions of years. 10. Still, these events are rare, and finding a lunar meteorite is not easy. Because the moon was born from the Earth, their rocks share many features. It is more difficult to tell a lunar rock from a terrestrial one than any other, says Colin Pillinger, a space scientist at the OU who worked on samples collected by the Apollo 11 astronauts. 11. What, then, does it take to find out if a meteorite has come from the moon? The traditional way to study any rock is to slice off a section with a diamond saw to reveal the mineral grains. This costs 1 to 2 grams of material, but as our rock weighs just 1.4 grams there would not have been much of it left if Pillingers team had done that. 4

When the moon lands


New Scientist 20 June 2009

12. Other important clues can come from the look of the stone and the way it has weathered. An experienced collector can tell a Mars from a moon meteorite, says Richard Greenwood, at the OUs Planetary and Space Sciences Research Institute, so this was the OU teams first line of attack. 13. It got off to a bad start. Planetary scientist Ian Franchi, who has hunted meteorites in Morocco, took one look and decided that our rock looked a little dark to come from the moon. Rocks from the lunar highlands contain a large proportion of light-coloured feldspar, a common mineral both on Earth and in space rocks. It was a heart-stopping moment. 14. Fortunately, we had a useful benchmark to check against. Our prize is from one of the 13 known fragments originating from a single parent meteorite. The largest of these fragments, known as Dhofar 026, has been studied closely by the Vernadsky Institute of Geochemistry and Analytical Chemistry of the Russian Academy of Sciences in Moscow. Using an electron microscope, Greenwood compared a little piece of our prize, which his colleague Michelle Higgins had mounted in epoxy resin and polished, with its larger sibling. He and another colleague, Diane Johnson, took a series of images and conducted chemical analyses. We waited tensely for Greenwoods verdict. 15. After looking at the images, he reported: The texture present is virtually identical to meteorite Dhofar 026. The initially off-putting colour can be explained by the fact that many minerals change structure when they experience a massive, instantaneous rise in pressure, as happened in the impact that gave rise to our meteorite and its siblings. This meteorite is both strongly shocked and partially melted, which is probably why it appears so dark, Greenwood says. 16. The test came at a cost, though. Because of a fracture in the rock, it is now in two pieces. 17. The results from the chemical analysis proved encouraging too. We have learned from samples brought back from the moon that lunar rock contains very little sodium compared with equivalent materials on Earth. The heat generated by the impact that formed the moon left the ejected rock so hot that it lost most of its volatile materials, including water and sodium. 18. Greenwood and Johnsons electron microscopy showed that the feldspar in our piece of moon rock had a similar composition to Dhofar 026 and other lunar rocks. Given the similarity of textures, the conclusion was clear: it looked lunar. 19. We wanted to run one more investigation of our rock, however. For this we enlisted the help of geochemist Andy Tindle, who is in charge of the OUs electron microprobe, an instrument that provides particularly accurate chemical analyses. His analysis not only confirmed that the feldspar was very sodium-poor, it also showed that two other key minerals, olivine and pyroxene, were a good match for those in Dhofar 026 and other lunar samples. We can be very confident that your sample is lunar, Greenwood concludes. 20. What could be a more fitting prize to mark the anniversary of the Apollo 11 adventure?

Universit Henri Poincar-Nancy 1 Diplme : L2 PC Epreuve crite de Chimie Physique Session de Janvier 2010

Dure 1 Heure 30 Rdacteur : J.L. Blin Documents non autoriss Calculatrice autorise

Exercice 1 La pression de vapeur de lanhydride sulfureux (SO2) solide en fonction de la temprature (en K), est donne par la relation : 1871,2 log10 (P) = + 10,59 T celle de lanhydride sulfureux (SO2) liquide, par la relation : 1425,7 + 8,32 log10 (P) = T o P reprsente la pression exprime en mmHg. 1. Calculer la temprature et la pression du point triple de SO2. 2. Calculer les enthalpies de sublimation et de vaporisation de SO2 et en dduire lenthalpie de fusion de SO2. 3. Calculer la temprature dbullition de SO2 sous P = 1atm. 4. Sachant que la variation de volume molaire au cours de la fusion est de 2 cm3.mol-1, calculer la pente de la courbe de fusion en (atm/K) la temprature du point triple. En dduire la temprature de fusion de SO2 sous P = 1tm. 5. Reprsenter le diagramme P = f(T) de SO2 en reportant les rsultats prcdents. Donnes ln (x) log10 (x) = ln (10) 1atm = 760 mmHg = 1,013 105 Pa

Exercice 2 On se propose dtudier lquilibre suivant :


SO2 (g) + 0,5 O2 (g) = SO3 (g) Donnes thermodynamiques 298 K, supposes indpendantes de T : Compos SO2 (g) O2 (g) SO3 (g)

fH0/kJ mol-1 -296,6


-394,8

S0/J K-1 mol-1 248,2 205,2 256,6

Cp0/J K-1 mol-1 39,9 29,4 50,7

On supposera que la variation denthalpie de la raction dans le sens direct est indpendante de la temprature. 1 Calculer lenthalpie libre standard de la raction rG et la constante Kp 298 K dans le sens direct.

2. 2.1. Citer la loi de modration des quilibres 2.2. Quelle est linfluence sur lquilibre : - dun abaissement de la temprature, - dune lvation de la pression, - dune addition de dioxygne O2 effectue volume constant ? - dune addition de gaz inerte effectue volume constant ? Vous justifierez chaque rponse. 3. Calculer la constante dquilibre Kp 700K. 4. A la temprature de 700 K on introduit 0,1 mole de SO2 (g) ; 0,1 de O2 (g) et 0,1 mole de SO3 (g) dans un rcipient A de volume constant V = 13 litres : 4.1. Calculer la pression totale linstant initial. 4.2. Calculer laffinit du systme dans son tat initial, en dduire le sens dvolution spontane du mlange initial. 4.3. A lquilibre, la pression totale dans le rcipient vaut 1,124 bar. Quelle est la composition du mlange lquilibre ? Que vaut laffinit chimique ? 5. Comme le montre le schma ci-dessous, le rcipient A contenant le mlange lquilibre 700 K est isol par une paroi dun rcipient B la mme temprature et contenant uniquement SO2(g) sous la pression de 1 bar. Les volumes des rcipients A et B sont identiques.

Rcipient A Volume V

Rcipient B Volume V

____

Piston

Prvoir le sens dvolution de lquilibre si aprs avoir supprim la cloison, on ne dplace pas le piston. Justifier votre rponse. Le mlange gazeux est idal R = 8,314 J.K-1.mol-1

* %

# ' +

$% ,

!" &

( &!)! ( % # -

/ % &

)/ % &

+ !

)!! )

&/% &

0 ! "# ! !$ "# )

+ &%

)!! &

/ & % &1

0 ' ) 2 + &3 + & ! 6)

!%

( (

/ 2 + )3 + ) + )

0* + 5 )4

% + &

+ 5 &4 + , -

7 / &1 % )1 &

0 %+ )$ + &

! +&

+ ! + , - , .

+ ) 6) (

+ &$

+ 45 8

/+ 5 + 5 )4 3 &4 0

"/ 7% )1 + , )

$ ! & ! )$

&

MTHODES MATHMATIQUES POUR LES SCIENCES DE LA MATIRE


Pierre Vuillermot Examen du 07.01.2010, 9h00-11h00
N.B. Les notations sont celles du cours et des travaux dirigs. Les notes de cours et des sances de travaux dirigs sont autorises, les calculettes sont interdites. La qualit de la rdaction sera un critre essentiel pour l valuation des copies. Exercice 1. Soit A 2 Mn (R) une matrice relle telle que A2 = dsigne la matrice identit. Prouver que: (a) A est inversible. (b) n est pair. (c) A ne possde aucune valeur propre relle. I, o I

Exercice 2. Soient A; B 2 Mn (K) deux matrices quelconques. Montrer qu est impossible d il avoir AB BA = I.

Exercice 3. Soit f : R3 7! R3 le champ vectoriel dont les trois composantes sont f 1 (x; y; z) = y; f 2 (x; y; z) = x et f 3 (x; y; z) = cos x. Soit E = (x; y; z) 2 R3 : y2 z2 x2 + 2 + 2 =1 2 a b c

l ellipsode centr l origine de demi-axes a > 0, b > 0, c > 0. Notons l intersection de E avec le plan horizontal z = 0. (a) Dterminer une reprsentation paramtrique de la courbe . (b) Dterminer l intgrale curviligne de f le long de parcourue dans le sens direct, relativement la reprsentation paramtrique obtenue sous (a). (c) Le champ vectoriel f est-il conservatif? La rponse est justier trs prcisment.

P RI ERE DE T OU RN ER LA P AGE 1

Exercice 4. Soit f : R3 7! R3 le champ vectoriel dont les trois composantes sont f 1 (x; y; z) = x; f 2 (x; y; z) = y et f 3 (x; y; z) = z. Notons S la surface plane dans R3 dont la frontire est le triangle de sommets A : (1; 0; 0); B : (0; 1; 0) et C : (0; 0; 1). (a) Dterminer l quation cartsienne de S sous la forme z = g(x; y) en calculant g explicitement et en prcisant trs exactement les contraintes imposer x et y, ncessaires pour la description de S. (b) partir du rsultat obtenu sous (a) dterminer n, le vecteur unit normal S dont la troisime composante est positive. (c) partir du rsultat obtenu sous (b), dterminer l intgrale de surface ZZ d (f; n)R3 :
S

UNIVERSITE HENRI POINCARE NANCY 1 FACULTE DES SCIENCES

SUJET DEXAMEN

JANVIER 10

DIPLOME

L2 SM-PMM

Epreuve de : Modlisation et concepts

Dure du sujet : Deux heures Nom du rdacteur : TAGHITE Documents non autoriss Calculatrices non autorises

Exercice 1 On considre dans 3 la forme diffrentielle dfinie par : ( x, y, z ) = ( y + yz )dx + ( x + xz + 2 yz 2 )dy + ( xy + 2 y 2 z )dz 1) Montrer que est une diffrentielle totale exacte. 2) Dterminer alors un potentiel f = f ( x, y,z ) tel que = df 3) Soit le chemin dfini par = {( x, y, z ) 3 ; x 2 + y 2 + z 2 = 1, y = x, z 0} quon oriente des y ngatifs vers les y positifs . Calculer I = .

Exercices 2 Soit la courbe gauche paramtre par : x = 3t 2 + t 3 y = 3t 2 t 3 z = 6 t 3 Dterminer pour t = 1 , le tridre de Frent, la courbure, la torsion ainsi que le centre de courbure. Exercice 3 Soient A, B, C et U quatre champs de vecteurs de E3 , espace vectoriel de dimension 3, dfinis sur un domaine D de E3 . 1) Transformer en utilisant les techniques de calcul tensoriel, le vecteur A ( B C ) en une autre criture intrinsque (c'est--dire indpendante de toute base). 2) On pose U = ( ) grad o est une application diffrentiable sur D et est une fonction scalaire. Calculer rot U , que peut-on dire de U ? Exercice 4 On considre le champ de vecteurs de 3 : V ( M ) = A

OM o A est un tenseur du second r2

ordre et r , rayon sphrique : r 2 = xk xk pour k = 1,2,3 . Donner les conditions sur A pour que : 1) div V = 0

2) rot V = 0 (Il est demander de ne pas utiliser les coordonnes sphriques mais de sappuyer sur r,i = Exercice 5 On considre deux tenseurs du second ordre A et B et un vecteur X . La relation A . B . X = A . B . X est vrifie ? Exercice 6 Etudier lexistence et la nature dextrema ventuels de la fonction f dfinie dans 2 par : f ( x, y ) = x 3 + 3xy 2 15x 12 y .
xi ). r

Anne 2009-2010 e Licence L2 PC Ondes 1 - Examen Janvier 2010 Dure : 2 h e Calculatrices autorises - Documents non autoriss e e

1. Question de cours 1
Par dnition, une onde stationnaire monochromatique correspond ` une fonction donde qui scrit, e a e en fonction du temps et de lespace (1D), sous la forme : F (x, t) = X(x)T (t) Sachant que cette fonction donde doit vrier lquation de dAlembert, dterminer la forme e e e gnrale de la fonction donde correspondante. e e

2. Question de cours 2
Dnir la linarit dune quation direntielle. Ecrire la reprsentation complexe dune onde e e e e e e plane progressive monochromatique. En dduire la relation de dispersion pour une onde vriant e e lquation de dAlembert. e

3. Ondes stationnaires le long dune corde


On consid`re une corde de masse linique , soumise ` une tension T0 , semi innie, attache en e e a e x = 0. Elle stend jusqu` x +. Une perturbation sinuso e a dale se propage dans le sens des x dcroissants, et est note F = F0 ei(1 t+k1 x) . Cette perturbation arrive en x = 0. e e a. Que peut-on dire de londe transmise vers x < 0 ? b. Soit G = G0 ei(2 tk2 x) londe rchie. Ecrire la condition sur la position de la corde en x = 0. e e En dduire que 1 = 2 = et k1 = k2 = k. Exprimer le coecient r = G0 /F0 . Quelle est la e caractristique principale de londe rchie ? e e e c. En dduire londe totale et y(x, t) sa partie relle en fonction de F0 , k et . Quel type donde e e obtient-on ? d. On impose une deuxi`me condition. La corde est conserve de 0 ` L, et xe en x = L. Comment e e a e se traduit cette nouvelle condition ? e. En dduire les frquences et longueurs donde possibles pour cette corde de longueur L ? Reprsenter e e e les trois premiers modes (y en fonction de x). f. A.N. : T0 = 900 N, L = 60 cm, = 1 kg m1 . Quelle est la frquence du mode fondamental ? e

4. Milieu dispersif
Pour une onde qui se propage dans un plasma, la relation de dispersion scrit : e
2 2 = p + k 2 c2

o` p est une constante, appele pulsation plasma. u e a. Reprsenter en fonction de k. Est-ce que toutes les ondes peuvent se propager ? e b. Calculer les vitesses de phase et de groupe. Discuter ces deux valeurs. c. Un paquet dondes, arrivant au bord du plasma, est constitu de trois ondes de pulsations e 1 = 1, 8p , 2 = 1, 6p et 3 = 0, 9p . Comment se propagent ces trois ondes dans le plasma ? page 1 de 2

5. La clarinette
Une clarinette peut tre modlise par un tuyau de longueur L, ferm en x = 0 et ouvert en e e e e x = L. a. Quelles sont les consquences (sans faire de dmonstration) de ces conditions aux limites sur le e e dplacement s(x, t) dune tranche dair d ` une perturbation ? e ua b. En dduire les frquences et longueurs donde possibles dans le tuyau. Reprsenter les quatre e e e premiers modes. c. A. N. : Si la longueur est de 50 cm, quelle est la frquence du mode fondamental ? e d. Un trou est perc en x0 = L/5. Quelle la frquence du nouveau mode fondamental ? e e

6. Eet Doppler
A partir dun instant initial t = 0, un son est mis dans lair en x = 0, ` une frquence f0 . A ce e a e mme instant, une premi`re personne, situe en x = L, se dplace vers x = 0 ` la vitesse v1 , alors e e e e a quune deuxi`me personne situe en x = +L sloigne vers x > L ` la vitesse v2 . On supposera e e e a que v1 et v2 sont infrieures ` la vitesse de propagation du son dans lair, note v0 . e a e a. Dterminer les frquences f1 et f2 qui seront perues par les personnes 1 et 2. e e c b. A.N. : Calculer ces frquences si f0 = 400 Hz, v1 = 200 ms1 et v2 = 200 ms1 . e c. Que se passe-t-il si f0 = 400 Hz, v1 = 0 ms1 et v2 = 500 ms1 ?

page 2 de 2

NANCY UNIVERSITE UNIVERSITE HENRI POINCARE- FACULTE DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN
DIPLOME : Licence SVS L2S3 Dure conseille pour rpondre au sujet : 40 min Nom du rdacteur : B. Charpentier

Epreuve de : CM, UE 3.01 Biologie Molculaire I, biosynthse des acides nucliques et des protines Session de : Janvier 2010 (S3) Date : /01/2010 Horaire : - h Documents non autoriss Calculatrice non autorise

LES SUJETS DE CETTE UE SONT A REDIGER SUR DES COPIES SEPAREES

1. 2. 3.

(a) Dfinissez et schmatisez la structure gnrale dune unit transcriptionnelle (UT)codantuneprotine. (b)DansquelsgnomesrencontretontypiquementdesUTappelesoprons? (c)Quelssontlesavantagesduneorganisationenopron?Explicitez.

(a) Quelles familles denzymes interviennent dans la catalyse permettant la polymrisationdesdiffrentsacidesnucliques.Explicitez. (b)Schmatisezlaractionpermettantlapolymrisationdacidesnucliques.

LesARNmessagerseucaryotesontdesextrmitsparticulires.Explicitez.

UNIVERSITEHENRIPOINCARE,NANCYIFACULTEDESSCIENCES SUJETDEXAMEN DIPLOME:LCVI S3 U01 Epreuve:Biologiemolculaire Session:1eSession Date:/01/2010 Dure:40minutes Nomdurdacteur:MmeRobas Documentsautoriss Documentsnonautoriss Calculatriceautorise Calculatricenonautorise

Veuillezrdigersurcopiespare Q1: Quels sont la composition, la structure et les fonctions cellulaires des ribosomes chez les procaryotes? Q2: QuvoquepourvousletermeWobbleoubasesflottantes.Expliqueznotammentquelle tapedumcanismedetraductioncemcanismeintervient.Estceunavantageounonpourlacellule? CijointlecodegntiquencessairepourrpondreausujetdeTD: Tableauducodegntique:

UNIVERSITE HENRI POINCARE-NANCY I

FACULTE DES SCIENCES et TECHNIQUES


DIPLOME: LCVI Epreuve de: TD de S3. UE 01 Session de: janvier 2010 Date: janvier 2010 Horaire: SUJET D'EXAMEN Nom du rdacteur : C. Guimont et L. Domenjoud Dure conseille : 40 minutes X documents non autoriss X calculatrice non autorise

SUJETS A TRAITER SUR COPIE SEPAREE


Exercice N1 Vous voulez savoir quel est le mode de rplication de lADN dune bactrie. - La coupure totale de cet ADN bactrien par des enzymes a produit 11 fragments dont le nom et le positionnement sont indiqus dans la figure ci-dessous. - De la thymidine radioactive (3H-Thy) a t ajoute dans le milieu de culture de cette bactrie soit pendant 5 minutes soit pendant 10 minutes. Aprs chaque temps de culture, les bactries ont t rcupres , lADN bactrien a t extrait, purifi, coup par les mmes enzymes. La radioactivit (en coups par minute : cpm) de chaque fragment a t mesure et rapporte (tableau ci-dessous). 1) Comment est lADN dune bactrie ? circulaire ? linaire ? simple brin ? double brin ? 2) Pourquoi la thymidine est-elle un bon prcurseur pour le marquage radioactif spcifique de lADN ? Dans quelle phase de croissance sont les bactries aprs 5 minutes et 10 minutes de culture ? 3) A partir des rsultats ci-dessous, dmontrez si la rplication est uni ou bidirectionnelle sur cet ADN. 4) Donnez le nom du fragment contenant les squences de lorigine de la rplication. Donnez le nom du fragment contenant la rgion de terminaison de la rplication.
Quantit relative de radioactivit (en cpm)

Nom des fragments A B C D E F G H I J K

Incorporation de 3H Thy pendant 5 minutes 1 3,9 0 0,9 1,8 4 5,4 1,7 2,7 4,9 2,4

Incorporation de 3H Thy pendant 10 minutes 1 3 0,8 0,9 2,0 3,1 4,2 2,5 3 3,7 2,9

Exercice N2: - La squence en bases et la structure secondaire de lextrmit dun fragment de lARN ribosomal 16S est prsente dans la figure cidessous (Nm indique des bases mthyles trs souvent prsentes dans lARN ribosomal). - La squence en bases de lARN messager codant pour une protine X de E. coli est donne ci-aprs. 5-ACUAAUAGAGGAGGACAAUCAUGGUACGCAUGACUUUGUGGGAUACCUACCUAUAAGACAUU -3 1) Que veut dire 16S ? 2) Pouvez-vous dire quelle est la sous-unit ribosomale qui peut se fixer sur cet ARN messager ? expliquez pourquoi laide dun schma. 3) Ecrivez et orientez la squence en acides amins de la protine X traduite partir de cet ARN messager. 4) Ecrivez et orientez les anti-codons des ARN de transfert impliqus dans cette traduction.

UNIVERSITE HENRI POINCARE-NANCY I FACULTE DES SCIENCES ET TECHNIQUES

LICENCE SCIENCES DU VIVANT LSV3.02 SUJET D'EXAMEN - 1re session


Epreuve de BIOCHIMIE Date : Janvier 2010 Horaire : Dure de lpreuve: 2 heures Documents non autoriss Calculatrices non autorises

LEPREUVE DE BIOCHIMIE COMPORTE 3 PARTIES A RENDRE SUR DES COPIES SEPAREES Partie 1 : Cours de H. MAZON Partie 2 : Cours de E. ROGALSKA Partie 3 : Travaux dirigs (dure conseille 40 min) (dure conseille 40 min) (dure conseille 40 min)

Partie 1 : Contrle terminal du cours magistral de H. MAZON


A rendre sur une copie spare. Dure conseille 40 min 1- La trypsine et la chymotrypsine sont deux enzymes qui hydrolysent les protines. Leurs sites de coupure diffrent lgrement. La trypsine coupe les liaisons peptidiques au niveau dun acide amin charg (lysine ou arginine), tandis que la chymotrypsine coupe les liaisons peptidiques au niveau dun acide amin aromatique (tyrosine, tryptophane ou phnylalanine). Les acides amins situs au niveau du site actif de chaque enzyme sont prsents ci-dessous : Trypsine Chymotrypsine Acides amins du site 1 Asp 189 Ser 189 Acides amins du site 2 Asp102, His 57, Ser 195 Asp102, His 57, Ser 195 a) A quoi correspondent les sites 1 et 2 de chaque enzyme ? b) Expliquer pourquoi les sites de coupure de chacune des deux enzymes sont diffrents. 2- Quelle reprsentation graphique permet de dterminer la vitesse initiale dune raction enzymatique ? 3- Ecrire (sans la dmontrer) la relation de Michaelis-Menten. Dfinir tous les paramtres de lquation et donner leurs units. 4- A partir de cette relation, quelle reprsentation graphique permet dobtenir prcisment Km et Vm ? Annoter le graphe et crire lquation correspondante. 5- Quel est leffet du pH sur une raction enzymatique. Illustrer par un schma.

Partie 2 : Contrle terminal du cours magistral de E. ROGLASKA


A rendre sur une copie spare. Dure conseille 40 min 1). Dfinir un zwitterion d'acide amin et expliquer son comportement en milieu acide et milieu basique.

2). La liaison peptidique : a. Donner une dfinition et dcrire son mode de formation. b. Citer les trois principales caractristiques structurales d'une liaison peptidique. 3). Dcrire les diffrents niveaux de structure des protines. Pour chaque niveau structural, prciser les diffrents types de liaisons qui interviennent. 4). Qu'est-ce que la dnaturation des protines, quels moyens peut-on employer pour l'obtenir et quelles en sont les consquences ?

Partie 3 : Contrle terminal de travaux dirigs (TD)


A rendre sur une copie spare. Dure conseille 40 min

Un extrait brut protique en solution dans un tampon phosphate, pH = 7,5 contient deux enzymes monomriques A et B dont les caractristiques principales sont indiques ci-dessous : Enzyme A a) masse molaire (kDa ou kg/mole) b) neutralit lectrique (unit de pH) c) domaine de prcipitation (% saturation en sel) d) complexe avec un ligand X (K dissociation en M) 50 5,8 30-45 10
-3

Enzyme B 100 6,8 50-65 10-4

Un exprimentateur veut sparer les 2 enzymes par une technique chromatographique. 1) Indiquer le nom gnrique de la chromatographie et celui du critre discriminant adapts chaque proprit a) b) c) d) indique ci-dessus. 2) Pour chaque chromatographie (les dtails mthodologiques ne sont pas demands) : Proposer le choix dun support dfini par les conditions respecter et un mode opratoire pour sparer les deux enzymes. En dduire leur ordre dlution respectif. Lenzyme B catalysant la transformation dun substrat S a t compltement purifie un taux de 300 fois avec un rendement de 50% en utilisant ces techniques chromatographiques. Lchantillon final contient 600 UI (units internationales) et 10 mg de protines 3) En dduire: - les activits totale et spcifique de B dans lextrait brut (prciser les units) - la quantit de protines dans lextrait brut 4) Calculer lactivit molculaire spcifique de B exprime en seconde -1 Le ligand X se comporte comme un inhibiteur non comptitif absolu vis--vis de la transformation de S par B. En prsence de X une concentration gale son Ki, la Vmax est gale 2 UA (units arbitraires). Y est un inhibiteur comptitif vis--vis de la transformation de S par B avec deux fois moins daffinit que X pour B. En prsence dune concentration de Y gale 2.10-4 M, la concentration en substrat pour laquelle la vitesse initiale obtenue est la moiti de la Vmax est gale 0,3 mM. 5) En dduire les valeurs en absence dinhibiteurs : - des paramtres cintiques de lenzyme (Vmax , Km) - de la vitesse initiale (en UA) obtenue une concentration initiale de S = 0,35 mM 6) Comparer laffinit des 3 ligands (S, X, Y) vis--vis de lenzyme B.

Epreuve de : UE 3U03 Session de : janvier 2009 (1re session) Dure du sujet : 2h00

Nom du rdacteur : A. Thibessard Documents : non autoriss Calculatrices : autorises

Exercice I :
Chez la drosophile, un gne nomm forked (f) provoque un raccourcissement et une inclinaison des poils et des soies. Un autre gne, nomm outstretched (od) provoque une mauvaise orientation des ailes qui, dans ce cas-l, forment un angle droit avec le corps. Un troisime gne nomm garnet (g) est responsable de la couleur rose des yeux des jeunes mouches. Des femelles htrozygotes pour chacun de ces gnes sont croises par des mles sauvages. Les rsultats de ce croisement F1 sont indiqus ci-dessous: Femelles : toutes sauvages Mles : 439 [outstretched] 419 [garnet, forked] 60 [forked] 57 [outstretched, garnet] 13 [sauvages] 9 [outstretched, garnet, forked] 2 [garnet] 1 [outstretched, forked] Vous utiliserez la nomenclature suivante : f +, od + et g + pour les allles sauvages et f -, od - et g - pour les allles mutants. 1. Sur quel chromosome sont situs ces trois loci? Argumentez. 2. Ces gnes sont-ils gntiquement lis ? Justifiez. 3. Quelles sont les associations parentales de la femelle F0 ? 4. Etablir la carte gntique. 5. Etes-vous en mesure de dterminer les relations de dominance-rcessivit de chacun de ces trois gnes ? Justifiez.

Exercice II :
Chez le champignon haplode Sordaria, les ascospores sont normalement noires (couleur sauvage). Deux souches mutantes ont t isoles : l'une prsente des spores blanches (mutant 1), l'autre des spores rouges (mutant 2). Crois avec le sauvage le mutant 1 donne des asques contenant 4 spores noires et 4 blanches. Crois avec le sauvage le mutant 2 donne des asques contenant 4 spores noires et 4 rouges. La disposition des spores dans lasque et les effectifs de chaque type dasque observs sont rsums dans la figure suivante :

I
Croisement (sauvage x mutant1) : Croisement (sauvage x mutant2) : 456 652

II
432 690

III
70 142

IV
65 137

V
82 145

VI
73 151

1. Que rvlent ces croisements quant au nombre de gnes impliqus dans la coloration des spores chez Sordaria et quant la (ou les) localisation(s) du (ou des) gne(s) en question ? Justifiez. Lors du croisement entre les deux souches mutantes 1 et 2, on observe : - 583 asques contenant 4 spores noires et 4 spores blanches - 580 asques contenant 4 blanches et 4 rouges - 498 asques contenant 4 blanches 2 noires et 2 rouges. 2. Interprtez ces diffrents types d'asques. Pouvez-vous conclure quant la liaison gntique entre les couples d'allles concerns? Etablir la ou les cartes gntiques possibles. 3. Interprtez linteraction existant entre ces gnes pour l'tablissement du phnotype de pigmentation des spores.

Exercice III :
On croise deux varits d'Hibiscus (organisme diplode) de race pure, diffrant par deux caractres (la forme et la couleur de la corolle). Les hybrides de F1 croiss entre eux fournissent en F2 la descendance suivante : 82 plantes corolle ouverte rouge, 165 plantes corolle ouverte rose, 81 plantes corolle ouverte blanche, 28 plantes corolle ferme rouge, 53 plantes corolle ferme rose, 26 plantes corolle ferme blanche. 1. Quels est la couleur de la corolle de chacun des parents F0 de race pure ? 2. Quels est la forme de la corolle de chacun des parents F0 de race pure ? 3. Quels sont le gnotype et le phnotype des hybrides de F1 ? 4. Quels sont les gnotypes des individus F2 ? 5. On dsire prciser le gnotype de chacune des 165 plantes corolle ouverte rose obtenues en F2. Que faut-il faire ? Quel sera le rsultat ?

Exercice IV :
Les gnes appels spore killer sont relativement frquents dans les populations naturelles de Neurospora crassa. Au sein des asques issus de miocytes htrozygotes pour le locus spore killer, toutes les spores qui ne portent pas lallle spore killer sont tues. Elles sont alors incapables de germer. Concrtement, lors dun croisement de Sk x sk (o Sk dsigne lallle spore killer) toutes spores portant lallle sk sont tues. NB : les spores sk issues dun miocyte homozygote, elles, sont viables. Un croisement Sk x sk produit 125 asques. Tous les asques possdent quatre ascospores mortes et quatre ascospores capables de germer. Pour 95 de ses asques, les quatre ascospores mortes sont toutes groupes lune ou lautre des extrmits de lasque (les demi-asques sont homognes). Quelle est la distance gntique entre le locus Sk/sk et le centromre ?

Intitul de lpreuve :
UE 3.04 Biologie du Dveloppement

Responsable du sujet : H. SCHOHN Dure de lpreuve : 1 H 30 Documents autoriss : non Calculatrice : non

Semestre 3 Anne : 2009/2010

1. La segmentation par rotation Prsentez ce mode de segmentation laide dune reprsentation schmatique

2. Dterminants cytoplasmiques Vous expliquerez limportance de dterminants cytoplasmiques dans la formation de laxe antro postrieur chez C elegans

3. Annexes extra embryonnaires chez le Poulet Quels sont les feuillets qui participent la formation des diffrentes annexes extra embryonnaires ?

4. La dlamination Aprs avoir dfini la dlamination, vous montrerez limportance de la dlamination au cours du dveloppement chez le Poulet.

5. Dterminants cytoplasmiques Comment mettre en vidence la prsence des dterminants cytoplasmiques dans le dveloppement de type mosaque

6. Dveloppement des Amphibiens Vous prciserez limportance de la raction corticale au cours du dveloppement.

7. La chorde Vous expliquerez son rle au cours du dveloppement chez les Vertbrs.

8. Gastrulation Rle de lintercalation au cours de la gastrulation chez les amphibiens

9. Ectoblaste ou ectoderme Prcisez le devenir de ce feuillet embryonnaire

10. Le msoderme Vos prciserez lorigine de ce feuillet embryonnaire

11. Crtes neurales Origine, mouvements et devenir des crtes neurales.

12. Placenta A partir de 2 schmas, vous expliquerez la formation de villosits choriales

13. Le chorion Que reprsente le chorion

14. Le sclrotome Origine et devenir

15. Mouvements morphogntiques Deux fragments dagar saturs en colorant vital sont mis en contact dune blastule damphibien. Les fragments sont placs selon le schma prsent. Lencoche blastoporale est indique par un trait continu sur la face o apparat cette structure morphologique. La position de lencoche blastoporale est indique par un trait pointill sur lautre face de lembryon. Prcisez le devenir possible des blastomres ainsi colors au cours de la gastrulation.

14. Epreuve de Travaux Pratiques

Ralisez un schma des coupes suivantes et annotez vos dessins

Figure 1

Figure 2

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES ET TECHNIQUES DIPLME : LSV2me anne UE 3.05: Nutrition carbone et azote des plantes Epreuve de : UE 3.05 Session de janvier 2010.................................................... Date : Horaire : .................................................. .....

SUJET D'EXAMEN Dure du sujet : 1 heure Documents autoriss Documents non autoriss Calculatrices autorises . Calculatrices non autorises (Veuillez cocher les cases correspondantes)

Sujet portant sur le cours de M. CHALOT Rpondez prcisment toutes les questions dans lordre et en reportant le numro de la question sur la copie. Remarque : Une illustration (schma, figure) peut efficacement remplacer un long propos. 1) Pourquoi parle-t-on de "cycle" de l'azote ? Dcrivez ce cycle. 2) Au cours du mois de juin, aprs de fortes pluies suivies de journes trs chaudes, l'eau d'une petite rivire borde de terres agricoles devient soudainement verte. Pouvez-vous expliquer ce qui s'est produit ? 3) Pourquoi pratique-t-on la rotation des cultures (particulirement la rotation lgumineuses/crales) ? 4) Qu'est-ce que le procd Haber/Bosch ? 5) Pourquoi le lisier de porc est-il nuisible pour lenvironnement ? 6) Sous quelle(s) forme(s) les plantes absorbent-elles l'azote ? Et que font-elles avec cet azote ? 7) Pourquoi une carence en azote se manifeste-t-elle par un jaunissement des feuilles ? 8) Pourquoi retrouve-t-on gnralement les plantes carnivores dans des sols acides et pauvres en nutriments? 9) Comment peut-on caractriser la fonction dune protine de transport ? 10) Les transporteurs dammonium et de nitrate appartiennent des familles multigniques. Quel est lintrt de cette multiplicit pour la plante. 11) Dans quels tissus et dans quels compartiments cellulaires sont localises les enzymes responsables de lassimilation du nitrate ? 12) Dcrivez brivement les modalits de contrle de la glutamine synthtase par la lumire.

LSV 3.05 Sujet dexamen

Page 1 sur 1

NANCY UNIVERSITE Facult des Sciences et Techniques DIPLOME : Licence Sciences du Vivant Epreuve de : L.S.V. 3U 05 TD-TP Session de : 1re session janvier 2010 Date : Horaire :

SUJET DEXAMEN Dure du sujet : 1 heure Nom du rdacteur: D Gerant, M Morel, L Diss, Y Jolivet Documents autoriss : Non Calculatrices autorises : Oui

Question 1 : Trois cellules issues du mme tissu vgtal dont les caractristiques sont = -1,5 MPa et p = +0,75 MPa sont places dans trois bchers distincts contenant : - bcher A : 50 ml d'une solution 100 mM de saccharose - bcher B : 50 ml d'une solution 100 mM de chlorure de sodium (NaCl) - bcher C : 50 ml d'une solution 100 mM de chlorure de calcium (CaCl2). Lexprience est effectue 27C. Existe-t-il des mouvements deau entre la cellule et les diffrentes solutions ? Si oui, dans quelles directions s'effectuent-ils ? R=0.00831 Question 2 : En vous servant du tableau ci-dessous, dterminez quel substrat est le plus adapt pour tudier la nutrition minrale dune plante qui a besoin de beaucoup deau. Justifiez votre rponse. Porosit Laine de roche Vermiculite Argile expanse Capacit au champ 81,8 42,3 34,6 Rserve utile 77,8 7,8 12,0 Point de Capacit dchange fltrissement cationique (eq/m3) 4,0 34,5 22,6 0 2 0

96,7 95,4 96,4

Les rsultats sont exprims en % du volume total Question 3 : Des plants de Haricot sont cultivs sur diffrents milieux dont on fait varier la nature de la source azote (voir tableau). Lactivit de la nitrate rductase (NR) est mesure dans les racines et les feuilles de ces plantes. Commenter les rsultats et interprter. Nature de la source azote NR racines mol NO2 / h / g MF NR feuilles mol NO2 / h / g MF milieu sans azote 0,1 0,4 NaNO3 1 mM 0,5 1,6 NH4Cl 1 mM 0,1 0,4 milieu mixte : NH4Cl 0,75 mM + Na NO3 0,25 mM 0,4 0,4

1 de 2

Question 4 : Le phosphore est un lment trs mobile, absorb par les racines grce des protines membranaires qui sont des transporteurs spcifiques. La morphologie du systme racinaire est un des premiers facteurs qui conditionne labsorption minrale et donc la croissance de la plante. Afin dtudier larchitecture du systme racinaire en fonction de la disponibilit en phosphate inorganique (Pi) dans le sol, des plantules dArabidopsis thaliana ont t semes sur des milieux de culture contenant 1 mM Pi (milieu standard) ou 5 M Pi (milieu carenc). Aprs 14 jours de culture diffrentes mesures sont effectues (tableau 1) : longueur de la racine primaire et du systme racinaire complet, et vitesse dincorporation du Pi. Milieu standard (+P) Longueur racine primaire (cm) Masse du systme racinaire complet (g) Vitesse dincorporation du Pi (mol Pi / h / g matire fraiche) 9,5 1 4,4 0,8 1,1 0,2 Milieu carenc (-P) 5,7 0,7 4,8 0,2 5,6 0,7

Quelles sont les consquences de la carence en Pi sur larchitecture racinaire ? Quelles sont les consquences de la carence en Pi sur la capacit intrinsque des racines absorber le Pi disponible dans le sol ? Comment peut-on expliquer ce phnomne?

2 de 2

NANCY UNIVERSITE Facult des Sciences et Techniques DIPLOME : Licence Sciences du Vivant Epreuve de : L.S.V. 3U 06 CM Session de : 1re session janvier 2010 Date : Horaire :

SUJET DEXAMEN Dure du sujet : 1 heure Nom du rdacteur: Y Jolivet Documents autoriss : Non Calculatrices autorises : Non

Sujet 1 (CM dure conseille : 1h)

1. Proposer et commenter un schma permettant sur un cycle photopriodique de rvler les


diffrences de fixation du CO2 externe entre les plantes mtabolisme photosynthtique de type C3 et les plantes mtabolisme photosynthtique de type CAM. (10 points)

2. Que savez-vous du saccharose et de sa biosynthse dans les feuilles lors de la priode


lumineuse ? (10 points)

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES ET TECHNIQUES DIPLME : LSV2 anne Epreuve de : UE 3.06 Biologie des organismes re Session de janvier 2010 (1 session) Documents non autoriss Calculatrice autorise
me

SUJET D'EXAMEN
Dure du sujet : 1 heure Nom des rdacteurs : D. GERANT, R. EL ZEIN et P. PRIAULT

PARTIE 1 (/5pts)
QCM : Les questions suivantes peuvent amener 1 ou plusieurs rponses. crivez le(s) proposition(s) juste(s) sur votre copie. 1. Une lectrode de Clark permet de mesurer : une teneur en O2 une teneur en CO2 courant lectrique un dgagement dO2 aucun de ces paramtres un

2. La respiration mitochondriale fonctionne: uniquement de jour uniquement de nuit de jour et de nuit 3. Une Intensit Photosynthtique Apparente (IPA) peut tre : ngative positive nulle 4. Lintensit respiratoire (IR) et lintensit photosynthtique apparente (IPA) ont t dtermines laide dune lectrode de Clark partir de 0,2 g dpinard dont la concentration en chlorophylles totales est de 0,5 mg/gpinard. Sachant que IR=-100 nmolesO2.min-1.g-1pinard et IPA= 18 molesO2.heure-1.mg-1chlorophylles, lintensit photosynthtique relle (IPR) sera gale : 118 nmolesO2.min-1.g-1pinard 500 nmolesO2.min-1.mg-1chlorophylles 50 nmolesO2.min-1.g-1pinard 100 nmolesO2.min-1.mg-1chlorophylles 250 molesO2.an-1.kg-1pinard.

PARTIE 2 (/10pts)
Une suspension de chloroplastes (SC) contenant 200g de chlorophylles totales par mL a t prpare partir de 10g de feuilles dpinard. La raction de Hill a t tudie en utilisant les proprits du DCPIP dtre bleu ltat oxyd et incolore ltat rduit. Ainsi la vitesse de rduction du DCPIP a t suivie pendant deux minutes 600 nm sur des cuvettes spectrophotomtre dune largeur d1 cm soumises une intensit lumineuse de 5000 lux et contenant 0,2 mL de DCPIP oxyd, 0,5 mL de suspension SC et 1,8 mL de tampon de lavage. Les rsultats obtenus montrent une chute dabsorbance de 0,2 unit de DO par minute. Le coefficient dabsorption spcifique () du DCPIP 600 nm est de 1,64 L.mole-1.cm-1. 2a. Que doit contenir le blanc servant faire le Zro 600 nm ? 2b. Calculer la vitesse de rduction du DCPIP en moles DCPIP rduites.min-1.mg-1chlorophylles totales. Dcrire chaque tape du calcul. 2c. Convertir le rsultat obtenu en moles O2.min-1.mg-1chlorophylles totales. Justifier votre rponse. 2d. Prdire limpact sur la vitesse de rduction de DCPIP dune augmentation de lintensit lumineuse laquelle sera soumise votre cuvette pendant les deux minutes de lexprience. Argumentez laide de vos connaissances sur les grandes tapes du mtabolisme photosynthtique ?

PARTIE 3 (/5pts)
Deux chantillons de rhizomes de muguet ont t rcolts deux priodes de lanne : le premier au printemps et le second en automne. Un test de coloration Lugol a t ralis sur une coupe transversale de chacun de ces deux rhizomes. 3a. Rappelez la dfinition dun rhizome et le principe du test au Lugol. 3b. Prdire le rsultat du test de coloration au Lugol sur les deux chantillons (Rhizome rcolt au printemps et Rhizome rcolt lautomne) en justifiant et discutant brivement de la saisonnalit du stockage des rserves carbones.

Intitul de lpreuve : LSV2 UE 3.07 Organisation des Vertbrs 1 Session Anne : 2009/2010

Responsable du sujet : S. Flament Dure de lpreuve : 2 heures Documents autoriss : non Calculatrice : non

Traiter les 3 questions suivantes : a) Dfinition et classification des Mammifres (8 points).

b) Les glandes cutanes des Mammifres (6 points).

c) Ladaptation la course quadrupde chez les Mammifres onguligrades (6 points).

LSV 3.08 Gntique des populations - Session Janvier 2010 Sujet propos par A. Puymge et N. Leblond-Bourget Documents et calculatrice mmoire non autoriss

Rabat coller

Nom : Prnom : N tudiant :

Exercice 1
Table du khi-

Avec d le degr de libert et p le seuil


La lactase, enzyme dgradant le lactose du lait, est tudie chez une population de 100 enfants europens (chez les adultes, lenzyme perd 90% son activit aprs le sevrage gnrant une intolrance des adultes au lait). La figure ci-dessus schmatise les mobilits lectrophortiques des isoenzymes lactases.

Q1 : Donnez brivement le principe de la mthode utilise.


Q2. Expliquez le raisonnement qui a conduit la dtermination des gnotypes des individus. Indiquez la nature de l'enzyme.

Q3. Calculez la frquence des allles A1 et A2.


Q4. La population est-elle en quilibre de Hardy-Weinberg ?


Sachant que dans cette population l'allle A1 est dfavorable de sorte que A2A2 a une valeur adaptative de 1, A1A2 de 0,7 et A1A1 de 0,4. Q5. Si aucune mutation ne se produit quelles seront les valeurs des frquences allliques de A1 et de A2 la gnration suivante ? (Faire un tableau - Il nest pas ncessaire de redmontrer les formules).

Exercice 2 : Les habitants sorciers du village de Goldric's Hollow vivaient totalement enclavs (comme sur une le) et ne se reproduisaient donc qu'entre sorciers. L'acceptation des moldus (personne sans aucun pouvoir magique) dans le village a permis aux moldus du monde entier de venir coloniser Goldric's Hollow. Ainsi, les sorciers de Goldric's Hollow ont pu se reproduire avec des moldus. Considrons le locus Mag deux allles Mag1 et Mag2. La frquence de lallle Mag1 est constante et gale 0,35 chez les habitants de Goldric's Hollow. La frquence de Mag1 est de 0,60 chez les migrants moldus. Q6. Calculez la frquence thorique de Mag1 chez les habitants de Goldric's Hollow sachant que m=0,02 depuis 10 gnrations.


Avant l'arrive des moldus, il tait frquent d'observer des croisements consanguins d la petite taille de la population sorcire.
Q7. A la lecture de larbre gnalogique dune famille moldus (cicontre), indiquez quel(s) individu(s) est (sont) consanguin(s). Expliquez.

... ... ... ... ... ... ... ...


Q8. Calculez le taux de consanguinit de ce (ces) individu(s).

l
Q9. Calculez le taux de consanguinit de ce (ces) individu(s) sachant que f(A)= 0,3

NANCY UNIVERSITE

Facult des Sciences et Techniques

SUJET D'EXAMEN

DIPLOME : Licence Sciences du Vivant, L2 Epreuve de : UE 3.09 Session : Janvier 2010 Date : Horaire : Biochimie Mtabolique

Dure : 1 heure Nom des rdacteurs : Cline Cakir-Kiefer Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

Rdigez une copie par examinateur


Premire partie : examen terminal (40 min)

Question 1 :

Glucides simples (surtout glucose)

Acides amins

Acides gras + glycrol

?
Vers quelle molcule converge le catabolisme des molcules indiques sur ce schma ? Exposer les caractristiques de cette molcule. Quel est le devenir ensuite cette molcule ?

Question 2 : De quelle manire lATP constitue-t-il une monnaie dchange passe partout ? Donner lexemple de lhydrolyse dune molcule couple la biosynthse de lATP. Pourquoi ce couplage est-il possible ?

Question 3 : Le complexe de la Pyruvate Deshydrognase catalyse la raction suivante : Pyruvate + NAD+ + CoASH Actyl-CoA + CO2 + NADH, H+

Quelles sont les avantages pour les enzymes de sorganiser en complexe multienzymatique ? De quelles enzymes est constitu ce complexe de la Pyruvate Deshydrognase ? Indiquer par quel substrat ou produit de raction sont rguls les composants E2 et E3 de ce complexe ? Comment sappellent ces rgulations ?

Deuxime partie : contrle continu (20 min)


1) Une voie mtabolique peut tre tudie diffrents niveaux Citer et expliquer ces diffrents niveaux dtude. 2) Rgulation dune activit enzymatique Expliquez de quelles manires la rgulation dune voie mtabolique peut se faire au niveau dune enzyme ? Quelles sont les caractristiques dune enzyme allostrique ? Comment agissent les effecteurs allostriques ? Proposez une exprience qui mettrait en vidence une rtroinhibition chez une bactrie.

UHP NANCY

Facult des Sciences et Techniques SUJET D'EXAMEN

DIPLOME : Licence Sciences du Vivant, L2 : Epreuve de : UE 3.09 Biochimie Mtabolique : Dure globale : 2 heures Nom du rdacteur : Rgis Marczak (dure : 1 heure) Session : Janvier 2010 Date : Horaire : Documents non autoriss Calculatrices non autorises

Rdigez une copie par examinateur

Premire partie : examen terminal : CM (40 min)


Catabolisme des acides amins : La dgradation des acides amins se passe en deux parties principales : 1.2. la partie carbone et 3. la partie azote. 1. Montrer en quoi la dgradation du squelette carbon est un exemple remarquable dconomie de transformations mtaboliques. Illustrez votre rponse en nommant les 7 molcules formes par ce catabolisme, en les plaant au centre dun schma et en les reliant entre elles par des flches selon le fonctionnement des voies mtaboliques. Les diffrents acides amins seront ensuite placs sur ce schma la priphrie en reliant les diffrentes voies par dautres flches appropries. Les noms des autres molcules intermdiaires et ceux des enzymes et des cofacteurs ne sont pas demands 2. Vous pouvez ainsi classer les acides amins en deux catgories principales : Nommez les et prciser la rpartition des acides amins dans ces deux catgories en fonction des voies de synthse dont ils sont les prcurseurs. Rappel : certains acides amins peuvent tre impliqus dans plusieurs voies. Quels composs peuvent tre forms en empruntant ces voies ? Donner un exemple dun acide amin dgrad en une seule raction. 3. La partie azote des acides amins est libre sous forme dammoniac qui chez les organismes suprieurs est fortement toxique pour la cellule A laide dun schma illustr, expliquer comment se fait le transport de lammoniac jusquaux tissus spcialiss et quel son devenir au niveau du rein et du foie. Pour ce dernier tissu, indiquez seulement quel est le produit final, donnez sa formule et lorigine des atomes de carbone et dazote le composant.

Deuxime partie : contrle continu : TD (20 min)


Dgradation de lalanine. 1) A laide dun schma simplifi, indiquez le devenir des deux parties de lacide amin lors de sa dgradation chez un organisme suprieur 2) Ecrire le bilan mtabolique global (ractions intermdiaires non demandes) et en dduire le rendement nergtique. 3) Expliquez par le calcul, partir du bilan de la dgradation de la partie azote de lalanine, pourquoi ce rendement est moins lev que celui obtenu chez un organisme librant directement de lammoniac.

UNIVERSITE HENRI POINCARE, NANCY-I SUJET DEXAMEN DIPLOME : Licences Sciences du Vivant, 2me Nom des Rdacteurs : R. SCHNEIDER, N. anne PELLEGRINI MOISE UE LCVI3U10, Ractivit fonctionelle des Dure du sujet : 2 h biomolcules 1 Documents non autoriss Calculatrices non autorises Date : Enonc de 2 pages Exercice 1. Comparer la force des liaisons H entre les alcools, les thiols et les amines. Exercice 2. On souhaite prparer la N-mthylpropylamine CH3NHCH2CH2CH3. 1) Le traitement de la propylamine par CH3I constitue til une bonne mthode de synthse de ce compos. Justifier et donner les mcanismes. 2) Donner les structures des composs 1 et 2 ainsi que les mcanismes des ractions suivantes.
NH2 + H O H 1 H2 Pd/C 2

Exercice 3. 1) La -D-gluconolactone peut tre prpare par une raction destrification intramolculaire entre lacide carboxylique en C1 et lalcool en C4. Donner le mcanisme de la raction et la structure du produit obtenu en projection de Haworth.
COOH OH H OH OH CH2OH

H HO H H

D-gluconolactone

+ H2O

Acide D-gluconique

2) In vivo, les acides carboxyliques sont transforms en thioester selon la raction suivante :
ATP O + R OH HSCoA thiokinase NH2 N O O O O P O P O P O O O O N O N N R SCoA AMP + PP O

ATP =

OH OH

Donner le mcanisme de cette raction sachant que lors de la premire tape la base conjugue de lacide RCOO- attaque lATP active par le cation Mg2+.

Exercice 4. Donner les mcanismes ainsi que les produits des ractions suivantes :
a) O NH2 O O ?

N b) OH H2SO4 concentr 180 C H2SO4 concentr 140 C c) ? ?

CH3SH ? N N CN CN

d)

O 100C + N H ? CH3I ? H2O ?

e)

O + HO OH

H ? 100 C

f) H3C

O + H Ph

O H

NaOH

? ? Ph

O H

UNIVERSITE HENRI POINCARE, NANCY I FACULTE DES SCIENCES DIPLOME Licence Sciences du Vivant 2me anne, parcours BM Epreuve de Spectroscopie molculaire et physique exprimentale, LCVI3U11 Session de Janvier 2010 Date Horaire

SUJET DEXAMEN Dure du sujet 2 heures Nom des rdacteurs J.C. Boubel ; C. Didierjean ; F. Favier Documents autoriss X Documents non autoriss X Calculatrices autorises Calculatrices non autorises

Les 3 parties sont traiter sur copies spares. Partie I : (Physique exprimentale, C. Didierjean, dure conseille : 40 min)
Question 1: Donnez les conditions ncessaires l'observation d'interfrences entre deux ondes lumineuses. Quel doit tre la diffrence de marche entre les deux ondes lumineuses pour observer des interfrences constructives ? Quel doit tre la diffrence de marche entre les deux ondes lumineuses pour observer des interfrences destructives ? Question 2: Une fente de largeur est claire par une source laser de longueur donde ; quelle condition la figure de diffraction est-elle observable ? Faire un schma de lexprience, faire un schma de la figure de diffraction et expliquer la mthode pour dterminer la largeur de la fente. Question 3: Expliquer pourquoi le rseau joue un rle de monochromateur dans le spectrophotomtre ? Il est possible de remplacer le rseau par un autre lment dispersif, le nommer et donner les lois physiques permettant dexpliquer cette proprit dispersive. Exercice 1: Une ouverture circulaire est claire par un faisceau laser de longueur donde = 0,6328 m, la figure de diffraction (Figure 1) est observe sur un cran situ 55 cm de louverture. Dterminer la taille de louverture circulaire (attention, k nest plus un entier 0, en partant du centre de la figure de diffraction, la premire fois que lintensit sannule k = 1.22, la deuxime k = 2.23, la troisime k = 3.24 et la quatrime k = 4.24).

Figure 1 1

Figure 2

Exercice 2: Interprter la Figure 2 et estimer le pas de lhlice dADN (type B) et la distance entre les paires de bases sachant que la distance entre lchantillon et lcran est de 4,8 cm et que la longueur donde utilise est de 1,54 = 1,54.10-10 m. Exercice 3: Un rseau unidimensionnel par transmission est clair en incidence normale par un faisceau lumineux provenant dun Laser (= 620 nm). La figure de diffraction est observe sur un cran plac 2 m derrire le rseau. Sachant que lordre 4 est distant de 1 m de lordre 0, dterminer le pas du rseau. Dterminer lordre maximum observable avec le rseau.

Partie II : (Spectroscopie UV/Vis et IR, F. Favier, dure conseille : 40 min)


Exercice 1) Spectroscopie dabsorption UV/visible 1) On souhaite mesurer la concentration dune protine dans une solution par mesure de labsorption de lUV et/ou du visible. Pour la protine, quel est le type de transition nergtique mise en jeu ? 2) Pour mesurer la concentration dune protine X (contenant 6 Tryptophanes, 3 Tyrosines et 4 Cystines) dans une solution, on utilise une cuve rfrence (1 cm dpaisseur) contenant 1000 L de tampon et une cuve chantillon (1 cm dpaisseur) contenant 910 L de tampon + 90 L de solution protique. Labsorbance mesure 280 nm est alors A280 = 0,470. Quelle est la concentration de la protine X dans la solution protique ? 3) La dmarche utilise la question 2 vous parat-elle optimale ? Donnes : 280 en prot. dnature (en L.mol .cm )
-1 -1

Tryptophane 5 690

Tyrosine 1 280

Cystine 120

Exercice 2) Spectroscopie dabsorption infrarouge 1) De quel type sont les transitions nergtiques mises en jeu pour donner lieu labsorption de linfrarouge par une protine ? 2) Le spectre dabsorption infrarouge de la lactate dshydrognase est reprsent dans la rgion de la bande amide I, sur la figure ci-contre. La bande amide I a de plus t dconvolue en un ensemble de gaussiennes reprsentatives des contributions de diffrents lments de structures secondaires de la protine. Frquence moyenne (cm-1) 1637-1613 1689-1682 1645-1637 1662-1645 1682-1662

Assignation

Brin Brin Non structur Hlice Tournants

a) Pourquoi les diffrents types de structures secondaires donnent-ils lieu des absorptions des frquences distinctes ? b) Comment, partir du spectre dabsorption, russit-on trouver ces bandes caractristiques des lments de structures secondaires ? c) Comment feriez-vous alors pour dterminer le taux dhlices de la lactate dshydrognase ?

Partie III : (RMN, J.C. Boubel, dure conseille : 40 min)


Exercice I : Un spectromtre de rsonance magntique nuclaire permet l'observation de proton dans une induction de 4,698 T. On enregistre le spectre du 1,4-dimthylbenzne (C8H10) dilu dans CCl4 : on observe deux singulets de dplacement chimique gal 2,30 ppm et 7,05 ppm par rapport au TMS. 1) Quelle est la frquence d'observation du proton ? 2) Attribuer ces deux singulets aux diffrents protons de cet chantillon et exprimer leurs dplacements chimiques en Hertz par rapport au TMS. 3) Comment seraient modifis ces dplacements chimiques, en ppm et en Hertz, si le spectre tait observ la frquence de 400 MHz. ? Donne : rapport gyromagntique du proton 1 H = 2,67. 108 rad.s-1.T-1. Exercice II : La formule dveloppe de l'acrylate de mthyle (C4H6O2) vous est donne ci-dessous :

Son spectre RMN protonique, suppos analysable au "1er ordre", est compos de quatre massifs correspondant aux protons nots A, B, C et D dont les dplacements chimiques sont respectivement: 6,4 ; 6,1 ; 5,8 et 3,8 ppm par rapport au TMS. Donner la multiplicit (faire un schma indiquant le nombre de raies attendues) de chacun de ces quatre massifs, compte tenu des couplages scalaires inter-protoniques suivant : 3 JA-B = 17,4 Hz ; 2JA-C = 1,4 Hz ; 3JB-C = 10,5 Hz.

NANCYUNIVERSITEUNIVERSITEHENRIPOINCARE FACULTEDESSCIENCESETTECHNIQUES

SUJETDEXAMEN
DIPLOME:L2S3MENTIONSCIENCESDUVIVANT PARCOURSBIOLOGIEMOLECULAIREETBIOCHIMIE

Duredusujet:2heures Nomdesrdacteurs:C.Jacob, R.Marczak Responsable:C.Jacob Calculatrices:autorises

Epreuvede:U.E.3.12Bionergtiquecellulaire Sessionde:janvier2010 Documents:nonautoriss

Les deux parties sont rdiger sur deux copies spares

PARTIE 1 : Examen de cours


Exercice 1 - Rpondez aux questions suivantes : Q1. O ont lieu les deux phases de la photosynthse ? Q2. Quelles sont les 3 phases du cycle de Calvin ? Q3. Ordonnez les lments suivants selon l'ordre du transfert des lectrons : P680 / ferrdoxine / H2O / P680* / plastocyanine / NADP+ ? Q4. Quel est le but du transport cyclique des lectrons au cours de la photosynthse ? Q5. La phase sombre de la photosynthse se droule-t-elle seulement la nuit ? Q6. Pourquoi appelle-t-on "photophosphorylation" la synthse d'ATP dans les chloroplastes ? Q7. Quelle tape mtabolique produit le plus d'ATP ? a- Le cycle de Krebs. b- La phosphorylation au niveau du substrat. c- La phosphorylation oxydative. d- La glycolyse. Q8. Lors du transfert d'lectrons par la chane respiratoire, nous observons : a- Des ions H+ pomps vers la matrice. b- Une augmentation du pH de l'espace intermembranaire. c- Une diminution du pH de la matrice. d- Aucune de ces rponses. e- Toutes ces rponses. Q9. A quoi servent les oxydations successives de la chane de transport d'lectrons de la mitochondrie ? -Page 1 sur 3-

a- pomper des protons dans l'espace intermembranaire. b- gnrer de l'ATP par phosphorylation au niveau du substrat. c- chauffer la cellule. d- pomper des protons dans la matrice. Q10. Dans les mitochondries, la phosphorylation oxydative peut-elle tre biologiquement dcouple ? a- Non, le dcouplage peut tre ralis uniquement de manire artificielle. b- Oui, c'est un moyen de produire de la chaleur. c- Oui, grce aux protonophores. d- Non, seulement pendant l'endosymbiose. Exercice 2 Soient les nergies libres standards d'hydrolyse G' des molcules suivantes : ATP Glucose-6P - 30,5 kJ/mol - 13,8 kJ/mol

1/ Quelle est la variation d'nergie libre standard de la raction : ATP + Glucose ADP + Glucose-6P

2/ Dans quel sens va se produire cette raction si tous les composants sont prsents initialement la mme concentration ? 3/ De quelle manire voluerait le droulement de cette raction dans des conditions plus physiologiques caractrises par les concentrations suivantes : [ATP] 2,25 mM; [ADP] 0,25 mM; [Pi] 1,65 mM; [Glucose] 3 mM; [Glucose-6P] 1,5 mM. Ceci vous sera donn en calculant le G de la raction. On utilisera pour les calculs T = 273 K + valeur C; R = 8,31 Joules/mole. Exercice 3 Reportez sur votre copie les numros et les lettres indiqus, et annotez le schma ci-dessous. !!! ATTENTION DE BIEN RESPECTER LES NUMEROS ET LES LETTRES !!!

-Page 2 sur 3-

PARTIE 2 : Examen de TD-TP

Partie TD : Dure conseille : 40 min Le pyruvate peut tre transform rversiblement en lactate par une oxydorductase. 1) Ecrire les 2 demi-ractions impliques et en dduire lquation globale. Le potentiel rdox standard du couple pyruvate /lactate est de -0,19V, celui de lautre couple est gal -0,32V pH 7,0 et 25C. 2) Indiquer dans quel sens seffectue "spontanment" cette raction pH 7,0. 3) Calculer la variation dnergie libre standard 25C. En dduire la constante dquilibre. Conclusions. Donnes : R = 8,32 joules.K-1.mol-1, F = 96500 joules.V-1.quivalent-1. Le lactate produit par les cellules musculaires lors de la contraction est oxyd en prsence de cette enzyme. Le coenzyme est roxyd par la chane respiratoire. 4) Calculer la variation dnergie libre standard 25C lors du transfert des lectrons du lactate jusqu loxygne avec O2 / H20 = + 0.82V. 5) Lnergie libre peut tre utilise pour la synthse de lATP. Sachant que, dans les conditions standards, la raction dhydrolyse de lATP libre 30,5 kJ/mol et que le rendement nergtique du lactate est de 47%, calculer le nombre de moles dATP pouvant tre synthtises lors de loxydation dune mole de lactate. 6) Indiquez en quoi, de faon gnrale, les conditions standards sont loignes des conditions physiologiques mais permettent nanmoins dinterprter les rsultats cidessus.

Partie TP : Dure conseille : 20 min Lors de la prparation dune fraction mitochondriale partir de foies de rats, deux tests enzymatiques peuvent tre utiliss comme marqueur subcellulaire. 1) Dcrire sans dtails exprimentaux le principe de chacun des deux dosages. Quel calcul conscutif ces deux dosages permet didentifier la fraction mitochondriale ? 2) Indiquer les conditions dans lesquelles le test ATP synthase est ralis avec cette fraction. Quel est le rle de chaque compos introduit dans la cuve ractionnelle ? Dessiner et commenter lvolution de cette activit au cours du temps.

-Page 3 sur 3-

Licence Sciences de la Vie, 2me niveau U18 : radiobiologie


Examen final janvier 2010 Rdacteur : F. Valsaque calculatrice autorise documents interdits

Le soin et la qualit de la rdaction seront pris en compte dans la notation. Les formules devront tre simplifies avant d'tre utilises.

I Radioprotection 1) Sachant que les tabliers (de 0.25 mm dpaisseur) utiliss dans les services de mdecine nuclaire attnuent de 60 % les rayonnements de 140 keV mis par une source de techntium 99Tc*, calculer (en cm-1) le coefficient dabsorption linique du matriau utilis. 2) Quelle paisseur serait ncessaire pour attnuer les rayonnements de 90 % ? 3) Justifier si ces tabliers protgent totalement des rayons .

II Courbes de survie Soit une population cellulaire dont la loi de survie lors dune irradiation est sigmode avec un nombre dextrapolation "n" gal 2. Aprs une irradiation de 1060 rd, il ne reste quun pourcent de cellules survivantes. On considra que la courbe de survie est quasi-linaire (en trac semi-logarithmique) pour des doses suprieures 0.2 krd. 1) Calculer la valeur de la dose ltale moyenne D0. 2) Si lon considre une autre population cellulaire dont la loi de survie nest pas sigmode, quelle est la dose laissant 1 % de cellules survivantes pour la mme valeur de D0 que celle calcule la question prcdente ? 3) Pour cette dernire population, retrouver la formule liant D0 et D50. Calculer la valeur de D50.

III Lsions molculaires radio-induites sur l'ADN 1) 2) 3) 4) Dfinir la notion de radiolyse de l'eau. Comment distingue t-on les lsions directes des lsions indirectes sur l'ADN ? Dfinir l'apoptose radio-induite. Prciser si toutes les lsions provoques sur l'ADN restent permanentes ou sont suivies d'un effet biologique. 5) Citer les autres effets biologiques que l'apoptose qui peuvent tre engendrs par les lsions radio-induites. 6) Rsumer sur un schma clair les principales tapes envisageables, depuis les diffrents types de lsions jusqu'aux diffrents effets biologiques. 1/2

IV Radiothrapie de la thyrode Un centre de mdecine nuclaire a besoin d'iode radioactif (131I, Z=53) qui lui est fourni par le CEA de Saclay. 1) Sachant que la priode radioactive de l'iode 131 est de 8 jours et que le temps entre la prparation de l'chantillon et son utilisation est de 3 jours, quelle est l'activit commander au CEA pour avoir une dose de 150 mCi? 2) Cinq malades seront traits le 9 janvier avec une dose moyenne par personne de 20 mCi. Combien de malades pourront tre traits le 17 janvier avec l'iode restant en utilisant des doses moyennes de 460 MBq ? 3) On peut rejeter un produit radioactif avec les ordures courantes condition que son activit soit infrieure 1 Bq. Quelle est la dure qui serait ncessaire pour jeter le produit restant aprs traitement de tous les malades ? 4) Liode 131I se dsintgre principalement par mission - dont l'nergie moyenne des rayonnements est de 192 keV. Cette dsintgration est suivie quasi-instantanment par lmission dun photon d'nergie 364 keV. Ecrire la raction ainsi que le schma de dsintgration (dans un repre donnant l'nergie en fonction du numro atomique). Prciser le nombre de nuclons du noyau de xnon form. 5) Si on suppose que 70 % des noyaux diode 131 provenant d'une dose de 460 MBq se sont fixs au niveau de la thyrode (dont la masse est de 25 g), quel est le dbit de dose absorbe au niveau de cette glande ? Justifier. 6) Dfinir clairement les notions de priode biologique (Tb) et de priode effective d'limination (Te) ainsi que les constantes b et e qui leur sont associes. 7) Sachant que pour l'iode 131, b = 1.83 an-1, en dduire Te.

2/2

UNIVERSITE HENRI POINCARE I. NANCY 1 FACULT DES SCIENCES


Diplme : L2 Science du Vivant Semestre 3 Anne : 2009-2010 Matire :ANGLAIS Date : janvier 2010 Sujet : P.Collin-Metzger
Note / 20 N / 90 APPRECIATIONS EXPLIQUANT LA NOTE CHIFFREE:

Winners Wear Red


I Dcidez si les affirmations suivantes sont vraies ou fausses. Inscrivez V ou F dans lespace prvu cet effet : (22 points) Attention : barme dgressif pour cet exercice ___ 1- Pour sortir vainqueur coup sr dun combat sportif, portez du rouge. ___ 2- Les tudes menes sur linfluence de la couleur sur le comportement humain ne portent que sur leffet du rouge. ___ 3- Linfluence des couleurs sur lissue des vnements sportifs est connue depuis peu. ___ 4- Les expriences montrent que la couleur rouge a une influence sur lhumeur et le comportement de celui qui la voit et non celui qui la porte. ___ 5- Seuls les primates ragissent la couleur rouge. ___ 6- La perception de la dimension de dominance dans la couleur rouge est un comportement acquis et non inn. ___ 7- Dans un contexte dapprentissage, lhumain fuit le rouge instinctivement car cette couleur reprsente le danger. ___ 8- Dans certaines situations le rouge peut augmenter votre crativit. ___ 9- La mme femme sera perue comme tant plus attirante en tant habille en rouge plutt quen vert ou en bleu. ___ 10- Mme les enfants ont une prfrence inne pour le rouge, quel que soit le contexte. ___ 11- La plupart des gens ne sont pas conscients de leffet du rouge sur eux. II Traduisez en contexte les mots de liaison souligns dans le texte: (15 points) 1- yet: 9- whereas: 2- so that: .. 10- whether: .. 3- although: ... 11- even: 4- meanwhile: 12- however: ...... 5- therefore: .. 13- while: ... 6- though: .. 14- then: . 7- instead: .. 15- indeed : . 8- whenever: ..
PCM UHP Nancy 1 - January 2010

III Vocabulaire. (28 points) A] Trouvez les quivalents anglais de : (8 points) 1- une moyenne (l.8 23) : . 2- chelle (l.8 23) : ... 3- le comportement (l.34 47) : .. 4- au hasard (l.34 47) : . 5- une prestation (l.60 72) : .. 6- la prcision (l.103 110) : .. 7- la capacit (l.125 138) :. 8- une menace (l.125 138) :... B] Trouvez les antonymes de : (10 points) 1- probable (l.95 110) ... 2- small (l.125 138) ... 3- success (l.256 266) ... 4- better (l.274 287) .. 5- to worsen (l.274 287) C] Trouvez les synonymes de : (10 points) 1- the result (l.8 23) : 6- to perform (l.216 227) : ... 2- approximately (l.34 59) : .. 7- to assess (l.298 309) : .. 3- proof (l.60 72) : 8- in a systematic way (l.324 337) : 4- principal (l.84 94) : .. 9- the aim (l.324 337) : 5- to enable (l.95 110) : ........ 10- conscious (l.324 337) : ...

IV Grammar (25 points)


A] If clauses. Conjuguez les verbes entre parenthses: (5 points) 1) If he hadnt worn a blue shirt, Tom thinks he . (not lose) the match. 2) If you dress in black, you . (appear) authoritative. 3) Your boss would have given you a pay raise if you . (think) of wearing red clothes when asking for it! 4) If you wore a red dress, you . (be asked) more often on dates. 5) Although people have individual color likes and dislikes, if you present them with certain colors everybody . (react) subconsciously in the same way because there is a physical effect of color on the body. B] Indiquez dans les crochets si le nom soulign appartient la catgorie [C] ou [U] : (10 points) Think about ityou are more formal towards the person in a dark navy outfit than to the one dressed in beige! Color [] can affect our reactions [] to people. The effect [] is subtle but very real; color sways perception [], judgment [] and behaviour []. It has the psychological power to influence emotion [ ]. Managing the impact of color on our image []is smart considering that color is one of the first things [] noticed about a person [], particularly from a distance. C] Posez la question sur llment soulign: (10 points) 1) Psychologists showed VDOs to 42 referees. 2) The test will last 5 minutes. 3) The students saw the word analogies or vocabulary. 4) Exposure to colors can have a significant effect on people. 5) Volunteers were asked to carry out an IQ test.
PCM UHP Nancy 1 - January 2010

Can the colour of your shirt really influence the outcome of a fight a soccer match or even your mark in an exam, asks Daniel Elkan

Winners Wear red

manipulated so that the clothing colours were 25 suggesting that exposure to certain colours MAGINE you are an experienced martial swapped round. The result? In close matches, can have a significant effect on how people arts referee. You are asked to score a number of 15 the scoring swapped round too, with red think and act. Up to now most of the research taekwondo bouts, shown to you on video. In competitors awarded an average of 13 per has focused on red clothing in sport, but other each bout, one combatant is wearing red, the cent more points than when they were dressed colours and settings are being investigated other blue. Would clothing colour make any 5 in blue (Psychological Science, vol 19, P 769). 30 too. It is becoming clear that colours can difference to your impartial, expert judgement? "If one competitor is strong and the other have an important, unappreciated effect on Of course it wouldn't. the way your mind works one that you 20 weak, it won't change the outcome of the Yet research shows it almost certainly fight," says Norbert Hagemann, who led the really ought to know about. would. Last year, sports psychologists at the study. "But the closer the levels, the easier it is The powerful influence of colour on 10 University of Mnster, Germany, showed video for the colour to tip the scale." 35 sporting success was first discovered a few clips of bouts to 42 experienced referees. They This is just the latest piece of research years ago, when evolutionary anthropologists then played the same clips again, digitally
1

NewScientist August 2009

PCM UHP Nancy1

that shirt colour appeared to influence the


50 result, with nearly 55 per cent of bouts being

"There is now good evidence that the colour red is perceived as dominant"
Russell Hill and Robert Barton of Durham University, UK, were looking for some way to test the idea that colours influence human 40 behaviour. The 2004 Athens Olympics were coming up, and it dawned on them that in some Olympic combat sports boxing, taekwondo, Graeco-Roman wrestling and freestyle wrestling-competitors are randomly assigned 45 a red or blue kit. "We realised that this was a ready-made experiment to study the effects of colour on match outcome," Barton says. When they analysed the results they found

won by the competitor in red. In closely fought bouts it was 62 per cent (Nature, vol 435, p 293). "It should have been roughly 50 per cent red, 50 per cent blue, and this was a statistically 55 significant deviation," Barton says. "Skill and strength may be the main factors if you're rubbish, a red shirt won't stop you from losing, but when fights were relatively symmetrical, colour tipped the balance." Barton says that the differences may be 60 accounted for, to some extent, by a referee's unconscious preference for red which he argues is an inherited preference as seen in the taekwondo experiment. He also believes colour 65 affects the combatants' mood and behaviour. "There is now good experimental evidence that red stimuli are perceived as dominant and that they cause negative effects on performance in those viewing them," Barton says. "It is 70 plausible that wearing red also makes individuals feel more confident, although this hasn't yet been tested." Red also appears to exert its influence in team games. Last year, a study of 56 seasons of English 75 soccer, led by Martin Attrill at the University of Plymouth, UK, found that, on average, teams whose first-choice kit was red finished higher in the league and won more home games than teams in other colours which might go some 80 way to explaining why Liverpool, Manchester United and Arsenal have won 38 out of 63 league titles between them since the second world war (Journal of Sports Sciences, vol 26, p 577). An unpublished analysis by Hill and Barton of 85 the Euro 2004 soccer finals in Portugal found that teams who had red as the main colour in one of their kits won more often and scored more goals when playing in that strip. Meanwhile, a group led by Iain Greenlees at the 90 University of Chichester, UK, found that goalkeepers felt more confident about saving penalties from footballers wearing white shirts rather than red (Journal of Sports Sciences, vol 26, p 569). 95 Clearly the effect of wearing red is strong enough to tip the balance of fights and soccer matches, but where did it originate? One possibility is that red is simply easier to see than other colours. In common with other 100 primates, humans have a trichromatic visual system which probably evolved to allow us to easily see red (therefore ripe) fruit. "It is plausible that visibility differences could have some effects," Barton says, though 105 this would be unlikely to make a difference in hand-to-hand combat. "We checked this explanation in football, predicting that red-

PCM UHP Nancy1

"Teams who had red as the main colour in one of their kits won more often and scored more goals"

110

115

120

125

130

135 Would England have won the 1966 World Cup in another colour strip?

shirted football teams would have increased accuracy in passing. But we find no such effect. So visibility doesn't seem to be the answer." Instead, most researchers believe that red directly affects how you perceive the wearer of that colour. In nature, red is often used to signal dominance and aggression, and in humans this is reinforced by cultural symbols such as warning signs and stop signals. One of the first scientists to explore the effect of red on animal behaviour was Nobel prizewinning ethologist Niko Tinbergen. Around 60 years ago he noticed that whenever a red postal van parked outside his window, the sticklebacks in his aquarium would adopt an aggressive head-down posture normally reserved for encounters with rival males. Primate behaviour is also strongly influenced by red. Joanna Setchell of Durham University found that mandrills, the world's largest species of monkey, use colour as a means of conflict management. In males, red faces, rumps and genitalia act as a status symbol, communicating fighting ability. "The brighter red a male is, the higher his testosterone level and the more aggressive he is," Setchell says. Between males of similar redness, threats, fights and tense stand-offs are frequent. Where there are large colour differences, the paler male usually stands down (Ethology, vol 111, p25).

"Mandrills are powerful animals and have


140 long canines, so any physical conflict risks

death," says Setchell. "Fights are costly to everyone, but through this adaptation these males actually avoid fighting." Other primates use more subtle variations 145 in facial redness to signal dominance. Rhesus monkeys, for example, become redder in the face in the mating season.

That red flush


Barton believes that red is involved in human behaviour in a similar way. "Subtle variations 150 in redness are conveying information about dominance, vigour and confidence. In an aggressive confrontation, confident individuals flush red with anger whereas frightened individuals go pale. There is 155 evidence for the physiological underpinning of that, with shunting of oxygenated blood to the periphery." Barton points out this is different to blushing because there the redness tends to spread upwards from the 160 neck and can be curiously patchy. He says the context of blushing would also be different. Recent evidence supports the idea that red exerts its effect on humans via perceptions of dominance. In an experiment, Hill and 165 colleague Tony Little showed 105 volunteers different coloured circles and asked them to indicate which would be "most likely to win a physical competition" and which circle looked "most dominant". Red won hands down
170 (Journal of Evolutionary Psychology, vol 5, p 161).

175

180

185

190

195

Is this response to red innate or learned? Again, animal experiments give some clues. In July, Sarah Pryke at Macquarie University in Sydney, Australia, published the results of a study into Gouldian finches, which, depending on their genes, have either red or black head feathers. "Red-headed birds dominate blackheaded ones," Pryke says. "1 wanted to find out whether this results from nature or nurture." Pryke raised newly hatched chicks with red or black heads in different family groups, so that they grew up in isolation or with adults of both head colours. She now had birds with black or red heads and various experience of colour. Next, to test what difference their experience of colour made, Pryke painted the juveniles' heads either red, black or blue (as a control) and put them into 20-minute contests, where two birds would compete for space at a bird feeder (Animal Behaviour, vol 78, p 393). The results were striking. Red-headed birds won the contests every time, regardless of their inherited colour or the upbringing of both combatants. "Painting the birds did not make them act more aggressively, but they won the food contests because the other birds wouldn't challenge them at the feeder," Pryke reports. "All the birds reacted strongly to red-

PCM UHP Nancy1

Wearing red means you are more likely to be asked on a date

200 painted birds even ones that had never seen

205

210

215

220

225

230

235

240

a red-headed bird before." After each interaction, Pryke measured levels of the hormone corticosterone, a reliable measure of stress. She found that birds facing a red opponent had 58 per cent higher corticosterone levels than birds that faced black or blue. "With no prior experience of the colour, these birds had an innate fear of red," Pryke concludes. Exposure to red doesn't just have an effect on fights. In a remarkable series of studies, Andrew Elliot of the University of Rochester in New York has demonstrated that even a brief glimpse of red can change human abilities and behaviour in all sorts of ways. In one experiment, volunteers were asked to carry out a 5-minute IQ test. They were assigned a bogus "participant number", written in either red or black, on the corner of the test paper. Volunteers whose numbers were written in red scored consistently lower on the tests. Elliot also gave the students different coloured folders and asked them to choose their preferred level of difficulty for an IQ test. Students given red folders tended to choose easier tests (Journal of Experimental Psychology: General, vol 136, p 154). Even more remarkably, Elliot has found that viewing red for just a few seconds can make people more timid. Elliot's team told 67 students that they would be taking either a vocabulary test or an analogies test, and asked them to look inside a folder to find out which one. The students saw either the word "analogies" or the word "vocabulary" on a red or green background and the colour had a profound effect on their subsequent behaviour. When the students were instructed to walk to an adjacent laboratory to take the test, they found a sign on the door saying "Please knock".

Those who had seen a red background knocked fewer times, and more quietly, than those given green. 245 This isn't the only example of "avoidance behaviour" caused by momentarily seeing red. Another set of participants with movement sensors attached to them were seated in front of a computer monitor and told 250 they were going to be given an IQ test. When the computer screen was red rather than grey or green, the volunteers leaned away from the screen. "These results show that at a very basic level, your body is pre-wired to move away 255 from red," says Elliot.

Red = Danger
Elliot believes the effects of red on both IQ tests and avoidance behaviour arise from the same underlying factor that leads to its association with sporting success. In both 260 cases the effect is on the person viewing the colour. "We view the red-equals-danger link as the linchpin of the effect," he says. "A dominant other and failure both represent danger. Achievement contexts [such as IQ 265 tests] are one of many types of situation in which danger, such as failure, is a possibility." When Elliot's volunteers exposed to colours on a computer screen were scanned with EEG equipment, results showed that those who 270 viewed red had more activity in the right frontal cortex, an area of the brain associated with emotional activity, particularly emotions associated with avoidance behaviour. Elliot points out that it may have real-world 275 consequences. "IQ tests are standardised tests used for selection in careers, but factors such as the colour of the pencil used, or the clothing worn by the test administrators, could significantly affect the result," says Elliot.

However, exposure to red during a task does not always produce worse results. Ravi Mehta and Juliet Zhu of the Sauder School of Business at the University of British Columbia in Vancouver, Canada, found that red enhances 285 performance on detail-orientated tasks, whereas blue improves the results of creative tasks (Science, vol 323, p 1226) In one experiment, the researchers asked volunteers to come up with new uses for a 290 brick, presenting the instructions on a screen with either a blue or a red background. Although the blue and red groups came up with just as many uses, the blue ideas were more creative while the red group's were more 295 practical and conservative. A second task designing a child's toy from 20 different components produced similar outcomes. Red does not always affect us through its association with danger. When Elliot and his 300 colleague Daniela Nesta showed male volunteers photos of averagely attractive women on red and white backgrounds, the men rated the women on red as more attractive. Men asked to compare women in red 305 or green shirts, and then red or blue shirts, said that they would be more likely to ask a redclothed woman on a date and spend more money on that date (Journal of Personality and Social Psychology, vol 95, p 1150). 310 "Red is clearly context specific. In achievement situations red means danger, which leads to avoidance, but in romance situations red means sexual availability or romance and that leads to approach 315 behaviour," says Elliot. It is this context-specificity that Elliot and colleagues are now exploring. Their latest work has investigated innate preference in infants. The team have found that one-year-olds shown 320 red and green Lego bricks tend to reach out for red bricks. Yet when the infants are shown an angry face before being exposed to the blocks, they go for green. What consistently impresses researchers is 325 the fact that their volunteers rarely suspect that colour plays an important, or indeed any, role in the outcome of an experiment. In Elliot's study of sexual attraction, almost none of the participants correctly guessed the purpose of 330 the experiment and they thought colour had a minimal effect on their ratings. "Colours function as a subtle primer, exerting a direct influence on motivation and behaviour without individuals' conscious awareness," 335 Elliot says. "Given that the influence of colour on our behaviour is so prevalent, it's shocking that we aren't more aware of it."
280 Daniel Elkan is a writer based in London

PCM UHP Nancy1

Examen dAnalyse Numrique - UE LCPC5U11 L3 Gnie Civil et PC Parcours Mcanique-Energtique. Premire session, janvier 2010. Rdacteur du sujet : O. Botella.

Dure : 2h. Cours, TD et calculatrice autoriss. Les trois exercices sont indpendants. Barme provisoire : Exercice 1, 6 points ; Exercice 2, 6 points ; Exercice 3, 8 points. Exercice 1. On veut utiliser la quadrature du rectangle composite pour calculer numriquement lintgrale :
1

I=
0

exp(x) dx.

(1)

1) Calculez analytiquement I et donnez sa valeur avec 6 chires aprs la virgule. 2) Ecrivez la procdure Maple rectangle :=proc(a,b,n,f) qui calcule lintgrale rectangle composite avec n sous intervalles de taille uniforme1 .
b a

f (x)dx par la formule du

3) Calculez une approximation de I avec la mthode du rectangle pour n = 2 et n = 4. Calculez le facteur de rduction et vriez que vous retrouvez lordre de convergence thorique du cours. Exercice 2. On considre le systme linaire AX = F avec A= 3 1 , 2 5 F = 4 . 7

1) Montrez que la solution X de ce systme est unique, et calculez-la par la mthode de Gauss. 2) On souhaite maintenant appliquer la mthode de Jacobi. a) Ecrivez cette mthode itrative pour rsoudre le systme linaire. Application : calculez le premier 1 itr obtenu partir de la condition initiale X0 = ( 1 , 2 )T . 2 b) Calculez la matrice ditration BJ et tudiez la convergence de la mthode. c) Dterminez le nombre ditrations kmin ncessaire pour faire dcrotre lerreur initiale ||X0 X ||2 dun facteur 10000.

Exercice 3. Pour rsoudre lquation direntielle du premier ordre : y = f (t, y), t 0,

on pose tn = nh o h est le pas de temps, on note y n lapproximation de la solution exacte y(tn ), et on considre le schma trois tapes : K1 = hf (tn , y n ), K2 = hf tn + y + , K3 = hf tn + 1 y n+1 = y n + (2K1 + 3K2 + 3K3 ) . 8 1) A quelle classe de mthodes ce schma appartient-il ? Est-il explicite ou implicite ? 2) Calculez le facteur damplication (h) du schma, et en dduire son ordre de prcision. 3) Le diagramme de stabilit du schma est reprsent sur la gure 1. Dduisez la condition de stabilit pour le cas purement rel (y = y, < 0) et purement complexe (y = i y tel que i2 = 1 et R ). Quel est lavantage principal du schma (1) par rapport aux schmas RK2- ?
1 Vous ne serez pas not sur la syntaxe exacte du programme, mais sur la justesse de sa structure et la dnition des variables locales que vous utiliserez.

(1a) y +
n n 2 3 K1 2 3 K2

2h 3 , 2h 3 ,

(1b) (1c) (1d)

1.73
2

Im( h)

2.51
0

3 3

2.5

1.5

0.5

0.5

1.5

Re( h)

Fig. 1 Diagramme de stabilit du schma (1). Le schma est stable pour les valeurs de h situes lintrieur de la courbe ferme. 4) Application 1 : Dterminez la condition de stabilit du schma (1) pour lquation scalaire y = et y, t 0. y + y + y 3 = 0, y(0) = y0 , y(0) = 0,

5) Application 2 : pour > 0, on considre lquation de Dung :

t 0.

(2)

On supposera que la solution du systme est priodique : y(t) [y0 , y0 ] pour tout t 0. a) Mettez cette quation sous la forme dun systme direntiel du premier ordre. b) Calculez les valeurs propres de la matrice jacobienne du systme. En dduire la condition de stabilit du schma en fonction de et y0 uniquement.

UNIVERSITE HENRI POINCARE FACULTE DES SCIENCES ET TECHNIQUES SUJET D'EXAMEN DIPLOME : Licence Physique Chimie UE Matriaux polymres organiques Dcembre 2009 Nom du rdacteur : P. GERARDIN Documents non autoriss Calculettes non autorises Dure de l'preuve : 40 min Enonc de 1 page

Traiter cinq questions de votre choix parmi les 7 questions poses ci dessous :
Question 1 Expliquer la diffrence entre une polymrisation par polycondensation et polyaddition. Pour chacun de ces types de polymrisation donner un exemple de votre choix. Question 2 Donner la structure, le nom et applications courantes des polymres obtenus partir des monomres suivants :
H H H H H H H Cl F F F F

thylne

chorure de vinyle

chorure de vinyle

Question 3 Donner la structure des monomres permettant dobtenir les polymres suivants :
O N H

O O

O n

H N O

H N n

A quelle famille appartient chacun des polymres prcdents.

Question 4 Expliquer pourquoi le bois est matriau dot de proprits mcaniques et isolantes exceptionnelles. Question 5 Donner la dfinition dune macromolcule et dun oligomre ? Question 6 En vous aidant dun schma, expliquer quoi correspond une liaison hydrogne ? Ce type de liaison correspond t-elle une liaison de forte ou de faible nergie ? Question 7 Quelles sont les trois grandes tapes impliques dans la polymrisation radicalaire des monomres vinyliques ?

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES Diplme : Licence Gnie Civil L3 Cours ciment-btons initiation Date : 15 Dcembre 2009 Horaire

Dure de l'preuve : 40 minutes Noms des rdacteurs : M. FRANCOIS Calculatrices autorises Documents non autoriss : non

Sujet rendre sur copie spare Sujet M. Franois I) Que se passe til de particulier pendant la clinkrisation et quelle temprature telle lieu ? Dcrire brivement les tapes qui suivent jusqu la mise en sac du ciment.

II) Donner la composition (massique) du clinker uniquement pour les phases C3A et C4AF par un calcul de Bogues, partir de lanalyse chimique suivante : CaO 60%, SiO2 20%, Al2O3 10%, Fe2O3 5%, autres oxydes 5%. Masses molaires : M(Al2O3) = 101,96 g, M(Fe2O3) = 159,70 g, M(SiO2) = 60,08 g, M(CaO) = 56,08 g

III) Un des ciments le plus vendu est le ciment CEM II/A-LL 32,5 R. Donner en une description.

IV) Citer cinq caractristiques essentielles des granulats pour bton.

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES

Nom : Prnom :

SUJET DEXAMEN
DIPLOME L3 Gnie Civil Dure du sujet 40 min Nom du rdacteur C. Petitjean Epreuve de Matriaux mtalliques.. Horaire .

A rdiger sur copies spares


Le diagramme Fer-Carbone 1- En considrant le diagramme mtastable, donner les coordonnes (temprature et pourcentage massique de carbone) des points du diagramme dquilibre de phases pour lesquels la variance est gale zro. Prciser le cas chant la ou les phases en prsence ainsi que la nature des ractions ventuelles mises en jeu. 2- Justifier les diffrences de solubilit du carbone dans la ferrite et laustnite. 3- O situe-t-on la limite acier/fonte ? 4- Quel diagramme doit tre pris en compte pour tudier les deux fontes suivantes (F1 et F2), justifier votre rponse.

F1

F2
Diagrammes dquilibre de phases Fe-C stable et mtastable Micrographies de fontes F1 et F2

Les alliages Aluminium Silicium De part les proprits spcifiques de laluminium, les alliages base daluminium sont utiliss dans de nombreux domaines.

Diagramme dquilibre des phases Al-Si

% atomique 1- Laluminium cristallise dans une structure cubique compacte. Dterminer la masse volumique de laluminium. Bas sur ce rsultat, proposer alors des applications pour ses alliages. 2- Sachant que la solubilit de laluminium dans le silicium est nulle. Prciser sur le diagramme le liquidus, le solidus et les diffrents domaines, vous noterez la phase riche en aluminium. 3- Dcrire et dessiner les diffrentes tapes de transformation au cours du refroidissement lent partir de 800 C dun alliage de composition eutectique. 4- Un alliage contenant 25 % atomique de silicium est port 1000 C. Dcrire les diffrentes tapes de transformation au cours du refroidissement lent jusqu 500 C. Dessiner schmatiquement ces diffrentes tapes. 5- Pour ces deux alliages, calculer les proportions (en pourcentages molaires) des phases prsentes 500 C et donner leurs compositions respectives en titre atomiques de Si. 6- Quelle est, pour ces deux alliages, la proportion de liquide solidifi selon la raction eutectique. 7- On ralise une coule de 200 kg dun alliage 20% en masse de silicium. Dterminer, 500 C, la masse de silicium contenue dans la phase ainsi que la masse daluminium contenue dans cette mme phase. Donnes : Rayon atomique de laluminium : RAl = 140 pm, Masse molaire de laluminium : MAl = 27 g.mol-1 Nombre davogadro : NA = 6,022.1023 mol-1

Examen L3 Gnie Civil

Mcanique des fluides

Examen de Mcanique des fluides Dure : 2 heures Sans documents


D Patm S x [1] E L=630 m D=1m Q,V Patm H=100m 45 Patm D y

[2]

Un bac niveau constant [1] sert dalimentation en eau un autre bac [2]. Les deux bacs sont relis par une conduite de 630m de long et de 1m de diamtre. La sortie de la conduite est situe 100m en dessous de la surface libre du bac [1] et dbouche lair libre, juste au dessus de la surface libre du bac [2].

Partie I : On nglige les pertes de charge.


1) Calculer la vitesse de sortie Vs 2) Calculer la pression au point S, juste avant la sortie de la conduite. 3) Calculer le dbit de fluide circulant dans entre les deux bacs.

Partie II : On ne nglige pas les pertes de charge.


La rugosit de la conduite produit une perte de charge rgulire dont le coefficient de frottement est de =0.004 quelque soit le nombre de Reynolds. 1) Calculer le dbit circulant dans la conduite. 2) Calculer la pression au point S. 3) Quel serait ce dbit si la sortie de la conduite tait immerge au dessous de la surface libre du bac [2] ?

Partie III : Calculer les composantes de la force exerce par le fluide sur le coude de sortie.
On ngligera le poids du fluide et le frottement au niveau du coude

Note : Les parties I, II et III sont indpendantes.

UNIVERSITE HENRI POINCARE NANCY 1 FACULTE DES SCIENCES

SUJET DEXAMEN

JANVIER 10

DIPLOME

L3 Gnie Civil

Epreuve de : Mcanique du solide

Dure du sujet : Deux heures Nom du rdacteur : TAGHITE Documents non autoriss Calculatrices autorises

Exercice 1

On considre une poutre

lastique (de coefficients de Lam et ) encastre et

( O, e1 , e2 , e3 ) un repre cartsien tel que laxe horizontal 0 x3 soit laxe de la poutre et le point 0 le centre de lencastrement. Le champ des dplacements U en tout point du solide est de la forme: 2 2 2 U = a { x3 + ( x1 x2 )} e1 + b x1 x2 e2 c x1 x3 e3 o a, b, c sont trois constantes positives et le coefficient de Poisson de la poutre. En adoptant lhypothse des petites perturbations: 1) Dterminer par ses composantes ij le tenseur des dformations 2) Quelles relations doivent vrifier a, b, c pour que la base ( e1 , e2 , e3 ) soit principale pour , puis donner la variation relative de volume. 3) Dterminer le tenseur des contraintes associ. 4) Dans quelles conditions les quations locales dquilibre sont-elles vrifies ?

Exercice 2

En un point M dun solide rapport un repre orthonorm ( O, e1 , e2 , e3 ) , la matrice du tenseur des contraintes dans la base ( e1 , 0.7 = 3.6 0
(i)

e2 , e3 ) est donne par : 3.6 0 2.8 0 107 Pa . 0 7.6


(i)

1) Pour les trois facettes orientes par les normales ei pour i = 1,2,3 , exprimer les vecteurs contraintes T associs dans la base ( e1 , e2 , e3 ) . En dduire lexpression de T dans la

base de Mohr ( n, t, e3 ) . 2) En traant le cercle de Mohr, dterminer graphiquement les directions et contraintes principales de au point M . 3) Dterminer la valeur de la contrainte de cisaillement maximum, ainsi que la direction de la normale correspondante.

Exercice 3

Deux cylindres mtalliques plein (1) et (2), de mme rayon a , de hauteurs L1 et L2 , sont placs bout bout comme lindique la figure ci-dessous. Les surfaces en contact sont parfaitement planes, lisses et lubrifies pour permettre les glissements sans frottement aux interfaces. Les caractristiques mcaniques sont ( E1 , 1 ) pour le solide (1) et ( E2 , 2 ) pour le solide (2). Dfinition
F , entre leffort de L compression F qui lui est appliqu et laccourcissement L quil subit.

On appelle rigidit de compression dun barreau le rapport K =

1) Calculer dans chaque solide, les champs des contraintes, dformations et dplacements. 2) Calculer ensuite la rigidit de lassemblage K en fonction des rigidits K 1 et K 2 de chacun des deux solides lastiques.

Z F

L2

( E2 , 2 )

L1

( E1 , 1 )

Fin

LICENCE MATHEMATIQUES EXAMEN ANGLAIS JANVIER 2010 (B. ANAND)


Read the text 'Tomorrow's weather: Cloudy with a chance of fractals'.

VOCABULARY
Find synonyms of the following (pg. 1 paras 1 -6): piles: propelled: to fade: testify to: endless: to think about seriously: astonishing: in fact: to struggle with: proof: ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. .............................................................................

Find antonyms of the following: to arrange differently (pg. 1 para. 6): smooth (pg. 2 para. 1) unlike (pg. 2 para. 1): inadequately (pg. 3 para. 1): few (pg. 3 para. 1): not to abandon (pg. 3 para. 1): succeeded (pg. 3 para 1): greater (pg. 3 para. 4): to recede (pg. 3 para. 4 ): familiar (pg. 3 paras 4-5): ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. ............................................................................. .............................................................................

COMPREHENSION
Tick True (T) or False (F). (Citez la page et le paragraphe o vous avez trouv vos rfrences) 1) Richardson a t convaincu que des processus comme des cascades o la dcomposition des structures plus grandes, cdaient places celles plus petites et crant ainsi une structure fractale agissant selon les lois de la puissance. T F

2) Les ides de Richardson concernant les structures fractales ont eu un grand succs dans le champ mtorologique. T F

3) Dans les annes soixante dix .la thse de Lovejoy portant sur les liens entre les fractals et la pluie a eu un succs retentissant. F T

4) Shretzer et Lovejoy ont enfin pu prouver que la pluie aussi se constituait des rseaux fractals en observant les satellites de TRIMM. T F 5) Toutefois, leurs conclusions ne concernaient que des surfaces atmosphriques limites. T F

Answer the following questions in FRENCH. 1) What is Richardson's role in modern weather forecasting? 2) Who has finally proved Richardson's claims today? 3) What research are Lovejoy and his team doing with the US National Oceanic and atmospheric Administration in Boulder Colorado? 4) What are parameterizations? 5) Justify the statement complex scientific phenomena have generally an underlying simplicity.

Universit de Nancy I e

Licence 3

Intgration et Probabilits e e Examen du 12 janvier 2010 dure 3h e Les documents et calculatrices sont interdits. Toutes les variables alatoires considres dans le sujet sont dnies sur un e ee e mme espace probabilis (, F, P). La lettre E reprsente lintgration par rapport e e e e ` P : pour toute variable alatoire intgrable Y , on a E[Y ] = Y () dP(). a e e Dans tout le sujet, log dsigne le logarithme nprien. On attire particuli`rement e e e e lattention du candidat sur les questions marques dun . e

Exercice 1 ( 7 points)
1. ` A laide dun dveloppement en srie enti`re, montrer que e e e (1)n = 3n + 1 n=0 2. On donne 1 1 = x3 + 1 3
+ + 1 0

dx . x3 + 1

1 x2 1 + x x2 x + 1 3

Montrer que (1)n 3 log 2 + = 3n + 1 9 n=0

Exercice 2 ( 4 points)
Soit (Xn )n1 une suite de variables alatoires telles que pour tout n 1, Xn e suit (sous P) une loi exponentielle de param`tre 2 log(1 + n). e 1. Montrer quil existe une constante A telle que n 1 P(Xn 1) A . n2

2. Montrer que P-presque srement, les Xn sont tous plus petits que 1 ` partir u a dun certain rang.

Probl`me ( 19 points) e
Soit p0 > 1 et X une variable alatoire positive telle que X Lp0 (, F, P). e Pour p ]0, p0 ], on pose N (p) = (E[X p ])1/p . 1. Soit I un intervalle de R. On suppose quon a dni sur (, F, P) une cole lection de variables alatoires (Xt )tI et une variable alatoire Y telles que e e Pour tout , t Xt () est continue. Pour tout t I, |Xt | Y . 1 Tournez la page S.V.P.

2. 3. 4.

5.

E[Y ] < +. Montrer que lapplication t E[Xt ] est bien dnie et forme une applicae tion continue sur I. (Ceci est une application directe du cours ; on prcisera e clairement le thor`me employ.) e e e En appliquant lingalit de Hlder aux fonctions X p et 1 avec des exposants e e o bien choisis, montrer que la fonction p N (p) est croissante sur ]0, p0 ]. Montrer que N (p) admet une limite relle lorsque p tend vers 0. Dterminer e e cette limite dans le cas o` X suit la loi uniforme sur [0, 1]. u Montrer que pour tout p ]0, p0 ], on a lingalit X p 1 + X p0 , puis que e e p E[X p ] est continue sur ]0, p0 ]. En dduire que p N (p) est continue e sur ]0, p0 ]. Indication : on pourra remarquer que N (p) = G(E[X p ], p) o` G(x, y) = x1/y . u Soit p ]0, p0 ]. On admet que la fonction F : R+ R+ (x, t) R+ ptp1 1 1{xt}

est (R2 , B(R2 )) (R, B(R)) mesurable. + + Montrer que F L1 (R2 , B(R2 ), PX ), puis que + + E[X p ] =
[0,+[

ptp1 P(X t) d(t).

Note : on rappelle que 1{xt} vaut 1 si x t, 0 sinon. 1 6. Soient p1 , p2 avec 0 < p1 < p2 < p0 . (a) Montrer quil existe A > 0 et B > 0 tels que x 1 et x ]0, 1] (b) On pose, pour x > 0, (x) = xp1 1 (1p2 log x)1 (x)+(1+p2 log x)xp2 1 P(X x)1 1[0,1] 1]1,+[ (x). Montrer que (x) d(x)
]0,+[

log x Axp0 p2 log x Bxp1 /2 .

2Bp2 + 1 p2 1 + AE[X p0 ] + E[X p2 ], p1 p0 p2

o` A et B sont des constantes telles que dtermines ` la question u e e a prcdente. e e (c) Montrer que la fonction p N (p) est C 1 sur ]0, p0 [. 7. Soit X une variable alatoire positive. On note e X
,ess

= sup{M > 0 : P(X M ) > 0}.

On suppose dornavant que X est telle que X ,ess < +. e (a) Soit M > X ,ess . Montrer que pour tout p > 1, X Lp (, F, P) avec N (p) M . (b) Montrer que (c) Soit M < X
p+ ,ess .

lim

N (p) X

,ess .

Montrer que pour tout p > 1, N (p) M P(X M )1/p ,

puis que

p+

lim

N (p) M . N (p) = X FIN


,ess .

(d) Montrer que

p+

lim

UNIVERSITE HENRI POINCARE NANCY I L3 Chimie Electrochimie dure : 1H30 Mardi 12/01/2010 Rendez votre sujet avec votre copie . UE 5U17

FACULTE DES SCIENCES contrle continu 2009 Rdacteurs : Marc Hbrant/C. Despas Documents non autoriss Calculatrices autorises

Mettez ci-dessous le code de votre choix que vous reproduisez sur votre copie : _________________________

Barme pour les QCM (de A H) : +0.25 par rponse correcte ; -0.25 par rponse fausse Rpondez aux questions en entourant ce qui est la bonne rponse, en rayant lautre. Chaque affirmation peut tre juste ou fausse. A) Le coefficient de diffusion : Dpend de la forme de la particule Dpend de la temprature Dpend de la viscosit du milieu Est proportionnel la charge de lion Sexprime en m2s-1 Vrai Vrai Vrai Vrai Vrai Faux Faux Faux Faux Faux

B) La premire loi de Fick : Permet de calculer le flux en fonction de la lpaisseur de diffusion Sexprime par lquation : J=D(dC/dx) Nest valable qu linstant initial Nest pas valable en prsence dun potentiel Ne sapplique pas dans les gaz Vrai Vrai Vrai Vrai Vrai Faux Faux Faux Faux Faux

C) La mobilit lectro-osmotique dans un capillaire de silice: Est proportionnelle la charge de lion considr Dpend du pH Nexiste pas en prsence de tensioactif cationique Dpend du potentiel appliqu aux extrmits du capillaire En valeur absolue, est plus grande que la mobilit lectro-phortique Vrai Vrai Vrai Vrai Vrai Faux Faux Faux Faux Faux

D) Considrant une lectrode membrane de verre pour la mesure du pH : Cest le proton qui assure le passage du courant au travers de la membrane Vrai Dans les solvants anhydres la rponse est plus rapide Vrai

Faux Faux

La slectivit membranaire pour H+ par rapport Na+doit tre suprieure 108 Vrai Faux si le potentiel mesur pH=7 est 0 mV, en thorie il est de -0.059V pH=6 Vrai Faux le potentiel pris par la membrane est donn par lquation de Nernst Vrai Faux

E) En chromatographie en phase gazeuse le facteur de rtention: est proportionnel la longueur de la colonne Vrai est proportionnel la racine carre de la longueur de la colonne Vrai diminue avec la temprature Vrai diminue si la vitesse linaire moyenne du gaz vecteur augmente Vrai augmente si, toutes choses tant gales par ailleurs, on considre une phase stationnaire plus polaire Vrai Faux Faux Faux Faux Faux

F) Considrant un dispositif dlectrodialyse, muni dune membrane slective aux anions : en labsence de tension applique aucune espce ne peut passer en labsence de tension applique, seuls les anions peuvent passer le courant ne peut passer que dans un seul sens les acides faibles ne peuvent passer qu pH suprieur au pKa On peut dsioniser compltement leau de mer Vrai Vrai Vrai Vrai Vrai Faux Faux Faux Faux Faux

G) En lectrophorse capillaire, en dtection inverse, en prsence dun inverseur de flux lectroosmotique et en utilisant la dtection spectrophotomtrique, laire intgre des pics dpend : De la tension applique de la concentration de llectrolyte support de la mobilit lectrophortique de lion donnant le pic du temps de rtention de la longueur donde du dtecteur Vrai Vrai Vrai Vrai Vrai Faux Faux Faux Faux Faux

H) Dpendance de la complexation vis--vis du pH. L est un complexant du magnsium, il est basique. pKa(LH22+/LH+)=4 ; pKa(LH+/L)=7. Log1=8 - La constante apparente de formation diminue quand on augmente le pH Vrai Faux - La constante apparente de formation vaut 1 pH=2 Vrai Faux 8 - La constante apparente vaut 10 pH=10 Vrai Faux 8 - La constante apparente vaut 10 pH=0 Vrai Faux - Le complexe et le ligand libres coexistent pH=7 Vrai Faux

H. 5 points Pour mener bien une analyse deau de rseau par lectrophorse capillaire on prpare une solution A de nitrate de calcium (masse molaire: 164.1 g) en dissolvant 25,6 mg de nitrate de calcium dans 5 mL deau ultrapure. A deux des trois chantillons deau de rseau de 10 mL on ajoute respectivement 25 et 50 microlitres de la solution A. Le tableau ci-dessous rassemble les rsultats Aire du pic (104V.s) Sans ajout 8.768 6.234 Aire du pic (104V.s) Ajout 25L solution A 11.34 10.73 Aire du pic (104V.s) Ajout 50L solution A 13.90 15.22

Nitrate Calcium

Quelles sont les concentrations de calcium et de nitrate en mol.L-1 et en ppm dans leau de rseau ? M(Ca)=40.08g ; M(N)=14.0g ; M(O)=16.0g I. 5 points Soit une cellule dlectrolyse dans laquelle plonge 2 lectrodes relies un potentiostat. Expliquer et dcrire ce qui se passe lorsque la cellule dlectrolyse munie de 2 lectrodes en cuivre est remplie dune solution aqueuse de sulfate de cuivre 10-2M et lon impose une tension suffisante pour obtenir un courant mesur quivalent 10 lectrons passant dans le circuit extrieur. i) Que sy passe t il si on y introduit une membrane inerte? ii) Que sy passe t il si on y introduit une membrane caractrise par un p(C+)=0? iii) Que sy passe t il si on y introduit une membrane caractrise par un p(X-)=0? Donnes : (H+) = 350 S cm2 mol-1 (Cu2+) = 108 S cm2 mol-1 (Cl-) = 76 S cm2 mol-1 (SO42-) = 160 S cm2 mol-1

UNIVERSITE Henri POINCARE Nancy Universit


DIPLOME : L3 SM Epreuve crite de : thermodynamique Session de janvier 2010

FACULTE des SCIENCES et des TECHNIQUES SUJET D'EXAMEN

Thermodynamique Dure du sujet : 2 H


Nom du rdacteur : B. Henry Date : 12 janvier 2010 Horaire : Documents : Non autoriss. Calculatrices autorises

Exercice n 1 On tudie en phase gazeuse, l'quilibre de dissociation : PCl5 = PCl3 + Cl2

1) 200 C, sous une pression p = 1 bar, la densit du mlange gazeux, obtenu par chauffage du pentachlorure pur, est d = 4,80. Ecrire littralement la constante dquilibre K. En dduire la valeur de la constante d'action de masse K (masse molaire de PCl5 = 208,5 g.mol-1 et celle de Cl2 = 71 g.mol-1 ). 2). Quelle est la composition du mlange obtenu l'quilibre, dans les mmes conditions, sous la pression p = 5 bars ? Justifier le sens du dplacement de l'quilibre. 3) Quelle est la variance de cet quilibre ? 4) Calculer la variation d'enthalpie standard r pour la raction considre 200C. 5) Calculer la variation d'enthalpie libre standard rG pour la raction considre 200C en supposant cette grandeur indpendante de la temprature. Quelles approximations faites vous? Est-ce raisonnable, justifiez votre rponse. 6) Etablir l'expression Ln K = f(T) pour l'quilibre considr. 7) quelle temprature faut-il oprer, sous p = 1 bar, pour que le taux de dissociation du pentachlorure l'quilibre soit de 25 % ? Donnes la temprature de 200C. f (kJ.mol-1) PCl3(g) - 287,0 PCl5(g) - 374,9 Cl2(g) 0 CP(J. K-1.mol-1) 112,8 71,8 33,9 S(J. K-1.mol-1) 311,7 364,5 223,0

Exercice 2 Le diagramme de phases liquide-solide, plomb (Pb not 1)- antimoine (Sb not 2) pression constante est donn sur la figure jointe (temprature en fonction de la fraction massique).

1) Prcisez la nature des phases dans chaque rgion du diagramme, la variance et situer le solidus et le liquidus (rponses sur le diagramme redonner avec les copies).

2) 315 g de mlange (Pb-Sb) de composition massique globale en plomb Z1 = 0,45 sont chauffs 630C.

a) On refroidit ce mlange, quelle temprature apparat le premier cristal ? Quelle est sa nature ?

b) Dterminer la composition du systme t = 400C. On dmontrera au pralable la rgle des moments chimiques.

c) Dterminer en masse et en moles t = 240C, la composition du systme au du palier de solidification.

d) Tracer le diagramme thermique pendant un refroidissement de t= 630C 200C. Donnes : masse molaire Sb = 122 g.mol-1 , masse molaire Pb = 207 g.mol-1

Voir diagramme joint. A complter et rendre avec les copies.

NOM :

Prnom :

Systme Sb-Pb la pression P = 1 bar

Pb not 1 et Sb not 2

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES et TECHNIQUES

SUJET DEXAMEN L3 Chimie et physicochimie UE numro : LCPC5U18 Epreuve de : Cintique chimique Anne 2009-2010, 1re session Date Horaire Dure du Sujet : 1 heure Nom du rdacteur : Dominique PERRIN 1 feuille de papier millimtr Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

-IVictor Henri a propos, entre autres, le mcanisme de catalyse enzymatique suivant : E+S E+S ES E+P (1) (-1) (2)

Montrez que la vitesse initiale est dcrite par une loi cintiquement indiscernable de celle de Michaelis-Menten. On rappelle que dans le mcanisme de Michaelis-Menten cest le complexe ES qui donne le produit P

-IILa raction en phase gazeuse du monoxyde dazote avec le dioxygne 2 NO + O2 = est tudie 25C dans un racteur ferm. Une premire exprience est ralise en prsence dun grand excs de dioxygne avec des concentrations initiales [O2] = 5,00.10-3 mol.L-1 et [NO] = 10,0 mol.L-1 ; on dose NO au cours du temps : t (min) [NO], mol.L-1 1 9,6 2 9,2 4 8,5 8 7,4 12 6,5 20 5,3 30 4,3 2 NO2

Une autre exprience est ralise avec des concentrations initiales [O2] = 10,0 mol.L-1 et [NO] = 1,00.10-3 mol.L-1; on dose O2 au cours du temps (en s): t (s) [O2], mol.L-1 10 9,3 20 8,6 30 8,0 60 6,4 120 4,1 240 1,7 360 0,7

1) En justifiant votre mthode, montrez que ces rsultats sont compatibles avec un ordre 2 par rapport NO et 1 par rapport O2. Que vous utilisiez une calculatrice ou la feuille de papier millimtr ( rendre avec votre n dtudiant), vos rsultats doivent tre justifis. 2) Calculez la constante de vitesse. 3) La raction est-elle un processus lmentaire ?

Page 1 / 1

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES et TECHNIQUES

SUJET DEXAMEN L3SM - Chimie et Physicochimie Molculaires Dure de lpreuve : 1h30 Nom du rdacteur : D. Canet Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

UE numro : LCPC5U19 Epreuve de : Mcanique quantique-Liaisons chimiques Session de janvier 2010 Date : Horaire :

A traiter sur une copie spare


On rappelle que les valeurs propres de loprateur L2 (associ au carr du moment cintique) sont de la forme h 2 l (l + 1) et que celles de loprateur L z (associ la composante selon z du moment cintique) sont de la forme hm . l est un entier ou un demi-entier positif ou nul et m est compris entre l et +l (dans cette plage, m varie par pas de 1). I Sachant que la partie en des harmoniques sphriques (fonctions propres de L2 et L z , si ceux-ci sont des

oprateurs moment cintique orbital) scrit ( e im / 2 ) et que, sagissant du moment cintique orbital, h Lz = , montrer que m (et par consquent l) sont des entiers. i II On considre deux lectrons occupant deux spin-orbitales dont les parties despace u1 et u2 sont diffrentes. Pour simplifier, on supposera que m vaut zro pour u1 et u2. Quelle est la valeur de l dans le cas du spin lectronique et quelles sont les valeurs possibles de ms ? Dresser le tableau de toutes les valeurs possibles de m1, m2, ms1, ms2 susceptibles de conduire des fonctions donde non nulles. En dduire : 1) les valeurs de M et Ms correspondant aux valeurs propres de la composante selon z des moments cintiques globaux (moment cintique orbital et moment cintique de spin). 2) les valeurs de L et de S correspondant aux valeurs propres des carrs des moments cintiques globaux. 3) lexistence dun tat singulet et dun tat triplet qui sont dnergie diffrente (ltat triplet tant le plus stable). On notera que cette dernire proprit peut stendre des valeurs quelconques des nombres quantiques m1 et m2. III On donne ci-dessous lexpression des orbitales atomiques (2s) et (2pz) de latome dhydrogne. ( 2 s ) = (1 / 4 2 )( 2 r )e r / 2
(2 p z ) = (1 / 2 ) 3 / 2 cos (1 / 2 2 )(2 r )e r / 2

Que reprsentent les coordonnes r et ? Indiquer la signification de la nomenclature (2s), (2pz). Quelle est lexpression des orbitales ( 2 p x ) et ( 2 p y ) ? Quelle est la symtrie des distributions lectroniques correspondant toutes les orbitales atomiques mentionnes dans cette question ? IV En ce qui concerne la molcule de di-oxygne (O2), on considrera que les orbitales de valence sont constitues des seules orbitales 2p. Donner lexpression de lorbitale molculaire construite partir des orbitales atomiques (2 p z ) a et (2 p z ) b , z tant la direction de la liaison, a et b dsignant les deux atomes doxygne (on veillera tenir compte du signe de ces deux dernires orbitales). Les orbitales ( 2 p x ) et ( 2 p y ) sont quivalentes et donnent naissance aux deux orbitales molculaires ( x ) et ( y ) (elles correspondent ncessairement la mme valeur de lnergie). Sachant que le numro atomique de loxygne est 8, et que le niveau antiliant est de plus faible nergie que le niveau antiliant, montrer, en se rfrant II, que cette molcule est paramagntique (S non nul).

UNIVERSITE DE NANCY I FACULTE DES SCIENCES ET TECHNIQUES SUJET D'EXAMEN

DIPLOME

L3SM parcours chimie

Nom des rdacteurs : M. Dossot, Dure du sujet : 30 minutes

Epreuve : Chimie Quantique et Spectromtries

Partie Spectroscopies Optiques


Documents autoriss Session de Date Horaire Janvier 2010 13 Janvier 2010 9h-11h00 Documents non autoriss Calculatrices autorises Calculatrices non autorises

Toutes les rponses devront tre trs soigneusement justifies. Dure du sujet: 30 minutes. A rendre sur une copie spare de l'preuve de Chimie Quantique.
On souhaite tudier en spectroscopie de vibration la molcule d'Ibuprofne, un antidouleur, anti-pyrique et analgsique trs rpandu dont la formule est donne ci-dessous :

HOOC

H3C
Figure 1 : la formule molculaire de l'Ibuprofne. L'ibuprofne est souvent incorpor dans des cachets contenant galement des excipients. La figure 2 montre les spectres d'absorption infrarouge de l'ibuprofne sous forme de poudre pure ("IBU"), au sein du cachet ("tablette") ainsi que le spectre des excipients.

tablette CO2 atmosphrique

Nombre donde (cm-1)

Figure 2 : spectres d'absorption IR de l'ibuprofne en poudre, du cachet et des excipients. 1) Une bande caractristique de l'ibuprofne est indique la figure 2 1721.5 cm-1. A quel groupement fonctionnel de la molcule cela correspond-il ? 2) Les excipients montrent une bande d'absorption large entre 2800 et 2980 cm-1. Quel(s) groupement(s) est (sont) responsable(s) de ce massif ? Pourrait-on choisir d'utiliser les bandes de l'ibuprofne 2840 et 2930 cm-1 pour le doser dans le cachet ? 3) On envisage la vibration d'longation du groupement carbonyle C=O d'un acide carboxylique. Sachant que la constante de force de cette liaison est d'environ 1200 N.m-1, calculez la masse rduite du groupement et le nombre d'onde de vibration associ. 4) Si l'acide est dproton, on obtient une fonction carboxylate. Dans ce groupement, la vibration d'longation du carbonyle a lieu vers 1550 cm-1. a) Expliquez pourquoi dans une fonction carboxylate la vibration du carbonyle a lieu plus bas nombre d'onde que dans l'acide carboxylique correspondant. b) Quelle conclusion peut-on en tirer sur l'tat de protonation de l'ibuprofne en poudre ? 5) On souhaite tudier l'ibuprofne en suspension dans l'eau. Peut-on utiliser la spectroscopie d'absorption infrarouge ? Quelle autre technique doit-on alors utiliser ? Donnes : Masse molaire 12C: 12 g mol-1 ; Masse molaire 16O: 16 g mol-1 ; vitesse de la lumire: 3108 m s-1.
2

NOM : PRENOM :

SECTION : L3 PC Mca NOTE :

Self-heating roads may avert the dangers of salt corrosion


Vocabulary: Find the equivalent words in the article for: acier charbon chaleur une bouilloire une couche la forme disponible amliorer la main doeuvre un grand morceau

Synonyms (words that have the same meaning): to need to pile up to increase in size to switch on to be successful

Antonyms (words that have the opposite meaning): to allow/ to enable to cool simple thin expensive

Supersonic flight without the boom


1 2 3 4 5 6 7 8 9 10

1
14/12/2009 Test L3 PC Mca

Supersonic flight without the boom


Are these statements true or false? Rpondez TRUE ou FALSE sur la grille de rponses.

1. NASA has finished doing tests using computer modelling which aim to reduce the sound of sonic booms.
2. Peter Cohen thinks it wont be long before sonic booms can be controlled. 3. Only the shock waves from the front of an aircraft create the noise when they reach the ground. 4. Passengers are not able to fly across the US at supersonic speed. 5. The sonic boom is not as loud if the shock waves from the front and back of the aircraft hit the ground at the same time. 6. It takes at least four years to build a test plane with a spiked nose-cone. 7. Reducing the sonic boom increases the fuel consumption of aircraft. 8. Aerodynamic modifications to large aircraft will not only reduce the sonic boom but will also cut fuel costs. 9. Measurements of shock waves collected from an experiment using two F-15 planes will be used by NASA. 10. There has been a lack of development in large supersonic aircraft because a solution to Concordes structural defects has not yet been found.

2
14/12/2009 Test L3 PC Mca

Self-heating roads may avert the dangers of salt corrosion


Paul Marks. New Scientist 29 November 2009

Hoping for an ice-free future. Blizzard-bound motorists wont have to wait for a salting truck or snowplough to clear the way if a self-heating road takes off. While salting disperses ice and snow, the salty run-off corrodes the steel rods that reinforce roads and bridge decks, and also damages vehicles. With the US government striving to improve its road infrastructure after a fatal bridge collapse in Minnesota in 2007, new methods to clear snow without damaging structures are being sought. One such method being developed by Christiana Chang at the University of Houston, Texas, and colleagues is to incorporate electric heating elements into concrete roads and bridge decks. When cold weather is forecast, the element can be fired up to heat the road and prevent ice forming. There are various methods to make a slab of concrete that can be heated electrically. One way is to pepper the mix with an electrically resistive material that will convert current into heat, like the element of a kettle. To start with, the team tried this approach, using fly ash, a waste product of burning coal in power stations, as the element, followed by steel shavings. Both options had the desired effect. Then they tried an alternative method, using sheets of carbon nanofibres to heat the concrete, and found it was much faster. Nanofibres comprise lengths of cone-shaped nanotubes nested like paper cups stacked on top of each other, says Chang. She bonded multiple layers of nanofibre-embedded paper beneath a chunk of road concrete that was 10 centimetres thick and 25 square centimetres in area. It warmed from -10C to 0C in 2 hours while consuming 6 watts of electrical power (Smart materials and Structures, DOI: 10.1088/0964-1726/18/12/127001). Heating the block slowly reduced power consumption. Its an interesting technique, but scaling it up to cover whole roads will require enormous power, says Derek Carder, an engineer with the Transport Research Laboratory (TRL) in Wokingham, UK. Indeed, overly high power use was a problem for a self-heating road trialled by TRL itself in 2007, he says. In a process called inter-seasonal heat transfer, TRLs system stored summer heat in water kept in insulated reservoirs. In cold weather, this warm water was pumped through a grid of pipes beneath the road to prevent icing. But the pumps proved too power-hungry. Ideas like these dont seem viable for whole roads, but they may work for known cold spots or bridge decks, Carter says. The Houston team, however, say that their method is less complex and that as sheets of paper embedded with nanofibres are already used to make electronic components, they are readily available and cheap. They add that savings made on salting and snowplough labour could make their low-maintenance design viable. 3
14/12/2009 Test L3 PC Mca

Supersonic flight without the boom but quiet will cost.


Jeff Hecht. New Scientist Technology 7 February 2OO9

NASA has completed a delicate set of flight tests to measure how modifications to an F-15 jet can affect the way shock waves form. The results could help turn sonic booms into distant rumbles. The measurements will be used to calibrate a computer model of shock wave propagation which will be a crucial aid for engineers designing a new generation of quieter supersonic aircraft. Were pretty close to being able to control sonic booms, says Peter Cohen of NASAs Langley Research Centre in Virginia, principal investigator for the agencys supersonic research programme. Shock waves form at the front and back of supersonic aircraft as they shove air out of the way. When these shock waves hit the ground, observers hear them as a single boom. Public opposition to booms has led to a ban on civilian supersonic flight over US land, and this key factor has discouraged further development of supersonic planes. Attempts to quieten the sound have focused on a technique called boom shaping, which has it that booms would be weaker if they spread out over a larger area. The idea is to redesign the shock-forming zones around the nose and tail so that waves from them dont hit the ground together, but instead arrive over a longer period, like distant thunder. Five years ago, NASA, the US Defense Advanced Research Projects Agency and several aerospace companies studied how a spiked nose-cone fitted to an F-5 fighter jet affected shock waves generated at the nose. Now NASA has finished a similar set of measurements of the boom generated at the rear of an aircraft. This depends on the shape of the wings and air flow around the engine. The Lift and Nozzle Change Effects Tail Shock project (LANCETS) measured the shock waves produced by a modified F-15 jet in different wing and engine configurations. The measurements were taken by a second F-15 flying close behind and will be used to calibrate NASAs computer models of how shock waves form. If the results live up to expectations, the next step would be to modify a jet so that it produces a low rumble rather than a boom in supersonic flight. Confirming the computer model is a crucial part of this process because designing, building and flying a test plane can cost more than $100 million, says Tim Moes of NASAs Dryden Research Center in California. We think we could do it in the next four to five years, Cohen told New Scientist. Dont expect to see a new Concorde any time soon, though. Cohen says that boom-hushing technology may first appear on small business jets rather than larger aircraft. Boom shaping doesnt come for free, says Cohen. The aerodynamic modifications reduce fuel efficiency by 10 to 15 per cent. Thats not too bad for a business jet, but not good for an airliner.

4
14/12/2009 Test L3 PC Mca

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES DIPLOME..Licence Mcanique L3 .. Epreuve de.Equations diffrentielles.. .. Session de final (1re session) Date janvier 2010.. Horaire. .. H

SUJET DEXAMEN
| | | | | | | Dure du sujet .1h Nom du rdacteur A.Ourjoumtsev Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

___________________________________ |_______________________________________ 1. Solution dune quation linaire avec une partie droite : a) Trouver la solution gnrale de lquation y + 2 xy = 0 . b) Trouver la solution gnrale de lquation y + 2 xy = xe x par variation de constante (se servir la rponse du problme prcdent) 2 c) Trouver la solution de lquation y + 2 xy = xe x avec la condition y (0) = 1 (se servir la rponse du problme prcdent) 2. Trouver la solution gnrale de chacune des quations diffrentielles linaires coefficients constantes : a) y 4 y + 3 y = 0 b) y ( 4 ) 4 y + 3 y = 0 c) y 6 y + 10 y = 0 d) y 4 y + 4 y = 0
2

3. Rsoudre lquation diffrentielle y +

x sin x = 0. y cos y

1a.

2 dy dy = 2 xdx ; ln y = x 2 + c ; y ( x) = Ce x = 2 xy ; y dx

1b.

(C e x 2 xCe x ) + 2 xCe x = xe x ; C e x = xe x ;
y=(
2 x2 + C1 )e x 2

C = x ;

C=

x2 + C1 ; 2

1c. y = (

2 2 x2 x2 + C1 )e x ; y (0) = C1 = 1 ; y = ( 1)e x 2 2

2. a) 2-4 +3=0 ; 1=1, 2=3 ; y ( x ) = C1e x + C 2 e 3 x b) 4-42 +3=0 ; 1,2= 1, 3,4=3 ; y ( x) = C1e x + C 2 e x + C 3 e x 3 + C 4 e x 3 c) 2-6 +10=0 ; 1,2=3i ; y ( x) = C1e 3 x cos x + C 2 e 3 x sin x d) 3-42+4 =0 ; 1=0 ; 2,3=2; y ( x) = C1 + (C 2 + C 3 x)e 2 x
dy x sin x ; = dx y cos y

3. Cest une quation avec des variables sparables ;


y cos ydy = x sin xdx ;

y cos ydy = x sin xdx . En calculant les intgrales par partie,

y cos ydy = y sin y sin ydy = y sin y + cos y x sin xdx = x cos x + cos xdx = x cos x + sin x
y sin y + cos y = x cos x sin x + C

Facult des Sciences et Techniques

1re session / janvier 2010

Introduction au transfert de chaleur. (Code LCPC5U12CT MECA) Examen sur le cours de D. Lacroix et P. Boulet Dure 1 heure Documents autoriss

On considre une sphre creuse de rayon interne Ri =20 cm et rayon externe Re = 25 cm ralise dans un matriau solide opaque. 1. On considre que les tempratures des faces internes et externes sont constantes (respectivement gales Ti et Te). Justifiez lhypothse dun transfert par conduction seule, 1D, stationnaire et sans source. En partant de lquation de la conduction en rgime stationnaire sans source, exprimez T(r) la temprature du milieu la position r et commentez son volution. On prcise que le laplacien en coordonnes sphriques pour une fonction f ne dpendant que de la position radiale r est

f =

2 f 2 f + . De mme r 2 r r

grad( f ) =

f er . r

2. Dmontrez quon peut dfinir une rsistance thermique par conduction en gomtrie sphrique telle que :

Rcond =

Re Ri 4 ReRi

3. La sphre est place dans un coulement dair extrieur dont la vitesse est Vair = 1m/s et dont la temprature est Tair = 20C. On mesure la temprature de la face externe : Te = 60C. Calculez le coefficient dchange de chaleur par convection hc autour de la sphre. Donnes : Corrlation usuelle en convection force pour une sphre :

Nu = 2 + 0,6 Re 1/2 Pr 1/3

(on utilisera le diamtre de la sphre comme dimension caractristique) Proprits de lair : TEMPERATURE (C) 20 40 60 Pr 0,703 0,699 0,696

(K-1)
3 3 3

(m2/s)
15,06 .10 16,96 .10 18,97 .10
6 6 6

(W/m.K)
2,59 .10 2,76 .10 2,90 .10
2 2 2

3,41 .10 3,19 .10 3,00.10

4. La surface externe a une missivit de 0,9. Calculez le coefficient dchange quivalent par rayonnement hr . 5. En dduire le flux chang entre la surface de la sphre et le milieu extrieur. 6. On souhaite que la temprature interne Ti ne dpasse pas 100C. Quelle devrait tre la valeur de la conductivit thermique pour cela ?

Universit Henri Poincar Module LCPC5U13 Niveau L3 Anne 2009-2010 Thermodynamique et lectrochimie appliques aux piles combustible Examen 2009-2010 - Sans documents -2h On dispose dassemblages membrane-electrode (AME) dont les caractristiques sont les suivantes : - Surface active de 100 cm2 - Membrane lectrolyte en Nafion 115 dpaisseur 125m - Electrodes de rugosit =100, de courant dchange 60C I0=4.10-7 A/cm2 , de pente de Tafel 60C b=50mV - Diffuseurs en tissu de carbone dpaisseur 300 m pour lesquels le coefficient de diffusion de loxygne dans lair 60C est Deff=2.10-6 m2s-1. - Tension courant nul 60C : U=0.98V. 1. Rappeler la structure du Nafion. 2. Pourquoi la tension vide nest pas de 1.23V ? 3. Surtension dactivation On rappelle que la surtension dactivation est donne par la loi de Tafel :
I 0 I De quel phnomne physique provient cette perte de tension ? Calculer la surtension dactivation 60C pour une densit de courant I variant de 0.1A/cm2 1.5 A/cm2 suivant un pas de 0.1 A/cm2

a = b ln

4. Surtension par effet Joule La pile est alimente en air humide. Cet air est humidifi par un bulleur dont la temprature est de 50C. Quelle est lhumidit de lair en entre de pile ? Quelle est lhumidit de lair en sortie de pile pour une stoechiometry en air de 2 en supposant que toute leau produite reste du cot cathodique ? En dduire par une moyenne entre-sortie lhumidit moyenne cot cathode. En supposant que lhumidit moyenne de la membrane est gale lhumidit moyenne de la cathode, calculer alors la surtension par effet Joule pour une densit de courant I variant de 0.1A/cm2 1.5 A/cm2 suivant un pas de 0.1 A/cm2 (toujours pour une stchiomtrie de 2). Conductivit protonique du Nafion : ( , T ) = ( 5.139 3.26 )10 e
1 1 1 1263 303 T

Loi de sorption de leau dans le Nafion : = 0.3 + 10.8Hr 16 Hr 2 + 14.1Hr 3


5096 ,23 sat Pression de vapeur saturante de leau : PH 2O = exp 13 ,669 P0 T

4. Surtension de concentration Toujours pour une stoechiometrie en air de 2 et une temprature de bulleur de 50C, calculer la concentration de loxygne en entre de cathode et en sortie de cathode. En dduire la concentration moyenne doxygne dans les canaux cathodiques. Calculer alors la concentration moyenne doxygne au niveau de llectrode cathode en fonction de la densit de courant. Enfin, calculer la surtension de concentration pour une densit de courant I variant de 0.1A/cm2 1.5 A/cm2 suivant un pas de 0.1 A/cm2
c0 Surtension de concentration : c = b ln O 2 cO 2
0 cO 2 : concentration doxygne dans lair ambiant

5. Performances de la cellule Tracer la courbe de polarisation pour une cellule. Tracer la courbe de puissance. Tracer la courbe de rendement. 6. Dimensionnement du Stack A partir de ces cellules, on souhaite construire un stack dont le rendement doit tre de 50 %. Quel sera le courant dbit par la pile ? la tension de fonctionnent ? Quel est le nombre de cellules empiler pour obtenir une puissance de 1kW dans ces conditions de fonctionnement ? Quel seront les dbits de gaz ?

Universit Henri Poincar UFR STMP L3 Physique Chimie parcours Mcanique Energtique Epreuve de technologie LCPC5UE14 Session de Janvier 2010

Dure : 2 heures Document autoris : tableau des 10 liaisons lmentaires Rendre les 3 feuilles du sujet dans votre copie
Le systme technique tudi est un robinet de radiateur de chauffage central dont le plan lchelle 4 : 1 vous est donn la page 3. (Vue de face en coupe et section sortie A-A et B-B) Le fonctionnement est assez simple : la rotation de la poigne 5 engendre indirectement la translation du boisseau 3 qui obture ou non le passage du fluide de A vers B. La nomenclature est donne ci-dessous. 9 8 7 6 5 4 3 2 1 Repre 1 1 1 1 1 1 1 1 1 Nombre Vis tte fraise Anneau lastique Joint plat Joint torique Poigne Vis de commande Boisseau Tte de robinet Corps de robinet Dsignation

Solidaire de 4 (paulement rapport)

Matire

Observations

Partie 1 Comprhension globale du mcanisme


Question 1 : Le passage du fluide est-il possible de A vers B dans la position du dessin ? Justifier votre rponse.

Partie 2 Comprhension du dessin


Question 2 : Dire pour les pices 1, 2, 3, 4 et 9 si elles possdent 0, 1 ou 2 partie filetes 0,1 ou 2 parties taraudes.

Question 3 : Les hachures nous donnent une information sur la famille de matriaux. Citer la famille de matriaux utilise pour la ralisation des pices 1, 2 et 3.

Epreuve de technologie

Page 1/3

Partie 3 Etude des formes dune pice.


Question 4 : Faire linventaire des formes du boisseau 3. Question 5 : Raliser une perspective isomtrique main leve du boisseau 3 ( main leve ne veut pas dire sans soin).

Partie 4 Modlisation du mcanisme


Question 6 : Rechercher les diffrentes classes dquivalence du mcanisme. Colorier chacune de ces classes dquivalence dune couleur diffrente sur toutes les vues du dessin page 3. Question 7 : Raliser le graphe des liaisons Question 8 : Faire linventaire des liaisons avec leur orientation. Question 9 : Raliser le schma cinmatique plan en couleur du mcanisme dans le plan (XY) .

Epreuve de technologie

Page 2/3

Epreuve de technologie

Page 3/3

LICENCE PHYSIQUE EXAMEN ANGLAIS JANVIER 2010


Read the article The self organizing quantum universe and answer the following questions:

VOCABULARY:
Find synonyms for the following (pg. 26 paras1-4, pg. 25 paras 1-3): Setting: To be situated: Frontier: Innumerable: Completely: Empty spaces: Major: Amazing: Results: Barely: ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................

Find antonyms for the following (pg. 25-26): Twisted: Inappropriate: Nearby: Normal, usual: Narrow: Part: Disconnect: Ambiguous: Double: Unattainable: ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................ ............................................................................................

COMPREHENSION:
Tick True or False: 1) Dans la thorie traditionnelle de la gravit, le nombre de dimensions est toujours invariable. F T 2) La gravit quantique reste un domaine inexplor dans la physique. T F 3) La structure de lespace temps vide permet de distinguer cause et effet dans le concept de causalit. T F 4) La prsence prpondrante des wormholes dans lunivers quantique rduit lespace a un minimum. T F 5) Les quations dEinstein de lunivers sont ptries de la constante cosmologique. T F

QUESTIONS:
Answer the following questions in FRENCH: 1) Define the superstring theory. ........................................................................................................................................................ ........................................................................................................................................................ 2) What is a fractal? ........................................................................................................................................................ ........................................................................................................................................................ 3) Describe briefly quantum fluctuations. ........................................................................................................................................................ ........................................................................................................................................................ 4) Explain briefly the main principles on which Eucledian quantum gravity is based. ........................................................................................................................................................ ........................................................................................................................................................ 5) What is de Sitter geometry? ........................................................................................................................................................ ........................................................................................................................................................

!" #

' % " $

'% )%

%& )

' ' ' > *) '

' =

( '

*+

'

' ' ' /

>

- = . %

* = <

*
>

< (, '

" 0 "

/ ) 2 %

, % ' )
=

' % '

' '' 1 ) ' 0' ' ' %

$ ' "

'% )% ' '1 1

' '

" , ' ' " ( ' '

+ 2

' '$ ) )

, 1 '

%" 3 ' ( ' (, " ' )

"
TSVP

/ '% * ' 1

' 1 ( ' 5 ' '

( '

14 0

% ' '

=
'

=

( '

"/


+ '

=
0' )

=
' '

"

" ' ' ' % / 1 ' 0 7'' ' ! ' % " ( ' ' ' " ' ) ( "7
=

' "

' )

'

'

'

( '

)(

' 0 "
<

'

'

' ' ) '

'

8 ' )

1/1 UNIVERSITE DE NANCY I FACULTE Diplme : Epreuve : Session : Date : DES SCIENCES L3 SM Sciences Physiques LCSM5CBCT - Informatique 2009 2010 1re session Horaire : SUJET D'EXAMEN Dure recommande : 30 mn Nom du rdacteur : D. Grandclaude Aucun document autoris

________________________________________________________________________________________

Architecture matrielle des ordinateurs

Les rponses aux questions doivent tre rdiges de faon trs synthtique. Privilgiez les phrases courtes et les schmas, plutt que les longs discours.

Question 1 :
Quest-ce linformation ? Quest-ce que la numrisation de linformation ? Comment numrise ton linformation ? Dtaillez et commentez.

Question 2 :
Pourquoi un ordinateur est-il aujourdhui une machine lectronique ? Expliquez, justifiez. Quest-ce que la loi de Moore ? Quels sont ses fondements ? Quelles en sont les consquences ?

UNIVERSITE HENRI POINCARE NANCY I - FACULTE DES SCIENCES et TECHNIQUES

SUJET DEXAMEN L3 Sciences physiques UE numro : LCPC5U02 Epreuve de : Cintique chimique Anne 2009-2010, 1re session Date Horaire Dure du Sujet : 1 heure Nom du rdacteur : Dominique PERRIN 1 feuille de papier millimtr Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

1) La raction entre lion bromate BrO3- et lion bromure Br- en milieu acide conduit au brome Br2. On se propose de dterminer les ordres partiels de cette raction par rapport BrO3, Br- et H+. 1.a) Ecrivez la stchiomtrie de la raction.

1.b) Dans une premire srie dexpriences 0C, avec les concentrations initiales suivantes : [BrO3-] = 1,00.10-3 mol.L-1 [Br-] = 0,143 mol.L-1 [H+] = 0,100 mol.L-1 on a obtenu les rsultats suivants : temps (s) 10 .[BrO3 ], mol.L-1
4 -

150 9,42

300 8,87

450 8,36

900 6,99

1800 4,89

3600 2,39

En justifiant les choix exprimentaux, montrez que ces rsultats sont en accord avec un ordre 1 par rapport BrO3-. Que vous utilisiez une calculatrice ou la feuille de papier millimtr ( rendre avec votre n dtudiant), vos rsultats doivent tre justifis. 1.c) Trois autres expriences 0C, avec [BrO3-] = 0,136 mol.L-1, ont donn les vitesses initiales de formation de Br2 , v, suivantes : [Br-]0, mol.L-1 0,108 0,143 0,108 [H+]0, mol.L-1 0,100 0,100 0,130 v, mol.L-1.s-1 1,22.10-4 1,62.10-4 2,07.10-4

Dduisez-en lordre initial par rapport H+ et par rapport Br-. 1.d) 2) Calculez la constante de vitesse 0C. On a propos pour cette raction le mcanisme suivant : BrO3- + 2 H+ H2BrO3+ Br- + H2BrO3+ Br2O2 + H2O + Br2O2 + 2 H + 4 Br produits

(1) (-1) (2) (3)

2.a) Pourquoi admet-on que lquilibre (1)(-1) est rapide? 2.b) Montrez que, si ltape (2) est dterminante, ce mcanisme est en accord avec lexprience. 2.c) Parmi ces processus, lesquels peuvent tre des processus lmentaires ?

Page 1 / 1

UNIVERSITE HENRI POINCARE. NANCY I

FACULTE DES SCIENCES DIPLOME : Licence Epreuve de : Ractivit LSM-5-304 Session de : janvier 2010 Date : Horaire :

SUJET DEXAMEN Dure du sujet : 1 h Nom du rdacteur : M.M.BETTAHAR

Calculatrices autorises

1- On a dtermin la surface spcifique dun charbon actif par la mthode BET en utilisant le n-butane comme gaz dadsorption. Le volume de la monocouche adsorbe est de 146 cm3g1 . Calculer la surface spcifique de ce charbon actif. Lencombrement de la molcule de nbutane est de 20 2. 2- Ladsorption dun gaz A sur une surface S suit une loi de type Langmuir. Les rsultats exprimentaux sont rapports dans le Tableau ci-dessous. P (Pa) 25.3 129.3 253.3 540 3 V(cm ) 0.042 0.163 0.221 0.321 a- Etablir les relations dans le cas dune adsorption associative et dune adsorption dissociative b- Vrifier que les rsultats obtenus vrifient lhypothse dune adsorption non dissociative. c- Dterminer la constante de chimisorption K et le volume Vm de la monocouche selon lhypothse ci-dessus. 3- Au contact dune paroi de verre, la raction suivante est catalytique : C2H4 + Br2 C2H4Br2 Le produit de la raction est liquide dont on ngligera la pression de vapeur. On appellera k la constante de vitesse, K1 et K2 les constantes de chimisorption de C2H4 et Br2 et S la surface de contact. aEtablir lquation de vitesse en supposant un mcanisme de type LangmuirHinshelwood. b- Lexprience montre que cette vitesse est sensiblement proportionnelle aux pressions partielles de C2H4 et Br2. Que peut-on conclure sur ladsorption des deux ractifs ? 4- Quest-ce que la microscopie ionisation de champ ?

UNIVERSITE HENRI POINCARE SUJET D'EXAMEN DIPLOME L3PC SPC Epreuve de Chimie Orbitalaire LCPC5U03 Session premire, anne 2009/2010 Date Horaire

FACULTE DES SCIENCES ET TECHNIQUES

Dure du sujet 3 heures Nom du rdacteur Xavier ASSFELD Documents autoriss Calculatrices autorises OUI OUI NON NON (1)

(1) Tables des caractres uniquement.

Indications : Le sujet comporte 4 pages. Les rponses seront justifies et rdiges avec concision. En cas derreur dnonc, indiquer sur la copie les initiatives que vous tes amens prendre et continuer dans lnonc. Partie I Mcanique Quantique. A. Questions de cours.
r a. Donnez lexpression des trois composantes Lx , Ly , Lz de loprateur moment cintique L en

r fonction des composantes de loprateur position r ( x, y, z ) et de loprateur quantit de


r mouvement p p x , p y , pz o pa = ih . a

b. Calculez les commutateurs suivants :


x y

[L , L ] ; [L , L ] ; [L , L ] ; [L , L ]
2
y z

c. Comment appelle-t-on les fonctions propres communes aux oprateurs Lz et L2 ?

B. Mthode variationnelle. La partie radiale de lquation de Schrdinger (en units atomiques) de latome dhydrogne scrit :

1 2 1 r = E 2r r 2 r
On approxime la fonction donde exacte ( ) de ltat fondamental par la fonction dessai :

= Ne

r 2

a. Calculez la constante de normalisation N de la fonction dessai . b. Pour la fonction dessai , exprimez la valeur moyenne de lnergie en fonction de . c. Dterminez la valeur de qui donne la meilleure nergie . d. Comparez lnergie obtenue lnergie exacte.

Partie II Liaison Chimique.


Gomtrie et structure lectronique des carbnes.

A. Gomtrie dquilibre. 1) La gomtrie de la molcule de CX2, o X est un atome normal, peut tre linaire ou coude (voir la figure 1). Dans un premier temps, on considrera que latome X est monovalent et quil ne porte quune seule orbitale atomique (OA) ou hybride (OH), nomme , pointant vers latome C (voir la figure 1). Latome de C apporte une OA 2s et 3 OA 2p. Lnergie des OH est intermdiaire entre celle de lOA 2s et celle des OA 2p de C. Pour les deux gomtries proposes, vous devez rpondre aux questions suivantes : i. Dterminez le groupe de symtrie. ii. Cherchez la(les) reprsentation(s) des OA ou OH. iii. Rduisez la(les) reprsentation(s) prcdentes. iv. Construisez les orbitales de symtrie (OS) v. Ecrivez les orbitales molculaires (OM) avec le minimum de coefficients inconnus. vi. Construisez le diagramme dOM de manire qualitative en justifiant les positions des OM les unes par rapport aux autres et par rapport aux OA ou OH. Attention, les deux diagrammes dOM doivent tre donns lun ct de lautre et les positions des OM dune gomtrie justifies par rapport aux positions des OM de lautre gomtrie.

2) Dterminez la gomtrie prfrentielle de la molcule CX2 en justifiant votre rponse.

x
Xb

a
(a)

Xa

b
Xb

a
Xa

(b)

Figure 1. Molcule XbCXa. (a) Gomtrie linaire. (b) Gomtrie coude. Les OA ou OH des atomes X sont
indiques (a et b). Attention, le choix des axes cartsiens de la figure (b) ne correspond pas celui des

tables des caractres ! Vous ne pouvez donc pas utiliser les dernires colonnes de ces tables pour cette gomtrie ! Attention aussi aux noms des plans de symtrie !

B. Configuration lectronique. 1) La molcule CX2 est considre dans sa gomtrie coude uniquement. Les atomes X portent maintenant une OA de type np perpendiculaire au plan de la molcule (voir la figure 2) en plus de lOH utilise la question A. Deux cas sont envisags : i) X est un donneur , son OA np est
2

doublement occupe et possde une nergie infrieure celle de lOA 2p du carbone. ii) X est un accepteur , son OA np est vide et possde une nergie suprieure celle de lOA 2p du carbone. i. Cherchez la reprsentation des OA np des deux atomes X. ii. Rduisez cette reprsentation. iii. Construisez les OS correspondantes. iv. Etablissez de manire qualitative le diagramme dOM de la molcule CX2 pour le cas o X est un donneur , partir du diagramme dOM obtenu la question A et des OS construites la question B.1.iii. v. Mme question pour le cas o X est un accepteur . On supposera que lordre relatif des OM de CX2 ne change pas lorsque linteraction est prise en compte. vi. Comment volue lcart nergtique entre lOM la plus haute occupe (HOMO) et lOM la plus basse vacante (LUMO) dans les deux cas ?

y
Xb C Xa

Figure 2. OA np des atomes X. Les notations de Cram sont utilises


pour indiquer que les atomes X sont en arrire du plan de la feuille.

2) Lorsque lcart nergtique entre la HOMO et la LUMO est faible, le principe dAufba peut tre viol cause des interactions bi-lectroniques et un lectron de la HOMO peut tre promu de la HOMO vers la LUMO pour donner un tat triplet o les deux lectrons clibataires ont le mme spin (voir la figure 3). Si lcart nergtique est grand, on obtient un tat singulet o chaque orbitale soit doublement occupe soit vide. Pour les molcules suivantes, indiquez si lon obtient un tat triplet ou un tat singulet . i. CF2 ii. C(CHO)2

LUMO grand HOMO (a) petit LUMO HOMO (b)

T.S.V.P

Figure 3. (a) tat singulet . (b) tat triplet .

Donnes :
Elment de volume en coordonnes sphriques : d = r 2 sin drdd Intgrales gaussiennes : Avec > 0 et n entier. Puissances paires de r :

r 2 ner dr =
2

22 n +1 n! n +1 2 n! 2 n +1

(2n )! 1 2

Puissances impaires de r :

r 2 n +1e r dr =
2

Fin de lnonc

UNIVERSITE HENRI POINCARE, NANCY I FACULTE DES SCIENCES

SUJET DEXAMEN

Parcours Sciences Physiques et Chimiques Dure de lpreuve 1h30 UE LCPC5U04 2me anne Epreuve Interfrences et diffraction Nom des rdacteurs F. Favier & C. Didierjean Documents autoriss Examen de 1er semestre X Documents non autoriss Date 8 janvier 2010 X Calculatrices autorises Horaire 16h30 18h Calculatrices non autorises Extrait du concours externe de recrutement de professeurs certifis et concours d'accs des listes d'aptitude (CAFEP), session 2002

Interfromtrie stellaire optique


Imagine ds 1868 par Fizeau, qui en tablit la thorie, l'interfromtrie stellaire dans le domaine optique ne parvint maturit qu'un sicle plus tard. Les premires tentatives exprimentales, dues Fizeau et Stphan, disposant d'un tlescope d'un mtre de diamtre, et visant des toiles parmi les plus lumineuses, se soldrent par un chec. Ds 1890, Michelson parvient valider la mthode en retrouvant les dimensions des satellites de Jupiter. Ce n'est qu'en 1920 que Michelson et Pease russissent, pour la premire fois, l'aide du tlescope de 2,5 mtres de diamtre du mont Wilson, dterminer le diamtre angulaire d'une toile (Btelgeuse dans la constellation d'Orion). Cette toile est une gante rouge dont ils valuent le diamtre 400 fois celui du Soleil. L'ide d'utiliser deux tlescopes pour faire ensuite interfrer les deux faisceaux qui en sont issus a longtemps t considre comme irralisable dans le domaine optique; oprationnelle dans le domaine des ondes radio ds la fin de la Seconde Guerre mondiale, elle n'est passe au domaine optique que sous l'impulsion d'Antoine Labeyrie en 1970, qui obtient les premiers rsultats en 1974. Toutefois, cette technique, dsormais oprationnelle, a l'inconvnient de dlivrer une information monodimensionnelle (cart angulaire) et est srieusement concurrence par l'optique adaptative, qui fournit une information bidimensionnelle (images). Depuis 1996 (toile double Capella), l'utilisation de 3 tlescopes ouvre l'interfromtrie optique l'accs la synthse d'images bidimensionnelles.

I. Limitation due la diffraction


On assimile le tlescope une lentille mince convergente L, de centre 0 et de distance focale image f'= 24 m. Oz dsigne l'axe optique de la lentille L. On accole un diaphragme D devant la lentille L quivalente au tlescope et on observe la rpartition de l'clairement dans son plan focal image FXY, d'quation z =f, au voisinage du foyer principal image F'. I.1 Pour un diaphragme rectangulaire de cts parallles aux axes Ox et Oy, et de dimensions respectives a et b paralllement ces axes, on montre que, lorsque l'onde incidente est une onde plane progressive monochromatique de longueur d'onde , se propageant selon l'axe optique de L, l'intensit lumineuse au point P(X,Y) du plan focal image est de la forme : aX bY I ( X , Y ) = I 0 sin c 2 ( ) sin c 2 ( ) f ' f '

o lon a introduit la fonction sinus cardinal dfinie par sin c( x ) =

sin x . x

I.1.a) Sans calcul pralable, reprsenter sur un schma l'allure de la figure de diffraction lorsque le diaphragme est carr. I.1.b) Donner l'inclinaison par rapport l'axe optique d'un rayon qui parvient au point P de coordonnes (X,0) dans le plan focal image de la lentille. Donner l'expression de I() pour le point P(X,0). I.1c) Tracer la courbe reprsentative de I(). On appelle demi-largeur angulaire de la tache centrale de diffraction la distance angulaire entre le centre de la figure de diffraction et le premier minimum de I. Dterminer la demi-largeur angulaire dans la direction F'X en fonction de a et . I.2 Que devient la figure de diffraction dans le cas o b>> a et b >> ? I.3 On remplace le diaphragme carr par un diaphragme circulaire de rayon R=1,75m. I.3.a) Donner sur un schma l'aspect de la figure de diffraction observe dans le plan F'XY. On neffectuera aucun calcul et on se contentera d'exploiter les proprits de symtrie. I.3.b) On montre que la demi-largeur angulaire de la tache centrale se dduit de celle qui a t R obtenue pour le diaphragme carr en effectuant le changement : a . 0,61 Que devient la largeur angulaire de la tache centrale de diffraction ?
I.4 Le critre de Rayleigh indique que la limite de rsolution d'un systme optique est l'cart

angulaire de deux objets mutuellement incohrents donnant des taches centrales de diffraction dcales de telle sorte que le maximum de l'une soit situe sur le premier minimum nul de l'autre.
I.4.a) Le diaphragme tant la monture (circulaire) de la lentille quivalente de diamtre D, quelle est la limite de rsolution du tlescope pour une longueur d'onde ? I.4b) On observe travers le systme l'toile double Sirius, dont les deux composantes sont cartes d'un angle 3,8.l0-5 rad. La rsolution des composantes de Sirius est-elle remise en cause par la diffraction pour =635 nm ?

II. Fentes de Young: mthode de Fizeau


Le diaphragme pupillaire est perc de deux fentes F1 et F2 (fentes de Young) de largeur a et de longueur b, et distantes de e.

x F1 E e a

X P

O F

F2

II.1.a) La marche des rayons lumineux issus de l'toile situe sur l'axe de la lentille, qui interfrent en P, est reprsente en pointills, mettre en vidence, en la justifiant, la diffrence de marche sur le schma (Il est important de noter que lon ne sintresse ici quaux interfrences linfini et donc de rayons parallles). II1.b) L'clairement I(X,0) dans le plan focal image de la lentille, peut se mettre, pour Y = 0, sous la forme : aX I ( X , Y ) = I 0 sin c 2 ( )(1 + cos ) f '

Exprimer en fonction de X et des donnes (on fera lapproximation des angles petits).
II.1.c) Que devient pour Y 0 ? II.2 On pointe, avec le dispositif prcdent, le centre d'une toile double symtrique; cette toile est constitue de deux sources primaires incohrentes E1 et E2, de contributions gales en intensit: IS1 = IS2 = IS. On oriente la direction dfinie par les fentes de telle sorte que F1F2 passant par O soit parallle E1E2. La largeur a de chacune des fentes est ngligeable devant la distance e qui les spare, dans ce cas on supposera : I ( X , Y ) = I S (1 + cos ) . On dsigne par d la distance O, xs1 la position de E1 selon un axe xs parallle l'axe pupillaire Ox et xs2 la position analogue de E2. On a ici: xs2 = -xs1.

xs

X P

E1

F1 a O F2

E2 d

F f

II.2.a) Justifier par un schma comment que la diffrence de phase entre les deux voies en e amont des fentes est, pour l'toile E1 : 1 = .

Montrer que l'expression de l'clairement I1 en P(X,0) d l'toile E1 est de la forme 2eX I 1 ( X ,0) = I S (1 + cos(0 + 1 ) avec 0= . f '
II.2.b) Donner sans calcul l'expression de l'clairement I2 en P d l'toile E2. II.2.c) Quelles sont, en fonction de Is, , e, X, f et , les contributions de l'clairement total au point P ? II.2.d) Montrer que la rpartition de l'clairement devient uniforme pour certaines valeurs de la distance e. Soit el la plus petite de ces valeurs; montrer que sa dtermination permet d'accder la distance angulaire qui spare El et E2. II.2.e) Dans le cas de Capella, suppose symtrique dans le visible, pour = 635 nm, on a trouv el = 116,5 cm. En dduire en seconde d'arc.

Epreuve de Thermodynamique chimique, session de janvier 2010 (1re session, 1er semestre) Mention Physique Chimie L3 PC, parcours Sciences physiques et Chimiques Calculettes autorises, Documents non autoriss Rdacteur : P. Rubini

Problme n 1 : 1) On ralise la combustion du butane (C4H10) gazeux dans un excs de dioxygne temprature et pression fixes. Dans les conditions exprimentales adoptes, il se forme du dioxyde de carbone gazeux et de leau liquide. Sachant que la combustion de 10 g de butane dgage 495,8 kJ, 298 K sous un bar, proposer une valeur de lenthalpie de combustion du butane gazeux. 2) Calculer, 298 K, la valeur de lenthalpie standard de la raction de dshydrognation du butane en but-1-ne (CH3-CH2-CH=CH2) sachant que celle de lenthalpie standard de formation du but-1-ne est gale -0,13 kJ.mol-1. 3) En utilisant les donnes relatives aux nergies de liaison, calculer la valeur de lenthalpie standard de la raction de dshydrognation du butane en butadine (CH2=CH-CH=CH2). On trouve dans la littrature une valeur de 238,70 kJ.mol-1 pour cette mme opration. Proposer une explication justifiant lcart avec la valeur calcule prcdemment. Donnes : Les gaz sont supposs possder le comportement des gaz parfaits. R = 8,32 J. K-1. mol-1 C = 12 g.mol-1 H = 1g.mol-1 Enthalpies standard de raction 298 K C solide + O2 gaz = CO2 gaz fHa = -394 kJ.mol-1 H2 gaz + 0,5 O2 gaz = H2O liquide fHb = -285 kJ.mol-1 Energies de liaison liaison Energie de liaison kJ.mol-1 C-C 345 C=C 610 C-H 414 H-H 435

Problme n 2 : Dans le modle du mlange simple, le coefficient dactivit de lun des constituants dun systme binaire sexprime en fonction de la fraction molaire de lautre constituant selon : 2 ln1 = 1 x2 + 1 x 2 ln2 = 2 x1 + 2 x 1 2 o 1, 2, 1 et 2 sont des paramtres fonction de la temprature (ln : logarithme nprien) 1) Quel est ltat de rfrence choisi pour valuer les activits ? 2) Montrer que les quatre paramtres ne sont pas indpendants et que les expressions des coefficients dactivits T et P constants se rduisent : 2 ln1 = x 2 et ln2 = x 1 (on utilisera la relation de Gibbs-Duhem). 2 3) On tudie maintenant le systme cadmium-zinc. On donnera lindice 1 Cd et lindice 2 Zn. a) tude du mlange liquide.

On donne la pression partielle de vapeur du zinc au-dessus de mlanges liquides de diffrentes compositions 950 K. x2 P2 (mmHg) 0,2 15,9 0,4 24,0 0,5 26,8 0,6 29,4 1 41,7

Montrer que la solution constitue un mlange simple. b) diagramme de cristallisation

Prciser la signification des diffrents domaines de ce diagramme. Dcrire les phnomnes observs lors du refroidissement, composition globale constante, de deux solutions caractrises par : 0 < x2 < x A et x A < x2 < x E 2 2 2 Tracer les diagrammes thermiques correspondants.

Problme n 3 La rfrence des potentiels standards est celui de llectrode standard hydrogne mettant en jeu la raction suivante : 1 + H aq + e- = H2 (g) 2 En se fondant sur la dfinition du potentiel chimique standard des ions en solution, dire si cette lectrode est ralisable exprimentalement. Conclusion ?

UNIVERSITE HENRI POINCARE NANCY 1 FACULTE DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN

DIPLOME: LSV L3 Epreuve de: LCVI 5U01 Physiologie Animale Session de: janvier 2010 Date : 06 janvier 2010 Horaire: 13h30 15h30

Dure du sujet : 2 heures Nom du rdacteur : Xavier COUSIN Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

Contrle terminal - Cours magistral


Question 1 (6 points) La progression du chyme dans le tube digestif est assure par des contractions coordonnes des muscles lisses longitudinaux et circulaires de la paroi intestinale. Cette coordination est assure en grande partie par le plexus nerveux dAuerbach. Faites un schma clair des connexions nerveuses de ce plexus et expliquez son fonctionnement. Question 2 (3 points) Comment la trypsine excrte sous forme inactive (trypsinogne) par le pancras est-elle active afin de jouer son rle denzyme protolytique dans la lumire intestinale ? Question 3 (3 points) Dcrivez un systme thorique dchange de chaleur contre courant et un systme contre courant en U . Quelles structures anatomiques peuvent prsenter une disposition permettant de tels changes ? Donnez quelques exemples de structures de ce type participant la rgulation des changes thermiques chez des endothermes.

Il sera tenu compte de la prcision et de la clart de vos rponses et de la prsentation de vos schmas (3 points)

Contrle terminal Travaux dirigs


Question 1 (2 points) Dans le film qui vous a t projet au cours des travaux dirigs, quelle enzyme est compare une balle de tennis ? Quel phnomne cette comparaison permet-elle dexpliquer ? Suite au verso

Question 2 (3 points) Reportez sur votre copie dexamen le nom de chaque structure anatomique reprsente ci-dessous, associ au numro indiqu sur le schma. Le foie : vue anatomique de la face infro-postrieure

13

14

15

1 2

3 4 5 6

7 11 12 10 9 8

Intitul de lpreuve : LSV3 UE 5.02


Fonctions vitales chez les animaux

Rdacteurs du sujet : D CHARDARD S KUNTZ Dure de lpreuve : 2 heures Documents autoriss : non Calculatrice : non

Janvier 2010 Anne : 2009/2010

Les 2 sujets sont traiter sur des copies spares


SUJET DE COURS (50% de lUE, dure conseille 1h20) Vous traiterez les deux questions ci-dessous : le plan, les illustrations et la rdaction seront pris en compte dans la notation. 1- Comparez et opposez les systmes respiratoires des oiseaux, des poissons et des mammifres. En quoi les performances du systme respiratoire des oiseaux et des poissons peuvent elles apparatre suprieures celles des mammifres lorsque la concentration en oxygne est faible ? (12 pts) 2- A partir dexemples pris chez les plathelminthes, les annlides, les insectes et les vertbrs, vous expliquerez rapidement mais prcisment pourquoi lappareil circulatoire est, suivant les cas, indispensable ou non. (8 pts)

SUJET DE TD (30% de lUE, dure conseille 40 min) Identifiez les diffrents crnes suivants (A F). Dterminez la formule dentaire, le rgime alimentaire et prcisez les caractristiques des dents labiales et/ou jugales en recopiant et compltant le tableau ci-dessous.
Formule dentaire Crne A Crne B Crne C Crne D Crne E Crne F Rgime alimentaire Espce Caractristiques des dents labiales et/ou jugales

(A)

(B)

(C)

(D)

(E)

(F)

Diplme : Licence SV (L3 parcours BO)


UE 5.03 Biologie Evolutive

Session 1 2009- 2010

Nom des rdacteurs : C. Bontemps et S. Chauchard Dure totale de l'preuve : 1H30 Dure de chaque sujet : 45 minutes Documents et calculatrices interdits

Sujet de Cyril Bontemps (45 min) NB:

Rendre les sujets de C. Bontemps et de Sandrine Chauchard sur copies spares


Justifiez les rponses, mais restez concis !

1) Parmi ces arbres, lesquels sont identiques ?

A
1 2 3 4 5

B
4 2 5 3 1

C
4 1 3 5 2

D
4 5 3 2 1

E
5 3 1 2 4

F
2 3 4 5 1

2) Dans le cadre d'une construction d'arbre par maximum de parcimonie, diffrentes combinaisons d'tats de caractres (XYW) ont t reportes sur des arbres non enracins construits avec 5 taxons. 2.1) Expliquer brivement le principe de la mthode de maximum de parcimonie. 2.2) Pour chacune des positions prsentes ci-dessous, indiquer si elles sont informatives ou non (note: pour chaque position, toutes les rpartitions possibles ont t indiques). Votre rponse devra tre justifie l'aide de schmas o seront reportes les diffrentes mutations expliquant l'arbre, le nombre total de mutations, ainsi que les tats de caractres aux trois nuds de l'arbre.
position1
X X X X Y X

position2
X X Y X Y X X X X

position3
X Z Y X Z X X Y Y X Y X

3) La phylognie des bonbons et des barres base de chocolat est prsente sous forme d'arbre non enracin dans la figure 1. Les diffrents taxons et les tats de certains caractres sont prsents dans le tableau suivant: Tableau : Rpartition des tats de diffrents caractres chez les taxons considrs taxon caractre Chocolat (Ch) Caramel (Cr) Cacahute (Cc) Mars + + Twix + + Toblerone + + M&Ms + + Snickers + + + + = prsence du caractre - = absence du caractre Abrviations: Ch=Chocolat, Cr=Caramel, Cacahute=Cc, Biscuit=Bi

Biscuit (Bi) + -

Twix Mars Toblerone


Figure 1 : Phylognie des bonbons et barres chocolates

M&Ms

Snicker s

L'enracinement de l'arbre est effectu par le taxon Skittles, des bonbons aux fruits non chocolats. Cet enracinement permet clairement de dterminer que les Mars et les Twix sont plus apparents entre eux et forment un groupe plus loign des autres taxons. 3.1) A quoi sert une racine en phylognie? 3.2) Dessiner l'arbre enracin. 3.3) Donner la dfinition d'un groupe monophyltique. Reprsenter sur l'arbre tous les groupes monophyltique d'au moins trois taxons l'aide d'un cercle (on ne tiendra pas compte de la nature des tats de caractres pour cette question). Le dernier anctre commun toutes les friandises chocolates possdait le caractre caramel, mais pas les caractres cacahute et biscuit. 3.4) Quelles sont respectivement la nature des tats de caractres partags cacahute, caramel et biscuit pour les organismes qui les possdent (synapomorphie, etc) ? Justifiez brivement vos rponses et placer les changements d'tats de caractre sur un arbre (Note: redessiner un ou plusieurs arbres enracins similaires la question 3.2 pour un soucis de clart).

La reproduction et la gntique des barres et bonbons chocolats sont en tout point semblables celles des bactries. De nombreux rsultats palontologiques et molculaires ont confirm la topologie d'arbre de la question 3.2. Nanmoins, les Mars, Twix, Snickers et Toblerone ont une forme de barre

tandis que les Skittles et les M&Ms ont une forme de bille. Chez les chocolats, le gne forM en copie unique, code lui seul pour la forme. La phylognie du gne forM, est prsente dans la figure 2. 3.5) Quelle hypothse et scnario volutif permettent d'expliquer l'incongruence de la phylognie du gne forM avec celle obtenue prcdemment?

Skittles M&Ms Twix Mars Toblerone Snickers Loukoum Fig 2. Phylognie du gne forM enracin par le groupe externe loukoum.

UNIVERSITE HENRI POINCARE, NANCY I FACULTE DES SCIENCES SUJET D'EXAMEN

DIPLOME : Licence 3 Epreuve de : UE 5.03 Biologie volutive Session : - 1re session S5 - Janvier 2010 Date : Horaire :

Dure du sujet : 1h30 heures Nom des rdacteurs : Sandrine Chauchard et Cyril Bontemps Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

SUJET DE S. CHAUCHARD ( traiter sur une copie spare, dure : 45 mn) : Question 1 (10 mn) : Dans une tude phylogographique, quelles caractristiques un marqueur gntique appropri doit-il avoir ? Vous donnerez des exemples. Question 2 (35 mn) : De Boer et Duffels (1996) ont tudi la rpartition gographique des Cigales (cicadas, hymnoptre) au sein de larc des les de louest pacifique en relation avec lhistoire gologique de la zone. Et notamment, les espces de cigale appartenant la sous-tribu des Cosmopsaltriaria. Cette sous-tribu englobe les genres suivant (Aceropyga, Brachylopbopyga, Cosmopsaltaria, Diceropyga, Dilobopyga, Maona, Rhadinopyga, et nouveau genre non dcrit). A partir des figures 1, 2, 3, 4 et de lencadr 1, retracez les vnements volutifs ayant conduits la spciation chez les cigales du Pacifique. Vous argumenterez votre rponse en vous appuyant sur les dites figures

Nord Molucas Nord de la Nouvelle Guine Archipel de Bismarck

Sud Molucas Centre de la Nouvelle Guine Sud de la Nouvelle Guine Pninsule papoue

Figure 1 : Distribution de la sous-tribu Cosmopsaltriaria et du genre prsum frre Meimuna.

Figure 2 : Zone dendmisme de larc des les de louest pacifique

Encadr 1 : Synthse de lhistoire gologique de larc des les pacifiques de louest de lAsie.

La migration de la plaque pacifico-australienne vers la plaque asiatique ont entrain une subduction (glissement de la plaque pacifico-australienne sous la plaque asiatique). Cette subduction sest accompagne dvnements volcaniques qui ont conduit la cration de larc des les de louest pacifique. La poursuite du glissement de la plaque pacifico-australienne a entrain un rapprochement entre larc des les de louest pacifique nouvellement form et lAsie. La collision sest opr il y a environ 40-42 million danne. Cette collision a entrain la fracture de larc. Les tapes de cette fracture peuvent tre rsumes par un cladogramme gologique (Figure 3).
Asie de lest Centre des Phillipines Nord + est Sulawesi Arc Sepik Pninsule papoue Pninsule papoue Guine Nord de la Nouvelle Finisterre Archipel de Bismarck Salomon Figure 3 : Cladogramme gologique prsentant la squence de fragmentations de larc.

Les les Vanuatu, Fiji, Tonga et une partie des les Salomon, qui dans leurs configurations prsentes semblent tre la continuation de larc, ont en ralit une origine diffrente. Ses les se serraient dveloppes partir de la cte australienne et forme aujourdhui ce que lon appelle larc des les du sud-ouest du Pacifique.

Asie du sud est Centre de la Nouvelle Guine Bismarck, arc des les du sud-ouest du Pacifique

Pninsule papoue

Figure 4 : Cladogramme du genre Meimuna et des genres de la sous-tribu Cosmopsaltriaria.

UNIVERSITE HENRI POINCARE, NANCY I FACULTE DES SCIENCES


SUJET DEXAMEN

Diplme : Licence Sciences du Vivant Dure du sujet : 2 heures Mentions : Biologie cellulaire et Physiologie Nom des rdacteurs : BECUWE et Biochimie-Biologie molculaire GRANDEMANGE Epreuve de Biologie cellulaire animale (UE 5.04) Session de : Janvier 2010 Date : Horaire : [ ] Documents autoriss [ X] Documents non autoriss [ X] Calculatrices autorises [ ] Calculatrices non autorises

Sujet de Cours et de Travaux Dirigs : Il sera tenu compte de la prcision et la logique dans les rponses ainsi que de lorthographe. Au cours du cycle cellulaire, plusieurs points de contrle permettent de maintenir lintgrit du gnome en empchant la transmission aux cellules filles dun ADN altr. Des dfauts de ces points de contrle contribuent au dveloppement de divers types de mutations ou de rarrangements chromosomiques pouvant induire la tumorigense. Lorsquil ya des altrations de lADN, les cellules normales sont bloques aux points de transition du cycle cellulaire jusqu ce que lADN soit rpar. Dans le cas de dommages non rparables, les cellules peuvent tre forces quitter dfinitivement le cycle voire dentrer en apoptose. Ainsi ces cellules ne se divisent plus. Des fibroblastes humains normaux (NHF) en culture sont exposs deux agents gnotoxiques : ICRF-193 (Ic), un inhibiteur de topoisomrase II et la blomycine (Bl), qui cause des cassures des brins dADN. 1- Dans une premire exprience, le pourcentage de cellules en mitose est valu dans des conditions traites (Ic ou Bl) ou non (Ct) (Figure 1). 1-1 Quels sont ces points de transition du cycle cellulaire et citez les acteurs molculaires mis en jeu ? 1-2 Analysez et interprtez cette figure ?

2- Pour mieux comprendre, leffet de la blomycine et de ICRF-193 sur la progression du cycle cellulaire, les fibroblastes en culture, non synchroniss mais en phase de croissance, sont exposs pendant des temps variables (3, 6, 12, 24h) ces deux drogues puis sont analyss par cytomtrie de flux. 2-1 Dcrivez le protocole exprimental de marquage ralis avant lanalyse des chantillons en cytomtrie de flux ? 2-2 Dcrivez le principe de la cytomtrie de flux ? 2-3 En comparant les cellules traites pendant 24h aux cellules contrles (0h), pouvez vous dterminer quelles sont la ou les phase(s) du cycle cellulaire affecte(s) par ces drogues ?

Rem : Hours after treatment = heures aprs traitement

3- Pour tudier plus spcifiquement leffet de lICRF et de la blomycine, les auteurs ont ralis partir dextraits de cellules contrles (Ct) ou de cellules traites (Ic et Bl), des immunoprcipitations avec un anticorps anti-cycline B1 (cyc B1) ou un anticorps anti-cycline A (cyc A). Ils ont ensuite mis en vidence la cycline B1 ou la cycline A ainsi que CDK1 ou CDK1/2 dans ces immunoprcipits par western blot et analys lactivit kinase de lhistone H1 des immunoprcipits (appele sur la figure 3 H1 kinase). 3-1 Commentez le choix des cyclines tudies par rapport vos connaissances du cours ? 3-2 Que met en vidence ces immunoprcipitations, suivies par des western blots ? 3-3 Quelles conclusions pouvez vous proposer ?

4- Les niveaux dexpression de p53 et de p21 prsents dans les cellules traites ou non sont analyss par western blot (Figure 4A). Les lysats de cellules traites (Ic et Bl) ou non (Ct) ont ensuite t immunoprcipits avec un anticorps anti-p21 (p21 IP), et les immunoprcipits ont enfin t analyss par western blot avec les anticorps suivants : cyc B1, cyc A, Cdk1, Cdk2, p21 (Figure 4B). 4-1 Pourquoi avoir choisi danalyser ces deux protines p21 et p53 ? 4-2 Analysez et interprtez les figure 4A et 4B ? 4-3 Proposez une hypothse concernant le mcanisme de blocage du cycle par lICRF-193 et la Blomycine ?

NANCY UNIVERSITE UNIVERSITE HENRI POINCARE- FACULTE DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN
DIPLOME : Licence SVS L3S5 Parcours Biochimie-Biologie Molculaire Biologie cellulaire et molculaire et Physiologie Dure conseille pour rpondre au sujet : 60 min Nom du rdacteur : B. Charpentier

Epreuve de : CM, UE 5.05 Biologie Molculaire II, les machines molculaires de rplication, transcription et traduction Documents non autoriss Session de : Janvier 2010 (S5) Date : /01/2010 Calculatrice non autorise Horaire : - h -

LES SUJETS DE CETTE UE SONT A REDIGER SUR DES COPIES SEPAREES Illustrez et expliquez les affirmations qui suivent (2.5 points chacune). 1: Deux classes de topoisomrases contrlent la topologie de lADN. 2 : Des liaisons 3-5 phosphodiester sont formes lors de la polymrisation des acides nucliques. 3 : Lors de la progression de la fourche de rplication, un des brins est rpliqu de faon discontinue. 4 : Plusieurs types de polymrases interviennent lors de la rplication bactrienne. 5 : La tlomrase catalyse la synthse des squences des tlomres lextrmit des chromosomes. 6 : Lassemblage du complexe dinitiation de la transcription par lARN polymrase II est squentiel. 7: En regard des ARNm bactriens, les ARNm eucaryotes possdent des extrmits particulires. 8 : Llimination des squences introniques fait intervenir des particules ribonucloprotiques snRNP.

NANCY UNIVERSITE UNIVERSITE HENRI POINCARE- FACULTE DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN
DIPLOME : Licence SVS L3S5 Parcours Biochimie-Biologie Molculaire Biologie cellulaire et molculaire et Physiologie Dure conseille pour rpondre au sujet : 60 min Nom du rdacteur : C. Jacob

Epreuve de : TD, UE 5.05 Biologie Molculaire II, les machines molculaires de rplication, transcription et traduction Documents non autoriss Session de : Janvier 2010 (S5) Date : /01/2010 Calculatrice non autorise Horaire : - h -

LES SUJETS DE CETTE UE SONT A REDIGER SUR DES COPIES SEPAREES Une attention toute particulire devra tre apporte l'orthographe et la prsentation de la copie, ainsi qu' la concision, la justification et la clart des rponses.

L'article d'Imanishi et al. (2000) servira de support ce sujet. Cet article tudie les mcanismes de rgulation impliqus dans la coopration de l'IFN- (interfron) et TNF- pour promouvoir la transcription d'IRF-1 (human IFN Regulatory Factor-1). IFN- et TNF- sont des cytokines qui ont des effets pliotropes (inflammation, hmatopoise). La cascade de signalisation induite par IFN- se traduit par la fixation d'une protine au niveau d'une squence ADN spcifique appele GAS (IFN- activation site). La cascade de signalisation induite par TNF- se traduit par la fixation de la protine NF-B au niveau d'une squence ADN spcifique appele lment B. Ces deux squences d'ADN se retrouvent au niveau du promoteur du gne IRF-1, mais les auteurs suspectent l'existence d'une squence d'ADN non identifie qui permettrait une induction d'IRF-1 par les 2 facteurs IFN- et TNF-.

1re partie : tude la transcription d'IRF-1

Figure 1 : A) Les ARN totaux sont isols de cellules AS-E2 soit non stimules (piste 1) ou stimules par IFN (piste 2), TNF- (piste 3), ou les deux (piste 4) pendant 3h et sont hybrids avec une sonde IRF-1 (audessus) ou -actine (au-dessous). B) Les taux d'ARNm IRF-1 ont t quantifis par densitomtrie et normaliss par rapport aux signaux -actine. Le graphe montre l'abondance relative des ARNm IRF-1 induits aprs stimulation avec IFN-, TNF- ou les 2 cytokines.

Question 1 : Aprs avoir nomm l'exprience dont les rsultats sont prsents sur la figure 1A, vous en rappellerez les principales caractristiques (gel utilis pour la sparation des chantillons, sonde utilise, applications). Question 2 : Commentez les rsultats prsents sur la figure 1. Quelle conclusion pouvez-vous en tirer ? Question 3 : Quelle autre hypothse pourriez-vous envisager pour expliquer les variations des taux de transcrits ?

2me partie : tude de la fixation de facteurs dans la rgion promotrice d'IRF-1

Figure 2 : Analyse d'empreinte la DNaseI avec des extraits nuclaires de cellules non stimules ou stimules avec l'IFN- et le TNF-. Les profils de protection la DNaseI pour le brin codant (pistes 1-13) et pour le brin non-codant (pistes 14-26) avec aucune protine (pistes 1, 4, 7, 10, 13, 14, 17, 20, 23 et 26) et 45 g (pistes 2, 5, 8, 11, 15, 18, 21 et 24) ou 90 g (pistes 3, 6, 9, 12, 16, 19, 22 et 25) d'extraits nuclaires prpars partir de cellules non stimules (pistes 2, 3, 15 et 16) ou stimules par l'IFN- (pistes 5, 6, 18 et 19), TNF- (pistes 8, 9, 21 et 22) ou les deux (pistes 11, 12, 24 et 25) pendant 3h sont montrs. Les rgions protges de la digestion par la DNaseI sont indiques sous forme de rectangles blancs.

Question 4 : Rappelez les objectifs et le principe de la technique d'empreinte la DNaseI, ainsi que les pr-requis. Quels renseignements apporte-t-elle ? Question 5 : Commentez les rsultats prsents sur la figure 2. Est-ce qu'un facteur protique se fixe au niveau de la rgion tudie ? Existe-t-il une stimulation pour la fixation de ce facteur ?

3me partie : identification de ces facteurs Les cascades de signalisation induites par les deux facteurs IFN- et TNF- sont connues. Question 6 : quelle(s) autre(s) exprience(s) pourriez-vous mettre en uvre afin d'identifier une interaction entre la rgion prcdente et une protine connue ? Vous en rappellerez les caractristiques principales. Question 7 : Comment s'assurer de la spcificit de l'interaction ? Vous en prciserez la mise en uvre.

NANCY UNIVERSITE Facult des Sciences et Techniques DIPLOME : Licence Sciences du Vivant Epreuve de : L.S.V. 5U.06 CM Session de : 1re session janvier 2010 Date : Horaire :

SUJET DEXAMEN Dure du sujet : 1 heure Nom des rdacteurs : Y Jolivet Documents autoriss : Non Calculatrices autorises : Non

Sujet CM dure conseille : 1h

1. Dans le cytosol, la phosphofructokinase ATP-dpendante est une enzyme importante :


- rappeler la raction catalyse par cette enzyme - que savez-vous de la rgulation de son activit dans la cellule vgtale ? (8 points)

2. Prciser ce que lon considre par la coordination entre lactivit de la


phosphonolpyruvate carboxylase et la voie anaplrotique au cycle de Krebs. (6 points)

3. Le nom de Mitchell est associ un processus dont le sige peut tre la mitochondrie.
Vous rappelerez brivement le processus impliqu et les consquences pour la cellule. (6 points)

Sujet D. Grant (1h)

preuve de TD LSV3 UE 5.06

Lassimilation (A) du CO2 par des feuilles de plante de type C3 a t mesure en fonction : * de la concentration interne en CO2 (Ci), en conditions dclairement ou densit de flux quantique constant (figure 1, ne pas tenir compte de la relation entre A et Ca) * de la concentration interne en CO2 (Ci), en conditions dclairement variable (figure 2) * de lclairement, en conditions de concentration interne en CO2 (Ci) constante (figure 3). 1. Prciser et schmatiser lorigine mtabolique des changes de CO2 existant gnralement dans les cellules foliaires de plante de type C3. 2. Quels paramtres peut-on dcrire partir de chacune des trois figures ? Les efforts de concision et de synthse seront pris en compte dans la notation. Figure 1 Figure 2 Figure 3

Ci en ppm (parties par million).

NANCY UNIVERSITE Facult des Sciences et Techniques DIPLOME : Licence Sciences du Vivant Epreuve de : L.S.V. 5U.07 TP / TD Session de : 1re session janvier 2010 Date : Horaire :

SUJET DEXAMEN Dure du sujet : 1 heure Nom des rdacteurs : Y Jolivet, M Morel, JC Pireaux Documents autoriss : Non Calculatrices autorises : Oui

Sujet de Y Jolivet / M. Morel / J-C Pireaux - dure conseille : 1h 1) Rappelez les principales caractristiques dun tat 4 et la signification du rapport ADP/O.

2) La figure 1 prsente des rsultats obtenus en tudiant leffet dun herbicide - le 2,4-D (acide 2,4 dichlorophnoxyactique) - sur des mitochondries extraites de tissus frais de tubercule de pomme de terre. Commenter et analyser cette figure. Conclure en prcisant le mode daction du 2,4-D. 3) Indiquer une manipulation qui permettrait de confirmer le mode daction du 2,4-D mis en vidence par la Figure 1. Justifiez votre rponse sans dtailler de faon excessive les mcanismes impliqus dans le test que vous proposez.

200

A
150 Vitesse d'oxydation Rapport ADP/O 1,5

100

50

0,5

0 0 6 12 18 24 30 2,4-D (mM)

0 0 3 2,4-D (mM) 6 9

Fig. 1 A : Effets du 2,4-D sur ltat 4 lors de loxydation du succinate par des mitochondries purifies de tubercule de pomme de terre. Les vitesses doxydations sont exprimes en nmol O2/min/mg de protines. B : Effets du 2,4-D sur le rapport ADP/O lors de loxydation du succinate par des mitochondries purifies de tubercule de pomme de terre. Toutes les manipulations prsentes Fig. 1 ont t ralises en prsence de 70 g de protines mitochondriales.

SUJET DEXAMEN

Diplme : Licence

Dure du sujet : 2 heures Documents non autoriss Calculatrices non autorises

U.E. 5.08 Physiologie du Comportement


Session de : 1
re

session 2009

Les sujets sont traits sur des copies spares.

Sujet M. TRABALON (20 points, 1 h conseille). 1 laide dexemples prcis de votre choix, expliquez la diffrence entre adaptation et acclimatation dans le cadre dune tude en physiologie du comportement. 2 Dcrivez de manire prcise 3 adaptations qui permettent au phoque de Weddell de demeurer sous leau beaucoup plus longtemps quun humain. Sujet C. GILBERT (20 points, 1 h conseille). Question 1. 8 points Quest-ce que la notion de balance ou dquilibre nergtique ? Quels sont les diffrents postes dapports et de dpenses de cette balance ? Expliquez brivement. Quels peuvent tre les impacts directs de lenvironnement sur les postes dapport et de dpense de cette balance ? Quelles peuvent tre les rponses des organismes en terme de stratgie dallocation nergtique face un environnement dfavorable ? Question 2. 2 points Quelle(s) mthode(s) de mesure de dpense nergtique utiliseriez-vous pour : - comparer la dpense nergtique dune souris expose des tempratures ambiantes de 25C et 20C ? - mesurer la dpense nergtique dun manchot royal en incubation sur la colonie ? - mesurer la dpense nergtique dun manchot Adlie au cours dun voyage alimentaire pour nourrir son poussin ? - mesurer la dpense nergtique dun gorille de montagne dans son milieu naturel ? Question 3. 10 points

Les rats-taupes nus, ou rats-taupes glabres (Heterocephalus glaber, famille des bathyergidae) sont des rongeurs habitant les zones arides de lAfrique de lEst (Ethiopie, Kenya, Somalie).

Rats-taupes nus

Rseau de galeries souterraines

Ce sont des rongeurs dont la taille adulte est denviron 10 cm, leur masse corporelle tant de 30-40g environ. Comme leur nom lindique, ils sont presque totalement dpourvus de poils. Ils ont une vie strictement souterraine, creusant des galeries la recherche de racines charnues de plantes. Ils possdent plusieurs particularits tout fait originales parmi les mammifres. Ils vivent en colonies, rassemblant une cinquantaine de membres, organises de la mme faon que celle des insectes eusociaux, comme les fourmis ou les abeilles sociales. Ils sont organiss en castes, un individu femelle tant la reine, fconde par quelques mles reproducteurs. Les autres individus, les ouvriers, participent toutes les tches assurant la survie du groupe : creusement des galeries, soins aux jeunes, dfense du groupe contre les prdateurs... Une autre particularit de ces animaux est leur incapacit maintenir leur temprature interne constante : celle-ci fluctue en fonction des faibles variations de la temprature de leurs galeries souterraines. Ils sont capables cependant de produire de la chaleur via leur tissu adipeux brun. 1. Dfinir les notions dendothermie, ectothermie et htrothermie. Les rats-taupes sont-ils endothermes, ectothermes, ou htrothermes ? 2. En fonction de votre rponse, prciser en quoi ceci est adapt leur environnement ? 3. Quelles sont les causes des dperditions thermiques majeures de ces mammifres ? 4. Quelles sont alors votre avis les adaptations permettant aux rats-taupes nus de minimiser les fluctuations de leur temprature interne ? Expliquer.

Epreuve de : UE 5.09 - virologie Contrle terminal janvier 2010 Dure du sujet : 1h00

Nom du rdacteur : V. Libante Documents non autoriss Calculatrices non autorises

Le virus de la Mosaque du Tabac 1) Gnome viral a- Fonction des gnes cods par le gnome du VMT. b- Dcrire la stratgie de compaction du gnome du MTV, expliquer en quoi cest une stratgie de compaction. 2) Dcrire brivement les 6 tapes du cycle de rplication du VMT en mettant en valeur les particularits de linfection des plantes.

Epreuve de : UE 5.09 - virologie Contrle terminal janvier 2010 Dure du sujet : 1h20 Contrle continu : Question 1 Dfinir ce quest un bactriophage.

Nom du rdacteur : V. Libante Documents non autoriss Calculatrices non autorises

Question 2 Lgender le document 1. Pour cela reportez sur votre copie les n figurant sur le document et prcisez ce quoi ils correspondent.

1 2 3 4 5 6 7 8

Document 1 : le VIH

Question 3 Quelles cellules humaines peuvent tre infectes par le VIH ? Pourquoi ce virus est-il spcifique de ces cellules ? Question 4 Le VIH appartient une famille particulire de virus, donnez le nom de cette famille et ses particularits.

Contrle terminal : Le virus de la Mosaque du Tabac 1) Fonction des gnes cods par le gnome du VMT. 2) Dcrire brivement les 6 tapes du cycle de rplication du VMT en mettant en valeur les particularits de linfection des plantes.

Universit H. POINCARE Facult des Sciences et Techniques Licence SV 3 / S 5 - UE 5.10 Dure 120 mn Session de janvier 2010 (pas de documents autoriss)

3 SUJETS A TRAITER SUR 3 COPIES SEPAREES


Sujet de G. Jacquemin 40 mn (contrle final) Question 1 (20 mn) Commentez les 3 graphiques ci-dessous. Qu'illustrent-ils?

graphique 1: ge de maturit de l'Elphant d'Afrique en fonction du nombre d'individus au km2

2
graphique 2: pourcentage de femelles gestantes chez le cerf, en fonction du nombre d'hectares disponible par individu

3
graphique 3: nombre d'ufs pondus par jour et par femelle de Drosophile, en fonction du nombre d'adultes par flacon d'levage.

Question 2 (20 mn) Donnez, en 40 lignes maximum, une description cologique concise de la rgion lorraine. Vous voquerez bien sr biotopes et biocnoses.

Sujet de S. Chauchard 50 mn (contrle final)


Exercice 1 (10 mn) : Dfinissez le terme richesse spcifique ? Quelles sont les limites de cette approche de la diversit ? Quelles approches complmentaires peuvent tre proposes ? Exercice 2 (25 mn) : Des scientifiques ont suivi le taux de survie des agneaux sous diffrentes densits de population de moutons primitifs (non-domestiqus) sur lle de Hirta. Les rsultats obtenus sont prsents dans la figure 1. 1) Vous dcrirez cette figure et mettrez des hypothses concernant les processus cologiques pouvant aboutir de tels rsultats. 2) Quel type de modle pourrait tre utilis pour dcrire laccroissement de cette population au cours du temps si on met lhypothse que le taux de reproduction est constant au cours du temps ?
Densit de population (nombre dindividus) Taux de survie des agneaux

3) Toujours

sous

cette

hypothse

vous

donnerez, en justifiant votre rponse, une estimation de la capacit de charge du milieu (K).

Figure 1 : Taux de survie des agneaux (Ovis aries) dans lle de Hirta en relation avec la densit des adultes : femelle (trait plein), mle (trait pointill).

Exercice 3 (15mn) : Une tude portant sur la prdation des lagopdes dEcosse par le busard SaintMartin a permis destimer le nombre de lagopdes tus en fonction de la densit de lagopdes disponibles. Les rsultats sont prsents dans la figure 2. 1) Dcrivez brivement la figure 2 et interprtez les rsultats. 2) Sachant quaucune augmentation du nombre de prdateurs (busard) na t observe pendant la dure de ltude, argumentez sur le type de rponse de la population de prdateurs laugmentation du nombre de proies (lagopde).
Densit de Lagopdes (nombre dindividus/km) Nombre de lagopdes consomms/heure

Figure 2 : Rponse de la prdation par les busards laugmentation du nombre de lagopdes dans le milieu.

Sujet de D. Silva 30 mn (contrle continu)


Les documents suivants sont issus dun catalogue des stations forestires du plateau lorrain ralis par lInstitut National de la Recherche Agronomique et lOffice National des Forts, en 1976. Quatorze groupes cologiques ont t dfinis partir de la description de la vgtation et de sa mise en relation avec des facteurs du milieu tels que lacidit et lhumidit du sol. Ces groupes sont reprsents dans les documents suivants. Nous avons extrait 5 relevs floristiques effectus sur le plateau lorrain. Linformation prsence/absence des espces a t releve, ainsi que lappartenance de chaque espce un groupe cologique. Les auteurs ont par la suite annex des tudes physicochimiques du sol de chaque relev et reprsent la coupe pdologique correspondante (profil de sol). A laide des documents et en slectionnant uniquement les informations utiles votre rflexion, - Reprsentez sous forme de tableau(x) lvolution des conditions stationnelles indiques par la composition floristique pour les relevs 1 5. - Dcrivez cette volution sur le gradient des 5 relevs en 10-15 lignes environ et en utilisant le(s) tableau(x) prcdemment construit(s) ainsi que certaines informations des descriptions de stations.

UNIVERSITE HENRI POINCAR, NANCY UNIVERSITE FACULT DES SCIENCES

SUJET D'EXAMEN Dure du sujet : 1h15 min CM, 45 min TD Nom du rdacteur : Lionel Domenjoud

Diplme : Licence Mention : Sciences du vivant Epreuve de : UE 5.11 Cours et TD Biologie molculaire des cellules eucaryotes Session de : Janvier 2010 Date : Horaire :

[ ] Documents autoriss [X] Documents non autoriss [ ] Calculatrices autorises [X] Calculatrices non autorises

La rgulation de la transcription (sujet de cours) La transcription des eucaryotes est rgule autant par ltat de la chromatine que par les facteurs de transcription qui se fixent sur lADN. Quels mcanismes connaissez vous qui sont responsables de lactivation/inactivation de la chromatine et des facteurs de transcription? Illustrez votre propos laide dexemples de votre choix ?

Sujet de TD Remarque : Nhsitez pas faire des schmas sur votre copie si cela vous parat ncessaire et dcouper celles du sujet que vous collerez sur votre copie si cela aide la comprhension. Exercice 1 : Les endonuclases de restriction de type II sont utilises lors du clonage de fragments dADN. Voici les notations simplifies des sites de restriction de diffrentes enzymes. BamH1 G/GATCC, EcoR1 G/AATTC, PvuII CAG/CTG, Kpn1 GGTAC/C, Sma1 CCC/GGG, Pst1 CTGCA/G, Hind3 A/AGCTT, Question 1 : Pouvez vous regroupez ces enzymes de restriction en trois classes en expliquant les types dextrmits produites par chacune de ces trois classes ? Question 2 : Choisissez une enzyme reprsentative de chacune des trois classes et donnez la notation complte de son site de restriction, en faisant bien figurer la faon dont elle coupe. Exercice 2 : Les 250 paires de bases des rgions promotrices proximales dun gne X (pb -250 +1) ont t clones pour produire ce fragment en quantit suffisante et lui appliquer la technique dempreinte la DNase (DNase I footprinting). La figure 1 vous montre le rsultat de lapplication de cette technique. Le dpt 1 correspond une absence dextrait protique contenant des facteurs de transcription. Les dpts 2 5 correspondent des quantits croissantes dun extrait protique contenant des protines nuclaires. Le dpt 6 correspond une raction de squenage o seules les positions des nuclotides A et G sont visualises par une bande radioactive, les grands blancs entre les bandes noires correspondant des positions occupes par des nuclotides C et des T mais que lon ne voit pas sur ce type de squence.

Question 3 : Vous expliquerez le principe de la technique dempreinte la DNase en insistant sur ce qui vous parat essentiel. On utilise du 32P dATP pour le marquage de lADN ? Pouvez vous expliquer de quoi il sagit ? Question 4 : Vous analyserez le rsultat de la figure 1 et direz ce que cette exprience vous apprend.

Figure 1

Figure 2

Un oligonuclotide double brin correspondant la rgion 180 -200 du gne X a t synthtis et marqu au phosphore 32 (32P*), pour le soumettre une exprience de retard de migration sur gel en prsence de concentrations croissantes du rcepteur des strognes, comme on le voit dans les dpts 1 4 de la figure 2. Question 5 :

Vous expliquerez le principe de la technique du retard de migration sur gel. Question 6 : Vous analyserez les rsultats de la figure 2. Vous expliquerez quoi correspondent les diffrentes bandes que vous voyez alors que lon a mis une solution de molcules dun seul facteur protique. Ce type dexprience nous apporte-t-il des renseignements supplmentaires par rapport aux rsultats de la figure 1?

Diplme : Licence SV (L3 parcours BO) Dure totale de l'preuve : 2H00 UE 5.12 Systmatique et diversit des Nom des rdacteurs : Claire Fourrey et Cyril Bontemps Procaryotes et des Champignons Session 1 2009- 2010 Documents et calculatrices interdits NB:

Rendre les sujets de C. Fourrey et C. Bontemps sur copies spares !


Sujet de Claire Fourrey (Dure 30min)
Question 1. Aprs avoir dfini ce quest une synapomorphie, vous citerez et expliquerez celle(s) qui constitue(nt) le nud E4 sur la figure 1. Figure 1. Arbre phylogntique des Ascomyctes

Page 1 sur 3

Sujet de Cyril Bontemps (Dure 1H30) Rendre les sujets de C. Fourrey et C. Bontemps sur copies spares ! Justifiez les rponses, mais restez concis 1) Plusieurs isolats bactriens ont t isols de tissus malades d'un concombre atteint de la maladie du "root mat". Dans un premier temps, les isolats on t regroups en 3 groupes suivant leur phnotype sur bote de Ptri (phnotypes 1, 2 et 3). 1.1) Donner une mthode molculaire permettant de caractriser rapidement les isolats un niveau taxonomique large (phylum ou genre, par exemple). Expliquer sur quels principes repose la technique que vous utilisez. L'analyse molculaire rvle que les bactries du phnotype 1 appartiennent toutes au genre Agrobacterium, celles du phnotype 2 au genre Ochrobactrum et que celles du phnotype 3 appartiennent aux genres Sinorhizobium et Rhizobium. Toutes ces bactries sont des protobactries. 1.2) Que sont les protobactries ? Est-il tonnant de retrouver des protobactries pathognes? Pouvez-vous citer d'autres exemples d'interactions possibles entre bactries et eucaryotes ? 1.3) Comment expliquer que 2 genres bactriens distincts aient t regroups sous un mme phnotype? Toutes les bactries causant la maladie du "root-mat" et caractrises jusqu'alors appartenaient uniquement l'espce Agrobacterium radiobacter. Or, des rsultats supplmentaires suggrent que les isolats d'Agrobacterium pourraient constituer une nouvelle espce distincte d'Agrobacterium radiobacter. 1.4) Quelle approche pourrait-on utiliser pour confirmer que l'on est en prsence d'une nouvelle espce ? Quel en est le principe, les avantages et sur quelles techniques (mesures) repose-t-elle? Les Agrobacterium radiobacter pathognes caractriss auparavant possdaient tous le plasmide Ri contenant l'ensemble des gnes confrant le caractre pathogne du root-mat. Un plasmide identique (100% d'identit) a t retrouv chez l'ensemble de vos souches quelque soit leur genre ou espce. 1.5) Comment expliquer ce rsultat ? Les gnomes bactriens sont gnralement diviss en core gnome et gnome accessoire. 1.6) Expliquer les diffrences entre ces deux notions. A quelle fraction appartiennent les gnes de pathognicit ports par le plasmide Ri ? Pourriez vous utiliser ces gnes de pathognicit pour tenter de dterminer l'appartenance taxonomique de futurs isolats (justifiez) ?

2) Le 12 juillet 2008, une expdition Norvgienne a identifi prs du Groenland une source hydrothermale sous-marine 2350 mtres de profondeur. Ces sources sont caractrises par des chemines d'o s'chappe un fluide sulfur extrmement chaud. Vous disposez au laboratoire d'un chantillon d'eau rcupr au niveau de cette source. 2.1) Comment qualifie-t-on gnralement les organismes pouvant survivre dans des milieux o les conditions de vie seraient mortelles pour la plupart des autres organismes ? Page 2 sur 3

Comment qualifieriez-vous plus prcisment les organismes prsents dans cet chantillon d'eau ? et ceux trouvs dans la banquise 2350 mtres plus haut? Un comptage microscopique de votre chantillon indique que le nombre de procaryotes vivants est 1000 fois plus important que le nombre d'UFC (Units Formant Colonies) estim par comptage sur milieu solide. 2.2) Comment expliquer ce rsultat ? Pour une majorit des procaryotes que vous identifiez, diverses analyses montrent que les squences et structures en sous-units des protines impliques dans la rplication de l'ADN (ADN polymrase) et la transcription (ARN polymrase) sont plus proches de celles des eucaryotes que de celles des bactries. 2.3) Compte tenu de ce rsultat, quel grand groupe d'organisme vos isolats sontils susceptibles d'appartenir?

Page 3 sur 3

LSV 5.13 Gntique fondamentale et molculaire - Session I Pierre Leblond dure conseille 1 h 20
- Rpondez succinctement, les rponses peuvent tenir sur une copie unique

Le rle des acteurs UmuC et UmuD dans la mutagnse spontane est recherch chez Escherichia coli au travers des expriences suivantes. Des mutants spontans de lopron umuCD ont t isols, et prsentent des mutations ponctuelles ou des insertions dans lun ou lautre des 2 gnes. Dans ces expriences, lopron umuDC a t dlt au locus chromosomique et remplac par le gne cat (confrant la rsistance au chloramphnicol) pour donner la souche umuDC595::cat. De plus, cette souche prsente un phnotype dauxotrophie vis--vis de lhistidine [His-]. Question 1 : Rappeler succinctement quel est leffet des mutations ponctuelles sur lexpression dun gne. Question 2 : Rappeler le principe de la ractivation et de la mutagnse de Weigle. Question 3 : Sur quel milieu slectionner les prototrophes issus de la souche umuDC595::cat ? Le taux de survie et la mutagense chez la souche umuDC595::cat ont t mesurs aprs exposition des doses varies de rayonnements ultraviolets (UV, = 254 nm). La mutagnse est value par mesure de la frquence de rvertants [His+] parmi les survivants. La souche umuDC595::cat a t transforme par un vecteur multicopies portant lopron umuDC sous plusieurs formes allliques (umuD+C-, plasmide pRW38 et umuD-C+, plasmide pRW40), et la survie et la mutagnse ont t mesures dans les mmes conditions (tableau cidessous). La souche umuDC595::cat a t galement transforme par le plasmide pRW30 portant les allles umuD+C+.
Souches Souche sauvage (umuD+C+) UV (J / m2) 0 0,5 1 0 0,5 1 0 0,5 1 0 0,5 1 0 0,5 1 Taux de survie 100% 100% 100% 100% 100% 100% 100% 100% 80% 100% 100% 95% 100% 100% 94% Frquence [His+] < 10-7 -6 2,4 x 10 8,2 x 10-6 -7 < 10 < 10-7 0,3 x 10-7 -7 < 10 < 10-7 0.2 x 10-7 -7 < 10 < 10-7 < 10-7 -7 < 10 6,5 x 10-6 1 x 10-5

umuDC595::cat umuDC595::cat/pRW38 (UmuD+C-) umuDC595::cat/pRW40 (UmuD-C+) umuDC595::cat/pRW30 (UmuD+C+)

Question 4 : Quels sont les tmoins de lexprience ? Comment sappelle lexprience de transformation avec le plasmide pRW30 (dernire ligne du tableau) ? Que prouve t-elle ? Question 5 : Interprtez les taux de survie et de mutagense dans les diffrents contextes. Dautre part, la synthse de la protine UmuD et de son driv matur UmuD a t observe dans diffrents contextes pour les gnes recA et lexA; et possdant soit le locus umuDC sauvage (indiques + sur la figure), soit la mutation umuDC595::cat (indiques ). La figure montre la dtection immunologique des protines (UmuD et UmuD) aprs traitement la mitomycine C. Les rsultats concernant UmuC sont analogues (non montrs).
Dtection des protines UmuD et UmuD dans diffrents contextes : + : umuD+C+ : umuDC595::cat Le contexte lexA(Def) est dficient pour la synthse de LexA. La mutation recA730 produit une protine RecA spontanment active en RecA* 30C. La mitomycine C bloque la rplication par la formation de ponts intercatnaires et de cassures dans la double hlice dADN. *Bande de dtection aspcifique

Question 6 : Expliquez le rsultat obtenu dans le contexte sauvage recA+ lexA+ umuC+D+ (piste de gauche). Question 7 : Avec vos connaissances sur le mcanisme dinduction du systme SOS chez E. coli, expliquez les rsultats obtenus dans les souches mutantes recA+ lexA(Def) umuC+D+ et recA730 lexA(Def) umuC+D+.

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES SUJET DEXAMEN Diplme : L3 Science du Vivant Epreuve de : TP-TD UE5.13 "Gntique molculaire" Session de : Janvier 2010 Date : Heure : Dure du sujet : 40 minutes Nom du rdacteur : F. Charron-Bourgoin Documents non autoriss Calculatrices non autorises

La carte suivante prsente 6 dltions reprsentes en pointills (notes de C H) dans les cistrons A et B de la rgion rII du phage T4. cistron A cistron B _________________________________________/_____________________________ C D E F G H 1 2 3 4 Quand Escherichia coli est infect par les diffrentes combinaisons de ces phages avec d'autres phages comportant les mutations 1, 2, 3 et 4, les rsultats suivants sont obtenus: 1 2 3 4 C 0 0 0 0 D R 0 C R E R 0 C 0 F C C R 0 G R R C R H 0 0 C 0 1 0 0 C R ------------------------------------------------------------------------------------------------------------------------------

0: pas de plages de lyse C: complmentation R: prsence de recombinants sauvages 1. A quoi correspond une plage de lyse ? 2. Donner le principe de lexprience de complmentation. 3. Donner le principe de lexprience de recombinaison et en dcrire les principales tapes sans les dtailler. 4. Indiquer la position des mutations 1, 2, 3 et 4 sur la feuille de lnonc. Faire un mme symbole sur la copie et lnonc. Ne pas oublier de justifier la rponse. 5. Quand c'est possible, prciser la nature de ces mutations (en justifiant la rponse), sinon indiquer le test permettant de la dterminer.

UNIVERSIT DE NANCY I FACULT DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN

DIPLOME ......L3. SV................................................ Dure du sujet .....2h....................................................... Epreuves de CM et TP/TD : Diversit et apprentissage du soi (UE 5.14). Session de ......Janvier 2010....................................... Date ......................................................................... Horaire .................................................................... Nom des rdacteurs: FRIPPIAT J.-P., ROPARS A. et. BASCOVE M Documents autoriss Calculatrices autorises
OUI NON (1)

OUI

NON

(1)

(1) Rayer la mention inutile

TRAITER SUR DES COPIES SEPARES LES SUJETS DES DIFFERENTS REDACTEURS Questions de Cours Magistral (dure conseille 1h15):

1- Sujet de J.-P. Frippiat : (30 mn conseills)

Expliquez comment un lymphocyte T cytotoxique reconnat et dtruit une cellule cible.

2- Sujet dA. Ropars : (45 mn conseills)

a) Expliquez les diffrents rles des phagocytes dans la rponse immunitaire

b) Expliquez de faon concise mais prcise la rponse immunitaire observe lors dune infection intracellulaire (vous pouvez faire un schma synthtique)

Questions de TP/TD (dure conseille 45 min) Sujet de M. Bascove : 1) Afin de dterminer par ELISA le titre dun srum dilu 100 fois (au 1/100), un exprimentateur doit faire les dilutions suivantes : 1000, 2000, 7000, 10 000, 20 000, 70 000, 100 000, 500 000 fois. Le volume minimal de chaque dilution est de 500l. Faites le tableau de dilutions en donnant un exemple de calcul.

Pourquoi faire une gamme de dilutions ?

2)

Rappelez et expliquez succinctement les deux mthodes de dtermination du titre dun immun-srum. Laquelle est la plus prcise ? Pourquoi ? (Nhsitez pas faire des schmas)

3)

Quels sont les 2 critres indispensables pour quun dosage avec un anticorps marqu par une enzyme fonctionne ?

4)

Vous disposez dune solution en anticorps anti-BSA purifie, comment vrifieriez-vous que vos anticorps ne croisent pas avec lalbumine de srum dune autre espce ?

LSV 5.15 Mcanismes & consquences des changes de gnes chez les bactries Session I Pierre Leblond dure conseille 1 h 30
- Rpondez succinctement, les rponses peuvent tenir sur une copie

La mise en vidence exprimentale de la comptence naturelle chez les bactries est souvent dlicate ; les conditions de dveloppement de cet tat physiologique particulier tant difficiles rvler. En revanche, lanalyse des gnomes squencs donne un moyen de prdire la capacit dvelopper la comptence en recherchant des gnes codant des protines homologues celles impliques dans la comptence naturelle chez des organismes o le phnomne a t tudi de faon extensive ; cest le cas de Streptococcus pneumoniae (diplocoque). Question 1 : Rappeler le mcanisme de contrle de la comptence naturelle chez Streptococcus pneumoniae. Question 2 : Proposez une stratgie exprimentale permettant de mettre en vidence la comptence naturelle chez une bactrie. Chez Lactococcus lactis, bactrie lactique apparente au groupe des streptocoques, deux sous espces (L. lactis ssp cremoris MG 1363 et L. lactis ssp lactis IL1403) sont utilises en industrie laitire pour la fabrication de produits ferments. Aucun phnomne de comptence naturelle na pu t mis en vidence chez cette espce. En revanche, lanalyse du gnome rvle la prsence dun certain nombre de gnes potentiellement impliqus dans les phases tardives du phnomne comme les gnes comX (codant un facteur de transcription) et dprA (codant une protine implique dans linternalisation de lADN exogne). En revanche aucun homologue de gnes codant les fonctions prcoces na t dcel dans le gnome. Question 3 : Ces donnes sont-elles compatibles avec lexistence du mcanisme de comptence naturelle chez Lactococcus lactis ? Pourquoi ? Les rgions promotrices de gnes potentiellement impliques dans la phase tardive de la comptence chez L. lactis ont t analyses par alignement de squences (figure 1).

Figure 1 : Alignement des rgions promotrices (415 nuclotides en amont du codon dinitiation de la traduction, START) des gnes potentiellement impliqus dans le dveloppement de la phase tardive de la comptence chez L. lactis. Le consensus correspond la squence o chaque nuclotide est le plus reprsent dans lalignement.

consensus

Question 4 : Que suggre lalignement des rgions promotrices ? En quoi ce rsultat conforte t-il votre rponse de la question 3 ? De faon tester le caractre fonctionnel de lhomologue comX, la phase codante a t place sous le contrle dun promoteur inductible par la nisine (une bactriocine) dans le vecteur PnisA, pour donner la construction PnisA::comX. Deux souches de L. lactis ont t construites en y introduisant le vecteur PnisA dune part, et la construction PnisA::comX dautre part. Ces deux souches prsentent une dltion du gne chromosomique comX. Elles portent par ailleurs les gnes de rsistance la nisine. Aprs 30 minutes dincubation en prsence de nisine, les ARNm totaux sont prpars partir des deux souches. La quantit de transcrits correspondant comX et diffrents gnes cibles a t mesure par transcription inverse suivie dune amplification PCR spcifique des diffrents gnes cibles (RT-PCR)(figure 2).
comX
Figure 2 : Estimation des quantits de transcrits de comX et des gnes de comptence tardifs par RTPCR chez L. lactis. Le gne codant la protine hu, de type histone, ne prsente pas dans sa rgion promotrice de squence proche du consensus dfini prcdemment.

PnisA PnisA::comX

Question 5 : A quoi sert dintroduire le gne hu dans lexprience ? Question 6 : A quoi servent les expriences menes sur la souche transforme par PnisA ? Comment interprtezvous la prsence/absence de bande pour certains gnes ? Par comparaison, interprtez les rsultats obtenus chez la souche PnisA::comX. Peut-on conclure quant au caractre fonctionnel de comX de L. lactis ? Proposez une stratgie pour tester si ComX rgule son propre gne.

LSV Parcours BC - UE 5.15 Mcanismes et consquences des changes de gnes entre bactries (TP/TD) Session 1 - 30 min (temps conseill) - Sujet propos par Romain HENRY (Documents et calculatrices interdits !) Argumenter vos rponses. Une copie maximum. On tudie des mutants blancs de Streptomyces ambofaciens, alors que la souche sauvage est de couleur grise. Afin dtudier quel(s) gne(s) est (sont) inactif(s) chez ces mutants non pigments, on ralise des essais de complmentation. Certains gnes tant suspects, ceux-ci sont amplifis par PCR puis introduit dans un plasmide appel pSET152, dont la carte est prsente ci-dessous :
SalI HindIII HindIII SalI HindIII PstI SalI XbaI BamHI SacII BssHII EcoRV EcoRI

lacZ
AatII SphI PstI SalI

attP (5,8 kb)

PstI SalI SacI NheI BalI ApaI XhoI

SacI

Aprs lectroporation des plasmides recombinants (plasmide pSET152 dans lesquels sont insrs les gnes amplifis par PCR) chez les mutants, lADN des transconjugants permettant la complmentation est extrait puis digr par BclI qui coupe de part et dautre du site dintgration du plasmide. LADN est dpos sur gel dagarose et un Southern-blot est ensuite ralise laide dune sonde, correspondant lADN du plasmide pSET152, marque la digoxygnine. 1) Expliquer le principe du marquage de la sonde la digoxygnine. Les rsultats obtenus sont prsents dans la figure ci-dessous : 1 2 3 4 5 6
14.1 11.5 5.1 4.6 4.5 2.8 2.6 2.44 2.1 1.9 1.7 1.15 1.1

1 : ADN du phage digr par PstI. 2 : ADN de la souche sauvage digr par BclI. 3 : ADN du plasmide pSET152 digr par ApaI. 4 6 : ADN de 3 transconjugants permettant la complmentation, digr par BclI.

2) Interprter la figure. Quelle conclusion pouvez-vous en tirer ?

3) Que ce serait-on attendu obtenir, pour le transconjugant prsent piste 4, si les ADN avaient t digrs par SacI ? Faire un schma. Lexprience a ainsi permis de mettre en vidence le(s) gne(s) impliqu(s) dans la couleur grise des colonies. Le gne gris a t squenc et rvle un pourcentage en base GC de lordre de 60% alors que le pourcentage en base GC de Streptomyces ambofaciens est de lordre de 72%. 4) Quelle(s) conclusion(s) pouvez-vous en tirer ?

UNIVERSITE HENRI POINCARE, NANCY I - FACULTE DES SCIENCES

SUJET DEXAMEN
DIPLOME : Licence SVT Dure du sujet conseille: 60 min Nom du rdacteur : Epreuve de : CM 5U16 Session de : Janvier 2009 Date : Horaire :
(1)

Pr I.MOTORINE NON(1)

Documents autoriss

Calculatrice autorise

NON (1)

Rayer la mention inutile

_____________________________________________________________________________ 1. Expliquez l'origine et le droulement des phnomnes traductionnels inhabituels comme la translecture des codons d'arrt ("readthrough") et le dcalage du cadre de lecture ("frameshift"). Comment fonctionnent les ARNt suppresseurs ? Indiquez leurs origines et fonctions dans le mtabolisme cellulaire. Expliquez les mcanismes de "frameshift" +1 et -1. Quel est le rle des nuclotides modifis pour viter un tel dcalage du cadre de lecture.

UNIVERSITE HENRI POINCARE, NANCY I - FACULTE DES SCIENCES SUJET DEXAMEN DIPLOME : LCVI5U16 - TD Epreuve : Biologie molculaire e Session : 1 Session Date : /01 / 2010 Dure : 60 minutes Thme 1 : Soit un opron codant deux protines ribosomales (B et C) et un facteur de traduction (A). Nom du rdacteur : Mme Robas Documents autoriss Documents non autoriss Calculatrice autorise Calculatrice non autorise

4 fusions (f1 f4) ont t construites avec le gne LacZ codant la -galactosidase. Les valeurs dactivit -galactosidase sont donnes dans le tableau en fonction dexcs ou non d1 protine (Ap : protine code par le gne A ; protine Bp etc).

Activit -galactosidase en % / Gne Lac Z non fusionn Nom des fusions f1 f2 f3 f4 Sans excs daucune protine 100 100 100 100 20 20 20 20 30 30 100 100 100 100 100 100 TOURNEZ SVP Excs de Ap Excs de Bp Excs de Cp

Q1 : Analysez les rsultats du tableau et expliquez les pour chaque fusion. Q2 : Quels sont ces mcanismes de rgulation ? Donnez les rles des 3 protines, quand agiraientelles ?

Thme 2 : Traduction in vitro dune polyPhe avec un mlange de 500 L contenant entre autre : 100L dextrait S30 auxquels sont ajouts 10 L dun polyU ( 3 mg/mL) et 10L dH3-Phe (500Ci/mL et 5 moles/mL). Le rendement du compteur est de 30% ((cpm/dpm) x 100). La relation Ci est : 1 Ci = 2,22 106 dpm. MMPhe = 165. DO260nm de S30 = 0,541 sur une dilution au 1/500 Temps (min) cpm dans 50L dchantillon prcipits au TCA froid 0,5 1 2 5 10
ime

dpm

1200 1350 2100 4500 45000 0

Q3 : Quelle est la quantit maximale de Phe obtenue, en g et en moles ? Q4 : Quelle est la quantit maximale thorique de Phe ? Commentez.

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES et TECHNIQUES

SUJET DEXAMEN Licence Sciences du Vivant 3me anne UE numro : 5.18 Cours Magistral Epreuve relative la partie : Biochimie Structurale Session de janvier 2010 (1re session) Dure du Sujet : 40 minutes sur 2 heures Nom du rdacteur : VITOUX Bernard Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

Composer sur une copie spare Remarque prliminaire : pour toutes les rponses, ncessairement succinctes puisque vous disposez en moyenne de 10 minutes pour tablir chacune dentre elles, il est recommand de se servir le plus possible de schmas ou de graphes prcisment annots et capables dillustrer vos dmonstrations. 1. Quelles sont les variations des grandeurs thermodynamiques H, S et G associes une protine en fonction de la temprature ? Quels sont les protocoles exprimentaux et les extrapolations mettre en uvre pour accder aux variations de G sur la plus grande partie du domaine de stabilit de ltat natif ? 2. En quoi consiste la carte de RAMACHANDRAN, et pour quelles raisons les points reprsentatifs des rsidus dacide amin des chanes polypeptidiques natives sont-ils observs dans quelques zones privilgies de cette carte ? 3. Par quelle proprit gomtrique la chiralit des feuillets se manifeste-t-elle, et pourquoi lexistence des feuillets mixtes en est-elle directement dpendante ? 4. Illustrez laide de trois exemples diffrents la notion de reprsentation topologique des structures tertiaires de protines appartenant diffrentes classes structurales.

UHP Nancy LSV 3 UE 5.18 Biochimie mtabolique Dure : 40 minutes

Rdacteur : R. Marczak Documents non autoriss.

La synthse des acides gras chez les eucaryotes. Vous prciserez (sans dvelopper les formules ni la succession des ractions intermdiaires) les 3 phases principales : Phase 1 : nom gnrique - raction globale et ses caractristiques - nom, cofacteur vitaminique et modes de rgulation de lenzyme implique - origines mtaboliques du substrat principal. Phase 2 : nom gnrique - formation des deux premiers composs associs au cofacteur transporteur - noms des 4 ractions suivantes incluses dans une squence rcurrente (le nom et les formules des composs intermdiaires ne sont pas demands) - nom et double origine du cofacteur des ractions 2 et 4 de cette squence. Phase 3 : nom gnrique - raction finale pour donner un acide gras satur. Ecrire la stoechiomtrie totale de la synthse dun acide gras satur en prenant comme exemple le palmitate (C16:0). En dduire le nombre de squences rcurrentes ncessaires pour sa synthse. Indiquer en quoi les 4 tapes de la squence rcurrente de la phase 2 constituent une srie de ractions analogues mais de type contraire celles de la dgradation des acides gras mais aussi ce qui diffrencie les deux voies (5 critres sont demands).

LICENCE SCIENCES ET TECHNOLOGIES, MENTION Sciences du Vivant

UE LCVI5U18 Biochimie Structurale et Mtabolique 2009-2010 Premire session Janvier 2010 EPREUVE SUR LES TRAVAUX DIRIGES Dure 1 heure - pas de documents calculatrice autorise Prvoir deux copies : une par sujet I. Sujet de Jean BALLONGUE (dure 30 min)
A) Toxicit des acides faibles : Sous quelle forme les acides faibles perturbent-ils la croissance des bactries ? Comment value-t-on, chaque instant, cette concentration en forme toxique si on connat la concentration totale (At) de lacide dans le milieu ? (On donnera le dtail du calcul) Comment peut-on saffranchir de cette toxicit ?

B) Bilan de carbone : La fermentation actonobutylique du glucose peut tre schmatise comme suit :

GLUCOSE 2ATP

PYRUVATE CO2 ETHANOL ACETYLCoA +ACETYL CoA ACETATE+ATP

ACETOACETYL CoA

ACETONE+CO2

BUTANOL

BUTYRATE+ATP

Sachant que la quantit de glucose consomme un instant donn est de 56.8 g/l et que les productions dtnanol (PM=46), dactate (PM= 60), dactone (PM= 58), de butanol (PM= 74) et de butyrate (PM= 88) sont respectivement de 1 g/l ; 1.5 g/l ; 6.5 g/l; 10 g/l et 2g/l 1- Etablir le bilan global du carbone ce moment. 2- Evaluer la quantit dATP produite?

II. Sujet de Anne LAGRANGE (30 minutes)


1) Donner un exemple illustrant des conformations diffrentes et des configurations diffrentes. Les nommer et les justifier. 2) Retrouver les projections de Fischer de l'acide L-Lactique et de la L-Alanine et crire leur formule dveloppe dans l'espace en utilisant pour les liaisons un trait continu si on est dans le plan, un pointill si la liaison est l'arrire de ce plan et un triangle si elle se dirige vers l'avant. 3) Qu'appelle-t-on tripeptide modle de la L-Alanine ? Combien comporte-t-il de liaisons peptidiques ? Ecrivez ce modle peptidique et numroter les carbones alpha (a) : i, i+1, ... Situer le N et le C terminal Expliquer ce qu'on appelle angle de torsion, comment le mesure-ton ? Nommez ceux de votre schma. Dcrire les liaisons H qui peuvent se former sur la chane primaire et quelles conformations prend alors la structure secondaire ? 4) Comparer une hlice alpha et une hlice 310, en insistant sur le sens du pas, les liaisons H, les pseudocycles et le nombre de rsidus aminoacyls par tour. Quelle distance existe-t-il entre 2 carbones alpha successifs dans une hlice alpha, quelle est la proprit consquente rencontre dans ce type dhlice ?

---------------------------

LICENCE SCIENCES ET TECHNOLOGIES, MENTION Sciences du Vivant UE LCVI5U19 Applications en Biochimie Structurale et Mtabolique Anne 2009-2010 - 1session - Janvier 2010 Dure 2 heures - Pas de documents - Calculatrice autorise 1) Analyse de l'huile de palme 1. Ecrire la raction quilibre (c. d. en prenant en compte les proportions stoechiomtriques) d'hydrolyse des lipides (raction de lipolyse). Comment est nomme cette raction ? 2. Comment spare-t-on les produits de cette raction ? (Schma bienvenu) 3. Connaissant les ractions ci-dessous :
(1) CH2OH - CHOH - CH2OH + 2 K IO4- -----> 2 HCHO + HCO2H + 2 K IO3- + H2O (2) (3) KIO4 + 2 KI 2 S2O3 2- + + H2SO4 I2 ---------> KIO3 + I2 + H2O + K2SO4

<=====>

S4O6 2- +

2 I

-Dcrire le microdosage du glycrol par la mthode de Malaprade - Calculer la teneur en glycrol dun litre de solution sachant que la prise dessai est de 2 ml. Lessai blanc a donn une chute de burette de 20 ml de Na2 S2O3

5 mM et la moyenne des essais est de 8 ml. Expliquer en dtail votre calcul. Le litre de solution ci-dessus correspond la quantit du glycrol contenu dans 5g dhuile de palme. - Calculer le pourcentage en gramme ainsi que le nombre de moles de glycrol pour 100 g dhuile de palme. Quelle quantit d'eau en grammes est ncessaire pour hydrolyser 100 g d'huile de palme ? Rappel : MM glycrol = 92 g. mol
-1

2) Etude des constituants du jaune d'uf Quels sont les phospholipides prsents dans le jaune duf Comment les rcupre-t-on partir du jaune duf ? Par quelle technique les spare-t-on les uns des autres ? Dcrivez la Comment les rvle-t-on ?

3) Prparation de solution Quel volume de solution commerciale d'HCl 37% (p/p) faut-il utiliser pour obtenir 500 mL de solution 0,1 M ? Dtailler le calcul. Dcrire les prcautions prendre, le matriel et la mthode de prparation. Verse-t-on lacide dans leau ou leau dans lacide ? Pourquoi ? Rappel : densit HCl = 1,18 20C 4) Modlisation Quelles sont les consquences strochimiques de la cyclisation d'un aldose? Confortez votre rponse en utilisant les formules dveloppes, linaire et cyclique, d'un aldose de votre choix. Prcisez la configuration absolue de tous les carbones chiraux dans les deux molcules. MM HCl = 36,5 g. mol-1

-----------

Mme N. FONTANEZ

DUREE 2H

1er semestre 2009-2010

TECHNIQUES DEXPRESSION ORALE ET ECRITE 5.21

TOUTES LES REPONSES DOIVENT ETRE REDIGEES SANS ABREVIATIONS NI TIRETS

AUCUN DOCUMENT AUTORISE

CALCULATRICE INTERDITE

UNIVERSITE HENRI POINCARE, NANCY I, FACULTE DES SCIENCES

Diplme : Licence Sciences du Vivant (L3) Mention : Parcours BO + BCMP .

Dure : 2 heures. Rdacteurs : A Ropars, S Flament,

Epreuve de : Relations hte-parasite chez les animaux UE 5.24 Session de janvier 2010 Documents non autoriss.

Les deux sujets (cours et TP/TD) sont traiter sur copies spares.
Sujet de TP/TD (S. Flament ), dure conseille : 1h
Dcrire la stratgie parasitaire du coucou et quelques expriences montrant les points dont dpend la russite de ce parasitisme.

Aborder ensuite laspect volutif de cette relation hte-parasite en tayant les hypothses par des faits concrets.

Sujet de cours magistral (A. Ropars), dure conseille : 1h


1) Expliquez ce quest un rservoir . Donnez quelques exemples.

2) Quelles sont les principales causes de contamination intra-espces ? Explicitez.

3) Expliquez de faon concise mais prcise les diffrentes rponses immunitaires mises en jeu contre les plasmodiums, agents du paludisme, chez les mammifres. Quelles sont les cibles les plus prometteuses pour obtenir un vaccin efficace?

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES ET TECHNIQUES


DIPLME : LSV 5.26 Interactions plantes microorganismes Epreuve de : 1re session Janvier 2010 Date : Horaire :

SUJET D'EXAMEN
Dure du sujet : 2h00.............................. Nom des rdacteurs : A. Brun-Jacob, M. Chalot, D. Blaudez. Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises (Veuillez cocher les cases correspondantes)

Les deux sujets (obligatoires) sont traiter sur deux copies spares. Sujet 1 (dure conseille : 1h) La rhizosphre : une interface microbiologiquement active entre la plante et le sol . Commentez cette dfinition. Sujet 2 (dure conseille : 1h) 1) Reprsentez schmatiquement et annotez le cycle de reproduction complet du champignon basidiomycte parasite Puccinia graminis. (7 pts) 2) Quelles sont les quatre voies possibles de pntration foliaire dun champignon phytopathogne ? (2 pts) 3) Citez deux maladies fongiques de plantes ayant eu des rpercussions mondiales importantes (1 pts) 4) Prsentez laide de schmas et commentez succinctement les diffrences anatomiques observes entre des coupes de nodules actinorhiziens et rhizobiens. Prcisez quels sont les partenaires impliqus. (5 pts) 5) Prsentez laide de schmas et commentez succinctement, les diffrences anatomiques observes entre des endomycorhizes et des ectomycorhizes. Prcisez quels sont les partenaires impliqus. (5 pts)

LSV 5.27 Diversit et volution des micro-organismes pathognes Session I 2009/2010 Sujet Pierre Leblond Dure conseille 1h
- Soyez succinct ! Les rponses peuvent tenir sur une copie unique ! -

Le genre Staphylococcus comprend des espces non pathognes comme S. xylosus ou S. carnosus aussi bien que des pathognes clbres comme S. aureus et S. epidermis, responsables dinfections nosocomiales. Dans cette tude, le gnome de lespce non pathogne, S. carnosus TM300 a t squenc. Cette espce est utilise comme ferment dans lindustrie agroalimentaire et est classe comme organisme GRAS ( generally recognised as safe 1 ). Le gnome de S. carnosus TM300 est lun des plus petits gnomes de staphylocoques avec 2,57 Mb contre 2,62 Mb chez S. epidermidis, 2,69 Mb chez S. haemolyticus et de 2,74 2,91 Mb chez S. aureus. Le pourcentage dADN codant est de 81,4%, plus faible que chez toutes les autres espces de staphylocoques. Enfin, le nombre de pseudognes (55 gnes tronqus par rapport aux homologues chez les autres staphylocoques) est important dans ce gnome. Le gnome de S. carnosus est galement caractris par labsence dlments gntiques mobiles de type IS ( insertion sequence ) alors que, par exemple, 92 sont prsents chez S. haemolyticus. Les squences dADN rptes sont galement en trs faible quantit dans ce gnome. Enfin, la distance entre origine et terminus de rplication est dsquilibre ; les deux bras chromosomiques correspondant 45% et 55% de la taille totale du gnome. Question 1 : En quoi le squenage du gnome dune espce non pathogne peut-il tre utile la comprhension des mcanismes de dveloppement de la pathognicit dune part, et dmergence disolat pathogne dautre part ? Question 2 : Que vous indique la taille du gnome de S. carnosus par rapport aux autres staphylocoques ? Que vous indique le pourcentage dADN codant ? Entre 46% et 50% (soit 1200) des produits de gne de S. carnosus sont conservs entre staphylocoques. Quatorze pourcents des protines codent une fonction inconnue. De plus, 41 des 187 protines classes dans la catgorie pathognicit ou production de toxine et rsistance sont prsentes chez tous les staphylocoques, incluant S. carnosus. Cependant, si les seuls facteurs de virulence avrs sont considrs (toxines, protines liant des facteurs de lhte, rsistance aux antibiotiques), peu dhomologues sont retrouvs (les gnes codant les superantignes tst ou les entrotoxines sea/sep sont absents). De plus, S. carnosus prsente trois homologues codant une hmolysine mais ne montre aucune activit hmolytique. Question 3 : Pourquoi compare t-on les gnomes au niveau protique et non nuclique ? Question 4 : Que peut rvler la prsence dans le gnome de S. carnosus de gnes annots comme gnes de pathognicit ? Au total, 345 protines (14% du total) sont spcifiques de lespce S. carnosus. La moiti de ces gnes sont localiss dans un segment denviron 500 kilobases localis proximit de lorigine de rplication, les autres tant rpartis tout le long du gnome. Si beaucoup codent des fonctions inconnues, les identits (en acides amins) les plus fortes correspondent des produits de gnes appartenant dautres genres bactriens (Clostridium, Burkholderia, Mycoplasma). Question 5 : Quel phnomne et quels lments gntiques pourraient expliquer la prsence de gnes spcifiques chez S. carnosus ? Question 6 : A laide de lensemble de ce donnes, pouvez-vous mettre une hypothse sur le scnario volutif de lespce S. carnosus par rapport ses proches parents pathognes ?

Catgorie dorganismes autoriss dans les procds agroalimentaires

UNIVERSITE HENRI POINCARE NANCY I FACULTE DES SCIENCES ET TECHNIQUES

SUJET D'EXAMEN DIPLOME Epreuve de Session de L3 SVS L.SV.5.27 Session 1, Janvier 2010 Dure du sujet 1 heure Nom du rdacteur B. Aigle Documents non autoriss Calculatrices non autorises

Remarque : soyez clair et concis et justifiez vos rponses ! Partie 1 1/ Aprs avoir rappel brivement la composition du virus influenza A notamment au niveau gntique, expliquez les diffrents modes dvolution de ce virus. 2/ Pourquoi parle t-on dans certains cas de rmergence dun virus ancien ? Partie 2 Vibrio cholerae est lagent bactrien responsable du cholra. Les souches pathognes portent toutes deux lments gntiques qui sont associs lapparition de cette maladie. Le premier lment est le phage lysogne filamenteux tempr CTX. Le gnome (6,9 kb) de CTX code la toxine cholrique (CT), le principal facteur de virulence de ce microorganisme pathogne. Le second lment est llot de pathogncit VPI (VPI pour V. cholerae pathogencity island ) codant le pilus TCP (TCP pour toxin-coregulated pilus ) qui agit comme facteur de colonisation. Lexpression de TCP est sous le contrle du facteur de transcription ToxR lequel rgule galement lexpression des gnes CT ports par CTX et comprenant notamment ctxAB codant les sous-units A et B de la toxine CT. Des expriences de transduction ont t ralises en utilisant un driv du phage CTX portant le gne km de rsistance la kanamycine (la prsence de ce gne na aucune influence sur les proprits du phage ; il est uniquement utilis comme marqueur de slection) et comme souche rceptrice V. cholerae 0395, une souche porteuse de llment VPI. Les expriences de transduction ont t ralises partir de culture de Vibrio pH 6,5 (conditions activant lexpression de ToxR) et pH 8,5 (conditions ne permettant pas lexpression de ToxR). Lefficacit de transduction est donne dans le tableau. Le mme type dexprience a t ralis avec les souches JJM43 (dlte pour toxR), TCP2 (dlte pour tcpA, gne codant une sous unit essentielle de TCP) ainsi quavec les souches SC253 et SC254 (souches portant des allles muts -mutations ponctuelles- de tcpA mais naffectant pas la production des pili TCP) et la souche SC62 portant un allle non fonctionnel de tcpA.
souches 0395 0395 JJM43 TCP2 SC253 SC254 SC62 Caractristiques des souches ou conditions de croissance Croissance pH 6,5 Croissance pH 8,5 Dltion de toxR Dltion de tcpA Substitution Val9 Met dans TcpA (TCP pili+) Substitution Val20 Thr dans TcpA (TCP pili+) Dcalage du cadre de lecture dans TcpA (TCP pili-) Efficacit de transduction de CTX -km 3,6 x 107 0 0 0 4,0 x 107 6,0 x 106 0

Lutilisation dantisrum anti-TCP dans les expriences de transduction bloque linfection phagique alors que lutilisation dantisrum anti-CT na aucune influence. 1/ Interprtez lensemble de ces rsultats. Quel est le facteur essentiel pour linfection des cellules de V. cholerae par CTX ? Des expriences ont t menes afin de dterminer si CTX peut transduire dans le tractus intestinal. Une souche donatrice RV508 (CTX -km) et une souche rceptrice O395 ont t mises en culture dans un milieu pH 8,5, puis aprs croissance et lavage intensif, les souches ont t mlanges concentration gale et le mlange a t utilis pour une inoculation gastro-intestinale de souris. Aprs 24 h, le petit intestin a t prlev puis tal sur un milieu slectif. Les rsultats obtenus montrent que 0,5 % des cellules de la rceptrice sont rsistantes la kanamycine. 2/ Que montrent ces rsultats ? Comment se ferait lacquisition de la pathogncit chez V. cholerae ? Sagit-il dune acquisition verticale ou horizontale ? Des tudes ont menes sur llment VPI. Il sagit dun lot de pathogncit denviron 40 kb contenant des gnes de virulence, de rgulation et de mobilit et qui est insr au niveau dun site att sur le chromosome. Une prparation de phages a t fate partir dune culture de la souche de V. cholerae contenant llment VPI. Des PCR ont alors t ralises sur cette prparation totalement dpourvue de cellules de Vibrio. Des produits de PCR ont t obtenus uniquement avec des couples damorces spcifiques de gnes de VPI mais aucun produit na t obtenu avec des couples damorces permettant damplifier les rgions flanquant immdiatement de llment ou dautres rgions chromosomiques. Des rsultats similaires ont t obtenus mme aprs traitement la DNase ou la RNase de la prparation. 3/ Interprtez ces rsultats. Quelle serait la nature de llment VPI ? Des cellules de V. cholerae DK236, contenant un lment VPI dans lequel a t insr le gne aphA confrant la rsistance la kanamycine et la nomycine, ont t mlanges avec des cellules de la souche DK238, une souche dpourvue de VPI et rsistance lacide nalidixique puis le mlange a t tal sur milieu contenant de la kanamycine et de lacide nalidixique. Aprs une nuit dincubation, plusieurs colonies taient dtectes sur ce milieu. Des rsultats similaires ont t obtenus en mlangeant des cellules DK238 avec une prparation de phages totalement dpourvue de cellules de Vibrio ralise partir de la souche DK236 et traite la DNase. 4/ Ces rsultats confirment votre hypothse prcdente ? Justifiez votre rponse. 5/ Daprs lensemble de ces rsultats, comment une souche non pathogne de Vibrio acquire la pathogncit ?

UNIVERSITE HENRI POINCAR, NANCY-UNIVERSIT FACULT DES SCIENCES

SUJET D'EXAMEN Dure du sujet de CM: 1 heure 30 minutes Dure du sujet de TD/TP: 30 minutes Nom des rdacteurs : Lionel Domenjoud Nadge Touche

Diplme : Licence Mention : Sciences du Vivant Epreuve de : UE 5.28 Cours et TD/TP De la cellule normale la cellule cancreuse Session de : Janvier 2008 Date : Horaire :

[ ] [X] [X] [ ]

Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

Sujet de cours Les tapes de la cellule normale la cellule cancreuse Vous rpondrez aux questions de cours et de TD de L. Domenjoud sur deux copies spares Le passage dune cellule normale une cellule cancreuse ncessite une volution en plusieurs tapes. Pouvez vous expliquer en quoi consistent ces diffrentes tapes ? En quoi les modles cellulaires in-vitro nous aident-ils comprendre ces diffrentes tapes ? Sujet de TD/TP Vous rpondrez aux questions de L. Domenjoud et de N. Touche sur deux copies spares Questions de Lionel Domenjoud Question 1 : Vous dcrirez les diffrentes tapes du protocole dextraction de lADN gnomique des cellules que vous avez cultives sans donner tous les dtails exprimentaux mais en expliquant le principe de chaque manipulation et les prcautions que vous prenez. Question 2 : Vous avez repris votre ADN dans 50 l deau et mesur sa DO 260 et 280 nm en utilisant 5 l de cet ADN dans 0,5 ml deau. Les valeurs de DO mesures sont : DO260 = 0,6 DO280 = 0.35 A quoi vous sert la valeur de DO 280 nanomtres ? Quelle est la concentration de votre solution dADN de dpart si une DO260 de 1 quivaut une concentration de 50 g/ml ? Question 3 : Pour dposer sur le gel un chantillon de 24 l contenant 20 g dADN et 4 l de bleu de dpt (6x), comment procdez-vous ? Question 4 : Quel est lintrt de chauffer lADN 65C avant de le dposer sur le gel ?

Question 5 : Que vous attendez vous voir sur votre gel si une partie de vos cellules sont en apoptose, une partie sont intactes et une partie sont ncrotiques ? Questions de Nadge Touche Des cellules adhrentes de la ligne MCF-7 sont mises en culture dans un milieu appropri la densit de 2.104 cellules par cm2 dans une boite de 25 cm2. 1- Quentend-on par cellules adhrentes ? 2- Quelle sont les principaux lments qui entrent dans la composition du milieu de culture de ces cellules ? Donnez brivement leur fonction. Aprs 7 jours de culture les cellules sont rcupres (volume rcupr 5ml). Un comptage est effectu en prsence de bleu trypan (V/V) sur une cellule de Neubauer. On compte 21 cellules sous la lame. 3- Quel est le rle du bleu trypan ? 4- Dtaillez la mthode permettant de rcuprer les cellules adhrentes ? Expliquez lintrt de chacune des tapes. Vous devez effectuer un repiquage de ces cellules. 5- Combien de boites de 75 cm2 pouvez-vous faire au maximum ? 6- Vous envisagez galement densemencer une plaque 6 puits ? Est-ce possible ? Explicitez votre rponse. On donne : volume de milieu pour 1cm2 de surface = 0.2ml surface dun puits dune plaque 6 puits = 9.6cm2 volume de la cellule de Neubauer 0.1mm3

UNIVERSIT DE NANCY I FACULT DES SCIENCES ET TECHNIQUES

SUJET DEXAMEN

DIPLOME ......L3. SV................................................ Dure du sujet .....2h....................................................... Epreuves de CM et TP/TD : Dveloppement du Systme Immunitaire (UE 5.30). Session de ......Janvier 2010........................................ Date ......................................................................... Horaire .................................................................... Nom du rdacteur: FRIPPIAT J.-P., ROPARS A. et BASCOVE M Documents autoriss Calculatrices autorises
OUI NON (1)

OUI

NON

(1)

(1) Rayer la mention inutile

TRAITER SUR 3 COPIES SEPARES : 1 POUR CHAQUE REDACTEUR 1- Questions de cours magistral (Frippiat J.-P.) (dure conseille : 1h) :
1.1- De quels mdiateurs molculaires, les invertbrs disposent-ils afin de rpondre une stimulation antignique ? Expliquez succinctement leurs modes daction respectifs. 1.2- Expliquez comment lanticorps peut rguler la rponse immunitaire. 1.3- Prsentez succinctement les grandes tapes du dveloppement des lymphocytes B partir des cellules souches de la moelle osseuse. Aidez-vous de schmas.

2- Questions de TP/TD (dure conseille : 1h) : Le TP constitue la note de CC (20 % de la note finale)
TD (Bascove M.): 15 min conseills
1- Schmatisez un signal de recombinaison entre un segment V et un segment J de chane lgre. 2- Quelle est la diffrence entre recombinaison par inversion et recombinaison par dltion ? (illustrez votre explication).

TD (Ropars A.) : 20-25 min conseills


1- Expliquez quoi sert la chromatographie daffinit. 2- Un exprimentateur doit tudier les organes lymphodes primaires dune espce proche des souris et des rats. Il doit mettre en uvre des techniques protiques. Dcrivez de faon concise mais prcise les techniques quil peut utiliser. Quels tmoins doit-il faire ?

TP (Ropars A.): (25-20 min conseills). NOTE DE CONTROLE CONTINU

1- A quoi sert le produit Polymorphprp ? Explicitez. 2- Pourquoi lyse t-on en gnral les globules rouge avant dutiliser la technique de la question 1 ? 3- Quelles diffrences apparaissent au microscope lorsque lon observe des lames de coloration moelle osseuse totale , rate totale et neutrophiles du sang ? Pourquoi ? 4- Un exprimentateur a un tube dont la concentration est de 0.5 million de cellules/mL. Pour son exprience, il a besoin dune concentration de 0.2 104 cellules/mL. Que doit-il faire ? Explicitez.

UNIVERSITE HENRI POINCARE, NANCY-I SUJET DEXAMEN DIPLOME : Licences Sciences du Vivant, 3me Nom des Rdacteurs : R. SCHNEIDER, S. anne LAMANDE-LANGLE UE LCVI5U32, Bio-organique Dure du sujet : 1 h Date : Documents non autoriss Calculatrices non autorises Enonc de 2 pages Exercice 1. a) Donner la structure ainsi que le mcanisme de formation de limine partir des composs indiqus ci-dessous.
+ O

NH2

b) Limine forme est en quilibre avec une namine (quilibre comparable celui de la tautomrie cto-nolique). Proposer un mcanisme pour cet quilibre (faire intervenir un acide H+ et une base B). c) Lenzyme fructose-1,6-diphosphate aldolase catalyse la raction du dihydroxyactone phosphate (DHAP) avec le glycraldhyde-3-phosphate (G-3-P) conduisant au fructose1,6diphosphate. Proposer un mcanisme pour cette raction. Faire intervenir lenzyme E-NH2, ainsi que la base B et son acide conjugu BH+ prsents dans le site actif de lenzyme.
2CH2OPO3 O HO H H OH H OH 2CH2OPO3

CH2OPO3 O CH2OH DHAP

2+ H

CHO OH 2CH2OPO3 G-3-P

d) Reprsenter le fructose-1,6-diphosphate sous sa forme furanique et donner le mcanisme de la cyclisation. e) La fructose1,6-diphosphatase est la seconde enzyme cytoplasmique spcifique de la gluconognse. Elle catalyse lhydrolyse de la liaison ester qui lie le carbone 1 du fructose-1,6diphosphate lacide phosphorique. Donner le mcanisme de cette raction.
H2O O CH2OPO3 OH 2O fructose-1,6-diphosphatase 2HPO4 CH2OH OH

Exercice 2. La suite ractionnelle suivante dcrit une synthse de lanti-guanosine.

O N CH2OH O Ac2O OH N ? N H HN N SiMe3 SiMe3 NH NH2 , SnCl 4 ? MeONa/MeOH ?

OH OH

Donner la structure des produits non indiqus ainsi que tous les mcanismes.

UNIVERSITE HENRI POINCARE NANCY 1 FACULTE des SCIENCES et TECHNIQUES SUJET D'EXAMEN
DIPLOME : LSV / Magistre 1re Anne Epreuve de : LSV-5.33 BioMembranes Session de : Janvier 2010 Date : Horaire : Dure du sujet : 80 min. Nom du rdacteur : Dr Ewa Rogalska Documents autoriss x Documents non autoriss Calculatrices autorises x Calculatrices non autorises

1). Expliquez pourquoi : a. les hydrocarbures purs ne forment pas de monocouches sur l'eau. b. les hydrocarbures purs ne forment pas de bicouches dans le milieu aqueux. c. les membranes des bulles de savons sont des bicouches inverses (les ttes polaires forment le coeur de la bicouche) par rapport aux bicouches de membranes cellulaires.

2). Dessinez schmatiquement la structure molculaire de la membrane plasmique. a. expliquez le schma dans une lgende. b. citez les mouvements qui caractrisent les composants de cette membrane. c. quelles mthodes peuvent tre utilises pour caractriser la fluidit de la membrane plasmique.

3). Transport membranaire : a. quelles sont les diffrences fondamentales entre le transport passif et le transport actif? b. quelles substances peuvent traverser la membrane sans passer par des canaux protiques? c. qu'est-ce que la diffusion facilite? d. quelle est l'importance de l'osmose dans le fonctionnement de l'organisme?

4). La mise en vidence rcente du transporteur de l'eau des globules rouges a conduit identifier une nouvelle classe de protines membranaires : les aquaporines. Ces transporteurs slectifs de l'eau sont impliqus dans de nombreux processus physiologiques. a. expliquez le mcanisme de fonctionnement de l'aquaporine 1 (AQP1). b. dessinez schmatiquement la structure 3-dimensionnelle de l'AQP1.

5). Expliquer : a. par quel mcanisme un enzyme lipolytique hydrosoluble (lipase ou phospholipase) agit-il l'interface entre une solution aqueuse et une phase lipidique. b. quelles sont les consquences de la catalyse lipolytique pour la structure de la membrane.

UNIVERSITE HENRI POINCARE - NANCY 1 FACULTE des SCIENCES et TECHNIQUES SUJET D'EXAMEN DIPLOME : Epreuve de : Session de : Date : Horaire : Dure du sujet : 40 min. Nom du rdacteur : Pr. N. Mrabet Documents autoriss Documents non autoriss Calculatrices autorises Calculatrices non autorises

LSV3 / Magistre 1re Anne LSV3 UE-5.33 Biomembranes MRABET N. Janvier 2010

Rpondre aux trois (3) questions. Lire attentivement toutes les questions avant dy rpondre. Prfrer des rponses brves et pertinentes. Dbuter une nouvelle page pour chacune des 3 rponses. Ne jamais crire dans le petit cadre sans marge, en haut, droite, de la seconde page. En toutes circonstances, prfrer lutilisation de schmas descriptifs. Chaque rponse doit tre numrote et porter le mme numro que la question concerne : par exemple, rponse 2.a pour la question 2.a. Cette numrotation est obligatoire en vue de comptabiliser vos points pour la note finale. Sparer les rponses l'aide de 2-5 lignes blanches. Bon succs ! 1. Membrane plasmique 1.a) A laide dun schma indiquant leur dimension et leur caractre physico-chimique respectifs, dcrire les trois zones constituant la membrane plasmique. 1.b) Quelles sont les mthodes biochimiques classiques qui servent dfinir la disposition topographique des diffrentes protines membranaires ?
__________________________________________________________________________________________________________________

2.

(Na+/K+)-ATPase 2.a) Dcrire la structure de la pompe (Na+/K+)-ATPase. 2.b) Dcrire le mode daction de la (Na+/K+)-ATPase. Un schma est requis.

__________________________________________________________________________________________________________________

3.

Transporteurs ABC Dcrire, l'aide d'un schma (obligatoire), les structure et fonctions des transporteurs ABC. Inclure dans le schma la reprsentation de la topologie des transporteurs en domaines, ainsi que l'insertion de la chane polypeptidique dans la membrane.