Nematology, 2011

Cloning and Sequence analysis of cellulase genes from Bursaphelenchus xylophilus isolates

Privilege T. MAKUNDE

Universidade de vora, 7002-554 vora Lab. Nematologia/ICAM, Plo da Mitra, Portugal Summary- Bursaphelenchus xylophilus is inimitable in that, besides feeding on fungi, they parasitizes live pine trees and subsequently cause pine wilt disease. The power behind this kind of plant parasitism by nematodes is their ability to secrete and inject effector proteins like cellulase, a protein which degrades the plant cell wall mainly composed of cellulose. We cloned B. xylophilus cellulase gene, sequenced it and subjected the sequence to orthologs search using Basic Local Alignment Search Tool in the public databases and we found that the cellulase gene is of B. xylophilus belongs to glycoside hydrolase family (GHF) 45. We also found that the cloned and sequenced gene is more related to GHF45 endoglucanases of fungi since orthologs retrieved from the databases were of B. xylophilus and fungi species. A phylogenetic analysis revealed that B. xylophilus isolates from Portugal, HF and 7C are closely related to the isolates from Asian countries and less related to the isolates from USA. Searching for co-transcribed genes with cellulase revealed that there are no genes in close proximity of B. xylophilus gene and this finding together with the relatedness of the cellulase gene of fungi evidently support the hypothesis that independent horizontal gene transfer events have helped in shaping the evolution of B. xylophilus. Keywords-Bursaphelenchus xylophilus; cellulase; secretions; glycoside hydrolase family 45, Lateral Gene Transfer.

*Corresponding author, email: mprivilege@hotmail.com

Nematology, 2011 Cellulose is a major structural component of the plant cell wall which provides its rigidity in concert with xyloglucans, hemicelluloses, pectin and proteins. It is a homopolymer composed of -Dglucopyranosyl units linked in a -1, 4 fashion (Pembroke, 1998). The complexity nature of cellulose microfibrils support the plant cells as well as the plant itself, and protects the cell from the environment constrains. Plant cell wall is therefore the main formidable barrier to the entrance, propagation and development of plant parasitic nematodes and other plant pathogens; it keeps the nematodes and other pathogens at bay. To circumvent this cell wall barrier plant parasitic nematodes in addition to the sclerotized, protrusible stylet which mechanically breach the host plant cell wall, have evolved in such a way that they secrete cell-wall-degrading enzymes to weaken it. The cell wall degrading enzymes are produced from the sub ventral glands and delivered into plant tissues and cells through the hollow stylet. These stylet secretions have been proved to play an important role in breaking down cellulose from the onset of penetration, migration within the host cells and the rest phase of parasitism (Jaubert et al., 2005). Plant parasitic nematodes cellulase genes were found to be exclusively expressed in the sub ventral gland cells and were first identified in Heterodera glycines and Globodera rostochiensis (Smant, et al., 1998; Yan et al., 1998) and following this, cellulase genes were found in several plant parasitic genera; Globodera, Meloidogyne, Heterodera, Ditylenchus, Pratylenchus, Radopholus, Aphelenchus and Rotylenchulus (Wang et al., 1999; de Boer et al., 1999; Rosso et al., 1999; Yan et al., 1998, 2001 Goellner et al., 2000, 2001; De Meutter et al., 2001; Gao et al., 2003, 2004b; Kikuchi et al., 2004; Ledger et al., 2006; Bellafiore et al., 2008; Opperman et al., 2008; Roze et al., 2008; Karim et al., 2009; Rehman et al., 2009a; Haegeman et al., 2008, 2011a). These characterised endogenous cellulases belong to glycosyl hydrolase family (GHF) 5 and resembles more to cellulases of bacteria than of eukaryotes, which gives a blue print that the cellulase genes possessed by these nematodes have been probably acquired from bacteria through horizontal gene transfer (Smant et al., 1998; Yan, et al., 1998; Jones et al., 2005; Ledger et al., 2006; Danchin et al., 2010). Contrary to this, the catalytic module of Bursaphelenchus xylophilus (Kikuchi et al., 2004) cellulase is classified into GH45 family according to sequence based homology (Henrissat, et al., 1993), which resembles much to fungi cellulases. Thefore, plant parasitic nematodes cellulases are mostly likely secreted for hydrolysis and breaking down of cellulose to facilitate penetration and migration in the plant cells during parasitism (de Boer et al., 1999). Bursaphelenchus is a large group of nematodes that has a global distribution. Most Bursaphelenchus species are exclusively fungal feeders and some species utilize fungi at some stage of their life cycle. The pinewood nematode (PWN), Bursaphelenchus xylophilus (Steiner & Buhrer, 1934), an endoparasitic migratory nematode is the causal agent of pine wilt disease, which cause great wreckages to many conifer trees in China, Japan, Korea and Portugal (Mamiya, 1988; Lee et al., 1990; Yang, 2003).The pathogenic mechanisms of B. xylophilus are still complex and not completely understood. Three main theories therefore exist; the enzyme theory, cavitation theory and the toxin theory (Odani et al., 1985; Kuroda, 1989). B. xylophilus is vectored from wilt-killed pine tree to a healthy tree by the beetle Monochamus galloprovincialis (Mamiya & Enda, 1972; Mamiya, 1983). The nematodes feed on cells in the tree and migrate through the tissues, spreading through the tree. This causes cell destruction of cells, leading to wilt symptoms that result in the death of the tree within one year of infection.

Nematology, 2011 However the origin of pine wilt nematode found in Portugal remains elusive (Mota et., al 2006). Here, we cloned; sequenced cellulase gene from different Bursaphelenchus xylophilus isolates and systematically investigated the evolutionary history of cellulase in plant parasitic nematodes and traced back the origin of the isolates. We show that these proteins most likely originate from horizontal gene transfer from fungi. Material and methods BIOGICAL MATERIALS The Bursaphelenchus isolates which were grown on the fungus Botritys cinerea at 25-28C were provided. Approximately 2000-10000 nematodes including the growth media were washed onto a filter paper in a Baermann funnel with sterile physiological salt solution (0.9% NaCl) and incubated for 24 hours. There Baermann funnel facilitated the removal of dead nematodes and growth media. 10 ml of the nematodes suspension were pipetted into microtubes tubes and centrifuged at 17g for 6 minutes. The supernatant was discarded and a sundry of microorganism were partially removed by an equivalent volume of 3% hydrogen peroxide for 5 minutes. The suspension was then centrifuged at 17g for 6 minutes, the supernatant were discarded and 500l of distilled water was added and the procedure was repeated three times. The nematodes were then kept at -20 C. NEMATODE
ANALYSIS

DNA

EXTRACTION

AND

DNA isolation from nematodes was performed in accordance with GENOMED JETQUICK Tissue DNA Spin Kit following the manufacturers instructions. Nematode remains were transferred into an Eppendorf tube and nuclei lysis and protein denaturation were done by 200l of Buffer T1 supplied with the kit and to the lysed nematodes, 20 l of proteinase K

was added to digest the denatured proteins. The lysates in the tubes were mixed thoroughly and incubated at 56C (1h). In between the incubation, the lysates were repeatedly inverted to enhance the efficiency of poteinase K, until the observation of a clear solution. Preceding the incubation, 20 l RNase A was added and the tubes were incubated at 37C (5 min) for the removal of cellular RNA. To the lysate 200 l of Buffer T1 was added and thoroughly mixed followed by incubation 70C (10 min). Following this, 200 l of absolute ethanol was added and DNA precipitation was avoided by shaking. The lysates were transferred into a JETQUICK column, placed into a suitable receiver tube and centrifuged at 10.000 x g (1 min). The flow through was discarded and 500 l of reconstituted buffer TX was pipetted into the micro-spin column and centrifuged at 10.000 x g (1 min). The same procedure was done using reconstituted buffer T3 except that, centrifugation was at 13.000 rpm (1min). The receiver tubes were discarded and the column was inserted into microtubes. DNA was then elutated by 200 l of prewarmed (65-70C) elution buffer (10 mM Tris-HCl [pH 9,0] which was placed directly onto the surface of the silica membrane and incubated at 22C (5 min) and centrifuged at 13,000 rpm (2 min). The eluted DNA was then stored at -20C. For qualitative test, 5l of DNA samples were resolved by gel electrophoresis in a 0.8% agarose gel with ethidium bromide in TBE (0.5) buffer at 80V (45 min). 1 kb Plus DNA Ladder (Invitrogen) was run in parallel with the samples. DNA fragments were visualized under UV light using UV transiluminator system. GENE AMPLIFICATION BY PCR AND ANALYSIS Extracted DNA (5 l) was transferred into a 0.2 ml Eppendorf tube containing: 5l 1 X Taq incubation buffer (NH4)2SO4; 1l (0.2 mM each) dNTPs mixture; 2 l (10

Nematology, 2011 pmol) of each primer (1 and 2); 0, 2l (1.25 u / 50 l) of Taq DNA polymerase, 4l (2 mM) of MgCl2 and 31l sterilized water to a final volume of 50 l. The forward primer 1, ENG00s (5 CTAAAATGAAGTCTCTTGTG 3) and reverse primer 2, ENG 00a (5 AGTCCTCTAAGCATCGTC3) were used in the PCR. The PCR conditions were as follows: pre-denaturation for 3 minutes at 95C, 30 cycles denaturation of 1minute at 94C, annealing at 50C for 1 minute, and polymerization at 72C for 5 minutes, with a final incubation at 10C hold. After completion of PCR, a mix of 5l of each PCR product with 5l of distilled water and 2l of sample buffer x 6 and were resolved in a 1% TBE (0.5) buffered agarose mini-gel at 80 V (60min). The PCR fragments were visualized under UV transiluminator after exposure of the gel in Ethidium Bromide (0.5g/mL) for 20 minutes. PURIFICATION AND PRODUCT QUANTIFICATION The PCR products were purified using the GFX column. The GFX columns were placed in collection tubes and to each 500 l of capture buffer was added. 100 l of the PCR product were transferred into each of the GFX columns and pipetted up and down 5 times. The mix was centrifuged at full speed for 30 seconds and the flow through was discarded. The above procedure was repeated and the collection tube was discarded. The GFX columns were placed onto a new 1.5ml micro centrifuge tubes and 40 l elution buffer (10mM Tris-HCl Ph 8.0. TE Ph 8.0) was pipetted onto the glass fiber matrix in the GFX column and incubated at room temperature for 1 min. Centrifugation of the samples at full speed was then done for 1 min to recover the purified DNA. PCR product quantification was done using Quant-iT dsDNA HighSensitivity Assay Kit from Invitrogen. During the routine the samples were handled carefully to avoid warming. For quantitative test, 1l of the PCR product was mixed with 199l working solution which composed of the buffer and fluorescent dye. The mixture was vortexed and incubated at room temperature for 3 minutes. LIGATION WITH PLASMID VECTOR The PCR products were cloned into pGEM-T Easy Vector following Promega pGEM-T protocol and pGEM-T Easy Vector Systems. The vector was centrifuged before use. The ligation mixture was composed of 5l of 2x buffer, 1 l pGEM-T Easy Vector (50ng), 1 l of T4 DNA ligase and 3l of the PCR product (insert). Reaction mixtures were mixed thoroughly by pipetting; incubated at room temperature for 1 hour and overnight at 4C for maximum transformants. E. COLI TRANSFORMATION The E. coli transformation was done following the Protocol Promega pGEM-T Easy Vector Systems. Four LB/ampicillin/IPTG plates were prepared for the ligation reaction. 15g agar was added to 1 litre of LB medium and autoclaved. The medium was allowed to cool to 50C; before addition of ampicillin to 100g/ml and 0.5mM IPTG and 80g/ml X-Gal. 35ml of medium was then poured into 85mm Petri dishes and the agar was left to harden. The ligation products were centrifuged and 5ul of each ligation reaction was added to sterile 1.5ml micro centrifuge tubes on ice. Frozen JM109 High Efficiency Competent Cells were just thawed (about 5 minutes) and the cells were mixed by gently flicking the tube. The cells were heat-shocked for 45 seconds in a water bath exactly 42C and immediately returned to ice for 2 min. Following this 950l of SOC medium was added to the tubes containing competent cells and ligation mixture and incubated at 37C (1.5 h) with shaking (~150rpm). 100l of each transformation culture was

Nematology, 2011 poured into LB/ampicillin/ IPTG/X-Gal plates and glass pellets were used to spread the innoculum and then incubate at 37C ncubated (24 h). White colonies were picked and inoculated in 2 ml LB with ampicillin, overnight at 37C, and shak , shaken at 200 rpm/min. Following this the cell were collected by centrifugation in micro tubes, at 10.000 rpm for 5 min and the medium removed and discarded. PLASMID DNA
EXTRACTION FROM

POSITIVE CLONES

The plasmid DNA from the positive cell was extracted and purifie purified following Fermentas Protocol GeneJET Plasmid Miniprep Kit. All steps were carried out at room temperature (20 (20C). The cells were resuspended in 250 of 250l resuspension solution, lysed by 250 of 250l Lysis Solution and neutralized using 350 350l of Neutralization Solution and the tubes were inverted 6 times after each solution and centrifuged for 5 minutes The minutes. supernatant was loaded to GeneJET spin column and centrifuged for 1 min. All centrifugations were done at 12000 x g (~11000rpm). The columns w were washed, centrifuged for 1 min after addition of 500l of Wash Solution. The flowthrough was discarded and the same procedure was repeated. The empty column were then columns centrifuged for 1 min and the DNA elution was done using 50l of Elution Buffer l Buffer, incubated for 2 min and centrifuged for 2 min. The presence of the insert was he checked by digestion of the recombinant plasmid with restriction enzyme NotI, that releases the insert .The product were he analyzed by resolving on agarose gel electrophoresis, together with linearized vector. The cloned genes were sent for ere sequencing. SEQUENCING AND PHYLOGENY ANALYSIS ENY After sequencing, the sequences of the three isolates were edited using BioEdit 7.13 and orthologs of nematode

cellulase were searched in public databases and checked for significance. Homologous sequences from BLAST search together with the three isolates sequences w then were subjected to clustalW multiple alignments using BioEdit 7.13 followed by manually editing. The phylogenetic tree was . constructed using Mega 5.50 The g 5.50. evolutionary distances were computed using the Kimura 2-parameter method. A parameter bootstrap analysis based on 1000 replicates of NJ data was performed. In addition to this, the cellulase genes from the isolates were subjected to BCM Search Launcher (http://searchlauncher.bcm.tmc.edu/seq http://searchlauncher.bcm.tmc.edu/sequtil/Options/sixframe.html), to note a util/Options/sixframe.html related celullase gene from the six reading frames. Further, the genes at the vicinity of cellulase gene were checked using STRING (Search Tool for the Retrieval of Search Interacting Genes/Protein) Genes/Protein). Results DNA QUALITATIVE ANALYSIS As shown in Figure 1, the DNA size was igure greater than 12000bp and was in low concentration, this is depicted by the faint bands.

Figure 1. Agarose gel electrophoresis of the genomic DNA extracted from five Bursaphelenchus xylophilus isolates. Lane M (DNA ladder), Lane 1(AG), 2(HF), 3(Bm7), 4(20) and 5(479).

PCR PRODUCT ANALYSIS AND QUANTIFICATION Amplification of the cellulase gene with ENG00s and ENG00a primers yielded single fragment band of 600bp in HF

Nematology, 2011 sample and the other samples were negative. The results are shown in figure 2. from public databases by BLAST search (shown in Table 1). The phylogen . phylogenetic analysis was inferred from analysis of cellulase gene and it showed that 7C and HF are in a clade consisting of Asian (BxCh-China, BxJT4 China, BxJT4-Japan, BxJS10Japan, BxKBG-Korea) and Portugal Korea) isolates (BxPt68ps, BxPt73F2, BxMad3F, BxMad4sv1, BxPt66F and Bx71TV) and 1, there is 55% bootstrap support. The % phylogeny tree is shown in figure 4. ee Nevertheless, the bootstrap consensus tree ootstrap (figure 5) revealed that the isolate 7C is closely related to BxPt68 and also near BxPt68PS BxOt73F2Por and BxCh. However HF is closely related to BxMad3F Portugal The Portugal. tree show that our isolates, HF and 7C are a distant away from an isolate from China (BxJx) , AB179544Bx (most probably from USA) and USA (Bx618, Bx745) isolates which are at the basal of the B. xylophilus clade. In the bootstrap consensus tree (figure 5 a monophyletic 5), clade of BxPt245, BxMad18SCD, BxCh BxChjx, BxUSA618USA and AB179544Bx is observed and isolate AS is closely related to Bursaphelenchus mucronatus from Portugal (BmPto) are form the outer group. Moreover the BLAST search reveals that the cellulase gene of B. xylophilus is related to fungi cellulase orthologs, Muccor circinelloides AB175928, Staphylotrichum coccosporum AB248917 and Gibberella zeae AY342397 which forms a clade with cellulase genes of AS and BxPto with 93% bootstrap support, though it was not strongly supported in the phylogeneitic tree with other cellulases from B. xylophilus. They are found at the basal position of the clade.

Figure 2. Agarose gel electrophoresis of the PCR . amplification of five cellulase gene from 5 isolates of B. xylophilus. Lane M (DNA ladder) Lane ladder), 1(AG), 2(HF), 3(BM7), 4(20) and 5(479).

The quantification of the PCR product using Quant-iT dsDNA High iT HighSensitivity Assay Kit from Invitrogen were as follows: HF (1.56ng), 7C (1.25ng), HB (0,521ng) and AS (0,396ng). RECOMBINANT
PLASMID ANALYSIS AFTER NALYSIS DIGESTION WITH Not1

The approximate sizes of restriction fragments from the rec recombinant plasmids containing the gene of interest are presented in Figure 2. The vector band is 3015 bp and the gene of interest in AS, 7C1 and 7C2 is 600bp except that of HF (500bp).

Figure 3. Agarose gel electrophoresis showing . restriction fragments of the recombinant plasmids after digestion with Not1, Lane M (DNA Ladder), Lane 1(AS), 2(HF), 3(7C1), 4(7C2)

PHYLOGENY ANALYSIS The sequence alignment included equence 24 sequences, 21 of which were obtained

Nematology, 2011
bootsrap values higher than 75 % maximum likelihood showed high similarity.

Table 1. Homologous sequences from Basic Local . Alignment Search Tool using AS, HF and 7C and others from previous sequences provided for phylogeny analysis.

Figure 4. Unrooted phylogenetic trees of different hylogenetic isolates of Bursaphelenchus xylophilus and orthologs from fungi.

Isolates Bursaphelenchus xylophilus BxPt68ps BxPt73F2Portugal BxCh BxMad3F BxMad4sv1 BxJT4 BxJS10 AB179544Bx BxUSA618 BxPt245Pt BxMad18SCD BxPt73FZ BxPt66F BxKBG BxPt24S BxChJX BxUSA745 EU6602070

Origin Portugal Portugal China Portugal Portugal Japan Japan .. USA Portugal Portugal Portugal Portugal Korea Portugal China USA Europe Portugal

Bx71TV

Fungi Muccor circinelloides AB175928 Japan Staphylotrichum coccosporum Japan AB248917 Gibberella zeae AY342397 ..

...-unknown origin* Discussion The comparison of the isolates omparison sequences with various database homologous sequence revealed similarities of our sequences to known cellulase genes of Bursaphelenchus xylophilus and other fungi species. The results suggest that 7C and HF together with other Portugal isolates within the clade of Asian isolates probably originated from Asian countries as they are far less related to the isolates from USA which occupied the basal position sition in the Bursaphenchus monophyletic group. This gives a blue print that Asian isolates have originated

Figure 5. Bootstrap consensus tree of cellulase . from Bursaphelenchus and fungi Posterior probability (PP) support values are indicat indicated at corresponding nodes, and those supported by

Nematology, 2011 from USA. However the best way to track the origin or evaluation of genetic diversity of B. xylophilus is the molecular analysis of the rDNA region including the 18S and 5.8S coding regions and the noncoding ITS-1 and ITS-2 regions as they proved to be helpful (Irdani, 2000; Kanzaki & Futai, 2002) and the region is used for diagnostic purposes (Braasch et al., 1995; Iwahori et al., 2000; Liao et al., 2001; Kang et al., 2004; Matsunaga & Togashi, 2004; Cao et al., 2005; Takeuchi et al., 2005). To investigate the evolutionary relationships between the Bursaphelenchus cellulase and the representative fungi cellulase orthologs from the database, a neighbour-joining tree of the cellulase gene family was constructed. Remarkably, the GHF45 endoglucanases from Bursaphelenchus xylophilus show the highest homology to fungal sequences. This suggests that, B. xylophilus cellulase gene was transferred from fungi through lateral gene transfer. To support this, B. xylophilus is a facultative fungal feeder; share the common niche and this appears to have evolutionary relevance in support of say the gene was acquired from fungi (Kikuchi et al., 2004). Furthermore, in the vicinity of the cellulase gene there were no co-transcribed genes after analysis of the cellulase gene with STRING. The absence of co-transcribed genes with cellulase gene strongly reinforces the hypothesis of the acquisition of nematode GH45 cellulases via lateral gene transfer (LGT) from fungi. References BELLAFIORE, S., SHEN, Z., ROSSO, M.N., ABAD, P., SHIH, P. & BRIGGS, S. (2008). Direct identification of the Meloidogyne incognita secretome reveals proteins with host cell reprogramming potential. PLoS Pathogens 4, e1000192. BRAASCH, H., BURGERMEISTER, W. & PASTRIK, K.H. (1995). Differentiation of three Bursaphelenchus species by means of RAPD-PCR. Nach-richtenbl. Deut. Pflantzenschutzd 47, 310 314. CAO, A.X., LIU, X.Z., ZHU, S.F. & LU, B.S. (2005). Detection of the pinewood nematode, Bursaphelenchus xylophilus, using a real-time polymerase chain reaction assay. Phytopathology 95, 566571. DANCHIN, E.G., ROSSO, M.N., VIEIRA, P., DE ALMEIDA-ENGLER, J., Remarkably and astonishingly, the cellulase present with B. xylophilus bears little resemblance to the cellulases of other plant parasitic nematodes, the tylenchids but is most analogous to GHF45 cellulases from fungi. Combining all this and other body of evidences (Kikuchi et al., 2004), strongly suggests that the cellulase gene was acquired by an ancestor of Bursaphelenchus by LGT from fungi. However, the LGT hypothesis should be handled cautiously since the dilemma is that there are no strict objective set of laws to examine whether a given gene was acquired from another non-related organism via LGT. Nevertheless, the most commonly used method to claim this is that no homologous genes can be found in other eukaryotes, but exclusively found in fungi (Mitreva et al., 2009). Acknowledgements I would like to express my gratitude to EC, Professor Solange Oliviera for the provision of all necessary materials for the project and also for carrying some tasks of the project in our absentia. Sincerest thanks also are extended to Anna Alexandra and Marta Laranjo for their input particularly on bioinformatics. Finally, I would like to humbly share the success of this work with my classmates for the inspiration and unending support.

Nematology, 2011 COUTINHO, P.M., HENRISSAT, B., ABAD, P. (2010) Multiple lateral gene transfers and duplications have promoted plant parasitism ability in nematodes. Proceedings of the National Academy of Sciences of the U S A 107, 17651 17656. DE BOER, J., YAN, Y., WANG, X., SMANT, G., HUSSEY, R., DAVIS, E. & BAUM, T. (1999). Mol. PlantDevelopmental expression of secretory beta-1, 4- endoglucanes in the sub ventral esophagous glands of Heterodera glycines. Microbe Interactions 12, 663-669. DE BOER, J.M., YAN, Y., WANG, X., SMANT, G., HUSSEY, R.S., DAVIS, E.L. & BAUM, T.J. (1999). Developmental expression of secretory beta-1, 4-endoglucanases in the subventral oesophageal glands of Heterodera glycines. Molecular Plant-Microbe Interactions 12, 663 669. DE MEUTTER, J., VANHOLME, B., BAUW, G., TYTGAT, T., GHEYSEN, G. & GHEYSEN, G. (2001). Preparation and sequencing of secreted proteins from the pharyngeal glands of the plant parasitic nematode Heterodera schachtii. Molecular Plant Pathology 2, 297301. GAO, B., ALLEN, R., DAVIS, E.L., BAUM, T.J. & HUSSEY, R.S. (2004b). Molecular characterisation and developmental expression of a cellulose-binding protein gene in the soybean cyst nematode Heterodera glycines. International Journal of Parasitology 34, 1377 1383. GAO, B., ALLEN, R., MAIER, T., DAVIS, E.L., BAUM, T.J., HUSSEY, R.S. (2003). The parasitome of the phytonematode Heterodera glycines. Molecular Plant-Microbe Interaction 16, 720726. GOELLNER, M., SMANT, G., DE BOER, J.M., BAUM, T.J. & DAVIS, E.L. (2000). Isolation of beta-1, 4endoglucanase genes from Globodera tabacum and their expression during parasitism. Journal of Dermatology 32, 154 165. GOELLNER, M., WANG, X. H., & DAVIS, E.L. (2001). Endo--1, 4-glucanase expression in compatible plant nematode interactions. Plant Cell 13, 2241-2255. HAEGEMAN, A., JACOB, J., VANHOLME, B., KYNDT, T. & GHEYSEN, G. (2008). A family of GHF5 endo-1, 4-betaglucanases in the migratory plantparasitic nematode Radopholus similis. Plant Pathology. 57, 581 590. HAEGEMAN, A., JOSEPH, S. & GHEYSEN, G. (2011a). Analysis of the transcriptome of the root lesion nematode Pratylenchus coffeae generated by 454 sequencing technology. Molecular and Biochemistry Parasitology 178, 7 14. HENRISSAT, B., & BAIROCH, B. (1993). New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochemistry Journal 293, 781 788 (1993). IRDANI, T. (2000). Genetic analysis of three Bursaphelenchus species by random amplified polymorphic DNA. Nematologia Mediterranea 28, 11120. IWAHORI, H., KANZAKI, N. & FUTAI, K. (2000). A simple, polymerase chain reaction-restriction fragment length polymorphism-aided diagnosis method for pine wilts disease. Forest Pathology 30, 157 164. JAUBERT, S., LEDGER, T.N., LAFFAIRE, J.B., PIOTTE, C., ABAD, P. & ROSSO, M.N. (2002). Direct identification of stylet secreted proteins from root-knot nematodes by a proteomic approach.

Nematology, 2011 Molecular and Biochemistry Parasitology 121, 205211. JONES, J.T., FURLANETTO, C. & KIKUCHI, T. (2005). Horizontal gene transfer from bacteria and fungi as a driving force in the evolution of plant parasitism in nematodes. Nematology 7, 641646. KARIM, N., JONES, J.T., OKADA, H. & KIKUCHI, T. (2009). Analysis of expressed sequence tags and identification of genes encoding cell-wall-degrading enzymes from the fungivorous nematode Aphelenchus avenae. BioMed Central Genomics 10, 525. KANG, J.S., CHOI, K.S., CHIN, S.C., MOON, I.S., LEE, S.G. & LEE, S.H. (2004). Development of an efficient PCRbased diagnosis protocol for the identification of the pinewood nematode, Bursaphelenchus xylophilus (Nematoda: Aphelenchoididae) Nematology. 6, 279285. KANZAKI, N. & FUTAI, K. (2000). A PCR primer set for determination of the phylogenetic relationship of Bursaphelenchus species within the xylophilus group. Nematology. 4, 3541. KIKUCHI, T., JONES, J.T., AIKAWA, T., KOSAKA, H. & OGURA, N. (2004). A family of GHF45 cellulases from the pine wood nematode Bursaphelenchus xylophilus. FEBS Letters 572, 201-205. KIKUCHI, T., LI, H., KARIM, N., KENNEDY, M.W., MOENS, M. & JONES, J.T. (2009). Identification of putative expansin-like genes from the pine wood nematode, Bursaphelenchus xylophilus, and evolution of the expansin gene family within the Nematoda. Nematology 11, 355 364. KIKUCHI, T., SHIBUYA, H. & JONES, J.T. (2005). Molecular and biochemical characterization of an endo beta-1, 3-glucanase from the pinewood nematode Bursaphelenchus xylophilus acquired by horizontal gene transfer from bacteria. Biochemistry Journal 389, 117 125. KURODA, K. (1989). Terpenoids causing tracheid-cavitation in Pinus thunbergii infested by the pine wood nematode (Bursaphelenchus xylophilus). Annals of the Phytopathological Society of Japan 55, 170178. LEDGER, T.N., JAUBERT, S., BOSSELUT, N., ABAD, P. & ROSSO, M.N. (2006). Characterization of a new beta-1, 4-endoglucanase gene from the root-knot nematode Meloidogyne incognita and evolutionary scheme for phytonematode family 5 glycosyl hydrolases. Gene 382, 121128. LIAO, J.L., ZHANG, L.H., ENG, Z.X. (2001). Reliable identification of Bursaphelenchus xylophilus by rDNA amplification. Nematologia Mediterranea 29, 131135. MAMIYA, Y. & ENDA, N. (1972). Transmission of Bursaphelenchus lignicolus (Nematoda: Aphelenchoididae) by Monochamus alternatus (Coleoptera: Cerambycidae). Nematologica 18, 159162. MAMIYA, Y. (1983). Pathology of the pine with disease caused by Bursaphelenchus xylophilus. Annual Reviews of Phytopathology 21, 201220. MATSUNAGA, K., & TOGASHI, K. (2004). Among-tree difference in the inhibition of systemic dispersal of Bursaphelenchus xylophilus (Nema-toda: Aphelenchoididae) by Pinus densiflora. Applied Entomology and Zoolology 39, 271277. MITREVA, M., SMANT, G. & HELDER, J. (2009). Role of horizontal gene transfer in the evolution of plant parasitism among nematodes. In:

Nematology, 2011 Gogarten MB, Gogarten JP, Olendzenski LC (eds) Horizontal gene transferGenomes in flux. Humana Press, New York, pp517 535. MOTA, M.M TAKEMOTO, S., TAKEUCHI, Y., HARA, N., & FUTAI, K. (2006). Comparative Studies between Portuguese and Japanese Isolates of the Pinewood Nematode, Bursaphelenchus xylophilus. Journal of Nematology 38(4), 429 433. ODANI, K., SASAKI, S., YAMAMOTO, N., NISHIYAM, Y. & TAMURA, H. (1985). Differences in dispersal and multiplication of two associated nematodes, Bursaphelenchus xylophilus and Bursaphelenchus mucronatus in pine seedlings in relation to the pine wilt disease development. Journal of Japanese Forestry Society 67, 398403. C.H., BIRD, D.M, OPPERMAN, WILLIAMSON, V.M., ROKHSAR, D.S., BURKE, M., COHN, J., CROMER, J., DIENER, S., GAJAN, J., GRAHAM, S., HOUFEK, T.D., LIU, Q., MITROS, T., SCHAFF, J., SCHAFFER, R., SCHOLL, E., SOSINSKI, B.R., THOMAS, V.P. & WINDHAM, E. (2008). Sequence and genetic map of Meloidogyne hapla: a compact nematode genome for plant parasitism. Proceedings of the National Academy of Sciences 105, 14802 14807. REHMAN, S., BUTTERBACH, P., POPEIJUS, H., OVERMARS, H., DAVIS, E.L., JONES, J.T., GOVERSE, A., BAKKER, J. & SMANT, G. (2009a). Identification and characterization of the most abundant cellulases in stylet secretions from Globodera rostochiensis. Phytopathology 99, 194202. ROSSO, M.N., FAVERY, B., PIOTTE, C., ARTHAUD, L., DE BOER, J.M, HUSSEY, R.S., BAKKER, J., BAUM, T.J. & ABAD, P. (1999). Isolation of a cDNA encoding a beta-1, 4endoglucanase in the root-knot nematode Meloidogyne incognita and expression analysis during plant parasitism. Molecular PlantMicrobe Interactions 12, 585591. ROZE, E., HANSE, B., MITREVA, M., VANHOLME, B., BAKKER, J., SMANT, G. (2008). Mining the secretome of the root-knot nematode Meloidogyne chitwoodi for candidate parasitism genes. Molecular Plant Patholology 9, 1 10. SMANT, G., STOKKERMANS, J.P., YAN, Y., DE BOER, J.M., BAUM, T.J., WANG, X., HUSSEY, R.S., GOMMERS, F.J., HENRISSAT, B., DAVIS, E.L., HELDER, J., SCHOTS, WANG, X., MEYERS, D., YAN, Y., BAUM, T., SMANT, G., HUSSEY, R. & DAVIS, E. (1999). In planta localization of a beta-1, 4-endoglucanase secreted by Heterodera glycines. Molecular Plant-Microbe Interactions 12, 64 67. SMANT, G., STOKKERMANS, J.P., YAN, Y., DE BOER, J.M., BAUM, T.J., WANG, X., HUSSEY, R.S., GOMMERS, F.J., HENRISSAT, B., DAVIS, E.L., HELDER, J., SCHOTS, A. & BAKKER, J. (1998). Endogenous cellulases in animals: isolation of beta-1, 4endoglucanase genes from two species of plant-parasitic cyst nematodes. Proceedings of the National Academy of Sciences of the U S A 95, 49064911. TAKEUCHI, Y., KANZAKI, N. & FUTAI, K. (2005). A nested PCR-based method for detecting the pine wood nematode, Bursaphelenchys xylophilus, from pine wood. Nematology 7, 775782. YAN, Y., SMANT, G., STOKKERMANS, J., QIN, L., HELDER, J., BAUM, T., SCHOTS, A. & DAVIS, E. (1998). Genomic organization of four beta-

Nematology, 2011 1, 4-endoglucanase genes in plantparasitic cyst nematodes and its evolutionary implications. Gene 220:6170. YAN, Y., SMANT, G., DAVIS, E. (2001). Functional screening yields a new beta-1, 4-endoglucanase gene from Heterodera glycines that may be the product of recent gene duplication. Molecular PlantMicrobe 14(1), 63-71. Interactions 14, 6371.