Sie sind auf Seite 1von 309

Populationsgenetik der ersten Bauern Mitteleuropas

Eine aDNA-Studie an neolithischem Skelettmaterial

Inauguraldissertation
zur Erlangung des Akademischen Grades
eines Dr. phil.

vorgelegt dem Fachbereich 02


Sozialwissenschaften, Medien und Sport
der Johannes Gutenberg Universitt
Mainz
von

Wolfgang Haak
aus Knzelsau
2006

Tag des Prfungskolloquiums: 18. April 2006

Inhaltverzeichnis

1. Einleitung

2. Grundlagen zur Archologie der Neolithisierung

2.2 Modelle zur Neolithisierung Europas

2.3 Das frhe Neolithikum in Mitteleuropa


2.3.1 Der Star4evo-Krs-Cri8-Komplex
2.3.2 Die Linearbandkeramik (LBK)

7
9
11

2.4 Zur Anthropologie des Neolithikums

14

3. Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

18

3.1 Die Neolithisierung aus Sicht der Humangenetik


3.1.1 Forschungsgeschichtlicher Hintergrund
3.1.2 Das wave-of-advance-Modell von Ammerman und Cavalli-Sforza
3.1.3 Der Einsatz von klassischen genetischen Markern
3.1.4 Kritik am wave-of-advance-Modell

18
18
18
19
22

3.2 Forschungsstand molekulargenetischer Studien


3.2.1 Mitochondriale Variabilitt in Europa
3.2.2 Besiedlungsgeschichte Europas anhand von mtDNA und Y Chromosom

25
25
26

3.3 Die Haplogruppenverteilung im modernen maternalen Genpool unter besonderer


Bercksichtigung Europas

34

3.4 Methodische Grenzen populationsgenetischer Studien und Einsatzmglichkeiten von aDNAAnalysen


42
3.5 bersicht zu bisherigen palogenetischen Studien
3.5.1 Stammesgeschichte sowie Vor- und Frhgeschichte des Menschen
3.5.2 Identifikation, Material- und Spurenkunde
3.5.3 Verwandtschafts- und Geschlechtsbestimmung
3.5.4 Epidemiologie, Pathologien und andere genetische Marker
3.5.5 Phylogenie und Phylogeographie
3.5.6 Rekonstruktion von kologie und Ernhrungsgewohnheiten
3.5.7 Domestikation von Tieren und Pflanzen

44
45
46
47
47
48
49
49

3.6 Eigenschaften alter DNA


3.6.1 Grundlagen zur chemischen und physikalischen Mutagenese in vivo
3.6.1.1 Endogene chemische Mutationsmuster
3.6.1.2 Chemische Mutagene
3.6.1.3 Physikalische Prozesse
3.6.2 Postmortale Degradierung von DNA
3.6.3 Die Authentizittskriterien der aDNA-Forschung

51
51
51
53
54
54
57

3.7 Verwendete genetische Marker


3.7.1 Eigenschaften der mtDNA und ihre Eignung als populationsgenetischer Marker
3.7.1.1 Die Struktur der mitochondrialen DNA
3.7.1.2 Die maternale Vererbung und das Fehlen von Rekombination
3.7.1.3 Homoplasmie
3.7.1.4 Die Mutationsrate
3.7.1.5 Die molekulare Uhr
3.7.2 Short tandem repeats (STRs)

59
59
59
59
60
61
62
63

4. Fragestellung und Zielsetzung der Arbeit

65

5. Material und Methoden

66

5.1 Fundorte und Proben


5.1.1 Fundorte in Deutschland

66
66

Inhaltverzeichnis
5.1.2 Fundorte in den Niederlanden
5.1.3 Fundorte in sterreich
5.1.4 Fundorte in Ungarn
5.1.5 Fundorte in Litauen
5.1.6 Fundorte in Polen
5.1.7 Fundorte in Russland
5.2 Methoden
5.2.1 Manahmen zur Kontaminationsvermeidung
5.2.2 Probennahme und Probenvorbereitung
5.2.3 DNA-Extraktion
5.2.3.1 Isolation von DNA aus Knochen und Zhnen
5.2.3.2 Isolation von DNA aus Mundschleimhaut
5.2.4 Die Polymerase-Ketten-Reaktion (PCR)
5.2.4.1 Das Prinzip der Polymerase-Ketten-Reaktion
5.2.4.2 Primerdesign
5.2.4.3 Amplifikation mitochondrialer DNA
5.2.4.3.1 Amplifikation der Hypervariablen Region I (HVR I)
5.2.4.3.2 Verwendung von Uracil-N-Glykosylase
5.2.4.3.3 Amplifikation von Bereichen der coding region
5.2.4.4 Amplifikation nuklerer DNA
5.2.4.4.1 Amplifikation von STRs mittels AmpFlSTR Profiler PlusTM
5.2.4.4.2 Amplifikation von STRs mittels Multiplex-PCR zur molekularen
Geschlechtsbestimmung und Verwandtschaftsanalyse.
5.2.5 Aufreinigung der PCR-Produkte
5.2.6 Agarose Gelelektrophorese
5.2.7 Klonierung
5.2.7.1 Prinzip der Klonierung
5.2.7.2 Protokoll der Klonierung
5.2.7.2.1 Vorbereitende Schritte
5.2.7.2.2 Ligation und Ligationsfllung
5.2.7.2.3 Transformation/Elektroporation und Ausplattieren
5.2.7.2.4 Vervielfltigung der Klone
5.2.8 DNA-Sequenzierung
5.2.9 Fllung von Sequenzierprodukten
5.2.10 Die Kapillar-Elektrophorese
5.2.11 Enzymverdau der PCR-Produkte der coding region

72
72
73
73
74
74
78
78
80
81
81
82
83
83
83
84
84
86
86
87
87
89
90
91
92
92
93
93
94
95
95
97
98
98
99

5.3 Auswertung
5.3.1 Definition und Berechnung der post mortem Substitutionsrate
5.3.2 Definition und Berechung der Sttigungsrate
5.3.3 Definition und Berechnung deaminierender hot spot- bzw. cold spot-Positionen
5.3.4 Netzwerke
5.3.5 Populationsgenetische Simulation mit dem Programm Simcoal 2.0

100
100
101
102
103
104

5.4 Authentifizierung

106

6. Ergebnisse

113

6.1 Probenerhaltung und Amplifikationserfolg


6.1.1 Amplifikationserfolg
6.1.2 Kontamination der Kontrollen
6.1.3 Untersuchungen zur Diagenese mittels SAXS-Analyse

113
113
116
118

6.2 Untersuchte genetische Marker


6.2.1 Mitochondriale DNA
6.2.1.1 Hypervariable Region I (HVR I)
6.2.1.2 Amplifikation und RFLP-Analyse von Abschnitten der coding region
6.2.1.3 Amplifikation langer PCR-Produkte
6.2.2 Nuklere DNA

119
119
119
121
122
123

Inhaltverzeichnis
6.2.2.1 Short tandem repeat (STR) Genotypisierung mittels AmpFlSTR Profiler Plus
6.2.2.2 Short tandem repeat (STR) Genotypisierung mittels Anthrofiler 2004
6.2.2.3 Vergleich zwischen morphologischer und genetischer Geschlechtsbestimmung

123
127
129

6.3 Quantifizierung und Charakterisierung der postmortalen Sequenzvernderungen


6.3.1 Allgemeine post mortem Substitutionsrate
6.3.2 Sttigungsrate
6.3.3 Charakterisierung und Verteilung postmortaler Sequenzvernderungen

130
130
132
134

6.4 Vergleichende Analysen der Haplogruppenverteilung

139

6.5 Netzwerke

143

6.6 Populationsgenetische Simulation mit Hilfe des Programmes Simcoal 2.0

148

7. Diskussion

149

7.1. Methodendiskussion
7.1.1 Amplifikationserfolg
7.1.2 SAXS-Analyse
7.1.3 Verwendung von UNG
7.1.4 Kontaminationen, Kontaminationsraten und Kontaminationsvermeidung
7.1.5 Amplifikation langer mtDNA Fragmente und nuklerer DNA (ncDNA)
7.1.6 Reproduktionsstrategien zur Validierung und Authentifizierung
7.1.7 Zur post mortem Substitutionsrate und Sttigungsrate
7.1.8 Charakterisierung und Verteilung postmortaler Sequenzvernderungen

149
149
150
151
153
155
157
158
160

7.2 Die Authentizitt der Proben in der Gesamtanalyse

166

7.3 Zur Populationsgenetik der ersten Bauern im frhen Neolithikum


7.3.1 Die phylogenetische und phylogeographische Auflsung der mtDNA
7.3.2 Die Haplogruppen der neolithischen Individuen

181
181
181

7.4 Die Neolithisierung Europas im Spiegel der mtDNA-Haplogruppen


7.4.1 Die Bedeutung der Ergebnisse fr die Rezentgenetik
7.4.2 Die Bedeutung der Ergebnisse fr die Archologie und Anthropologie

190
196
198

8. Zusammenfassung

200

9. Literatur

202

10. Anhang

230

10.1 Zustzliche Tabellen

230

10.2 Verwendete Puffer und Lsungen

240

10.3 Verwendete Gerte, Chemikalien und Kits


10.3.1 Gerte
10.3.2 Chemikalien
10.3.3 Enzyme
10.3.4 Kits
10.3.5 Gefe, Einwegartikel und Schutzkleidung

240
240
241
242
242
243

10.4 Abkrzungsverzeichnis

244

10.5 Alignments der Sequenzen der neolithischen Individuen

245

Einleitung

1. Einleitung
Die Jungsteinzeit stellt eine der bedeutendsten Epochen der Menschheitsgeschichte dar.
Besonders in Eurasien ist dieser Zeitraum vom bergang der aneignenden zur
produzierenden Lebensweise, der so genannten Neolithischen Transition, geprgt.
Der Beginn der buerlichen Lebensweise im eurasischen Raum erfolgte vor ca. 12 000 Jahren
in der Region des so genannten Fruchtbaren Halbmonds im Nahen Osten, eines zu
damaliger Zeit naturrumlich begnstigten Gebiets. Von dort aus verbreitete sich die neue
Lebensweise in den nachfolgenden Jahrtausenden in die umliegenden Regionen und
gelangte schlielich auf verschiedenen Wegen in das nacheiszeitliche Europa. Die
archologische Forschung ber die Neolithisierung Mitteleuropas beschftigt sich seit langer
Zeit mit der Fragestellung, ob der Wandel, welcher in den materiellen Hinterlassenschaften
dokumentiert ist, auch einen Bevlkerungswechsel widerspiegelt. Erfolgte die Verbreitung
der neolithischen Lebensweise im Sinne einer wie auch immer gearteten Kolonisierung der
Nutzflchen durch die ersten Bauern oder wurde die Idee zu Ackerbau- und Viehhaltung
von ursprnglich jagenden und sammelnden Gesellschaften nach und nach bernommen?
Die Untersuchung der genaueren Umstnde dieser so bemerkenswerten Umstellung der
Lebensweise, deren Bedeutung in der Beschreibung Neolithische Revolution (Childe 1957)
Ausdruck finden sollte, ist seit jeher ein Forschungsschwerpunkt sowohl in der Vor- und
Frhgeschichte, der Anthropologie als auch zunehmend in der Genetik. In den vergangenen
Jahrzehnten wurde vermehrt mit Hilfe molekulargenetischer Methoden versucht, den
populationsgenetischen Hintergrund der Neolithischen Transition aus der heutigen
Datenlage zu rekonstruieren. Hierbei stellt die enorme populationsgenetische Dynamik des
eurasischen und vornehmlich europischen Raumes, welche auch geschichtlich belegt ist, ein
groes Problem dar, da hierdurch der Blick in die Vergangenheit in nicht unerheblichem
Mae verschleiert wird.
Die Analyse alter DNA (aDNA) bietet sich als ideale Methode an, sich mit den zentralen
Fragestellungen der Neolithisierung Europas zu beschftigen. Sie ermglicht die direkte
Analyse neolithischen Probenmaterials und damit eine Art molekulargenetischer Zeitreise,
die sich den tatschlichen neolithischen Verhltnissen zuwendet. Mit Hilfe der aDNAAnalysen knnen nicht nur die populationsgenetischen Fragestellungen bezglich der
Dynamik menschlicher Besiedlungsprozesse erforscht, sondern auch die Prozesse der
Domestikation und Verbreitung von ersten Haustieren und Nutzpflanzen genauer
beleuchtet werden.
Der Ansatz mittels aDNA-Analysen bestehende Fragestellungen der Neolithikumsforschung
zu beantworten, wurde erstmalig mit dem Projekt Die ersten Bauern in Europa und der
Ursprung der Rinder- und Milchwirtschaft. Biomolekulare Archometrie des Neolithikums
(gefrdert vom Bundesministerium fr Bildung und Forschung, Frderkennzeichen
03BUX1MZ) verfolgt.

Einleitung
In der vorliegenden Dissertation werden neolithische menschliche Skelettproben
vornehmlich aus Mitteleuropa mit molekulargenetischen Methoden untersucht. Ein
Vergleich mit rezenten populationsgenetischen Daten soll die Bevlkerungsdynamiken in
Europa vor, whrend und nach dem bergang zur buerlichen Lebensweise ermitteln und
deren Einflsse sowie Auswirkungen auf die heutige Bevlkerungsstruktur beschreiben.
Die groe Bedeutung der verbindenden Fragestellung macht im vorliegenden Projekt eine
interdisziplinre Herangehensweise an das Thema erforderlich. Der fcherbergreifende
Ansatz verknpft insbesondere Disziplinen wie die Vor- und Frhgeschichte, biologische
Anthropologie, Molekular- und Populationsgenetik.

Grundlagen zur Archologie der Neolithisierung

2. Grundlagen zur Archologie der Neolithisierung


2.2 Modelle zur Neolithisierung Europas
Der Schritt von einer aneignenden Jger- und Sammlergesellschaft im Epipalolithikum bzw.
Mesolithikum zur Sesshaftigkeit und Agrikultur im Neolithikum ist ein sehr entscheidendes
Ereignis der Menschheitsgeschichte. Nach dem Ende der letzten Eiszeit vollzog sich in
weiten Teilen Europas dieser als Neolithische Revolution bekannte Prozess, welcher
letztendlich zur Herausbildung und Prgung unserer heutigen Gesellschaften mit allen
sozialen und wirtschaftlichen Konsequenzen gefhrt hat.
Zunchst jedoch stand bei der Epochenbeschreibung und Begriffsbildung zum Neolithikum
dieser Schritt gar nicht im Vordergrund. Vielmehr wurde versucht, dem Auftauchen von
neuen Steinwerkzeugformen im archologischen Fundgut gerecht zu werden. Der jngste
Abschnitt der Steinzeit wurde demzufolge nach dem Neuauftreten von geschliffenem
Felsgestein benannt (neo, gr. Neu, lithos, gr. Stein). Erst nach und nach wurde der Prozess der
Neolithisierung, wie wir ihn heute kennen, mit Ackerbau und Viehzucht unabdingbar
verbunden, so dass dieser heute im Vordergrund steht. Vere Gordon Childe (1957) prgte
den Begriff Neolithische Revolution und wollte damit den immensen kulturellen Schritt
betonen, den er im bergang von der aneignenden zur produzierenden Wirtschaftsweise
erkannte und welchen er im Vergleich mit der Industriellen Revolution besttigt sah.
Ackerbau und Viehzucht sind die wesentlichen kulturellen Neuerungen der so genannten
Neolithischen Revolution, die auch in genetischer Sicht zu einer Reihe von fr den
Menschen und seine Umwelt bedeutenden Effekten gefhrt hat. In Folge von Ackerbau und
Viehzucht und den damit verbundenen zivilisatorischen Erscheinungen, wie dauerhafte
Sesshaftigkeit, Lager- und Viehhaltung und Entwicklung komplexer sozialer Verbnde (bis
hin zu den frhen stdtischen Hochkulturen) wuchs die menschliche Bevlkerung im
Vergleich zum Ende der Eiszeit bis heute auf ein mittlerweile Tausendfaches an. Durch den
kontinuierlichen Eingriff des Menschen in die Selektion von wilden Tieren und Pflanzen
entstanden domestizierte Formen, die in vielen Fllen die ursprnglichen Wildformen
verdrngten und berlebten.
Eines von mehreren Zentren des bergangs von Jgern und Sammlern zu Ackerbauern und
Viehzchtern ist der so genannte Fruchtbare Halbmond, ein Gebiet, das sich von der
sdlichen Levante, Jordanien und Palstina, dem Verlauf des Taurus und Zagros Gebirges
folgend, durch Sdost-Anatolien, Syrien und Irak bis fast zum Persischen Golf erstreckt.
Hier sollen nach archologischen Vorstellungen Weizen und Gerste kultiviert und die
Domestikation von Ziege, Schaf, Schwein und Rind zum ersten Mal stattgefunden haben.
Die Anzeichen von Domestikation und Landwirtschaft in archologischen
Fundzusammenhngen finden sich dort im 9. Jahrtausend v. Chr. und sollen danach
schrittweise und teilweise stark zeitversetzt in andere Regionen der Erde verbreitet worden
sein. In einigen Gebieten wie z.B. dem Nordwesten Russlands, dem stlichen Baltikum und

Grundlagen zur Archologie der Neolithisierung


nrdlicheren Skandinavien setzt die buerliche Lebensweise erst zur Eisenzeit ein (Zvelebil
1998; 2002, Zvelebil & Lillie 2000, Antanaitis 1999). Somit kann der Prozess der
Neolithisierung - in einem kontinentalen Kontext betrachtet als lang andauernd betrachtet
werden.
Birgt bereits die Transition im Vorderen Orient eine betrchtliche Anzahl an zu klrenden
Fragen hinsichtlich des berganges selbst und seiner Faktoren bzw. Grnde, so ist vor allen
das vollstndige Erfassen und Verstehen des Wie der Verbreitung der Idee Ackerbau und
Viehzucht in und ber Europa ein greres Unterfangen. Selbst bezglich der
Neolithisierung des mitteleuropischen Raumes existieren zahlreiche Erklrungsmodelle.
Die Divergenz der Hypothesen ist grtenteils bedingt durch die zeitweilig subjektiv
gefhrte Interpretation der Datenlage. So spielen bei Fragestellungen wie dieser - mit ca. 100jhriger Forschungstradition - immer Moden und zeitgeistliche Einflsse eine Rolle, sowie
regional dominierende Schulen und fast dogmenhafte Lehrmeinungen, welche kaum mehr
hinterfragt werden. Sogar die politische Gesinnung der Verfechter der einzelnen Hypothesen
kann im Spiegel der Wissenschaftsgeschichte sichtbar gemacht werden (ein detaillierter
berblick hierzu findet sich in Scharl 2004). Als Tatsache bleibt bestehen, dass es (auch
forschungsgeschichtlich
bedingt)
kaum
zusammenfassende
oder
ganzheitliche
Erklrungsanstze zur Neolithisierung Europas gibt.
Von Seiten der Archologie bestehen bezglich der Art und Weise der Verbreitung von
Ackerbau und Viehzucht nach und in Europa drei grundlegende Erklrungsmodelle (vgl.
Kap. 3.1):
1. Der traditionellen Meinung nach basiert der Prozess der Neolithisierung Europas auf
der Einwanderung von neolithischen Bauern nach Europa (Childe 1957, Piggott 1965,
Clark 1965). Demnach besiedelten neolithischen Bauern aus dem Nahen Osten
geeignete Gebiete in Europa und fhrten die buerliche Lebensweise ein. Als
zugrunde
liegender
Motor
dieses
Prozesses
wurde
ein
rasches
Bevlkerungswachstum angesehen, welches der frhbuerlichen Gesellschaften
zugesprochen wurde und somit die Verdrngung der einheimischen Bevlkerung
beinhaltete und erklrte.
2. Ein zweites Erklrungsmodell benennt die gegenteilige Situation (Dennell 1983,
Barker 1985, Whittle 1996, Kind 1998), in welcher der bergang zu Ackerbau und
Viehzucht in erster Linie durch Ideentransfer in kulturellen Kontaktzonen erklrt
wird. Einer Einwanderung von Trgern der neolithischen Kultur wird keine
ausschlaggebende Rolle beigemessen bzw. gnzlich ausgeschlossen.
3. Der dritte Erklrungsansatz stellt eine Synthese der beiden oben genannten Modelle
dar. Dies bedeutet, dass beide Szenarien eine Rolle spielten, jedoch zu
unterschiedlichen Zeiten in unterschiedlichen Regionen einen variierenden Beitrag
zur Neolithischen Transition leisteten (Zvelebil 1989, 2002; Chapman 1994; Thorpe
1996; Zilho 1997).

Grundlagen zur Archologie der Neolithisierung


Dass die Neolithische Transition in Europa, wie auch berall in der Welt, einen komplexen
und vielschichtigen Entwicklungsprozess darstellt, der sich nicht auf wenige Faktoren
vereinfachen lsst, ist unumstritten. Da die archologische Erfassung meist kleinrumig
erfolgt und dabei bereits im archologischen Material ersichtlichen Verbreitungsgebieten
von Fundkomplexen folgt, die als kulturelle Einheiten zusammengefasst werden (Price
2000), ist es nicht verwunderlich, dass fr die unterschiedlichen Regionen verschiedene
Hypothesen zur Neolithisierung existieren. Diese sind in mehreren nachfolgenden Modellen
zusammengefasst (Zvelebil 2000; Zvelebil & Lillie 2000):
Folk migration (Anthony 1990; Anthony & Brown 1991):
Direkter Zug einer Bevlkerung zu einem definierten Gebiet.
Demic diffusion (Ammerman & Cavalli-Sforza 1984; Renfrew 1987, vgl. Kap. 3.1.2):
Sukzessive ungerichtete Besiedlung einer Region durch nachfolgende Generationen.
Elite dominance (Renfrew 1987):
Unterwanderung eines Gebiets durch eine Minderheit, die jedoch die autochthone
Bevlkerung sozial und kulturell dominiert und ggf. kontrolliert.
Infiltration (Neustupny 1982):
Graduelle Unterwanderung eines Gebiets durch kleine spezialisierte Gruppen, die
spezifische konomische und gesellschaftliche Nischen besetzen.
Leap frog colonization (Zilho 1993; Andel & Runnels 1995):
Selektive Kolonisierung durch kleine Bevlkerungsgruppen, die gezielt bestimmte,
naturrumlich optimale Gebiete (z.B. Lbden) aufsuchen und somit Enklaven oder
Kolonien innerhalb der autochthonen Bevlkerung bilden.
Individual frontier mobility (Zvelebil 1995; 1996):
Kleinrumige wirtschaftliche Kontakte und etablierte soziale Beziehungsstrukturen
zwischen Bauern und Jger/Sammlern und den Kontaktzonen mit Transfer in beiden
Richtungen.
Contact:
Wirtschaftliche Kontakte entlang und durch Handelsrouten, die als
Kommunikationskanle dienen und innovative Technologien rasch verbreiten ohne
sich verlagernd auf die Bevlkerungsstruktur auszuwirken.
Streng genommen lassen sich aus archologischer Sicht keine Beweise fr eine
Einwanderungswelle greren Ausmaes bzw. Wanderungsbewegungen, die einen Groteil
des Kontinents betreffen, darlegen (Thomas 1996, Zvelebil 1989). Allerdings finden sich im
archologischen Fundgut Beweise und Assoziationen fr die Einfhrung von Ackerbau &
Viehzucht an bestimmten Zeitpunkten, die innerhalb Europas einen deutlich erkennbaren
chronologischen Gradienten von Sdwest- nach Nordosteuropa aufweisen (Clark 1965,
Ammerman & Cavalli-Sforza 1984, Pinhasi et al. 2000). Ein groes Problem stellt die Tatsache

Grundlagen zur Archologie der Neolithisierung


dar, dass sich Migration als Prozess nicht im archologischen Material ablesen lsst (Renfrew
1987). Daher ist grundstzlich die Deutung von verwandtem Fundgut ber grere
Distanzen als Resultat von Handelsbeziehungen oder aber von Migration kritisch zu sehen.
Prinzipiell ist in den berwiegenden Teilen Europas eine kulturelle Kontinuitt im
Fundkomplex der meso-neolithischen Transition festzustellen, der einen abrupten Wechsel
der Lebens- und Wirtschaftweise und einen damit assoziierten Bevlkerungswechsel
unwahrscheinlich macht (Bogucki 1988, Zvelebil 1998; 2002, Price 2000). Zvelebil sieht jedoch
in Mittel- und Sdosteuropa Beweise fr einen Abbruch der mesolithischen Tradition und
ein abruptes Einsetzen einer neuen neolithischen Sachkultur, das er sich nur mit einer der
denkbaren Formen der Kolonisierung erklren kann. Das scheinbar bergangslose und
schnelle Einsetzen der buerlichen Lebensweise in Sdost- und nachfolgend in Mitteleuropa
wirft Fragen auf, fr die in der Archologie nur eine Kolonisierung jedweder Art als
Erklrung herangezogen wird.

Grundlagen zur Archologie der Neolithisierung

2.3 Das frhe Neolithikum in Mitteleuropa


Derzeit besteht in der Archologie neben dem allgemein akzeptierten Ursprung im Nahen
Osten auch der Konsens ber mindestens zwei Verbreitungswege der Landwirtschaft nach
Europa. Zum einen wird der mediterrane Weg in Richtung Westen entlang der
Mittelmeerkste postuliert. Diese Route beinhaltet sowohl die Mittelmeerinseln als auch
Nordafrika. Parallel hierzu sind der binneneuropische Landweg (Lning 2000) ber den
Balkan und dessen Tiefebenen von besonderer Bedeutung. Dieser hypothetische
Verbreitungsweg wird dadurch gesttzt, dass die frhneolithische mitteleuropische Kultur,
die Linearbandkeramik (LBK), aufgrund vergleichbarer keramischer Besonderheiten in der
Tradition der frhen sdosteuropischen bzw. balkanischen archologischen Kulturen
Star4evo und Krs (benannt nach den jeweils ersten charakteristischen Fundsttten in
Star4evo in Serbien/Montenegro bzw. entlang des Flusses Krs in Ungarn) zu stehen
scheint (Abbildung 1 und Abbildung 2).
Gem traditioneller - und hier in erster Linie - osteuropischer archologischer
Forschungsmeinung wird angenommen, dass Ackerbau und Viehzucht als Paket
neolithischer Prgung vom Nahen Osten ber den Balkan nach Mitteleuropa gelangt seien,
wobei die Ausbreitung bis ins Karpatenbecken und die ungarische Tiefebene schnell
erfolgte, dort aber aufgrund des Erreichens der Nordgrenze der mediterranen Klimazone
zunchst stagnierte. In dem darauf folgenden Zeitraum von ca. 500 Jahren erfolgte nach
Meinung ungarischer Archologen die Anpassung der Wirtschaftsweise an das
mitteleuropische Klima, welche gleichermaen die Initialzndung fr die Verbreitung der
bandkeramischen Kultur darstellte (Kalicz & Makkay 1977, Gronenborn 1999, Scharl 2004).
In den nachfolgenden Kapiteln wird auf die archologischen Kulturen, die fr die
Inlandsroute der Neolithischen Transition eine bedeutende Rolle spielten und mit welchen
die Mehrzahl der untersuchten neolithischen Skelettindividuen der vorliegenden Arbeit
assoziiert sind, eingehender dargestellt.

Grundlagen zur Archologie der Neolithisierung

Abbildung 1. Die Verbreitung frhbuerlicher Kulturen und die mglichen Verbreitungswege der
Landwirtschaft in Europa und im Nahen Osten (nach Gronenborn 2005). Die postglaziale
Entwicklung des Klimas ist anhand des variierenden Sauerstoffisotopenverhltnisses (W18O) des
grnlndischen GRIP-Eisbohrkerns dargestellt.

Grundlagen zur Archologie der Neolithisierung

2.3.1 Der Star0evo-Krs-Cri3-Komplex


Auf die Beziehung der frhen mitteleuropischen LBK zu sdosteuropischen Kulturen
wurde bereits hingewiesen. Einflsse aus dem transdanubischen Raum wurden 1960 von
Quitta anhand von charakteristischen Gefformen bzw. -stilen beschrieben.
Das frhe Neolithikum in Sdosteuropa war im Wesentlichen durch den archologischen
Fundkomplex Star4evo-Krs-Cri8 charakterisiert. Dieser umfasste die regionale
frhneolithische Star4evo-Kultur, die in Sdwestungarn und Serbien verbreitet war, die
Krs-Kultur, die in Ostungarn lokalisiert war und deren rumnisches Pendant, die Cri8Kultur (Gronenborn 1999, Scharl 2004). Die Beziehungen der einzelnen Kulturen
untereinander sowie deren chronologische Entstehung ist noch unklar, es lsst sich jedoch
konstatieren, dass sie alle als regionale Entwicklung der Protostar4evo-Stufe gelten, welche
hauptschlich in der Stufe A durch Keramikfunde (Weie Verzierungen auf rotem Grund
bzw. rot-monochromer Keramik) charakterisiert ist. Diese ist vor 6000 v. Chr. noch
berregional
einheitlich
und
verkrpert
die
Nord-Sd-gerichtete,
erste
Neolithisierungswelle. Nach 6000 v. Chr. setzte eine Differenzierung des Keramik-Stils ein,
die in der Ausprgung des Star4evo-Krs-Cri8-Komplex mndete, so dass sich diese drei
regionalen Entwicklungen heute typologisch unterscheiden lassen (Abbildung 2).

Abbildung 2. Entstehung und Verbreitung der frhneolithischen Kulturen im Karpatenbecken


und angrenzenden Gebieten (modifiziert nach Gronenborn 1999).

Grundlagen zur Archologie der Neolithisierung


Auch fr das Karpatenbecken stellt sich die grundstzliche Frage, ob sich die neue
Wirtschaftweise durch Migration oder durch Prozesse der Akkulturation durchsetzen
konnte. Fr das Gebiet Sdosteuropa ist, abgesehen von einigen prkeramischen Funden in
Griechenland, das prkeramische Neolithikum nicht nachgewiesen. Demnach stellt die
neolithische Wirtschaftsweise fr den Raum des Karpatenbeckens eine unbekannte
Erneuerung. Leider liegen fr selbiges Gebiet nur sehr wenige mesolithische Befunde vor, so
dass ber die Transition nur gemutmat werden kann. Somit kann erst mit dem Auftreten
des Star4evo-Krs-Cri8-Komplexes Ackerbau und Viehzucht auch fr den
transdanubischen Raum angenommen werden (Preu 1998, Pavk 1994).
Es wird allgemein angenommen, dass die Durchsetzung der landwirtschaftlichen
Lebensweise im frhen Neolithikum durch die geografische Lage im Karpatenbecken unter
kologischen Gesichtpunkten unter klimatisch gnstigen Einflssen stand, da sie zeitlich in
ein Klimaoptimum des Atlantikums fiel (Preuss 1998).
Als Wirtschaftsgrundlage wurde sowohl die Haltung von Schafen, Ziegen, Rindern und
Schweinen als auch die Kultivierung von Emmer, Einkorn, Weizen sowie Linsen und Erbsen
nachgewiesen (Kalicz 1990), wobei der Schwerpunkt auf der Viehzucht lag. Es muss dabei
betont werden, dass in beiden Gebieten auch die Jagd als Ergnzungsfaktor noch nicht in
den Hintergrund getreten war. Neben der Keramik konnten auch in den Subsistenzmustern
Unterschiede zwischen der Star4evo- und der Krs-Kultur nachgewiesen werden, die sich
auf die unterschiedlichen Naturrume zurckfhren lieen. So berwogen in der
ungarischen Tiefebene, die von zahlreichen Seen, Fluss- und Bachlufen geprgt ist, noch der
Fischfang die Jagd auf Wild, whrend in der Star4evo-Kultur, die in hgeligem Gebiet
lokalisiert ist, Viehzucht und Feldbau vorherrschend waren (Bknyi 1989).
Weitere Unterschiede zwischen den beiden Kulturen fanden sich bei den Siedlungen bzw.
im Siedlungswesen. In der Krs-Kultur konnten oft nur kurze Belegzeiten der Siedlungen
nachgewiesen werden, die auf hufige Siedlungsverlegungen bzw. eine nur temporre
Sesshaftigkeit hinwiesen, wohingegen bei (allerdings wenigen) Star4evo-Siedlungspltzen
mehrere Schichten zu finden waren, die auf eine Siedlungskontinuitt hindeuteten (Preuss
1998, Gronenborn 1999). Dagegen war im Verbreitungsgebiet der Krs-Kultur eine
wesentlich hhere Siedlungsdichte feststellbar. Dieser Umstand lie sich durch die gnstigen
kologischen Verhltnisse des Flachlandes erklren. Im Vergleich mit den greren Gebieten
Star4evo- und Cri8-Kulturen waren im kleineren Gebiet der Krs-Kultur mit leicht zu
bearbeitenden Ackerflchen und einem dichten Wassernetz mehrere Faktoren vereint, die
die nachhaltige Etablierung und Weiterentwicklung der neolithischen Lebensweise
begnstigten. Zum einen bot die wasserreiche Ebene ein groes Angebot an Wild und Fisch,
ermglichte eine effiziente Viehhaltung (vor allem im Hinblick auf die Rinderwirtschaft) und
bot optimale Bedingungen fr den Pflanzenbau. Mglicherweise kann aus diesen Grnden
besonders der in der Phase der regionalen Differenzierung prosperierenden Krs-Kultur im
Rahmen des umfassenden Star4evo-Krs-Cri8-Komplexes eine besondere Rolle zugeordnet
werden, die hinsichtlich der weiteren Neolithisierung des geografisch sowie zeitlich
angrenzenden westlichen Bereichs der Linearbandkeramik als auslsendes Element
bezeichnet werden kann.

10

Grundlagen zur Archologie der Neolithisierung

2.3.2 Die Linearbandkeramik (LBK)


Die Einfhrung der Landwirtschaft in Mitteleuropa ist mit der bandkeramischen Kultur zu
verbinden. Diese Kulturstufe wurde nach ihrer typischen, mit linearen Bndern verzierten
Keramikgefe benannt (Klopffleisch 1884) und wird daher in der Literatur meist als
Linearbandkeramik oder auch Linienbandkeramik (engl. Linear Pottery Culture) bezeichnet. Die
charakteristische Keramik zeigt als Grundmotive lineare Muster aus Spiralen,
Wellenbndern, Mandern und Winkelbndern, welche teilweise durch Schnittstiche ergnzt
sein knnen. Als Gefformen sind einfache Kalottenschale, kugeliger Topf und bauchige
Flasche mit Trichterhals bekannt. Bedeutend ist hierbei weniger die Keramik selbst, als ihre
groflchige Verbreitung. Fundmaterial aus dem gesamten Mitteleuropa unterstreicht die
grorumige Reichweite und den bedeutenden Stellenwert dieser Kultur zur Zeit ihrer
grten Ausdehnung, welche 5500 v. Chr. in Kerngebieten begann (Transdanubien) und sich
bis 5000 v. Chr. vom Pariser Becken bis in die Donauebene erstreckte (Zimmermann 2002a;
2000b, Gronenborn 1999, Lning 2000, Scharl 2004). Die Tatsache, dass in einem so groen
Verbreitungsraum hnliche Keramik vorherrscht, fhrte dazu, dass man von einer
kulturellen Einheit ausging und somit die Trger der Kultur, also die Hersteller und Nutzer
der Keramik, als Bandkeramiker bezeichnete (Klopffleisch 1884, zitiert in Gronenborn 2005).
Im zeitlichen Verlauf der Kulturstufe bildeten sich regionale Differenzierungen, sogenannte
Lokalstile heraus, die teilweise sehr stark sind, ohne die berregionale Vergleichbarkeit zu
verlieren. Hierbei lassen sich zwei Tendenzen feststellen: zum einen das Herausheben der
Bandmuster durch unterschiedliche Fllformen und zum anderen die Zunahme der Stichgegenber der Ritzverzierungen (Sangmeister 1983). Die unverzierte, grbere Keramik zeigt
ebenfalls berregionale hnlichkeit. Hervorzuheben sind hier als Vorrats-, oder Kochtpfe
gedeutete Gefe, die vermutlich an Schnren aufgehngt wurden. Die Zahl und
Anordnung dieser sen (Dreizahl) ist fr die Bandkeramik charakteristisch und findet sich
nicht in vergleichbaren frh- bzw. mittelneolithischen Keramikgattungen, wo eine Vierzahl
blich ist.
Das bereits erwhnte begriffsdefinierende Element des Neolithikums, das geschliffene
Felsgestein, besitzt in der Linearbandkeramik einen charakteristischen Vertreter. Der so
genannte Schuhleistenkeil, ein asymmetrisches Steinbeil, das aller Voraussicht nach in
variierenden Formaten zur spezialisierten Holzbearbeitung diente, konnte bislang bei keiner
lteren neolithischen Kultur gefunden werden. Der Fundbestand an Felsgesteingerten wird
durch Gegenstnde wie Mahlsteine, Reiber und Schleifplatten erweitert. Zwar besitzen diese
keine
fr
die
Linearbandkeramik
besondere
Form
oder
Verzierung
als
Unterscheidungsmerkmale von anderen Kulturen, jedoch sind hier besonders die Mahlsteine
als Anzeiger fr eine buerliche Lebensweise der Bandkeramiker herauszustellen. Ein
weiterer Indikator fr eine produzierende Wirtschaftsweise findet sich in den
Feuersteingerten. Hier fllt auf, dass sich im Vergleich zum gut dokumentierten (weil hier
fast als einziges erhaltenen) Silexgerteinventar der frheren bzw. zeitgleichen
Jger/Sammler-Kulturen lediglich einfache, wenig bearbeitete Klingen finden, die sich nicht
weiter typisieren lassen. Auffllig an diesen Klingen ist eine bestimmte glnzende
Oberflche. Die Klingen fanden daher wohl Anwendung in sogenannten Kompositsicheln,
also Sicheln aus Holz oder Knochen, die mit Feuersteinklingen versehen wurden. Die

11

Grundlagen zur Archologie der Neolithisierung


Ursache des Oberflchenglanzes konnte in Experimenten besttigt werden, wobei eine
Oberflchennderung des Silex beobachtet wurde, die bei Bearbeitung starker
siliziumhaltiger Grser entsteht. Zweifellos lassen sich hierbei in Anwesenheit von
Mahlsteinen Hinweise auf Getreidebau erkennen. Sollten diese Klingen jedoch nur zum
Schnitt von Schilf als Dachdeckmaterial gedient haben, so kann zumindest von einer
fortgeschrittenen Sesshaftwerdung im Zuge des Hausbaus gesprochen werden (Sangmeister
1983).
Besonders Hausbau und Siedlungswesen sind in der Bandkeramik sehr gut untersucht,
wobei auch hier eher integrierende Gesamtmerkmale festgehalten werden knnen, als
regional begrenzte Merkmalskomplexe. Bereits 1934 wurden von W. Buttler die Grundrisse
von Rechteckhusern gefunden (zitiert nach Sangmeister 1983), heute sind aus allen
Bereichen des bandkeramischen Verbreitungsgebietes vergleichbare Hausgrundrisse
bekannt. Der Grundtyp des Hauses war ein groer Bau von ca. 8m Breite und 30m Lnge,
wobei die Dimensionen variierten, die Proportionen jedoch immer gleich blieben. Das Dach
wurde von drei Stnderreihen getragen, die Wnde bestanden aus locker gestellten
dnneren Pfosten, die vermutlich nicht tragend waren. Die Ausrichtung erfolgte immer nach
Nordwesten, wo auch die Wnde und ein Viertel der Lngsseiten durch Spaltbohlen oder
dichter gesetzte Pfosten verstrkt waren. Brandreste des Lehmbewurfs konnten den
Unterbau aus Ruten und Flechtwerk besttigen. Neben den Grobauten sind wenige
kleinere Bauten belegt, deren Nutzung unklar ist. Zahlreiche Gruben unterschiedlicher Tiefe
sind auf Siedlungsflchen neben und zwischen den Husern vorhanden. Teilweise sind diese
auf den Wandverputz an Ort und Stelle zurckzufhren, in anderen regelmiger geformten
Gruben wiederum scheinen gewisse Ttigkeiten (z.B. eine Silex-Werksttte in Arnsbach,
Nordhessen, Sangmeister 1983) durchgefhrt worden zu sein.
Im Gegensatz zur Anzahl gefundener Siedlungen ist die Anzahl gefundener Grber bzw.
Grberfelder berraschend gering. Zudem findet sich unter diesen ein groer berhang an
frhbandkeramischen Grbern, wohingegen Grber mit sptbandkeramischen Beigaben im
Lokalstil bislang eher selten sind. Die Bestattung erfolgte in Hockerlage und als Beigaben
finden sich die charakteristischen bandkeramischen Gegenstnde, hier vor allem
Schuhleistenkeile. Keramik tritt weniger hufig auf als in spteren Epochen, wobei eine
bevorzugte Gefform nicht festzustellen ist. Auffllig in Grbern ist die Beigabe von Rtel
und Schmuck aus Spondylusmuscheln. Eine geschlechterspezifische Beigabensitte lie sich
bislang nur bedingt erkennen. Zusammenfassend lsst sich jedoch auch hier feststellen, dass
sich diese Bestattungsweise und Beigabensitte als die gesamte Bandkeramik umfassendes
Merkmal darstellt.
Beweise fr Ackerbau als Wirtschaftsweise treten gelegentlich auch als Primrindizien in
den Siedlungsgruben auf. So finden sich verkohlte Pflanzenreste, vor allem Samenkrner der
Weizenarten Einkorn und Emmer, sowie mehrzeiliger Gerste. Neben den Getreidesorten, die
vermutlich vermischt angebaut wurden, finden sich als weitere Nutzpflanzen Erbsen,
Linsen, Lein und Mohn. Wahrscheinlich wurde das Getreide gedroschen und vor der
Einlagerung gerstet (zumindest fr Bhmen knnen gebrannte Lehmplatten als Rstpltze
gedeutet werden) (Sangmeister 1983).

12

Grundlagen zur Archologie der Neolithisierung


Im Verhltnis zu den Indizien fr den Ackerbau sind solche fr die Viehzucht in weiten
Gebieten der Linearbandkeramik eher gering. Sicher nachgewiesen ist die Haltung von Rind,
Schwein, Schaf und Ziege, deren Knochen man in den Abfallgruben fand. Gemessen an der
Quantitt der Haustierfunde scheint der Stellenwert der Viehzucht nicht hoch gewesen zu
sein. Allerdings spielen fr diese Interpretation die generellen Erhaltungsbedingungen eine
groe Rolle. Darber hinaus mssen auch besondere Schlachtgewohnheiten und
Verwertungssitten in Betracht gezogen werden, welche archologisch kaum nachgewiesen
werden knnen. Gleiches gilt fr den Stellenwert der Jagd. Zwar liegen hier gengend
Pfeilspitzenfunde aus Grbern und Siedlungen vor, die sich jedoch in der Funddichte und
Form gnzlich von der mesolithischen Tradition unterscheiden, so dass von der Jagd als
bedeutendem Wirtschaftsfaktor kaum gesprochen werden kann. Die Grubenfunde von
Wildtieren sind ebenfalls sehr gering. Am ehesten kann fr die frhe Linearbandkeramik
daher von einer Mischwirtschaft ausgegangen werden, die mit wechselnder Intensitt
Ackerbau und Viehzucht betrieb und Jagd bzw. Fischerei als Ergnzung oder in Notzeiten
erforderlich wurde. Die Vorstellung, dass in der Linearbandkeramik der Getreideanbau eine
grere Bedeutung als die Viehzucht gehabt habe, wurde durch Beobachtungen von B.
Sielmann (1972) gesttzt. Dieser konnte nachweisen, dass die Verteilung der Siedlungspltze
vornehmlich nach der Beschaffenheit des Bodensubstrats, des Klimas und der Anbindung an
das Gewssernetzes erfolgte. Die Auswahl musste nach Merkmalen der Vegetation erfolgt
sein und sollte den natrlichen Anforderungen fr den Regenfeldbau entsprechen.
Gleichermaen kann man davon ausgehen, dass besagte Siedlungskammern bzw.
Landschaften auch fr die Viehzucht sehr geeignet schienen.
Die Gesamtsicht der bandkeramischen Befunde lsst ein buerliches Wirtschaftsystem
erkennen, welches bereits sowohl im Siedlungswesen als auch in der Regionen
bergreifenden Gesellschaftsstruktur komplexe Zge annahm. Daher verwundert es auch
nicht, dass dieses funktionierende System eine rasche und groe Verbreitung erlangte. Nun
stellt jedoch eben diese bereits vollstndig herausgebildete Neolithisierung der Bandkeramik
die Fragen nach ihren zeitlichen und rumlichen Ursprngen auf.

13

Grundlagen zur Archologie der Neolithisierung

2.4 Zur Anthropologie des Neolithikums


Da die Anthropologie mit der Archologie einen gemeinsamen Forschungsursprung besitzt,
wurde von Beginn versucht, die Fragestellungen, die sich aus der Meso-Neolithischen
Transition ergeben, mit anthropologischen Anstzen zu lsen. Die Anthropologie des
Neolithikums war zu Beginn der Forschungsarbeiten noch von der Ansicht geprgt, dass
sich die archologischen Kulturen auch im Skelettmaterial der jeweiligen Kulturen
morphologisch-morphognostisch wieder finden und charakterisieren lassen. Als Beispiel sei
hier Schliz (1909) genannt, der konstatiert, ...dass diese bestimmten Kulturkreise wirklich
getragen waren von wohlcharakterisierten Volksstmmen von bestimmtem, somatischanthropologischem Habitus.
Diese Ansicht wurde teilweise auch noch nach den beiden Weltkriegen von einigen
Anthropologen vertreten, so sah beispielsweise Gerhardt (1978) auch nach dem
grundlegenden Paradigmenwechsel der Anthropologie, die Hauptaufgaben derselben in der
Typologie und Typognose bzw. der Typogenese.
Aus heutiger Sicht lsst sich feststellen, dass Arbeiten wie die genannten die Ideologien und
dem Paradigma des damaligen Zeitgeistes entsprachen, welche sich in einigen Fllen lange
gehalten haben. Weiterhin kann festgehalten werden, dass diese Arbeiten heute aufgrund
ihrer
oft
zweifelhaften
typologischen
Herangehensweise
nur
noch
von
forschungsgeschichtlichem Interesse sein knnen.
Ein grundstzliches Problem stellte die geringe Funddichte dar, so wurden zwar die
wenigen zur Verfgung stehenden Funde methodisch penibel erfasst, die Interpretationen
und Schlussfolgerungen wurden aber trotz geringer Materialbasis weit gefasst.
Kritik an diesen weit reichenden Interpretationen bzw. der Zuordnung eines Typus zu einer
archologischen Kultur wurde jedoch noch in derselben Publikationsreihe von W. Bernhard
(1978) angefhrt. Dieser stellt in der einzigen berregionalen Aufarbeitung des damalig
bekannten Materials fest, dass die Trger der Bandkeramik anthropologisch keineswegs eine
homogene Bevlkerungsgruppe darstellen, sondern regional unterschiedliche morphologische
Differenzierungstendenzen aufweisen (Bernhard 1978). Abgesehen von dieser Arbeit liegen fr
das fr die vorliegende Arbeit interessanten Verbreitungsgebietes der Bandkeramik keine
berregionalen Vergleichsarbeiten vor. Die wenigen neolithischen Funde in bestehenden
anthropologischen Studien waren weitgehend auf kleinrumige bzw. regionale
Materialaufnahmen beschrnkt (z.B. Bach 1978, Bach & Bach 1989).
Erst in den letzten 20 Jahren konnten vermehrt Fundpltze des Neolithikums und
insbesondere der Bandkeramik ergraben und dokumentiert werden, welche das bislang
whrende anthropologische Bild dieser Epoche erweitern knnen. Es stehen, zumindest fr
den deutschen Raum, die anthropologischen Bearbeitungen in den meisten Fllen noch aus
(z.B. Schwetzingen, Vaihingen, Herxheim, Derenburg und Halberstadt) so dass zum
gegenwrtigen Zeitpunkt keine aktuelleren Bearbeitungen einzelner Regionen vorliegen.
Eine Ausnahme bildet eine aktuelle Studie von C. Meyer (2004, Meyer & Alt 2005), welche in
einer osteometrischen Vergleichsuntersuchung das Oberrheingebiet erfasste. Als
Datengrundlage wurden vier frhneolithische und drei mittelneolithische Grberfelder

14

Grundlagen zur Archologie der Neolithisierung


herangezogen, wobei erstmals wieder ein vergleichender bevlkerungsbiologischer Ansatz
verfolgt wurde. Als vorlufiges Ergebnis lie sich eine Bevlkerungskontinuitt vom Frhbis ins Mittelneolithikum feststellen, wobei im Falle des oberrheinischen Fundplatzes von
Jechtingen der Rssener Kultur ein statistisch signifikant unterschiedliches Variationsmuster
beobachtet werden konnte: Mit der grtenteils aus Rssener Zeit stammenden Population mag
hier ein neues bevlkerungsbiologisches Element erfasst sein, welches zuvor im Arbeitsgebiet nicht
vertreten war (Meyer & Alt 2005).
Analog zur Archologie existieren auch seitens der Anthropologie nur wenige Studien, die
in einem berregionalen Ansatz mit morphologischen Methoden die Fragestellungen zur
Neolithisierung Europas thematisieren.
Eine aktuelle Studie von Brace und Kollegen (2006) beinhaltete die Distanzanalysen von 24
Kraniofazialmaen an einer Stichprobe von insgesamt 1282 Individuen, die sowohl moderne,
bronzezeitliche, neo-, meso-, und palolithische Individuen aus Europa, dem Nahen Osten,
West- und Zentralasien sowie Nordafrika umfasste. Die Ergebnisse dieser Studie konnten
unter anderem zeigen, dass fr den diese Arbeit betreffenden Bereich Mitteleuropas eine
grundstzliche grere hnlichkeit der neolithischen Individuen mit Neolithikern anderer
Regionen besteht als mit modernen Bevlkerungsgruppen Mitteleuropas. Selbiges
hnlichkeitsmuster galt auch fr alle Individuen der Bronzezeit. Dagegen konnte fr die
Neolithiker und Individuen der Bronzezeit aus Sdosteuropa eine hnlichkeit mit den heute
dort lebenden Bevlkerungen festgestellt werden. Nach Ansicht der Autoren untersttzten
die Ergebnisse dieser osteometrischen Studie daher diejenigen Neolithisierungsmodelle, in
welchen zwar eine Neolithisierung Sdosteuropas durch einwandernde Bauern erfolgt ist,
die weitere (ideelle) Verbreitung des neolithic package jedoch durch eine Vermischung mit
einheimischen Sammler-Jgern bzw. in einem Aufgehen in den jeweiligen autochthonen
Bevlkerung der benachbarten Gebiet zu sehen ist.
Pinhasi & Pluciennik verfolgten bereits 2004 einen vergleichbaren Ansatz. Als
Datengrundlage diente eine Auswahl von 16 Kranial- und Mandibelmaen, sowie von zwei
Zahnmaen an neo- und mesolithischen Skelettindividuen. Das Untersuchungsgebiet
beschrnkte sich auf die drei Regionen (Anzahl der untersuchten Individuen in Klammern):
Anatolien und die Levante (Region 1: 114), Sdosteuropa (Region 5: 79) und die
Mittelmeerregion von Spanien bis Griechenland (Region 6: 38). Die Autoren kamen nach den
Ergebnissen der Distanz- sowie Hauptkomponentenanalysen zu den Schlussfolgerungen,
dass bereits die Stichprobe aus Region 1 eine groe Heterogenitt bezglich der Variabilitt
der untersuchten Merkmale aufweist. Eine Verbindung der Stichprobe von Sdosteuropa
konnten sie in der ausgeprgten Homogenitt mit Proben aus Anatolien sehen, wobei sie fr
die geringere Variabilitt der Merkmale in Sdosteuropa gleichsam ein Grndereffekt und
eine sehr geringe Interaktion mit autochthonen Sammler-Jger-Bevlkerungen postulierten.
Dagegen fhrten sie fr den verbleibenden Mittelmeerraum eine hhere Heterogenitt an,
fr die sie komplexere demographische Prozesse als eine graduelle demische Verbreitung
annahmen.

15

Grundlagen zur Archologie der Neolithisierung


Eine weitere berregionale, jedoch nichtmetrische, sondern palodemographische Studie
wurde 2002 von Bocquet-Appel verffentlicht. Basierend auf der Annahme, dass in einer
ansteigenden Populationsgre der Anteil an Kindern und Jugendlichen hoch ist, in einer
schwindenden Bevlkerung dagegen klein, wurde dieser Anteil im Hinblick auf Geburtenund Wachstumsraten von 68 ausgewhlten neolithischen und wenigen mesolithischen
Bestattungspltzen untersucht. Die Ergebnisse der einzelnen Fundorte wurden in
chronologischer Distanz zur Front der neolithischen Diffusion nach Ammerman & CavalliSforza (1984) aufgetragen (vgl. Kap. 3). Hieran konnte nach einer stationren
Bevlkerungsgre im Mesolithikum mit Beginn des frhen Neolithikums eine
demographische Transition im Sinne einer stark ansteigenden Bevlkerung beobachtet
werden. Bocquet-Appel erklrte den hheren Anteil an Kindern und Jugendlichen mit der
hheren Fertilittsrate der Neolithiker, die er letztlich unter ansonsten identischen
Voraussetzungen mit der verkrzten Stilldauer der Neolithiker begrndete. Diese sah er
einerseits in den Erfordernissen des intensiveren Arbeitsaufwands der buerlichen
Lebensweise erzwungen und andererseits durch die Umstellung der Ernhrungsweise im
Neolithikum ermglicht.
Einen weder klassisch-morphologischen noch genetischen Ansatz verfolgte die
Arbeitsgruppe um Douglas Price und Alexander Bentley, die mit Hilfe von Isotopenanalysen
an menschlichem Skelettmaterial die regionale Mobilitt der Neolithiker in Mitteleuropa
untersuchten (Price et al. 2001, Bentley et al. 2002; 2003). Hier diente vor allem das
variierende Verhltnis der beiden Strontiumisotope 87Sr/86Sr als Grundlage, welches die
geochemische Signatur eines Ortes widerspiegelt (Bentley et al. 2002). Strontium gelangt
ber die Nahrungskette in den menschlichen Organismus, wo es anstelle von Kalzium im
Hydroxylapathit des Knochen bzw. der Zhne eingebaut wird. Da sich Strontium in Zhnen
(4-12 Jahre) schneller manifestiert als in Knochen (6-20 Jahre), kann bei einem Vergleich von
beiden Proben eines Individuums festgestellt werden, ob sich dieses in frheren oder in
spteren Jahren in einer Region mit abweichender geochemischer Strontium-Signatur
aufgehalten hat. Im Vergleich mit geochemischen Kartierungen kann daher eine mgliche
Herkunftsregion, zumindest aber Mobilitt fr das fragliche Individuum postuliert werden.
Die Untersuchungen an linearbandkeramischen Skelettindividuen aus Flomborn,
Schwetzingen und Dillingen (Bentley et al. 2002) ergab eine hohe Mobilittsrate fr die
Fundorte Flomborn (64%) und Dillingen (65%), wohingegen im zeitlich leicht spteren
Schwetzingen nur noch eine Mobilittsrate von 25% zu beobachten war. Als weitere
Ergebnisse konnte konstatiert werden, dass a) vermehrt Frauen signifikant vom lokalen
Strontiumverhltnis abwichen, b) die durch das 87Sr/86Sr-Verhltnis nicht von Geburt an als
Ortsansssige definierten Individuen auch in der Orientierung ihrer Bestattung abwichen, c)
vermehrt ohne LBK-charakteristischen Schuhleistenkeil bestattet wurden (Mnner) und d)
85% der nicht-lokalen Individuen signifikant ber dem Wert des lokalen StrontiumVerhltnisses lagen, d.h. sich Werten nherten, die unter gegebenen kologischen
Gesichtspunkten fr Sammler/Jger errechnet wurden. Die Autoren boten auf der
Grundlage dieser Ergebnisse die Hypothese an, dass es sich bei den nicht-lokalen Individuen
bevorzugt um Frauen aus Sammler/Jger-Gemeinschaften in benachbarten Regionen
gehandelt haben knnte und zogen dafr ethnografische Vergleiche heran (Bentley et al.

16

Grundlagen zur Archologie der Neolithisierung


2002). Gleichzeitig aber zogen sie auch die Alternativhypothese in Betracht, in welchen keine
Unterscheidung in mgliche Bauern und Sammler/Jger getroffen wurde, stattdessen aber
die generell hohe Mobilittsrate und die deutlichen Hinweise auf eine Patrilokalitt der
frhneolithischen Gesellschaft der LBK herausgehoben wurden.

17

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.

Grundlagen zur Neolithisierung aus Sicht der


Humangenetik und zur Analyse alter DNA

3.1 Die Neolithisierung aus Sicht der Humangenetik


3.1.1 Forschungsgeschichtlicher Hintergrund
Der Ansatz, die Geschichte Europas aus Sicht der Genetik zu erzhlen, geht grtenteils auf
die Arbeiten von Luca Cavalli-Sforza und seinen Kollegen zurck. Die Pionierarbeiten, die in
den 70er Jahren verffentlicht wurden, verbanden erstmalig genetische Daten mit gngigen
archologischen Fragestellungen, womit gleichermaen der Grundstein fr jede weitere
Zusammenarbeit von Archologen und Genetikern gelegt wurde. Mageblich fr die
Geburtsstunde der Archogenetik war die Zusammenarbeit des Archologen Albert
Ammerman mit Cavalli-Sforza, der, aus der Statistik kommend, in der Lage war, die
Methoden quantitativer Datenanalysen auf die Fragestellungen der Archologie zu
bertragen. Nicht zuletzt war diese naturwissenschaftliche Herangehensweise eine Folge der
von Lewis Binford (1968) mit beeinflussten processual archaeology, deren Hypothesenbildung
und nachfolgende mathematisch-statistische Prfung einerseits dem damaligen Zeitgeist
entsprach, andererseits der Archologie eindeutig neue Impulse von auen gab.

3.1.2 Das wave-of-advance-Modell von Ammerman und Cavalli-Sforza


Die 1984 erschienene Arbeit The Neolithic Transition and the Genetics of Populations in Europe
von Ammerman und Cavalli-Sforza ist nach wie vor die Grundlage aller Debatten um die
Neolithische Transition aus Sicht der modernen Genetik. Die Autoren profitierten zunchst
von der neu entwickelten Methode der Radiokarbon-Datierung (Clark 1965), indem sie auf
Karten nun absolut datierter Funde, welche mit Ackerbau und Viehzucht assoziiert waren,
erkennbare Ost-West Trends herausarbeiteten und somit die Geschwindigkeit der
Ausbreitung der Agrikultur berechneten. Sie waren auch die ersten, die isochrone Karten
entwarfen, worauf die Verbreitung der Elemente des neolithischen Kulturkomplexes entlang
von Konturlinien gleichen Zeitpunkts oder so genannten Isochronen aufgetragen waren. Das
Ergebnis, das sie erhielten, war ein bemerkenswert gleichfrmiger Prozess der
Neolithisierung Gesamteuropas, welcher mit ebenfalls kontinuierlicher Geschwindigkeit
(1km pro Jahr bzw. 25km pro Generation) in relativ schneller Zeit (innerhalb 2500 Jahren)
vonstatten ging.
Diese Entdeckung einer konstanten Neolithisierungsrate fhrte zur Schlussfolgerung, dass
nur ein singulrer und bergreifender Mechanismus die Ursache sein konnte. Die Autoren
fhrten hierfr einen Diffusionsprozess an, der dem herkmmlichen Gedanken einer
gerichteten Kolonisierung gegenberstand. Gleichzeitig definierten sie die Begriffe demic
diffusion, um die Einwanderung von Bauern von der cultural diffusion, der Verbreitung des
neolithischen
buerlichen
Ideenguts
auf
die
indigene
europische
Jger/Sammlergesellschaften zu unterscheiden. Der Begriff der demischen Diffusion wurde

18

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
hufig dem gebruchlichen Bild der Einwanderung und Kolonisierung gleichgesetzt.
Cavalli-Sforza und Ammerman hatten jedoch nicht dieses Bild im Sinne, sondern schlugen
gleichzeitig das sogenannte wave-of-advance-Modell vor. Dieses Modell hatte Cavalli-Sforza
seinem Mentor R.A. Fisher entlehnt, der damit die Ausbreitung eines vorteilhaften Gens
durch eine Population umschrieb (Sykes 2000). Es beinhaltete die beiden Annahmen, dass
sich erstens der Anteil der bevorteilten Trger des Gens erhht und zweitens in zuflliger
Richtung ausbreitet. bertragen auf die neolithische Transition bedeutete dies zum einen ein
natrliches Anwachsen der neolithischen Bevlkerung, welches durch erwirtschafteten
berschuss ermglicht und begrndet ist. Zum anderen implizierte diese Annahme die
Fhigkeit, den berschuss erneut einzusetzen, was wiederum eine damit einhergehende
radiale Verbreitungswelle bedingte, innerhalb der sich die neolithische Kultur mit ihren
Trgern verbreitete.

3.1.3 Der Einsatz von klassischen genetischen Markern


Das wave-of-advance-Modell schien geeignet zu sein, um die anhand der Radiocarbon-Daten
beobachteten Verbreitungsgeschwindigkeit zu erklren. Der entscheidende Schritt zur
Archogenetik wurde nun durch den Einsatz von Daten der klassischen genetischen Marker
erbracht. Als klassische genetische Marker werden heute die Systeme all jener Gene
bezeichnet, deren Nachweis und Vererbungsmuster, sowie deren Allelfrequenzen auch
schon in der pr-DNA ra der Genetik untersucht wurden. Dies umfasste hauptschlich
Antigen-Antikrper Reaktionen zahlreicher Blutgruppensysteme, welche teilweise bereits
seit 70 Jahren bekannt waren (Landsteiner 1900), die Gewebsantigene des HLA-Systems und
eine Reihe von Enzymen.
Der Einsatz von klassischen Markern setzte zunchst einige Hypothesen voraus, die zur
nachfolgenden Modellbildung bezglich der demischen bzw. kulturellen Diffusion
unerlsslich waren und welche, so sollte sich herausstellen, gleichermaen der
Schwachpunkt des wave-of-advance-Modells waren. Unter der Annahme, dass Europa und
der Nahe Osten im ausgehenden Palolithikum und Mesolithikum weitgehend isoliert
waren und somit theoretisch Gelegenheit zur genetischen Differenzierung gegeben war,
konnten verschiedene Vorhersagen generiert und somit Hypothesen zum Wie der
Ausbreitung von Ackerbau und Viehzucht erstellt werden.
1. Ein reine Verbreitung von Ackerbau und Viehzucht im Sinne eines Ideentransfers
(cultural diffusion) wrde die angenommene genetische Unterscheidbarkeit von
Europa und dem Nahen Osten nicht beeinflussen und wre somit leicht ersichtlich.
2. Demgegenber wrde eine demische Diffusion - eine vollstndige Verdrngung der
Einheimischen vorausgesetzt (replacement) - als Homogenitt von Europa und dem
Nahen Osten im genetischen Substrat feststellbar sein.
3. Eine demische Diffusion mit genetischem Beitrag der indigenen europischen
Bevlkerung wrde zu einer graduellen Ausprgung von Genfrequenzen entlang der
Hauptverbreitungsachse fhren.

19

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Inspiriert wurde der Einsatz der klassischen genetischen Marker durch eine Beobachtung
von Mourant (1954), welcher anhand des ausschlielichen Vorkommens des
Blutgruppengens Rhesus negativ (Rh-) in Nordafrika und Europa und dort mit der grten
Hufigkeit innerhalb der Basken, folgerte, dass letztere ein Relikt einer proto-europischen
Bevlkerung darstellten, die sich spter mit anderen Bevlkerungen vermischt habe. Das
Auffinden von hohen Rh- Frequenzen in Nord und Nordwesteuropa, also in den
hypothetischen Randgebieten der neolithischen Expansion, bestrkte Cavalli-Sforza und
Ammerman in der Annahme, dass es sich bei der von Mourant nicht nher benannten
spteren Bevlkerung um neolithischen Bauern handeln knne (Richards 2003).
Die nachfolgend untersuchten Gene der klassischen Marker zeigten jedoch hufig andere
Verteilungsmuster. Es stellte sich zudem nach und nach heraus, dass die genetische
Unterscheidbarkeit a priori von Europa und dem Nahen Osten nicht der Realitt entsprach.
Ein eindeutiges Bild resultierend aus allen untersuchten Genorten (zunchst 39, spter 95
(Cavalli-Sforza et al. 1994)), wie in den drei obigen Hypothesen dargestellt wurde, konnte
nicht erstellt werden. Die Komplexitt der gewonnenen Daten erforderte zudem den Einsatz
multivariater Analysemethoden, um bestimmte Verteilungsmuster von Allelen oder
Dispositionen zu erhalten. Dafr wurde die Hauptkomponentenanalyse (principal component:
PC, im Folgenden zur Beschreibung auch im Deutschen als PC abgekrzt) gewhlt (Menozzi
et al. 1978). Sie ermglichte es, Frequenzen mehrerer Genorte fr bestimmte geografische
Bereiche zusammenzufassen und die Flle der Information in wenigen Dimensionen
darzulegen. Die Ergebnisse lieen sich nun in zweidimensionalen Plots darstellen oder in
den mittlerweile fr die Anhnger der Diffusionisten zum Wappen avancierten
Konturkarten fr die einzelnen Komponenten (vgl. Abbildung 3).
Die Karte der ersten Hauptkomponente, welche 27% der absoluten Variation der klassischen
Marker beinhaltete, zeigte einen Gradienten von Sdost nach Nordwest, wie er zuvor auf
der aus Radiokarbon-Daten gewonnenen Karte ersichtlich war. Dies wurde unmittelbar als
Beweis fr die Hypothese der demischen Diffusion mit mesolithischem Beitrag gesehen. Die
Karten der Hauptkomponenten 2 und 3, die fr 22% bzw. 11% der Variation standen, zeigten
einen Sdwest-Nordost-Gradient, sowie einen Ost-West-Gradienten. Da deren Einfluss auf
die genetische Variation als geringer erkannt worden war, kam man zu dem Schluss, dass es
sich hierbei um Prozesse handelte, die nach dem Neolithikum stattgefunden hatten.
Die Ergebnisse und Schlussfolgerungen der Arbeiten von Cavalli-Sforza wurden auch von
anderer Seite bzw. mit anderen Analysemethoden besttigt (Sokal et al. 1989, 1991). Auch sie
konnten zeigen, dass etwa ein Drittel der Frequenzen ihrer Daten in einem SdostNordwest-Gradienten zu verlaufen schien.

20

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

Abbildung 3. Die clines der ersten Hauptkomponente in Europa (modifiziert aus Renfrew & Boyle
2000 nach Cavalli-Sforza et al. 1994).

Eine entscheidende Frage war mit dem umfangreichen Datensatz von Cavalli-Sforza nicht zu
klren: Wie gro waren die relativen Anteile der indigenen Bevlkerung und der
neolithischen Neuankmmlinge? Zwar konnten entsprechende Simulationen des wave-ofadvance-Modells die Prozesse der Diffusion mit und ohne Interaktion darstellen, der kritische
Faktor der Akkulturation - der Ideentransfer - konnte allerdings nicht befriedigend mit
einbezogen werden (Ammerman & Cavalli-Sforza 1984). Ein ebenfalls kritischer Aspekt
zeigte sich in der Tatsache, dass in Simulationen mit erhhtem Anteil an hypothetischen
Mischehen, stets ein schneller Verlust der Neolithikergene festzustellen war (siehe hierzu
auch die aktuellen Simulationen von Currat & Excoffier 2005). Somit musste konstatiert
werden, dass zwar das Ausma einer bzw. mehrerer Diffusionsereignisse aufgezeigt, der
eigentliche Nachweis des wave-of-advance-Modells jedoch nicht eindeutig erbracht werden
konnte.
Nichtsdestoweniger setzte sich das wave-of-advance-Modell, das in gewisser Hinsicht als
Selbstlufer bezeichnet werden kann, als anerkannte Lehrmeinung durch (Richards 2003).
Ammerman & Cavalli-Sforza hatten zwar ihre Hypothesen vorsichtig formuliert, d.h. das
jeweils nur hchstens ein Drittel der Variation einen Gradienten aufweist, und auch dem
oben erwhnten Faktor der Akkulturation besondere Achtung einzurumen gemahnt. Die
Gesamtinterpretation der neolithischen Transition auf der Basis dieser Verffentlichung lag
jedoch auf der Hand: Die Neuankmmlinge, d.h. einwandernde neolithische Bauern,
bildeten die Basis des heutigen europischen Genpools (Richards 2003). Diese Ansicht hatte
sich bereits zur Verffentlichung des 1994 erfolgten opus magnum (zitiert nach Richards 2003)
von Cavalli- Sforza, The History and Geography of Human Genes, durchgesetzt und mittlerweile
auch die Autoren selbst trotz ihrer frher geuerten Ansichten beeinflusst. Auf Basis ihres
nun auf 95 Genorte erweiterten Datensatzes erklrten sie alle Variation, die nicht dem
Sdost-Nordwestgradienten entsprach, als Folge postneolithischer Migrationen. Sie gingen

21

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
sogar soweit, die Hauptkomponenten-Analyse als relative Datierungsmethode zu empfehlen
(Cavalli-Sforza 1996).

3.1.4 Kritik am wave-of-advance-Modell


Die magebliche Kritik am wave-of-advance-Modell richtete sich zunchst auf die Wahl der
genetischen Marker. So wies Allan Fix (1996, 1999) darauf hin, dass die Mehrzahl der von
Ammerman und Cavalli-Sforza untersuchten Allele, welche einen NW-SO-Gradienten
aufweisen, zum HLA-System zu rechnen sind (human leucoyte antigen). Da dieses einen
bedeutenden Teil des menschlichen Immunsystems bildet, lag es nach Fix nahe, dass die
betreffenden Allele einer Selektion im Rahmen der Immunabwehr unterliegen. Gerade im
Hinblick auf die Domestikation von Tieren lassen sich eine Flle neuer Krankheitserreger
anfhren (Zoonosen), die einen distinkten Selektionsdruck auf das Immunsystem der frhen
Viehzchter ausgebt haben konnten. Demzufolge spiegelten nach Fix die beobachtbaren
clines der (HLA-)Allelhufigkeiten nicht die demische Diffusion der Populationen wider,
sondern den differenzierten Anpassungszustand an die vernderte Situation an mglichen
Krankheitserregern. Darber hinaus wren im Rahmen der Immunabwehr auch
Anpassungen an vernderte klimatische Bedingungen denkbar.
Die Ergebnisse von Cavalli-Sforza und Kollegen beeinflussten wiederum die Hypothesen
und Modelle der archologischen Neolithikumsforschung. Der Archologe und Linguist
Colin Renfrew (1987) sah sich durch das wave-of-advance-Modell in seinen eigenen
Hypothesen besttigt. Fr ihn stellte es das passende prozessuale Modell dar, mit dem er
seine, vormals als radikal bezeichnete, Hypothese zur Ausbreitung der indoeuropischen
Sprachen im Rahmen der neolithischen Transition untermauern konnte. Die Linguisten
zogen noch weitgehend die Hypothese von Marija Gimbutas vor, die eine nach Westen
gerichtete Verbreitung von Proto-Indoeuropern den bronzezeitlichen Kurgan-Kulturen der
osteuropischen Steppen zuordnete (Gimbutas 1965).
Kritik aus den Reihen der Archologen kam vornehmlich bezglich der Interpretation der
Gradienten der Hauptkomponentenanalyse. So bemerkte Zvelebil (1989, 1998), dass es
keinen eindeutigen Grund gab, anzunehmen, dass der Sdost-Nordwest Gradient
(Abbildung 3) der ersten PC mit der Ausbreitung der neolithischen Kulturen in
Zusammenhang stnde. Er machte gleichzeitig deutlich, dass durch die geographische
Deutung Europas als kleine Halbinsel Eurasiens im Laufe der Menschheitsgeschichte
mehrere mgliche Verteilungswellen in das Becken Europa geflossen sind. Dass hierbei
Richtungen von Sdost nach Nordwest erkennbar seien, liege unter anderem daran, dass
dies schlichtweg einer von mglichen Wegen nach Europa darstellt. Zur Verdeutlichung
wurde hierfr von Renfrew (1998) und Zvelebil (1998) der Begriff Palimpsest entlehnt1, der
veranschaulichen sollte, dass ein beobachtbarer Gradient die Folge mehrerer
Verbreitungswellen sein kann, von welchen jeweils die letzte die vorausgehende
berschreibe. Die Ursachen der mglichen berlagernden Verbreitungswellen sah jedoch
Palimpsest: Pergament-, oder Papyrushandschriften, die im Altertum oder Mittealter nach
Abwaschen oder Abkratzen wiederbeschriftet wurden.

22

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
auch Zvelebil (2000) eher in postneolithischen Zeiten. Erst Richards (1997), der analog zu
Clark (1965, siehe oben) eine Karte mit Radiokarbon-Daten fr das frhe obere
Palolithikum erstellte, konnte zeigen, dass bereits die erste Ausbreitungswelle des
anatomisch modernen Menschen nach Europa einen mit dem Prozess der Neolithisierung
vergleichbaren Weg einnahm.
Cavalli-Sforza und Kollegen hatten die Reihenfolge ihrer Hauptkomponenten nach der Hhe
der enthaltenen Variation zeitlich geordnet. Sie nahmen weiterhin fr jede PC eine
Wanderungsbewegung an. Die erste PC mit 27% der Gesamtvariation sollte der
Neolithisierung entsprechen, fr die dritte PC (11% ) mit Ost-West Verlauf der Frequenzen
wurde der Einfluss von Gimbutas bronzezeitlichen Kurgan-Kulturen postuliert und fr die
vierte PC wurden die griechischen Kolonien im stlichen Mittelmeergebiet herangezogen.
Fr die zweite Hauptkomponente (22%) konnte jedoch kein passendes (vor-)geschichtliches
Ereignis gefunden werden, das in den nun engen (postfrhneolithisch-bronzezeitlich)
gespannten Rahmen passte. Aus heutiger Sicht berraschend spt kam daher das
entsprechende Modell von Torroni (1998), der den Sdwest-Nordost-Verlauf der zweiten PC
als Folge der spt bzw. postglazialen Reexpansion aus den glazialen Refugien im frankokantabrischen Raum deutete. Sptestens jetzt war die Idee, dass je eine PC einer Bewegung
entsprach, die in hierarchisch-chronologischer Abfolge stattfanden, nicht mehr aufrecht zu
halten.
Der zweite groe Kritikpunkt der Archologen an der 1984 erschienenen Arbeit von
Ammerman & Cavalli Sforza lag eher im methodischen Bereich. So stand hauptschlich die
Definition des propagierten neolithic package im Vordergrund der Kritik. Zahlreiche
Archologen deuteten darauf hin, dass sich die einzelnen Komponenten dieses Pakets (z.B.
Keramik, Getreide, Viehhaltung etc.) nicht in vergleichbarem Ma und in einigen Gebieten
keineswegs in Vergesellschaftung verbreiteten und zudem der wesentliche Faktor von
Austauschsystemen mit mesolithischen Bevlkerungen nicht mit einbezogen wurde (u. a.
Price 2000, Gronenborn 2003). Zvelebil merkte bereits 1986 an, dass vor allem die von
Ammerman und Cavalli-Sforza verfolgte Strategie, das Vorkommen von Keramik an einem
Fundpunkt als eindeutig neolithisch zu werten, automatisch zu einer deutlichen
berbewertung des neolithischen Einflusses in Europa fhre.
Ein weiterer Kritikpunkt am wave-of-advance-Modell betraf die Annahme einer groen
Populationsdichte bzw. das daraus resultierende Wachstumspotential, die den
agrikulturellen Bevlkerungen zugeschrieben, den Mesolithikern dagegen versagt wurde
und die gleichermaen die Sttze des Modells darstellte. Jedoch wurde auch diese Annahme
als einheitliche Erklrung von archologischer Seite abgelehnt. So ist die groe
Populationsdichte keineswegs archologisch nachgewiesen. Die Befunde deuteten
grtenteils sogar in die entgegengesetzte Richtung. Die mesolithischen Bevlkerungen, die
entlang von Flssen, Seen und Ksten lokalisiert wurden, wiesen ein ungleich greres Ma
an Sesshaftigkeit und auch an Bevlkerungsdichte auf, als ursprnglich vermutet (van Andel
& Runnel 1995). Ethnographische Vergleiche mit australischen aborigines oder
sdafrikanischen Jger/Sammlergesellschaften wurden verworfen und stattdessen

23

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Analogien zu nordwestamerikanischen Indianerkulturen erstellt, deren naturrumliche und
klimatischen Verhltnisse am ehesten den des europischen Mesolithikums nahe kamen
(Zvelebil 1986). Demzufolge war die mesolithische Lebensweise in Europa als vollwertige
westliche Alternative zum Neolithikum zu sehen.
Andererseits mehrten sich auch auf Seiten der Archologen die Belege fr Gebiete, wie z.B.
dem der linearbandkeramischen Kultur oder auch der Cardial-Kultur, in welchen die
neolithische Lebensweise schneller als mit der von Ammerman & Cavalli-Sforza
veranschlagten Geschwindigkeit Verbreitung fand (Gronenborn 1999; 2004, Bogucki 2000,
Price 2000, Barnett 2000, Zilho 2000; 2001) und fr welche nur eine Kolonisierung plausibel
erscheint.
Es bleibt anzufgen, dass auch die einstigen Vertreter der Neolithischen Invasion
mittlerweile ihre Aussagen bezglich Gre und Einfluss derselben angepasst haben
(Cavalli-Sforza 2003, Bentley et al. 2003). Es herrscht weitestgehend Konsens ber die stark
ausgeprgte Komplexitt des Prozesses der neolithischen Transition an sich und deren
regional bzw. rumlich unterschiedlichen Entfaltung (Gronenborn 2004), wenn auch einige
eine Verbreitung der neolithischen Kultur durch Einwanderung von auen nicht
ausschlieen (Bogucki 2003, Kaczanowska & Kozlowski 2003).

24

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.2 Forschungsstand molekulargenetischer Studien


Parallel zum Erscheinen des grundlegenden archogenetischen Werkes von Ammerman
und Cavalli-Sforza (1984) zu den klassischen Markern wurden auch im
molekulargenetischen Bereich entscheidende Fortschritte gemacht, die nicht viel spter die
gleichen Fragestellungen untersuchten bzw. an diese anknpften.
Der Grundstein fr alle molekulargenetischen Studien wurde durch die Entdeckung und
Entwicklung der Methode der Polymerase-Kettenreaktion (PCR) gelegt. Die PCR
ermglichte es nicht nur, DNA unendlich zu vervielfltigen und damit gengend
Ausgangsmaterial zur weiteren Analyse zur Verfgung zu stellen, sondern gleichermaen
auch den zu untersuchenden Abschnitt exakt einzugrenzen (vgl. Kap. 5.2.4). Es konnten
somit nicht nur die Produkte eines Gens, sondern das Gen selbst und seine Variationen
(sofern vorhanden) erschlossen werden. Ein weiterer Vorteil der PCR lag darin, dass nun
auch nicht-rekombinierende Genorte einfach und unter geringem Zeitaufwand analysiert
werden konnten.
Aus populationsgenetischer Sicht waren in erster Linie das mitochondriale Genom, das nur
maternal vererbt wird, und das Y-Chromosom, welches nur bei Mnnern vorkommt, von
Interesse. Diese genetischen loci bargen gegenber den klassischen Markern vor allem zwei
Vorteile (vgl. Kapitel 3.7.1): Erstens konnten nun einfache Genealogien erstellt werden und
zweitens konnten diese, unter der Annahme, dass Mutationen zufllig und somit ber die
Zeit gesehen linear verlaufen, ber die obliegende Mutationsrate datiert werden. Letztlich
erlaubte diese Art von Daten auch eine einfache Einordnung von Genealogien in Raum und
Zeit, wofr der Begriff Phylogeographie entworfen wurde (Richards et al. 1997, Avise
2000, Bandelt et al. 2002). Die Interpretation dieser phylogeographischen Karten war jedoch
ebenfalls nicht selbsterklrend, sondern erforderte - vergleichbar mit den Isochron-Karten
der klassischen Marker - untersttzende Hypothesen von Seiten aller beteiligten Disziplinen
(Richards 2003).

3.2.1 Mitochondriale Variabilitt in Europa


Bereits seit Beginn der 90er Jahre untersuchten mehrere Arbeitsgruppen die Variationsbreite
des mitochondrialen Genoms. Hierbei wurden zunchst methodisch unterschiedliche
Anstze verfolgt. So bediente sich die Gruppe um Antonio Torroni der klassischen Methode
des Enzymverdaus, der RFLP-Methode (Restriktionsfragment-Lngenpolymorphismus, vgl.
Kap. 3.3). Die zu untersuchenden mitochondrialen Genome verschiedener Herkunft wurden
nach hierarchischem System mit unterschiedlichen Restriktionsenzymen verdaut. Somit
konnten diejenigen polymorphen Positionen im Genom, die fr das Entstehen oder den
Wegfall einer Restriktionsschnittstelle urschlich sind, beschrieben werden und die dabei
beobachteten Verdaumuster verschiedenen Gruppen (Haplogruppen) zugeordnet werden
(Torroni et al. 1996). Parallel hierzu erfolgte von anderen Arbeitsgruppen (u. a. von Brian
Sykes) die Sequenzierung vornehmlich der schnell evolvierenden Regionen des
nichtkodierenden Bereiches, der so genannten hypervariablen Segmente HVS I und HVS II.

25

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Die ersten Ergebnisse schienen im Hinblick auf vorgeschichtliche Ereignisse zunchst wenig
informativ zu sein, denn die Verteilung der europischen Haplogruppen zeigte ber weite
Gebiete ein uniformes Bild (Richards et al. 1996, 1998). Erst die Verbindung beider
Informationsstrnge (coding region und control region) sowie die sukzessive Einigung auf eine
gemeinsame Nomenklatur verbesserten die Situation und ermglichten ein sicheres
Zuordnen in verschiedene clades bzw. Haplogruppen (Macaulay et al. 1999). Die
Verknpfung von HVS I Haplogruppen mit diagnostischen Schnittstellen im kodierenden
Bereich des Mitochondriums konnte durch die Sequenzierung des gesamten
mitochondrialen Genoms fr einzelne Haplogruppen erfolgen (Finnil et al. 2001, Richards
and Macaulay 2001). Mittlerweile wird in populationsgenetischen Studien bevorzugt das
gesamte mt-Genom sequenziert, um die maximale phylogenetische Auflsung zu erreichen.
Diese maximale Auflsung des mitochondrialen Markers ist zum gegenwrtigen Zeitpunkt
noch nicht erreicht und auch ein vorlufiges Ende ist noch nicht in Sicht. Die neuesten
Arbeiten auf diesem Gebiet befassten sich nach wie vor mit der Aufschlsselung der
phylogenetischen Beziehungen der einzelnen Haplogruppen zueinander sowie der
Subhaplogruppen bzw. Haplotypen untereinander (z.B. Palanichamy et al. 2004). So konnte
unlngst die bislang wenig transparente, aber hufigste europische Haplogruppe H in etwa
15 Subhaplogruppen unterteilt werden (Loogvli et al. 2004, Achilli et al. 2004, Pereira et al.
2005).

3.2.2 Besiedlungsgeschichte Europas anhand von mtDNA und Y Chromosom


Die vorgeschichtlichen Besiedlungsereignisse Europas betreffend, gab es seitens der
mitochondrialen Daten frhzeitig Aussagen ber deren Beschaffenheit (Richards et al. 1996).
Die grundlegenden Fragen konnten allerdings bislang nicht beantwortet werden. Sind die an
modernen Daten beobachtbaren Gradienten innerhalb Europas grtenteils das Ergebnis der
(mglicherweise in mehreren Wellen erfolgten) Erstbesiedlung durch den anatomisch
modernen Menschen (Homo sapiens sapiens) im Palolithikum, einer postglazialen
Wiederbesiedlung aus den Refugien oder einer genetischen Neolithisierung Europas, d.h.
das Ergebnis einer Expansion und Diffusion frher Ackerbauern und Viehzchter nach
Europa (Barbujani & Goldstein 2004)?
Wie in Tabelle 1 deutlich wird, lassen sich vor allem die beiden Modelle der ersten
palolithischen sowie der neolithischen Besiedlungswellen aus dem Nahen Osten
hinsichtlich ihrer Auswirkungen auf den modernen Genpool nicht unterscheiden. Lediglich
der Anteil der jeweilig bedachten Grnderpopulation variiert hier.
Tabelle 1. Erwartete Verteilungsmuster dreier Modelle zur Besiedlungsgeschichte Europas
(umgezeichnet nach Barbujani & Goldstein 2004).
Etablierung des europischen Genpools grtenteils im
Palolithikum nacheiszeitlichen Palolithikum Neolithikum
Sdost-Nordwestgradient

erwartet

unerwartet

erwartet

Nord-Sdgradient

unerwartet

erwartet

unerwartet

gro

klein

Anteil an palolithischen Linien gro

26

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Leichter unterscheidbar scheint auf den ersten Blick das Modell der postglazialen
Wiederbesiedlung aus den Refugien Sdeuropas. Hier wre ein Sdost-Nordwestgradient
eher unerwartet. Der neolithische Einfluss wird ebenso als gering eingeschtzt. Es sei jedoch
angemerkt, dass das Modell der nacheiszeitlichen Expansion nicht einfach zu interpretieren
ist, da es letztlich unmittelbar von der vorausgehenden Dynamik der (palolithischen)
Erstbesiedlung abhngig ist und deren Verteilungsmuster in den genetischen bottlenecks bzw.
melting pots der Refugien verstrkt bzw. abgeschwcht werden konnten.
Wie eingangs erwhnt, lieen die ersten europischen mtDNA-Studien eher eine Uniformitt
der Haplogruppenverteilung erkennen (Richards et al. 1996). Die grundlegende Arbeit zur
Besiedlungsgeschichte Europas aus mitochondrialer Sicht wurde von Martin Richards im
Jahre 2000 verffentlicht. Auf einer stark erweiterten Basis von 4100 Individuen aus ganz
Europa bzw. dem Nahen Osten und Nordafrika ermittelte er mit Hilfe der founder analysis
Koaleszenzzeiten fr die einzelnen Haplogruppen (siehe Box 1, Abbildung 4). Er konnte
damit zeigen, dass der berwiegende Anteil an europischen Haplogruppen ein Alter
aufweist, das in den Zeitrahmen des spten Palolithikums fllt. Gleichzeitig wurde dies als
Beweis gedeutet, dass die meisten europischen mitochondrialen Sequenzen auf
autochthone palolithische Vorfahren zurckzufhren seien und demnach nur ein
geringerer Anteil, etwa 20-25%, einem neolithischen Einfluss zuzurechnen sei.

Abbildung 4. Ergebnisse der founder analysis nach Richards et al. 2000. Aufgefhrt sind die
hufigsten Haplogruppen Europas und gleichzeitig deren prozentuales Vorkommen. Die Querbalken
entsprechen
dem
95%
(schwarz)
bzw.
50%
(wei)
Konfidenzintervall
der
Koaleszenzzeitberechnungen der founder analysis. LUP, MUP, EUP: Late, Middle und Upper Paleolitihic.

27

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

Box 1. Founder analysis.


Die Grnderanalyse (founder analysis) nach Richards et al. 2000 beruht auf dem Prinzip
des Vergleichs einer Ursprungspopulation mit einer hieraus abgeleiteten
Nachfolgepopulation. Dabei wird die jeweilige molekulare Diversitt der beiden
Populationen bestimmt und der Zeitpunkt der Migration der Nachfolgepopulation
errechnet. Hierfr mssen zunchst Grndertypen in der aus Migration
hervorgegangenen Nachfolgepopulation definiert werden. Anschlieend wird die Anzahl
der von diesen Grndertypen abgeleiteten Typen innerhalb der Nachfolgepopulation
bestimmt. Diese erfolgt durch Subtraktion der Diversitt der Nachfolgepopulation von
der Diversitt der Ursprungspopulation. Der Quotient aus der Summe der Mutationen
durch die Anzahl abgeleiteter Typen aus der entsprechenden Nachfolgepopulationen
wird anschlieend mit der Mutationsrate des jeweiligen locus multipliziert (siehe Grafik).

Die Analyse setzt jedoch einige Grundannahmen voraus:


Zum einen wird die Ursprungspopulation als die ltere angesehen. Daraus resultiert,
dass die Nachfolgepopulation eine Ersatzpopulation darstellt. Zudem wird
vorausgesetzt, dass die heutige Nachfolgepopulation der Ursprungspopulation in
derselben geographischen Region vorhanden ist und eine vergleichbare Diversitt wie die
Ursprungspopulation aufweist.
Als weitere Voraussetzungen fr die Analyse gelten, dass einerseits rezente
Rckwanderungen von Bevlkerungsteilen und andererseits auch Parallelmutationen
erkannt und somit ausgeschlossen werden knnen. Beide Faktoren wrden hinsichtlich
der ursprnglichen Wanderung zu einer Unterschtzung der Diversitt in Ursprungsund Nachfolgepopulation fhren (Richards et al. 2000, Jobling et al. 2004).

28

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Parallel hierzu lieferte die Gruppe um Torroni (1998; 2001), gesttzt auf bestimmte
mitochondriale Haplogruppen, Hinweise auf mgliche postglaziale Expansion aus der
Iberischen Halbinsel in nordstliche Richtung. Mit dem gleichen Datensatz wurde auch der
bis dahin als postneolithisch nicht erfassbare Sdwest-Nordostgradient der zweiten
Hauptkomponente von Cavalli-Sforza (vgl. Kap. 3.1.3) erklrt und gleichermaen zeitlich in
das ausgehende Palolithikum datiert.
Bezglich der Auswirkungen der neolithischen Periode auf den europischen Genpool,
existierten auch von Seiten der Populationsgenetik unterschiedliche und zum Teil
gegenstzliche Hypothesen. Diese bewegten sich polar zwischen einer Akkulturation der
autochthonen mesolithischen Bevlkerung einerseits und einem Bevlkerungswandel durch
einwandernde Bauern andererseits. Hier spielten nicht zuletzt wissenschaftsgeschichtliche
Aspekte eine Rolle. Demnach wird auf der einen Seite versucht, auf molekularer Ebene das
Modell der "demischen Diffusion" von Ammermann und Cavalli-Sforza (1984; Cavalli-Sforza
et al. 1994) widerzuspiegeln, das im extremsten Sinne von einer demographischen "wave of
advance" von Farmergenen und einer kontinuierlichen Verdrngung autochthoner
europischer Linien ausgeht. Andere wiederum versuchten anhand molekularer Daten das
Gegenteil zu beweisen. So spaltete sich im Licht der neuen (molekulargenetischen)
Methoden Mitte bis Ende der 90er Jahre erneut die (molekulargenetische)
Forschungsgemeinschaft in so genannte Demisten, also Befrworter der Einwanderungsund Verdrngungshypothese um Guido Barbujani, und Indigenisten, Anhnger einer
autochthonen Neolithisierung durch bloe bernahme der neuen Lebensweise wie z.B.
Martin Richards.
Dieser jahrelange Disput lsst sich gut in der Literatur verfolgen und ist letztlich auf
unterschiedlichen Ergebnissen von mitochondrialen und Y-chromosomalen Daten begrndet
(z. B. Cavalli-Sforza und Minch 1997, Richards et al. 1998, Chikhi et al. 1998; 2002, Barbujani
et al. 1998, Torroni et al. 1998, Semino et al. 2000a, Simoni et al. 2000a; 2000b; 2000c). Mit
steigender Anzahl der erhobenen Daten und vor allem nach Annherung der Methoden
bzw. Ermglichung einer Vergleichbarkeit, gltteten sich in den vergangenen fnf Jahren
auch die Wogen der Debatte. Letztlich war man sich nicht ber die Ergebnisse uneinig,
sondern ber die Interpretation derselben. Der Streitpunkt betraf die Hhe des Anteils der
neolithischen Bevlkerung am heute beobachtbaren europischen Genpool.
Die wichtigsten grundlegenden Arbeiten sowie auch die kritischen Anstze beider Seiten zu
dieser andauernden Diskussion sollen hier in kompakter Form wiedergegeben werden.
Martin Richards und Kollegen (1996; 1998) kamen im Widerspruch zu den Resultaten der
klassischen genetischen Marker von Cavalli-Sforza zunchst zu dem Ergebnis, dass ein
Gradient von SO- nach NW-Europa nicht existiert und dass nur ein geringer Anteil von ca.
12% der Linien in Europa nahstlichen Ursprungs sein kann. Diese Arbeit wurde von
Cavalli-Sforza und Minch (1997) stark kritisiert. Sie hegten Zweifel an der Eignung der
mtDNA als populationsgenetischer Marker selbst und fhrten hier als Grnde mgliches
Vorkommen von Heteroplasmien an. Dieses Argument kann jedoch heute nicht mehr
aufrecht gehalten werden (vgl. Kap.3.7.1.3). Des Weiteren wiesen sie darauf hin, dass bei

29

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
einem mtterlich vererbten locus wie der mtDNA ein verwischender Effekt in einer
patrilokalen Gesellschaft (wie sie fr Ackerbauern und Viehzchtern postuliert wird)
anzunehmen sei. Ein weiterer Kritikpunkt folgte von Barbujani (1998), der anfhrte, dass
grundstzlich das Alter eines cluster bzw. einer Haplogruppe nicht mit dem Alter einer
Population gleichzusetzen sei. Die Antwort von Richards & Sykes (1998) stimmte Barbujanis
Kritik grundstzlich zu, betonte aber gleichzeitig, dass sie sich in ihren ursprnglichen
Studien auf einzelne Haplotypen innerhalb von Haplogruppen gesttzt hatten, woraus sich
Grnderereignisse sich im Vergleich zwischen Populationen ablesen lieen und aufgrund
der Datierbarkeit der betreffenden mtDNA-Linien durchaus mit archologischen Ereignissen
assoziiert werden konnten.
Die bereits beschriebene Verknpfung von HVS I Sequenzdaten mit diagnostischen RFLPs
des kodierenden Bereichs und letztlich eine gezielte Erweiterung des Datensatzes von
Richards und Kollegen (1998) besttigte jedoch die Ergebnisse der vorausgegangenen Studie.
Auch mit der grundlegenden Arbeit von 2000 inklusive einem erneut vergrerten
Datensatz, vor allem der Vergleichsgruppen im Nahen Osten, und einer verfeinerten
Grnderanalyse (founder analysis) von Martin Richards nderte sich nichts Grundlegendes
am mitochondrialen Bild Europas. Der Anteil an putativen neolithischen Linien, d.h.
allochthone Linien die im Neolithikum neu in Europa auftreten, wurde um die 20% beziffert.
Zudem konnte Richards zeigen, dass sich lediglich die Basken und die Gruppen im Nahen
Osten vom homogenen Verteilungsbild Europas unterscheiden lassen. Basierend auf den
Koaleszenzzeiten der Haplogruppen (vgl. Abbildung 4) wurden postglaziale
demographische Ereignisse als Hauptfaktor angesehen.
Parallel hierzu erfolgten die Verffentlichungen der Ergebnisse aus mtDNA-Studien seitens
der Demisten (Simoni et al. 2000a). Die Analyse von ber 2600 Sequenzen besttigte ebenfalls
das homogene mtDNA Muster in weiten Teilen Europas, konnte jedoch vor allem im
Mittelmeergebiet graduelle Verteilungsmuster herausarbeiten. Allerdings lieen die Autoren
bewusst offen, ob eine palolithische oder neolithische Expansion urschlich fr diese
Muster sei. Sie wiesen aber gleichzeitig darauf hin, dass Beweise fr einen NordSdgradienten, wie es fr das Modell der postglazialen Wiederbesiedlung vorsieht, nicht
signifikant waren.
Inwieweit die Wahl der Analyse zu einem kontrren Ergebnis fhren konnte, zeigte sich in
der 2002 erschienenen Arbeit von Richards und Kollegen. Basierend auf dem Datensatz der
Publikation aus dem Jahr 2000 machten sie sich gezielt auf die Suche nach geographischen
Mustern im mtDNA-Pool Europas. Hierfr teilten sie Europa nach palokologischen
Kriterien (Gamble 1996; 1999) in verschiedene Regionen auf und untersuchten diese mit
Hilfe der Hauptkomponentenanalyse. Die erste Hauptkomponente, der 51% der Variation
entsprachen, zeigte nun das bekannte Bild der Sdost-Nordwestgradienten. Eine Parallele
zur ersten Hauptkomponente von Cavalli-Sforza und der daraus abgeleiteten
Neolithisierungshypothese war vordergrndig offensichtlich, konnte jedoch bei genauerer
Betrachtung nicht dauerhaft besttigt werden. Denn es fielen zwar die gewhlten Regionen
im Sdosten, d.h. der Balkan, sowie der stliche und zentrale Mittelmeerbereich in ein

30

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
gemeinsames cluster, eine Verbindung zu Zentraleuropa, welche der neolithischen
Inlandsroute entsprche, bestand jedoch nicht. Interessanterweise zeigte auch keiner der
Hauptkomponenten dieser Arbeit eine Nord-Sd-Ausrichtung, wie sie in der zuvor
vertretenen These der haupturschlichen postglazialen Wiederbesiedlung zu erwarten
gewesen wre (siehe auch Jobling et al. 2004). Weiterfhrende Interpretationen lie auch
Richards bewusst aus, zog jedoch erstmals postneolithische Prozesse fr das mtDNA (und
eventuell auch entsprechend fr das Y-chromosomale) Verteilungsmuster strker in
Betracht.
Der Analyse der maternalen Linien entsprechend, erfolgten zeitgleich ausgedehnte
Untersuchungen zur europischen Variabilitt des Y-Chromosoms. Erste Untersuchungen
hierzu waren analog zur mitochondrialen DNA zunchst explorativer und deskriptiver Art
(Jobling 1994, Semino et al. 1996, Jobling & Tyler-Smith 2000). Doch konnten auch hier frh
unterschiedliche Frequenzen einzelner Haplogruppen geographisch notiert werden, was
gleichermaen bereitwillig in der Diskussion um die Besiedlungsgeschichte aufgenommen
wurde. Basierend auf Ergebnissen ausgedehnter Analysen von Y-Chromsomen von Rosser
und Kollegen (2000) bzw. Semino und Kollegen (2000) konnten nun SO-NW-Gradienten
innerhalb Europas beschrieben und bekrftigt werden. Vor allem die detaillierte Studie von
Zo Rosser und Kollegen unterstrich die Ergebnisse der klassischen Marker. Sie fanden im
Verteilungsmuster der verschiedenen Y-Haplogruppen die entsprechenden Parallelen zu
allen vier Hauptkomponenten von Cavalli-Sforza und Kollegen. Bezglich der angemerkten
SO-NW-Gradienten zweier Y-Haplogruppen, welche ca. 45% der Variation und
kontinentweit dem Modell der demic diffusion entsprachen, boten Rosser und Kollegen keine
genaue Interpretation an. Stattdessen warnten sie vor voreiliger Verknpfung mit
archologisch bekannten Prozessen ob der Tatsache, dass gerade die Datierungen fr beide
betreffenden Haplogruppen zu divergent seien.
Die zeitgleiche Arbeit von Semino hingegen, welche ebenfalls diesen Gradienten nachwies,
definierte neolithische Y-Haplogruppen und setzte deren Anteil von 22% gleich dem Beitrag
an neolithischem Einfluss auf den europischen Genpool. King & Underhill (2002) schufen,
basierend hierauf, wieder eine direkte Verknpfung zum archologischen Fundgut und
sahen sich in den geographischen Parallelen von gehuftem Vorkommen bestimmter YHaplotypen und dem Auftreten von anthropomorphen Figurinen und bemalter Keramik
besttigt.
Eine kritische berprfung der Daten von Semino (2000) durch Chikhi und Kollegen (2002)
kam zu einem hheren Wert von durchschnittlich 50-65% Anteil an neolithischen Linien
(70% auf dem Balkan und sich in Gradienten bis auf die Iberische Halbinsel auf 30%
verringernd). Der Ansatz, der hierbei verfolgt wurde, war jedoch ganz anderer Art. So
wurden innerhalb des Datensatzes putative Urpopulationen ausgewhlt. Auf der einen Seite
wurden die Basken als Vertreter der europischen Palolithiker definiert und auf der
anderen Seite ein Pool aus Daten aus dem Nahen Osten erstellt, welcher die Nachkommen
der
ersten
Ackerbauern/Viehzchter
widerspiegeln
sollte.
Mit
Hilfe
von
Simulationsanalysen
wurde
nun
der
jeweilige
Anteil
der
entsprechenden
Ausgangspopulationen in der jeweiligen Vermischungspopulation festgestellt. Diese Arbeit
wurde wiederum von Richards (2003) kritisiert, denn zum einen fasste sie mehrere
unplausible Annahmen zusammen (vor allem die unkritische Ansetzung der beiden

31

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Ursprungspopulationen) und lie keine postneolithische weitere Vermischung zu. Zum
anderen wurde der Grad der Rckwanderung auer acht, den Richards (et al. 2000) mit
einer Hhe von 20% postuliert hatte. Das wichtigste Argument gegen die Arbeit von Chikhi
und Kollegen war jedoch das Fehlen zeitlicher Tiefe und die unkritische Zuordnung der
Beobachtungen in die Periode des frhen Neolithikums (Richards et al. 2003).
Ein neuere Arbeit - seitens der Demisten - von Isabelle Dupanloup und Kollegen (2004)
knpfte methodisch an die Arbeit (und die Daten) von Chikhi (et al. 2002) an und erweitete
die Vermischungsanalysen (admixture analysis) auf mehrere loci, indem sie mitochondriale
Daten von Simoni et al. (2000), Y-chromosomale Daten von Rosser et al. (2000) und weitere
nuklere Daten von Chikhi et al. (1998) sowie aus den gngigen Datenbanken mit einbezog.
Mit diesem bislang grten molekularen Datensatz besttigt Dupanloup die Ergebnisse von
Chikhi, d.h. ein Beitrag nahstlicher Linien von durchschnittlich 50% innerhalb von 12
europischen Gruppen. Zwar pldierte Dupanloup nicht fr ein Verhltnis dieser Art bereits
im Neolithikum, sondern argumentierte bewusst fr ein beobachtetes Verhltnis in heutiger
Zeit. Das grundlegende Dogma, dass der ursprngliche Ansto, dessen Auswirkungen
wir im Verhltnis heutigen europischen Genpool Europas beobachten, nur im Rahmen der
Neolithisierung Europas erfolgt sein konnte, blieb jedoch unbegrndet bestehen.
Eine krzlich verffentlichte Studie von Currat & Excoffier (2005) nahm die Arbeit von
Dupanloup (et al. 2004) kritisch in Augenschein und attestierte ihr methodische Mngel
bezglich der Auswahl der loci. Darber hinaus boten die Autoren Ergebnisse ihrer
Simulationen hinsichtlich des Neolithisierungsprozesses. Die Analysen bzw. Simulationen
waren bereits auf die Fragestellung der mglichen Vermischung von Neandertalern und
anatomisch modernen Menschen angewendet worden (Currat & Excoffier 2004), so dass
lediglich die zeitlichen Mastbe verschoben werden mussten, um der aktuellen
Fragestellung gerecht zu werden. Im Gegensatz zu den Simulationen der Demisten kamen
sie zu dem Ergebnis, dass bereits ab einer hypothetischen Vermischung von 3% der
neolithischen Immigranten mit der indigenen Bevlkerung Europas, erstere heute nicht
mehr nachweisbar seien.
Eine weitere aktuelle Arbeit (Roewer et al. 2005) beinhaltete die Analyse von Y-STRHaplotypen von 12.700 Individuen aus 91 Sammelpunkten Europas. Auch hier beobachteten
die Autoren graduelle Verteilungen der Y-STR-Haplogruppen. Die diskutierten mglichen
demographischen Prozesse bezogen sich jedoch in erster Linie auf historische Ereignisse, ein
Umstand den sie mit der hheren Mutationsrate von STRs gegenber binren Y-SNPs
begrndeten. Roewer und Kollegen konnten allerdings erneut nachweisen, dass ganz
besonders die Regionen Sdosteuropas vorgeschichtlich, wie auch geschichtlich bedingt eine
extreme Form eines Palimpsest darstellten.
Zusammenfassend kann nun festgestellt werden, dass trotz abnehmender Vehemenz der
Debatte (Richards 2003) kaum ein Konsens bezglich der Besiedlungsgeschichte Europas aus
genetischer Sicht besteht. Der oft zitierte und geuerte Beitrag von 20% neolithischer Linien
im europischen Genpool (berufend auf Richards et al. 2000 und die Annherung der
Demisten an diesen Wert gem Simoni et al. 2000) kann daher einstweilen nur als

32

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Anhaltspunkt bzw. Arbeitshypothese standhalten. Einigkeit herrscht in der Annahme, dass
phylogenetisch feiner auflsende und umfassendere Studien mehr Klarheit in die
Kontroverse bringen knnen, wie aktuelle mtDNA Studien zeigen konnten (Achilli et al.
2004, Pereira et al. 2005 und Loogvli 2004). Die Debatte ber die Besiedlung Europas ist
nach wie vor im Gang und eine endgltige Lsung momentan nicht in Sicht (Forster 2004, Di
Giacomo et al. 2004). Es kann zum gegenwrtigen Zeitpunkt lediglich festgestellt werden,
dass ein noch nher zu bestimmender Anteil der modernen Europer sdstlichen
Ursprungs zu sein scheint. Ob dieser Anteil letztlich auch mit der Neolithisierung Europas
oder Teilen Europas in Verbindung steht, muss weiter offen bleiben bzw. soll in der
vorliegenden Arbeit beleuchtet werden (Kap. 4).

33

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.3

Die Haplogruppenverteilung im modernen maternalen Genpool


unter besonderer Bercksichtigung Europas

Die wegweisende Arbeit zur Phylogenie der mitochondrialen DNA wurde 1987 von Rebecca
Cann und Kollegen verffentlicht, die damit die Debatte der mitochondrialen Eva
entfachte. Sie konnte anhand einer globalen Stichprobe von 147 Individuen zeigen, dass alle
untersuchten mtDNA-Linien auf einen afrikanischen Ursprung zurckzufhren seien. Eine
Datierung ihres phylogenetischen Baum ergab ein Alter von ca. 200.000 Jahren. Die
Anhnger der Recent Out of Africa-Modelle (OOA) sahen sich endlich in ihren Thesen
untersttzt, dennoch wurde diese Arbeit kontrovers diskutiert, da einerseits die afrikanische
Stichprobe selbst nicht reprsentativ genug war und auch die phylogenetische Analyse
Unzulnglichkeiten aufwies. Zahlreiche weitere Arbeiten sowohl am mitochondrialen
Genom (Stoneking et al. 1990, Vigilant et al. 1991) als auch an nukleren Markersystemen
(Tishkoff et al. 1994, Bowcock et al. 1994, Kaessmann et al. 1999) besttigten den Ursprung
der anatomisch modernen Menschen in Afrika in genetischer Hinsicht (Wallace 1999, Jobling
et al. 2004). Dieses Modell im Rahmen der Ausbreitung des anatomisch modernen Menschen
(AMH nach anatomically modern human) gilt heute als weithin akzeptiert. Gegenstand der
heutigen Forschung ist insofern kaum mehr die lange gefhrte paloanthropologische
Debatte zum OOA-Modell (z.B. Stringer & Andrews 1988) im Vergleich zu den Modellen der
Multiregionalisten, die die heutige Variabilitt des AMH als kontinentale in situ Entwicklung
aus der bereits vor ~ 1,8 Millionen Jahren erfolgten Ausbreitung des Homo erectus aus
Afrika erachteten. Vielmehr wird heute unter Einbezug der stetig ansteigenden Information
seitens der Genetik das Wie der ersten (und einzigen?) Ausbreitung des AMH aus Afrika
untersucht. Die extreme Form des OOA-Modells, welches auch als Garden of Eden-Modell
bezeichnet wurde und das replacement aller archaischer Menschenformen auf den jeweiligen
Kontinenten beinhaltete, wurde jedoch ebenfalls als zu vereinfachend angesehen, da es
kaum Erklrungsanstze zur heute beobachtbaren Variabilitt des AMH bereit stellte. Bereits
die ersten groregionalen mtDNA Studien konnten zeigen, dass jeder Kontinent
eigenstndige und phylogenetisch tiefwurzelnde mtDNA Zweige aufwies (Stoneking et al.
1990, Torroni et al. 1996, Schurr et al. 1999, Kivisild et al. 1999, Watson et al. 1997, Forster et
al. 2001). Diese Beobachtungen standen mehr im Einklang mit dem so genannten Weak
Garden of Eden-Modell, das von Harpending et al. (1993) geprgt wurde. Dieses Modell
vertrat die Annahme, dass nicht eine stetige demografische Expansion aus Afrika fr die
heutige Variabilitt zugrunde lag, sondern vielmehr hierfr eine kontinentale
Differenzierung mit Herausbildung regionaler Verbreitungsmuster als Folge einer
(womglich einzigen Expansion) oder weniger zu sehen sei.
Es scheint sich somit auch aufgrund moderner mtDNA Studien besttigt zu haben, dass sich
einerseits alle AMH auf ein evolutives Ereignis zurckfhren lassen (Mitochondriale Eva)
und andererseits die heutige Diversitt das Ergebnis multiregionaler Entwicklung aus einer
frh erfolgten geographischen Aufsplittung ist, die wiederum nur einer Expansion aus
Afrika folgte.

34

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Mittlerweile liegt eine in weiten Teilen sehr detaillierte Phylogenie zur Variation des
mitochondrialen Genoms vor. Dies konnte durch initiale RFLP-Analysen, Sequenzierungen
der HVR und letztlich durch die sukzessive Sequenzierung des gesamten Mitochondriums
ausgesuchter mtDNA Varianten erreicht werden (Torroni et al. 1996, Richards et al. 1996,
1998, Ingman et al. 2000, Finnil et al. 2001, Maca-Meyer et al. 2001, Herrnstadt et al. 2002,
Mishmar et al. 2003). Als Ergebnis hiervon konnten die einzelnen mtDNA-Varianten
(Haplotypen) in monophyletische Kladen (Haplogruppen; im Folgenden auch als Hg oder
Hgs) zusammengefasst werden, welche sich wiederum in so genannten Super- oder
Makrohaplogruppen (Makro-Hg(s)) erfassen lieen. Die Haupthaplogruppen (z.B. H)
werden nach Grobuchstaben benannt, wobei die weitere hierarchische Untergliederung in
Subhaplogruppen (Sub-Hg(s); z.B. H1) und weiteren Varianten (z.B. H1a oder H2a1) bis zum
Haplotypen erfolgt, ab welchen diese lediglich durch die individuellen Nukleotidpositionen
beschrieben werden. Wenngleich noch nicht alle einzelnen Haplogruppen komplett
sequenziert sind, was eine feinstmgliche Auflsung der phylogenetischen Beziehung
bedeuten wrde, so ist dies gleichsam Gegenstand der aktuellen Forschung (z.B. Loogvli et
al 2004, Tanaka et al. 2004).
Alle mtDNA-Linien auerhalb Afrikas knnen in zwei groe Gruppen N und M (so
genannte Makrohaplogruppen) aufgeteilt werden (Watson et al. 1997, Quintana-Murci et al.
1999). Diese unterscheiden sich von ihrem afrikanischen cluster L3 durch jeweils eine
Mutation. Die beiden Makro-Hgs beinhalten jeweils weitere Haplogruppen, die sich
wiederum durch verschiedene weitere Mutationen unterscheiden lassen. So umfasst die eine
Grogruppe M die Hgs C, D, E, G, M*, Q und Z und die andere Grogruppe N die Hgs A, I,
W, X, N* sowie ein cluster R, das die Hgs B, F, H, V, J, T, U, K, R* beinhaltet. Prinzipiell lassen
sich bereits die Makro-Hgs N und M geographisch trennen. So sind die Linien der Makro-Hg
M vorwiegend in (Sd- und Ost-)Asien und sehr hufig bei der ursprnglichen Bevlkerung
des amerikanischen Kontinents zu finden. Haplogruppen der Makro-Hg N sind mehrheitlich
in Nordafrika, Europa und Westasien verteilt. Einige Hgs der N-Familie (A, B, F, Y) kommen
jedoch ausschlielich in Asien vor. Eine hypothetische, sowie reduziert schematische
Darstellung der Haplogruppenverteilung der beiden Makro-Hgs N und M ist in Abbildung
5 zu sehen. Der Zeitpunkt, an dem beide Makro-Hgs Afrika verlassen haben, wird von
Ingman (et al. 2000) mit 60.000 Jahren angegeben. Quintana-Murci und Kollegen (1999)
kommen mit 53.000 Jahren fr das untersuchte indische cluster der Makro-Hg M diesem
Wert nahe. Eine unmittelbare Abspaltung der Makro-Hg R von N erfolgte wohl nur kurze
Zeit danach. Zieht man die bekannt groen Standardabweichungen der
Koaleszenzzeitberechnungen in Betracht, so berlappen die beiden Bereiche weitgehend.
Aktuelle mtDNA-Studien an noch verbliebenen, putativen Urbevlkerungen Sdostasiens
konnten diesen mglichen Zeitpunkt im Hinblick auf Makro-Hg M besttigen (Kong et al.
2003, Metspalu et al. 2004, Macaulay et al. 2005, Thangaraj et al. 2005). Darber hinaus lie
sich anhand der Daten eine schnelle Verbreitung der M-Linien entlang der Sdkste Asiens
rekonstruieren (Forster & Matsumura 2005).

35

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

Abbildung 5. Hypothetische Verteilung der Haplogruppen der Makrohaplogruppen N, M und R in


Eurasien.

36

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Metspalu und Kollegen (2004) lokalisierten den Split von west- und osteurasiatischen Linien
im Gebiet nrdlich des persischen Golfes zwischen dem heutigen Iran und dem Industal. Sie
stellten weiterhin fest, dass sich die Hauptverbreitungszonen der Makro-Hg N, M und R der
ersten (und einzigen) Auswanderungswelle aus Afrika auch heute noch bemerkenswert
wenig berlappen bzw. vermischt haben. Aus Sicht der mitochondrialen DNA hatte die
Besiedlung Amerikas ber die Beringstrasse zur Folge, dass heute nur vier bzw. fnf Hgs
dort aufzufinden sind. Dies sind in erster Linie die asiatischen Linien A und B der Makro-Hg
N und die Linien C und D der Makro-Hg M (Schurr et al. 1990, Torroni et al. 1994a; 1994b,
Forster et al. 1996, Alves-Silva et al. 2000). Zudem findet sich dort die Haplogruppe X,
welche auch in Nordeuropa und Nordasien vorkommt und daher wahrscheinlich eine
Verbreitung in und ber zirkum(nord)polare Bevlkerungsgruppen erfahren hat (Brown et
al. 1998, Derenko et al. 2001).
Die Besiedlung des polynesischen bzw. austronesischen Raums erfolgte durch die
Haplogruppen B, P, Q und weitere (Sub-)Hgs von M (Sykes et al. 1995, Melton et al. 1998,
Lum et al. 1998, Lum & Cann 1998, Forster et al. 2001). Die phylogenetischen Beziehungen
und die Verteilung der Haplogruppen in Europa lsst sich grtenteils auf die intensiven
Bemhungen der beiden Arbeitsgruppen um Antonio Torroni und Martin Richards bzw.
Brian Sykes zurckfhren (Torroni et al. 1994, 1996, 1998, 2001, Richards et al. 1996, 1998,
2000). Torroni begann zunchst mit der Charakterisierung der Hgs H, V, I, W, X, J, T, K und
U, die mit Hilfe von 12 Enzymen im kodierenden Bereich der mtDNA durchgefhrt wurde.
Parallel hierzu wurde von der Arbeitsgruppe um Richards die HVR I sequenziert und dafr
eine eigenstndige Nomenklatur erstellt. Die Synthese der beiden Anstze erfolgte durch
Macaulay (et al. 1999) unter Beibehaltung der Nomenklatur Torronis und wurde durch
vollstndige Sequenzierung des mitochondrialen Genoms spezifischer Hgs besttigt
(Ingman et al. 2000, Finnil et al. 2001). Ein Netzwerk der phylogenetischen Beziehungen der
hauptschlich europischen/eurasischen Hgs, die aus Makro-Hg N hervorgegangen sind, ist
in Abbildung 6 aufgezeigt.

Abbildung 6. Vereinfachtes Netzwerk der Makrohaplogruppe N. Es sind mit Ausnahmen nur die
kennzeichnenden Substitutionen der HVR I angegeben. Fr die Haplogruppen R, U, HV und H, die
sich im Bereich der HVR I nicht unterscheiden lassen, sind charakteristische Positionen der coding
region angegeben.

37

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Die Hgs Europas lassen sich durch zwei cluster beschreiben. Zum einen durch die
Haplogruppen I, W, X, N1a und N1b der Makro-Hg N, die sich jeweils in zwei spezifischen
Mutationen in der HVR I von N unterscheiden. Die europischen Hgs von N stellen mit
durchschnittlich 5% lediglich einen geringen Anteil aller europischen Haplogruppen dar.
Dieser Anteil nimmt im Nahen Osten sowie in Nordwestasien zu. Die Hgs I, N1a, N1b, N1c,
N1d lassen sich aufgrund von weiteren spezifischen coding region Mutationen in ein
subcluster N1 zusammenfassen. Hg N1a ist in gleichen Anteilen, allerdings in drei mglichen
Subhaplogruppen in Europa, West- bzw. Zentralasien, sowie in Nordostafrika und
Sdwestasien vorhanden und ist Gegenstand ausfhrlicher Diskussion der vorliegenden
Arbeit (Vgl. Kap. 7.3.2). Hg I ist im europischen Raum vornehmlich im Norden und
Nordwesten zu finden. Hg W ist allgemein hufiger im Sden Europas aufzufinden
(Richards et al. 1998), weist allerdings zwei bemerkenswerte Verbreitungsgebiete mit
deutlich erhhten Frequenzen auf: zum einen in Finnland, wo Meinil (et al. 2001) einen
Anteil von 11% beobachten konnte, hierfr jedoch aufgrund der sehr geringen Diversitt der
W Haplotypen einen Grndereffekt bzw. bottleneck vorschlgt, zum anderen mit 5% in
Pakistan und Nordostindien (Metspalu et al. 2004). Das Vorkommen der verbleibenden
Zweige von N, der Hgs A und N9a, ist auf (Ost-)Asien beschrnkt. Allen Zweigen gemein ist
jedoch ein relativ hohes Alter von etwa 25.000-50.000 Jahren, ein Umstand, der auf eine weit
zurckliegende Expansion hindeutet, jedoch mit dem postulierten Alter der MHg N von ca.
60.000 Jahren selbst in Einklang steht.

Abbildung 7. Die Verteilung der mitochondrialen Haplogruppen in Europa. (modifiziert nach


Jobling et al. 2004).

Die berwiegende Mehrheit des europischen mtDNA Genpools ber 90% ist durch die Hgs
HV, H, V, J, T, U und K des cluster R gekennzeichnet (Abbildung 7). Spezifisch fr das cluster
R ist eine TaC Mutation an Nukleotidposition (np) 16223, welche die ursprngliche
Verbindung der MHg M und N zur afrikanischen Linie L3 betrifft und somit dieses cluster
direkt von afrikanischen und asiatischen Hgs unterscheidet. Die weitere Unterteilung von R

38

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
erfolgt durch spezifische Mutationen. Hg F unterscheidet sich an np 16304 und Hg B
zeichnet sich durch eine charakteristische Deletion von 9bp sowie der HVR I Mutation an np
16189 aus. Diese beiden Hgs sind prinzipiell auf den asiatischen Raum beschrnkt; von einer
Ausnahme, Hg F betreffend, berichten Tolk (et al. 2001) im heutigen Kroatien.
Die hufigste Haplogruppe Europas ist H, welche wiederum ein groes cluster verschiedener
H-Linien in sich vereint, dessen Auflsung sich die aktuelle Forschung zur Aufgabe gemacht
hat (Loogvli et al. 2004). Die Hufigkeit variiert innerhalb Europa zwischen 40-60%, die im
Nahen Osten auf ~20-30% abnimmt (Richards et al. 2000). Des Weiteren ist Hg H auch in
Nordafrika (Rando et al. 1998) und in West- bzw. Zentralasien relativ hufig (Metspalu et al.
1999, Comas et al. 2004, Quintana-Murci et al. 2004). In geringen Anteilen ist Hg H auch in
Sibirien und Sdasien zu beobachten (Kivisild et al. 1999, Derenko et al. 2003, Fedorova et al.
2003). Richards et al. (2000) datiert und lokalisiert die zugrunde liegende Expansion des H
cluster vor ~25.000 Jahren im Nahen Osten. Die feinere Auflsung sowie Charakterisierung
der Hg H hatte lange Zeit Schwierigkeiten bereitet, da sie die Referenzsequenz CRS
(Cambridge Reference Sequence, Anderson et al. 1981) beinhaltet, welche sich im HVS I Bereich
der diversen Linien nicht unterscheidet bzw. ausreichend kennzeichnend ist, und auch die
Auflsung der RFLP-Analyse an ihre Grenzen gestoen war. Basierend auf vollstndigen
Sequenzierungen des mtDNA Genoms distinkter H-Hgs konnten sukzessive die Zweige H1,
H2 (Finnil et al. 2001), H3, H4 (Herrnstadt et al. 2002), H5, H6 (Quintns et al. 2004,
Loogvli et al. 2004, Pereira et al. 2005), H7 (Quintns et al. 2004), H8, H10, H11 (Loogvli et
a.l. 2004) und H9 sowie H12-H15 (Achilli et al. 2004) beschrieben werden. Entgegen der
ursprnglich eher uniformen Verteilung ber Eurasien (wie sie auch noch in Abbildung 5
dargestellt ist) zeigen in den jeweiligen Studien von Loogvli, Achilli und Pereira die
einzelnen Sub-Hgs von H phylogeographische Verbreitungsmuster. Unter diesen ist Sub-Hg
H1 mit 30% die hufigste Linie, welche gleichermaen ca. 13% des europischen Genpools
darstellt. Zudem ist innerhalb Europas ein deutlicher Gradient von der Iberischen Halbinsel
nach Nordosteuropa der Abnahme von H1 festzustellen. Selbiges zeigt sich bei Sub-Hg H3,
welche im Sdwesten zu 17% nachzuweisen ist, jedoch verschwindend gering im Nahen
Osten zu finden ist. Diese Beobachtung lsst sich gut mit einer Expansion aus dem glazialen
Refugium im frankokantabrischen Raum bzw. auf der Iberischen Halbinsel in Einklang
bringen, wie es bereits fr Hg V vergleichsweise postuliert wurde (vgl. Kap. 3.1.4; Torroni et
al. 1998). Die errechneten Koaleszenzzeiten fr die Sub-Hgs H1 und H3 mit einer Spanne
von ~8.600-13.400 Jahren vor heute (v. h.) passen in den Zeitraum der Hypothese.
Zusammen mit der Schwesterlinie Hg V lsst sich Hg H im cluster HV vereinen, das durch
np 73 charakterisiert ist. Die Linien der Hg HV selbst (HV1-3) sind vorwiegend im Gebiet
des Nahen und Mittleren Ostens und im Kaukasusgebiet verbreitet, wofr Metspalu et al.
(1999) ein Alter von ~40.000 Jahren v. h. errechnen.
Hg V (16298) ist mit einer Frequenz von 1-6% in Europa vertreten. Als Ausnahmen konnten
die Basken und Katalanen Spaniens mit einer Frequenz von 20% genannt werden (Torroni et
al. 1998, 2001). Eine weitere Ausnahme bilden die Saami, bei welchen der Anteil an Hg V bei
40% liegt (Sajantila et al. 1995, Tambets et al. 2004), die Diversitt allerdings sehr gering ist

39

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
(Torroni et al. 1998). Die Datierung der Hg V auf ~10.000-15.000 Jahre v. h. und deren
gehuftes Vorkommen in Sdwesteuropa sieht Torroni zudem als Beweis fr eine
postglaziale Expansion der Hg V aus Iberien ins Festland.
Die Hg J und T sind Schwesterlinien, die beide die typische np 16126 aufweisen, sich jedoch
in weiteren charakteristischen Positionen (u.a. 16069 fr Hg J und 16294 fr Hg T)
unterscheiden lassen. In variierender Zusammensetzung stellen beide etwa ~20% des
europischen Genpools dar. Es gilt als sehr wahrscheinlich, dass auch fr Hg J und T ein
nahstlicher Ursprung vor bzw. whrend der letzten Eiszeit angenommen werden kann.
Beide Linien zeigen eine komplexe innere Struktur, die jedoch auch jngere sternfrmige
cluster beinhalten, die Richards et al. (1998, 2000) im Rahmen der founder analysis als putative
Kandidaten fr eine neolithische Expansionen erachtete (vgl. Kap. 3.2.1).
Die Haplogruppe U und ihre Subhaplogruppen (Sub-Hg bzw. Sub-Hgs) unterscheiden sich
von cluster R durch eine charakteristische Restriktionsschnittstelle des Enzyms Hinf I in der
coding region. Die Sub-Hgs U1-U6 lassen sich jedoch im Bereich der HVR I durch eine oder
mehrere Mutationen charakterisieren. Die Hg U ist in Europa mit einer Hufigkeit von ca.
14% durch die Linien U3 (16343), U4 (16356) und U5 (16270) und K (16224, 16311) vertreten,
wobei der Anteil der Linie U5 innerhalb dieser ca. 68% betrgt. Koaleszenzzeitberechnungen
sowohl fr U als auch U5 allein ergaben ein sehr hohes Alter von ca. 50.000 Jahren sowohl in
Europa als auch im Nahen Osten (vgl. Abbildung 4; Richards et al. 2000). Dies bringt
Richards zu der Annahme, dass im frhen Oberen Palolithikum ein Groteil der ersten
Bevlkerung im eurasischen Raum dieser mtDNA Linie angehrt haben muss und dass sich
Hg U5 sehr wahrscheinlich frh in Europa ausgeprgt hatte, da sie berall im heutigen
Europa in vergleichbaren Anteilen zu finden ist, ihre Frequenz im Nahen Osten allerdings
rasch unter 0,2% fllt. Fr das hohe Alter der Hg U sprechen weiterhin die grorumige
Verbreitung und die regionale Differenzierung der einzelnen Untergruppen. So fand z.B. Hg
U6 (16172, 16219) vermutlich eine Reexpansion entlang der Nordkste Afrikas, wo sie
vermehrt in Nordwestafrika zu finden ist und in Europa auf den iberischen Raum
beschrnkt ist. Hg U7, eine weitere Linie von U mit der HVR I Position 16318 ist wiederum
mit einer Frequenz von 9,4% fr den vorderasiatischen Raum um den heutigen Iran
charakteristisch, dagegen in Europa sehr selten zu finden. Hg U2 ist ebenfalls sehr selten in
Eurasien, tritt dafr aber mit einem vergleichsweise hohen Anteil von ca. 8% auf dem
Indischen Subkontinent auf. Hg U4 (16365) ist die Zweithufigste der europischen ULinien. Das Alter dieser Linie wird von Richards et al. (1998) auf ~25.000 Jahre v. h.
angesetzt, was hnlich wie fr Hg U5 eine Verbreitung vor der letzten Maximalvereisung
(oder im Folgenden synonym: LGM fr last glacial maximum) vorgibt. Fr Hg U4 ist
innerhalb Europas ein leichter Gradient von West nach Ost bzw. Sden zu erkennen; die
hchste Frequenz wird bemerkenswerterweise mit 16% fr die ugrisch-sprachigen Mansi
Westsibiriens berichtet (Derbeneva et al. 2002).
Hg K (16224, 16311) zhlt ebenfalls zu cluster U, wurde jedoch ursprnglich aufgrund einer
Rckmutation im kodierenden Bereich als eigenstndige Hg beschrieben, die ursprngliche
Benennung jedoch nach der Korrektur beibehalten (Hofmann et al. 1997, Richards et al.
1998). K ist berall in Europa und Eurasien allgemein mit einer Frequenz von ~5% im

40

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
maternalen Genpool vorhanden, mit leicht steigender Tendenz jedoch in westeuropischen
Bevlkerungen.
Es lsst sich grundstzlich sagen, dass sich der Groteil der heutigen europischen mtDNA
Variation aus Haplogruppen zusammensetzt, die Europa bereits im ausgehenden
Palolithikum bzw. Mesolithikum vom Nahen Osten aus erreicht haben. Dies lsst sich
aufgrund der leicht hheren Haplotypendiversitt und auch hheren Koaleszenzzeiten fr
den Nahen Osten herausarbeiten (Torroni et al. 1998; Richards et al. 2000). Ausnahmen
bilden lediglich Hg U5, fr die eine frhe Ausbildung in Europa anzunehmen ist, sowie Hgs
V, H1 und H3, welche sich sehr wahrscheinlich periglazial aus palolithischen
Vorluferlinien entwickelten und postglazial aus den Refugialzonen verbreiteten.

41

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.4

Methodische Grenzen populationsgenetischer Studien und


Einsatzmglichkeiten von aDNA-Analysen

Die grundlegenden Probleme rezentgenetischer Untersuchungen liegen im methodischen


sowie analytischen Ansatz begrndet, der feine zeitliche und geographische Auflsungen
eines komplexen Vorgangs wie z.B. der Neolithisierung anhand des untersuchenden
Datensatzes nicht zulsst. Die archologische Forschung hat lngst differenziertere Modelle
entwickelt, jedoch fhrte auch dies nicht zu einem umfassenden akzeptierten KonsensModell. Daher wird man im Rahmen der Genetik vorerst auf eine Vereinfachung von
Modellen zurckgreifen mssen, die allerdings in den wenigstens Fllen der Realitt gerecht
werden knnen.
Das Hauptproblem von populationsgenetischen Studien, welche sich historischen
Fragestellungen widmen, liegt in der Tatsache begrndet, dass sie fast ausnahmslos mit
modernen Daten arbeiten (mssen). Dies bedeutet, dass der Hauptpunkt der historischen
Fragestellung - die zeitliche Tiefe - nicht direkt an den Daten selbst ablesbar ist. Es knnen
nur indirekt Aussagen ber mgliche Verhltnisse und Zustnde in der Vergangenheit
erstellt werden und ber Datierungsmglichkeiten, wie die der molekularen Uhr,
Schtzwerte zum Zeitpunkt von Ereignissen erbracht werden. Letztlich mssen diese
Aussagen jedoch als Annahmen bestehen bleiben. Ein direkter Ansatz zur Erfassung des
genetischen status quo an einem beliebigen Punkt in der Vergangenheit kann daher nur
durch einen gezielten zeitlichen Querschnitt erfolgen.
Momentan ist nur die Analyse von alter DNA (aDNA) imstande, in genetischer Hinsicht
gesicherte, Aussagen ber vergangene Zeiten zu ermglichen. Dieser Umstand soll in
Abbildung 8 verdeutlicht werden, welche eine hypothetische Verteilung fiktiver genetischer
Linien in Raum und Zeit darstellt. Ein rezentgenetischer Querschnitt kann lediglich die
Situation zum heutigen Zeitpunkt erfassen. Die Verteilung von beobachteten Typen lsst
somit nur bedingt Aussagen zur Vergangenheit zu, wie z.B. zum Zeitpunkt der Aufsplittung
der Typen a2.1 und a2.2. Ein Querschnitt auf der Zeitachse zu einem frheren Zeitpunkt
ergbe zumindest einen terminus post quem bezglich der Aufsplittung des Typs a2. Zudem
liefert er Aussagen ber die anteilig hhere Frequenz von a1, der Existenz einer
ausgestorbenen Linie a3 (ohne jedoch die Aufsplittung vor dem Verschwinden zu erfassen),
sowie einer geringeren Frequenz von a4. Zustzlich knnte bei ausreichender
Stichprobengre auch das Vorkommen einer rumlich differenzierten Linie zu diesem
Zeitpunkt der Vergangenheit noch ausgeschlossen werden.
Mglicherweise muss die Analyse alter DNA aufgrund inhrenter Limitierungen auf das
mitochondriale Genom beschrnkt bleiben (die Ursachen hierfr sind in Kap. 3.7.1
angefhrt). Sofern die Authentizitt der erhobenen Daten gewhrleistet werden kann,
knnen jedoch die direkt ermglichten Einblicke in vergangene genetische Zustnde
Antworten auf gezielte Fragestellungen liefern, wie sie bereits fr einige (vor allem
ausgestorbene) Tierarten erbracht werden konnten (z.B. Cooper et al. 1992; 2001 fr Moas,
Barnes et al. 2002 fr pleistozne Braunbren, Hofreiter et al. 2002 fr Hhlenbren, Burger
et al. 2004 fr Hhlenlwen).

42

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Sicherlich wird die Stichprobengre bei alter DNA immer reduziert sein, so dass Vergleiche
mit modernen Untersuchungen statistisch erschwert oder gar unmglich sind. Ein
diachroner Ansatz von Untersuchungsquerschnitten durch die Zeit drfte jedenfalls vorerst
Fiktion bleiben. Zumindest aber kann jedes untersuchte Individuum wertvolle Hinweise
bzw. Impulse fr zuknftige Analysen geben.

Abbildung 8: Schema einer phylogeographischen Verteilung von genetischen Varianten in Raum


und Zeit. Die roten Linien entsprechen zeitlichen Querschnitten mit den jeweiligen
Frequenzverteilungen der verschiedenen Varianten in den zugehrigen Kreisdiagrammen.
Erluterungen hierzu im Text.

43

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.5 bersicht zu bisherigen palogenetischen Studien


Die Forschungsrichtung der Analyse alter DNA ist vergleichsweise jung. Sie entsprang
Anfang der 80er Jahre der Genetik und hat sich in ihrer 20-jhrigen Geschichte vom
ursprnglichen Charakter eines Orchideenfachs zu einem etablierten und interdisziplinr
orientierten Wissenschaftszweig der Genetik entwickeln knnen.
Die ersten Studien zu Erhalt und Isolierung von alten DNA-Moleklen wurden bereits vor
der Etablierung der Technik der PCR (polymerase chain reaction) durchgefhrt (Hunan
Medical College 1980, Higuchi et al. 1984, Pbo 1984, Johnson et al. 1985, Doran et al. 1986).
Doch erst die enzymatische Vervielfltigung gezielt gewhlter DNA-Abschnitte durch die
Etablierung der PCR-Techniken durch Saiki et al. (1985) sowie Mullis & Faloona (1987)
ermglichte eine anhaltende Entwicklung des Forschungsbereichs der so genannten ancient
DNA (aDNA).
Ausgehend von der Situation in vivo in welcher mitochondriale DNA in vergleichsweise
hherer Kopienzahl als Kern-DNA vorliegt, beschrnkte man sich in den meisten frhen
aDNA-Studien noch weitgehend auf die Analyse des Mitochondriums. Doch auch die erste
Verffentlichung ber nuklere single copy-Fragmente aus prhistorischen Weichteilen war
bereits 1986 erfolgt (Doran et al. 1986). Die wesentlichen Publikationen der ersten Jahre nach
der Etablierung der PCR-Technik beinhalteten Studien zur Isolierung von DNA aus bis
dahin unzugnglichen Materialien wie in Bernstein eingeschlossene Insekten und Pflanzen
(Cano et al. 1992, DeSalle et al. 1992, Poinar et al. 1993), aus Weichteilen von ausgestorbenen
Museumstieren (z.B. Thomas et al. 1990, Cooper et al. 1992, Krajewski et al. 1992) und aus
Knochen (Hagelberg 1989, Horai et al. 1989, Hummel & Herrmann 1991). Nachdem 1989 die
Amplifikation von Fragmenten der mtDNA aus Knochen beschrieben wurde, war sptestens
ab diesem Zeitpunkt das Interesse seitens der Anthropologen und Archologen geweckt. Im
Jahr 1991 erschien die erste Verffentlichung ber die Amplifikation nuklerer multicopyDNA aus Knochen (Hummel et al. 1999).
Der anfnglichen Begeisterung ber die neu erffneten Mglichkeiten zur Beantwortung
alter Fragestellungen folgte alsbald die Ernchterung, nachdem einige Arbeiten kritischer
berprfung nicht standhalten konnten, da sie sich als Kontamination moderner DNAMolekle erwiesen (Pbo & Wilson 1991, Zischler 1995, Austin et al. 1997, Sykes 1997,
Walden & Robertson 1997). Dies betraf vor allem die Arbeiten, welche ein extrem hohes
Alter bis zu mehreren Millionen Jahren propagierten. Diese Krise erfolgte im Rckblick
jedoch rechtzeitig, da somit eine Reihe von Kriterien herausgestellt wurde (vgl. Kap. 3.6.3),
welche auf bis dato erfolgte methodische Unzulnglichkeiten abzielten und die zur
Authentifizierung von aDNA-Resultaten herangezogen werden (Poinar et al. 1996, Krings et
al. 1997, Handt et al. 1996, Cooper und Poinar 2001, Hummel et al. 2000, Hofreiter et al. 2001,
Burger et al. 2004, Pbo et al. 2004, Willerslev & Cooper 2005, Gilbert et al. 2005a).
Mittlerweile konnten jedoch die Erkenntnisse hinsichtlich der Erhaltungsaussichten alter
DNA - insbesondere im Knochen - vermehrt werden (Colson et al. 1997, Collins et al. 1999,
Burger et al. 1999, Nielsen-Marsh et al. 2000a; 2000b, Smith et al. 2001, Millard 2001,
Gtherstrm et al. 2002). Dies und dem Umstand, dass in der Forschungsgemeinschaft
weitgehend den Kriterien zur Authentifizierung entsprochen wird, verdankt der junge

44

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Zweig der Palogenetik eine Reihe von Arbeiten, welche grundlegend zu aktuellen Fragen
beitragen konnten (Pbo 2004).
Die aDNA-Forschung ist in ihrer 20-jhrigen Geschichte bemerkenswert interdisziplinr
geworden. Die Herangehensweise, die Fragestellung und die methodische Ausrichtung der
Arbeiten sind breit gefchert und von den jeweiligen einbezogenen Disziplinen geprgt, so
dass ein Abriss der wichtigsten Arbeiten in Kategorien erfolgen muss, wobei gem der
vorliegenden Arbeit die betreffenden Kategorien der aDNA menschlicher Quellen bzw. der
Domestikationsereignisse intensiver behandelt werden.

3.5.1 Stammesgeschichte sowie Vor- und Frhgeschichte des Menschen


Die wohl bekannteste Arbeit ber die Analyse alter DNA wurde 1997 von Krings und
Kollegen verffentlicht. Ihnen gelang es, aus dem namensgebenden Fund des Neandertalers
der Feldhofer Grotte DNA zu isolieren und mtDNA-Abschnitte des HVS I zu amplifizieren.
Die erfolgreiche Untersuchung der Region HVS II wurde 1999 ebenfalls publiziert (Krings et
al. 1999). In der nachfolgenden Rezeption der Arbeit wurden die Ergebnisse als Beweis dafr
gewertet, dass die Neandertaler keinen Beitrag zum genetischen Erbgut des modernen
Menschen lieferten. Eine Besttigung der Ergebnisse erfolgte durch weitere erfolgreiche
Analysen an Neandertalerfunden aus Mezmaiskaya im Nordkaukasus (Ovchinnikov et al.
2000), Vindija in Kroatien (Krings et al. 2000) und erneut der Feldhofer Grotte (Schmitz et al.
2002). Sequenzen von weiteren Neandertaler-Individuen erschienen erst krzlich (Serre et al.
2004). Zahlreiche Arbeiten beschftigten sich mit der phylogenetischen Stellung der Taxa
Neandertaler und anatomisch moderner Mensch (Nordborg 1998, Krings et al. 2000,
Guitrrez et al. 2002, Knight 2003, Cooper et al. 2004). Die Rezeption dieser Ergebnisse
erfolgt jedoch seitens der Archologen und Palontologen nach wie vor zgerlich und
kritisch (Schfer et al. 2004).
Ebenfalls fr Aufsehen sorgte die Publikation der Australier Gregory Adcock und Kollegen
(2001) ber zehn pleistozne bzw. holozne australische Funde, die unter anderem die
bekannten Funde Lake Mungo 3 und Kow Swamp enthielten. Die Interpretation der
Ergebnisse und hier besonders die postulierte phylogenetische Einordnung des Fundes Lake
Mungo 3, welche zudem die Out of Africa Hypothese in Frage stellen sollte, wurde hart
kritisiert (Relethford 2001), nicht zuletzt aufgrund der scheinbar sensationellen Ergebnisse,
sondern in erster Linie wegen methodischer Mngel (Cooper et al. 2001b).
Eine Studie an zwei sptpleistoznen Funden anatomisch moderner Menschen (24.000 Jahre)
(Caramelli et al. 2003) stand ebenso stark in der Kritik, obwohl sie die geforderten aDNAArbeitskriterien zu erfllen schien. Die immer whrende Kontaminationsgefahr durch den
Mensch als Bearbeiter des Menschen aufgrund der zu geringen Diskriminierungs- bzw.
Individualisierungskraft der untersuchten Marker und die damit verbundene Problematik,
dass sie nie zu 100% ausgeschlossen werden kann, wurde in Folge aufs heftigste diskutiert
(Abbott 2003, Barbujani & Bertorelle 2003, Serre et al. 2004, Cooper et al. 2004). Die aktuellste
Arbeit an Neandertalern von Serre und Kollegen (2004) beinhaltete auch die Analyse einiger
Funde zeitgleicher anatomisch moderner Menschen, verzichtete jedoch auf Grund dieser
potentiellen Kontaminationsgefahr auf die eingehende Weiterbearbeitung der Skelettfunde.

45

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Die Analyse alter DNA von anatomisch modernen Menschen nimmt in der aDNAForschung zweifellos eine besondere Stellung ein, denn der Bearbeiter als erste
Kontaminationsgefahr stellt ein methodenimmanentes Hindernis dar, welches theoretisch
nur durch uerste Sorgfalt und strenge Authentizittskriterien umgangen werden kann.
Somit lsst sich leicht begrnden, warum die bislang publizierten Arbeiten zum Menschen
immer hart in der Kritik standen und letztlich die Arbeiten, die Anmerkungen zur
Qualittssicherung bzw. zu Authentizittskriterien beinhalten, zahlenmig die eigentlichen
Forschungsarbeiten bertreffen. Leider wird hier oft die Bedeutung der einzelnen Arbeiten
weniger an den jeweiligen Ergebnissen bemessen als an der berzeugungskraft der
Authentizittsnachweise. Dem negativen Ansatz, der von Serre und Kollegen vertreten wird,
stehen eine Reihe anderer Untersuchungen an menschlichen Proben gegenber, die,
zustzlich zu den erbrachten Authentifizierungsleistungen, einerseits durch methodische
Logik und andererseits durch die im genetischen Rahmen sinnvollen Resultate berzeugen
knnen (Ricaut et al. 2004a; 2004b; 2004c; 2004d, Keyser-Tracqui et al. 2003, Endicott et al.
2003, Lalueza-Fox et al. 2004, Haak et al. 2005a; Haak et al. 2005b).
Einige Studien an menschlichen vorgeschichtlichen Proben sind bezglich ihres Zeitrahmens
fr die vorliegende Arbeit von besonderem Interesse. Als prominentes Beispiel knnen die
molekulargenetischen Untersuchungen an der als tzi bekannt gewordenen Eismumie aus
den Tiroler Alpen genannt werden (Handt et al. 1994). Die Ergebnisse dieser Arbeit wurden
zwar von einem unabhngigen Labor besttigt, die Auslegung selbst blieb allerdings immer
umstritten. An diesem Fund lsst sich beispielhaft das Einzelfundproblem errtern, denn
die europische Zuordnung der tzi-Sequenz war aus archologisch-anthropologischer
Sicht nicht als berraschend anzusehen, vielmehr kann ein europischer Fund, von
Europern bearbeitet, dem Verdacht der mglichen Kontamination nicht entgehen. Im
selben Zusammenhang sind auch die ersten Analysen an drei neo- und mesolithischen
Skeletten aus Italien zu sehen (Di Benedetto et al. 2000). Diesbezglich ist die von den
Autoren angefhrte Aussage, dass eine genetische Diskontinuitt zwischen Mesolithikum
und heute bestnde, da die beiden neolithischen Sequenzen im Gegensatz zur
mesolithischen Sequenz im heutigen Genpool vorhanden seien, aufgrund der Datenmenge
kritisch zu sehen.

3.5.2 Identifikation, Material- und Spurenkunde


Verffentlichungen dieser Art beinhalten die Etablierung von Methoden zur
Speziesidentifikation bspw. im archologischen Fundgut, welche wiederum in der
Materialanalyse, zur Kontrolle der Nahrungsmittelindustrie sowie bspw. im Artenschutz
Anwendung finden knnen (Bollongino 2000, Burger et al. 2000b, Burger et al. 2001).
Des Weiteren erfolgten unter dem Begriff der Identifikation auch der Forensik angelehnte
Arbeiten im Zuge derer mit vergleichbaren Methoden versucht wurde, historische
Persnlichkeiten zu identifizieren. Als Beispiel kann hier der Evangelist Lukas (Vernesi et al.
2001), Jesse James (Stone et al. 2001) und Isaac Newton (Gilbert et al. 2004) oder die schon
ber ein Jahrzehnt andauernde Kontroverse um die Zarenfamilie (fr eine aktuelle
Zusammenfassung siehe Knight et al. 2004) angefhrt werden. Abgesehen von deren

46

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
ffentlichkeitswirksamkeit wurden letzteren Arbeiten wenig wissenschaftlicher Nutzen
zugeschrieben (Pbo et al. 2004) und darber hinaus ethische Bedenken geuert (Andrews
et al. 2004).

3.5.3 Verwandtschafts- und Geschlechtsbestimmung


Ebenfalls an die moderne Rechtsmedizin angelehnt sind die Anwendungen von Methoden
zur Verwandtschafts- und Geschlechtsanalysen. Diese Fragestellung ist insbesondere fr
Anthropologen und Archologen bei binnenstrukturellen Untersuchungen innerhalb bspw.
eines Grberfeldes bzw. einer Grbergemeinschaft von Bedeutung, was u.a. wiederum
Rckschlsse auf die soziale Struktur der zu rekonstruierenden Lebensgemeinschaft zulsst
(Schultes et al. 2000, Gerstenberger et al. 1999, Hummel et al. 1999, Ricaut et al. 2004d,
Keyser-Tracqui et al. 2003).

3.5.4 Epidemiologie, Pathologien und andere genetische Marker


Eine eher medizinische Ausrichtung erfhrt die Analyse von alter DNA beim Nachweis von
Pathogenen wie Viren und Bakterien, die im Gewebe persistieren knnen. Viele Arbeiten
hierzu beinhalten den Nachweis des Tuberkuloseerregers Mycobacterium tuberculosis (Salo et
al. 1994, Donoghue et al. 1998; 2004, Haas et al. 2000a, Zink et al. 2001; 2003a; 2003b, Schewe
et al. 2005, Fletcher et al. 2003). Weitere Arbeiten thematisieren den Nachweis des
Pesterregers Yersinia pestis (Drancourt et al. 1998, 2004, Raoult et al. 2000, Drancourt & Raoult
2002), der Lepra Mycobacterium laprae (Taylor et al. 2000, Haas et al. 2000b, Donoghue et al.
2001) oder des Erregers der Spanischen Grippe von 1918 (Taubenberger et al. 1997, Reid et
al. 1999). Jedoch werden auch diese Arbeiten kritisch betrachtet, da zum einen einige
Bodenbakterien starke hnlichkeiten zum Tuberkuloseerreger aufweisen (Pbo et al. 2004,
Gilbert et al. 2005b) und zum anderen ein Nachweis des Pesterregers an scheinbar
gesicherten historischen Proben erfolglos blieb (Gilbert et al. 2004a). Vergleichbar mit dem
Kontaminationsproblem bei der Bearbeitung von menschlicher DNA (jedoch in noch
extremerem Ausma) erweist sich die mikrobielle Kontaminationsgefahr (Willerslev et al.
2004), da die bekannten rezenten Mikroben eine globale Verteilung zeigen, die kaum eine
geographische Charakterisierung zulassen (Willerslev & Cooper 2005). Eine benachbarte
Arbeitsrichtung konzentriert auf den Nachweis von genetisch disponierten Pathologien wie
der Zystischen Fibrose (Bramanti et al. 2003) oder der ankylosierenden Spondylitis (Haak et
al. 2005a). Ein Vorteil, der diesen Arbeiten innewohnt, ist, dass erstens die zu
untersuchenden Marker genetische Prdispositionen darstellen, im Gegensatz zu
Pathogenen also keine ueren Einflsse durch falschpositive Ergebnisse die Analyse
erschweren und zweitens eher selten sind, womit die Kontaminationsgefahr bzw. die
Wahrscheinlichkeit, dass ein Kontaminant Trger des gleichen Merkmals ist, bedeutend
verringert ist.

47

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Einige Arbeiten widmeten sich auch dem molekulargenetischen Nachweis vormals
klassischer genetischer Markersysteme, wie z. B. der Allele der ABO-Blutgruppen (Hummel
et al. 2002, Haak et al. 2004).

3.5.5 Phylogenie und Phylogeographie


Bereits eine der ersten Untersuchungen alter DNA, die an einem Museumsprparat des
Quaggas (Higuchi et al. 1984) durchgefhrt wurde, ermglichte per genetische Zeitreise die
direkte Analyse eines mittlerweile ausgestorbenen Tieres. So verwundert es nicht, dass bis
heute Studien, welche sich die Mglichkeiten der aDNA-Analysen zu Nutze machen, um
bestehenden Fragen der Bereiche Palontologie, (Archo-)Zoologie, (Archo-)Botanik bzw.
Archologie nachzugehen, in einer groen Anzahl vorliegen. Ein mglicher Grund hierfr ist
sicherlich der enorme Erkenntnisgewinn, der je nach Fragestellung erbracht werden kann
und der in einigen Bereichen eine willkommene Ergnzung, wenn nicht ein dringendes
Desiderat darstellt. Ein zweiter Grund ist die geringere Kontaminationsgefahr bei
Einhaltung der aktuellen Standardvorkehrungen. Letzteres gilt allerdings nur fr die
Tierwelt und nur mit Einschrnkungen fr die Pflanzenwelt.
So liegen bereits fr den erfassenden Zeitrahmen der mglichen DNA-Erhaltung fr sehr
viele (ca. 50) (teilweise heute ausgestorbenen) Tiere des spteren Pleistozns, sowie des
Holozns Arbeiten vor, welche einen nicht unbetrchtlichen Beitrag zu Fragen der
phylogenetischen Stellung, der genetischen Variabilitt und der phylogeographischen
Verbreitung liefern konnten.
Als Beispiele seien hier ausgestorbene Arten wie das Mammut (Hagelberg et a. 1994, Hss et
al. 1994, Greenwood et al. 1999, Noro et al. 1998), der Hhlenbr (Hnni et al. 1994, Loreille
et al. 2001a, Orlando et al. 2002, Hofreiter et al. 2002), der Moa (Cooper e al. 1992, 2001,
Bunce et al. 2003, Huynen e al. 2003), der Beutelwolf (Thomas et al. 1989, Krajewski et al.
1997), das Riesenfaultier (Hss et al. 1996), der Riesenadler (Bunce et al. 2005) und der
Riesenhirsch (Lister et al. 2005, Khn et al. 2005) angefhrt.
Ein aktuelles Beispiel der Arbeitsgruppe befasste sich mit der Taxonomie des Hhlenlwen
(Panthera leo spelaea), womit erstmals die umstrittene systematische Stellung dieser Tiere
geklrt werden konnte. Die phylogenetische Analyse der Sequenzen ergab, dass es sich bei
dem Hhlenlwen um eine Schwesterart des afrikanischen (P. leo leo und P. leo senegalensis)
und des asiatischen Lwen (P. leo persica) handelte und dass der Hhlenlwe nach ca.
600.000 Jahren Isolation in Europa ohne Nachkommen ausstarb (Burger et al. 2004).
Aber auch die Analyse von alten Funden heute noch existierender Spezies erbrachten
wertvolle Einsichten in die Phylogenie und Dynamik von Populationen, wie vor allem an
nordamerikanischen Braunbren (Barnes et al. 2002, Leonard et al. 2000) und an Bisons
(Shapiro et al. 2004) gezeigt werden konnte. Fr mehrere Spezies konnten sogar fr gewisse
Regionen und einen limitierten Zeitraum diachrone Beobachtungen der Populationsdynamik
gemacht werden, so z.B. fr Adlie-Pinguine (Ritchie et al. 2004), Hasen (Hardy et al. 1995),
Seeotter (Larson et al. 2002), Grizzlybren (Miller et al. 2003) und Hawaiignse (Paxinos et al.
2002a; 2002b).

48

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.5.6 Rekonstruktion von kologie und Ernhrungsgewohnheiten


Einen auf den ersten Blick ungewhnlichen Ansatz verfolgten Hss und Kollegen (1992), als
sie an Fkalien von Bren erfolgreich DNA sowohl der Bren als auch der verdauten
Nahrungspflanzen nachweisen konnten. Dieser nichtinvasive Ansatz wird standardisiert
auch zur Kontrolle von Wild- und Zootierbestnden genutzt, da sich neben Hinweisen zu
Ernhrungsweise und Gesundheitszustand auch verwandtschaftliche Verhltnisse
rekonstruieren lassen (Constable et al. 1995, Kohn et al. 1995). Poinar und Kollegen (1998),
sowie Hofreiter und Kollegen (2000) gelang es jeweils in ihren Studien an Koprolithen
(fossile bzw. subfossile Fkalien) sowie an Knochen, DNA des ausgestorbenen Faultiers
Nothrotheriops shastensis nachzuweisen. Zudem konnten sie auch Chloroblasten-DNA
nachweisen, welche sie mit Daten der modernen Fauna am Fundort verglichen. Dieser
Ansatz ging soweit, dass Poinar und Kollegen 2001 eine Arbeit zu menschlichen Koprolithen
paloindianischer Ureinwohner Amerikas verffentlichten, in der sie versuchten, die
Zusammensetzung der Ernhrung zu rekonstruieren.
Ebenso ungewhnlich war der Ansatz, alte DNA in Sedimenten von Hhlen,
Permafrostbden und Eisbohrkernen nachzuweisen. Hierbei konnten u.a. Sequenzen von
Mammut, Bison und diversen Pflanzen und Bakterien in Schichten von teilweise sehr hohem
Alter von mehreren 100.000 Jahren nachgewiesen werden (Willerslev et al. 1999; 2003; 2004).
Diese Arbeiten knnen jedoch nur vage Hinweise zur Rekonstruktion kologischer
Verhltnisse liefern, da sich die nachgewiesenen Molekle einerseits nur bedingt datieren
und andererseits nicht reproduzieren lassen (Hofreiter 2003, Stokstad 2003).

3.5.7 Domestikation von Tieren und Pflanzen


Verffentlichungen dieser Art befassten sich mit Ursprung und Auswirkungen der
Domestikation der heutigen Haustiere bzw. Nutzpflanzen, was auch im Rahmen dieser
Arbeit von vordergrndigem Interesse ist. So konnte gerade die begleitende Arbeit dieses
Projektes (vgl. Kap. 1) von Bollongino (2005) wertvolle Hinweise zum Ursprungsgebiet der
modernen Hausrinder in Europa liefern. Es wurde bereits von Troy und Kollegen (2001) aus
modernen Daten und Bailey und Kollegen aus einigen alten Funden (1996) ein rezenter, d.h.
neolithischer Ursprung der Hausrinder im Nahen Osten postuliert. Bollongino konnte diesen
Befund direkt anhand von aDNA-Daten neolithischer Hausrinder und Auerochsen
Mitteleuropas sowie aus dem Nahen Osten besttigen. Damit konnte sie eine unabhngige
Domestikation von Wildrindern in Europa wie sie von einigen Archologen postuliert
wurde, ausschlieen. Darber hinaus konnte gezeigt werden, dass die Abspaltung des
europischen Auerochsen von der Population in Vorderasien und damit von den Vorlufern
der spteren Hausrindform bereits vor ca. 200.000 Jahren erfolgte.
Anhand des umfangreichen archozoologischen Fundmaterials wurde auch fr die
Hausschweine eine erste Domestikation im Nahen Osten angenommen. Moderne DNADaten lieferten jedoch den Nachweis fr mindesten drei Domestikationsursprnge (Guiffra
et al. 2000, Kijas & Anderson et al. 2001). Eine umfassende, aktuelle Studie konnte nun unter
Einbezug von 165 alten Proben eine detaillierte Phylogenie erstellen, die mehrere mgliche

49

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Domestikationszentren postuliert (Larson et al. 2005). So konnten in bislang sechs Regionen
von Europa bis Sdostasien bereinstimmungen von Wild- bzw. Hausschweinelinien
werden,
welche
als
Domestikationszentren
gedeutet
wurden.
nachgewiesen
Interessanterweise konnten fr den europischen Raum gleich zwei solcher Gebiete besttigt
werden, wovon eines auf die italienische Halbinsel beschrnkt bleibt, das andere ganz
Europa umfasst. Zudem konnten im Gegensatz zu den Rindern keine bereinstimmungen
mit den Daten aus dem Nahen Osten bzw. Vorderasien nachgewiesen werden; ein Umstand
der ebenfalls auf eine bzw. zwei autochthone Domestikationsereignisse innerhalb Europa
schlieen lassen.
Fr Ziegen (Loreille et al. 1997, Luikart et al. 2001, Bar-Gal et al. 2002) und Pferde (Lister et
al. 1998, Vila et al. 2001) scheinen ebenfalls mehrere Domestikationsereignisse plausibel,
denn die modernen Daten von beiden Spezies zeigen eine komplexe Struktur, die vor allem
bei den Pferden die weitere Interpretation fr die maternalen Linien insofern erschwert, als
dass mindestens 77 Stuten zur heutigen Variabilitt beigetragen haben mssen, deren
Haplogruppen allerdings weder mit geographischen Regionen noch mit einzelnen Zuchten
in Verbindung zu bringen sind (Jansen et al. 2002).
Ebenfalls bemerkenswert sind die Ergebnisse, die Studien zur Phylogenie und
Domestikation des Hundes/Wolfes erbrachten. So zeigten diese, dass gerade der von allen
Haustieren am lngsten domestizierte Hund noch eine sehr groe hnlichkeiten mit dem
Wolf besitzt, wobei vor allem die genetische Diversitt in beiden Formen vergleichbar hoch
ist, was auf eine stetige Einkreuzung der Wildform schlieen lsst (Vila et al. 1999,
Savolainen et al. 2002). Dies scheint zumindest fr den Eurasischen Raum zuzutreffen, wo
nach Savolainen auch der Domestikationsursprung fr Asien angenommen wird. Fr
Amerika konnte dies nicht belegt werden, da sich die prkolumbischen Hunde von den
amerikanischen Wlfen unterscheiden lassen (Leonard et al. 2002).
Eine diachrone Studie zur Hasenphylogenie einschlielich derer Domestikation unter
entscheidendem Einbezug von aDNA-Daten wurde bereits 1995 von Hardy und Kollegen
vorgestellt (1995).
Fr die Domestikation von Nutzpflanzen liegen berwiegend Resultate aus Studien mit
modernen DNA-Daten vor. Dies ist vor dem Hintergrund der schlechten
Erhaltungsmglichkeiten von organischen Pflanzenresten vor allem in gemigten Zonen
nicht verwunderlich. So sind bislang nur Studien zu Mais verffentlicht worden. Es konnte
bereits anhand moderner Mikrosatellitendaten gezeigt werden, dass entgegen der weiten
Verbreitung von Mais nur ein Domestikationsereignis stattfand. Jaenicke-Desprs und
Kollegen (2003) konnten darber hinaus in einer Untersuchung prhistorischer Proben
zeigen, dass auch die entscheidenden Zuchtmerkmale des Mais, die ihn von der Wildform
teosinte unterscheiden, bereits vor 4400 Jahren ausgeprgt und verbreitet waren.

50

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.6 Eigenschaften alter DNA


3.6.1 Grundlagen zur chemischen und physikalischen Mutagenese in vivo
Das genetische Material, d.h. der Aufbau und die Abfolge der Desoxyribonukleinsuren
(DNA), steht unter konstantem Einfluss chemischer und physikalischer Prozesse, welche zu
Basenaustauschen bzw. Zerstrung der Gesamtstruktur der DNA fhren knnen. Die
Bandbreite der Prozesse bzw. deren Ursachen ist gro, so kann z.B. zwischen somatischen
Mutationen, endogenen Keimbahnmutationen und exogenen Faktoren, die direkt oder
indirekt zu Keimbahnmutationen fhren, unterschieden werden (Knippers 2004, Passarge
2004):
Mutationen im Soma: Schwach-energetische Strahlung, z.B. UV-Licht
Endogene Mutationen durch freie Radikale des Stoffwechsels oder Replikationsfehler
a) direkt: Ionisierende Strahlung (hochenergetisch): Gamma-Strahlung
b) indirekt: Ionisierende Strahlung (hochenergetisch): Alpha-Strahlung
Endogene chemische oder physikalische Prozesse finden stndig statt. Als Ursachen der
Vernderungen gelten im Allgemeinen die Hydrolyse, spontane Oxidation, unkontrollierte
Methylierung/Alkylierung und die bereits erwhnte ultraviolette Strahlung. Reaktive
Substanzen, die zu Vernderungen der DNA-Struktur fhren, werden allgemein Mutagene
genannt.
Im Folgenden sind die bekannten Mutationsmuster aufgefhrt:

3.6.1.1 Endogene chemische Mutationsmuster


Deaminierung: Sie beschreibt den Verlust der Aminogruppe NH2 durch Oxidation
oder Hydrolyse (Abbildung 9). Bei Cytosin, Guanin und Adenin, die eine
Aminogruppe enthalten, fhrt der Verlust derselben zu einem vernderten
Basenpaarungsmuster. Als hufigstes Beispiel sei hier die Deaminierung des Cytosins
zu Uracil genannt. Wird nun statt Cytosin Uracil eingebaut, so paart dieses mit
Adenin. In der folgenden Replikation paart nun Adenin konform mit Thymin. Es
kommt zum Basenaustausch CaT bzw. GaA. Diese Vernderung wird in vivo von
der Uracil-DNA-Glycosylase rckgngig gemacht. Dies lsst sich auch in vitro durch
die Zugabe des Enzyms Uracil-N-Glykosylase (UNG) durchfhren, welche mgliche
deaminierte Cytosine einer DNA-Matrize (template) entfernt (vgl. Kap. 5.2.4.3.2). Die
Deaminierung von Adenin fhrt zu Hypoxanthin, das jedoch mit Cytosin paart. Die
Folge ist eine Transition von AaG bzw. TaC. Das Verhltnis der Deaminierungen
von Cytosin zu Adenin betrgt ca. 40:1 (Lindahl 1993). Eine sehr wichtige Form und
Ursache fr spontane Genmutationen ist die Deaminierung von 5-Methylcytosin. Das
an Position 5 methylierte Cytosin wird durch Verlust der Aminogruppe zu Thymin.
Dieses wird als regulre Base von den Reparaturmechanismen nicht erkannt, es
kommt folglich zur Transition von CaT bzw. GaA.

51

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

Abbildung 9. bersicht ber die mglichen Formen der Deaminierung (Verlust der Aminogruppe
NH2) durch Hydrolyse oder Oxidation.

Depurinierung: Die Depurinierung beschreibt den Verlust der Purinbasen Adenin


und Guanin und wird durch Hydrolyse verursacht. Diese fhrt zu einer Spaltung der
N-glykosidischen Verbindung der Purine mit dem Zuckermolekl, folglich zu einem
Verlust der Basen und zu einer mglichen Deletion in der nachfolgenden Replikation.
Oxidative Schden: Hierunter fallen allgemein Schden durch Einfluss von reaktiven
Hydroxyl-Radikalen (-OH). Reaktive OH-Gruppen entstehen u. a. ber Umwege aus
Wasserstoffperoxid bei Reaktionen der Atmungskette. Der grte Teil reaktiver
Hydroxyl-Radikale entsteht jedoch durch ionisierende Strahlung. Mittlerweile sind
ca. 100 verschiedene Reaktionsprodukte bekannt, die durch freie Radikale verursacht
werden. Darunter wird als Mutationsauslser hufig 8-Oxoguanin erwhnt. Dieses
oxidative Reaktionsprodukt paart nun bevorzugt mit Adenin, was die
Transversionen GaT bzw. CaA zur Folge hat. Es kann jedoch auch die Guaninbase
im freien Triphosphat betroffen sein. Das Reaktionsprodukt 8-OxodGTP kann nun
gegenber von Adenin eingebaut werden. Somit kommt es im Vergleich zu oben zu
den umgekehrten Transversionen AaC und TaG.

52

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.6.1.2 Chemische Mutagene


(Knippers 2004, Passarge 2004)
Basenanaloga: Hierunter fllt der Einbau von analogen Basen whrend der
Replikation, die den regulren Nukleotidbasen sehr hnlich sind, jedoch
abweichende Paarungseigenschaften von der eigentlichen Base besitzen. Hier kann
als Beispiel 5-Bromouracil angefhrt werden, ein Thymin-Analogon, das mit Guanin
bindet. 5-Bromodeoxyuridin ist ebenfalls ein Thymin-Analogon mit vergleichbaren
Eigenschaften. Die Anwesenheit eines Bromatoms induziert demnach
Fehlpaarungen.
Basenmodifizierende Agenzien: Diese verndern die Paarbindungseigenschaft von
Basen innerhalb der Helix. Beispielsweise reagiert Hydroxylamin mit Cytosin, so
dass dieses mit Adenin statt Guanin paart.
DNA-Alkylierung: Hierunter wird das Einfgen einer Methyl- oder Ethylgruppe in
ein Molekl verstanden. Als Beispiel sei die Alkylierung des Guanins genannt. Dabei
wird die Wasserstoffbrcke des Sauerstoffes an Position 6 des Guanins aufgebrochen
und eine Methylgruppe angefgt. Das dadurch entstandene 6-Methyl-Guanin kann
nur noch zwei Wasserstoffbindungen ausbilden. Die Folge ist eine Paarung mit
Thymin, demnach eine CaT Transition. Alkylierende Verbindungen entstehen z.B.
als Nitrosamine im Magen-Darm-Trakt von Sugetieren. Eine spontane Methylierung
von Nukleotiden erfolgt jedoch auch durch die bertragung von Methylgruppen des
Co-Faktors
S-Adenosyl-Methionin
whrend
der
vielen
natrlichen
Methylierungsreaktionen der Zelle.
Interkalierende Agenzien: Hierbei handelt es sich um meist flache Molekle, die sich
zwischen Basenpaaren einbauen und somit durch Strukturstrung zu Insertionen
oder Deletionen von ein oder mehr Basen fhren knnen.
Cross-linking agents: Hierunter fallen Agenzien wie z.B. Mitomycin C, die
verschiedene Abschnitte des DNA-Stranges oder verschiedene DNA-Strnge
miteinander verbinden. Darber hinaus knnen auch Verbindungen zu Proteinen
bzw. Mineralien erfolgen.

53

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA

3.6.1.3 Physikalische Prozesse


Als physikalischer Einflussfaktor auf das DNA-Molekl ist in erster Linie Strahlung zu
nennen: UV-Strahlung induziert sehr hufig eine chemische Verbindung zwischen
anlagernden Thyminnukleotiden. Diese konvalente Bindung an den Kohlenstoff-Atomen 5
und 6 fhrt zu Thymindimeren. Diese knnen, sofern sie innerhalb eines Gens liegen, die
Replikation sowie auch die Transkription stren, werden jedoch durch DNAReparaturmechanismen weitgehend korrigiert. Das so genannte T-C-(4-6)-Photoprodukt ist
ebenfalls eine UV-induzierte konvalente Bindung zweier benachbarter Thymin- und
Cytosin-Nukleotide an den Kohlenstoffatomen 4 und 6.
Hochenergetische ionisierende Strahlung fhrt zu Brchen des DNA-Rckgrates, was in
Einzel- und Doppelstrangbrchen resultiert. Es knnen sich auch, analog zum endogenen
Zellstoffwechsel, reaktive Ionen (freie Hydroxyl-Radikale) bilden, die wiederum zu
Basenaustauschen fhren (siehe oxidative Schden).

3.6.2 Postmortale Degradierung von DNA


Bei lebenden, gesunden Zellen wird die DNA und deren Struktur unaufhrlich von
Reparaturenzymen kontrolliert und fehlerhafte Stellen werden korrigiert (Lindahl 1993).
Nach dem Tod eines Organismus fallen diese Reparaturmechanismen weg, bestehende und
neu auftretende Schden knnen nun nicht mehr korrigiert werden. Neben den bereits
erwhnten chemischen und physikalischen Einflussfaktoren beginnen nun auch die
krpereigenen Autolysesysteme (lysierende Nukleasen) die DNA zu zerstren. Diese
Prozesse setzten bereits unmittelbar nach dem Tod ein und knnen mit speziellen
Elektrophoresemethoden nachgewiesen werden (Johnson & Ferris 2002). Innerer und
uerer Befall von Mikroorganismen (Bakterien, Pilzen und Insekten) trgt ebenfalls zur
sukzessiven Auflsung der organischen Matrix bei. Wird dieser Auflsungsprozess nicht
verlangsamt oder gestoppt, fhren all diese Faktoren zur kompletten Auflsung des
Organismus und damit zum unwiederbringlichen Verlust der DNA. Unter sehr bestimmten,
aber vielfltigen Umstnden kommt es zu einer Verlangsamung des Zersetzungsprozesses,
so dass in wenigen Fllen mit Hilfe der PCR die vereinzelten Molekle vermehrt und
anschlieend analysiert werden knnen (Pbo et al. 2004). Vor allem bei Bestattungen bzw.
Niederlegungen von toten Organismen sind die Prozesse nach der Autolyse abhngig vom
umgebenden Liegemilieu (Burger et al. 1997, Smith et al. 2003). So beeinflussen im
Wesentlichen Temperatur, Feuchtigkeit, pH-Wert und elektromagnetische Strahlung den
Ablauf und die Geschwindigkeit der meist chemischen Prozesse, die zur stetigen Auflsung
der DNA fhren.
In erster Linie ist die Temperatur entscheidend, da vor allem die Wrmeenergie smtliche
enzymatischen sowie chemischen Reaktionen direkt bedingt. Die relative Feuchtigkeit eines
Ortes wirkt sich ebenfalls direkt auf die DNA-Degradierung aus, da hohe Feuchtigkeit eine
gesteigerte Prozessivitt von Oxidationen und Hydrolysereaktionen mit sich bringt. Der pHWert kann als indirekter Faktor gewertet werden, da z.B. ein saures Milieu den Abbau der
Mineralmatrix von Knochen und Zhnen, also der die DNA schtzenden Umgebung,

54

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
begnstigt (Burger et al. 1999). Dies deckt sich weitgehend mit den Erfahrungen, welche zum
Erhalt von DNA in den einzelnen Klimazonen gemacht wurden (z.B. Bollongino 2005).
Die uns bekannten und fassbaren postmortem-Degradierungprozesse decken sich grtenteils
mit solchen der Mutagenese in vivo, und sind zum besseren berblick in Tabelle 2
zusammengefasst, sowie in Abbildung 10 schematisch dargestellt. Als hufigste Schden
knnen in erster Linie die durch Hydrolyse induzierten Aufbrche des Zuckerrckgrates
genannt werden, die Strangbrche verursachen und zur schnellen und starken
Fragmentierung der Molekle fhren. Ebenfalls durch Hydrolyse verursacht sind die
hufigen Brche der N-glykosidischen Bindung, vornehmlich der Purine Adenin und
Guanin (Depurinierung, vgl. Kap. 3.6.1.1), welche letztlich ebenfalls zum Strangbruch bzw.
im Hinblick auf die Analyse alter DNA zur Inhibition whrend der Amplifikation fhren
knnen. Diesem folgen die hydrolytisch bzw. oxidativ verursachten Modifikationen an den
Basen selbst. Auf der einen Seite ist dies die Bildung so genannter Hydantoine durch
Umbildung der Ringstruktur der Basen, welche ebenfalls zur Inhibierung der PCR fhren.
Auf der anderen Seite sind dies die Deaminierungen (Kap. 3.6.1.1), die im Rahmen der
Amplifikationsreaktion zu Substitutionen fhren knnen, die letztlich in Sequenzierungen
alter DNA zu beobachten sind.

Abbildung 10. a) DNA-Schden, die durch hydrolytische sowie oxidative Prozesse verursacht
werden: 1) Strangbrche am Zuckerrckgrat; 2) Basenverlust (meist Adenin und Guanin;
Depurinierung); 3) Deaminierung der Basen Cytosin, Adenin und Guanin; 4-7) Oxidative
Fragmentierung der Kohlenstoff-Doppelbindungen der Basen (Hydantoine) sowie 8) des
Zuckerrckgrates. b) DNA-crosslinks. 1) Bindung mit anderen DNA-Moleklen oder Proteinen; 2)
irregulre Bindung zweier DNA-Strnge (Abbildung modifiziert nach Hebsgaard et al. 2005).

55

Grundlagen zur Neolithisierung aus Sicht der Humangenetik und zur Analyse alter DNA
Tabelle 2. Zusammenfassung der mglichen Schden an alter DNA (umgezeichnet und ergnzt
nach Pbo 2004).

Prozess/Einfluss

Schadensform

Auswirkung

Lsungsstrategie

Mikroorganismen, Strangbrche

Kurze Fragmente

Wahl kurzer und

Nukleasen,

hydrolytische Spaltung der

Reduzierung

der berlappender

Hydrolyse

Phosphordiesterbindungen

Gesamtmenge

Amplikons

Oxidation

Fragmentierung der Basen bzw.

Inhibition der PCR,

Fragmentierung der Zuckermolekle

ggf. Strangabbruch

durch Hydroxyl-Radikale (-OH) oder


Verknpfung von Purinen mit dem
Zucker-Phosphatrckgrat
Oxidation

Hydantoine, Beeintrchtigung der


Basen durch Auflsung der CDoppelbindungen

Hydrolyse

Depurinierung von Adenin und


Guanin durch Spaltung der Nglykosidischen Bindungen

Oxidation
Hydrolyse

Guanin > 8-Oxoguanin


Deaminierung: von Adenin zu

Transversion

Mehrere

G/CaT/A

unabhngige PCRs

Transition AaG

Klonierung und
Sequenzierung

Hypoxanthin
Hydrolyse

Deaminierung von Cytosin zu Uracil

Transition CaT

Hydrolyse

Deaminierung von 5-Methylcytosin zu Transition CaT


Thymin

(Evtl. Einsatz von


UNG;
(Uracil-NGlycoslase))

Hydrolyse

Deaminierung von Guanin > Xanthin

DNA crosslinks

Bindung zwischen DNA-Molekulen

sog.

Einsatz von N-

oder mit anderen Biomoleklen

Maillard Produkte

Phenacyl
Thiazoliumbromid
(PTB) in Extraktion

56

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA
Ein Phnomen, das bezglich der Isolationsmethoden von alter DNA von groem Interesse,
allerdings noch weitgehend unerforscht, ist, ist das der cross linking Eigenschaften der DNAMolekle (Mitchell et al. 2005, Hebsgaard et al. 2005, vgl. auch Kap. 3.6.1.2). Diese stellt
zugleich einen Vorteil als auch einen Nachteil der Analyse alter DNA dar, denn zum einen
untersttzen diese cross links die Stabilisierung der DNA und damit eine mgliche
Erhaltung, zum anderen bereiten jedoch gerade diese methodische Probleme bei der
Isolation der DNA bzw. Amplifikation derselben. Mitchell et al. (2005) vermuten basierend
auf Studien von Permafrostproben, dass jedes Molekl, das grer als 100-200 Basenpaare
ist, mindestens ein cross link Ereignis aufweist. Eine andere Form von cross links stellen die so
genannten Maillardprodukte (Vasan et al. 1993), eine Kondensationsreaktion von
Zuckermoleklen, Nukleinsuren und bestimmter Aminogruppen von Proteinen, dar. Diese
konnten Poinar et al. (1998) durch gaschromatographische/massenspektrometrische
Analysen an Koprolithenproben feststellen. Diese Form der DNA-Bindung kann durch den
Einsatz von N-Phenazylthiazoliumbromid aufgebrochen werden (Vasan et al. 1993), was
eine Isolation von DNA ermglicht (Poinar et al. 1998, Krings et al. 2000).
Mittlerweile existieren mehrere Arbeiten, in welchen die hufigsten DNA-Schden an alter
DNA sowohl genauer beobachtet, quantifiziert als auch deren Verteilungsmuster untersucht
wurden (Hansen et al. 2001, Hofreiter et al. 2001a, Gilbert et al. 2003a; 2003b, Gilbert et al.
2005b, Binladen et al. 2005), wobei hier in erster Linie die an aDNA-Sequenzen
beobachtbaren Substitutionen im Vordergrund standen.

3.6.3 Die Authentizittskriterien der aDNA-Forschung


Aufgrund der immerwhrenden Kontaminationsgefahr, welche falschpositive Ergebnisse
erbringen knnen, sowie der Problematik der post mortem-Alterierung der DNA-Molekle,
die zu fehlerhaften Ergebnisse fhren, welche wiederum die Interpretationen der Ergebnisse
beeinflussen knnen, wurden fortwhrend Kriterien zur Authentifizierung von aDNA-Daten
erstellt (Handt et al. 1994, Pbo 1989, Cooper & Poinar 2001, Hofreiter et al. 2001, Pbo et
al. 2004, Hebsgaard et al. 2005, Bower et al. 2005, Gilbert et al. 2005a), die hier kurz
zusammengefasst werden sollen:
1. Trennung der Arbeitsbereiche. Arbeitsbereiche sollten ein klare Trennung in
PrPCR- und PostPCR-Labor aufweisen, um gewhrleisten zu knnen, dass PCRProdukte nicht bertragen werden.
2. Leerkontrollen. Leerkontrollen sollten sowohl bei der Extraktion als auch bei der
PCR durchgefhrt werden, um die Kontaminationsfreiheit beider Anstze zu
berwachen.
3. Theoriekonformes Verhalten degradierter Molekle. Es sollte eine inverse
Korrelation zwischen Amplifikationserfolg und Produktlnge beobachtbar sein.
4. Reproduzierbarkeit. PCRs sollten wiederholt von einem oder mehreren Extrakten
durchgefhrt werden, um Ergebnisse zu besttigen, sporadische Kontaminationen
aufzudecken und mgliche konsistente Sequenzvernderungen in Klonen zu

57

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA

5.

6.

7.

8.

9.

identifizieren, die auf Amplifikation eines oder weniger Molekle zurckzufhren


sind.
Klonierung. PCR-Produkte sollten kloniert und mehrere Klone amplifiziert werden,
um die Identifikation von Sequenzvernderungen und Kontamination zu
ermglichen.
Unabhngige Reproduktion. Neue und unerwartete Ergebnisse sollten in einem
zweiten Labor unabhngig besttigt werden, um laborinterne Kontaminationen
auszuschlieen.
Biochemischer Erhaltungszustand. Es sollte simultan auf den Erhalt von anderen
Bio- bzw. Makromoleklen getestet werden, um dem DNA-Erhalt durch indirekten
Nachweis des allgemeinen biochemischen Erhaltungszustandes mehr Plausibilitt zu
verleihen.
Quantifizierung. Es sollte eine Quantifizierung der Ausgangsmolekle durchgefhrt
werden,
um
die
Wahrscheinlichkeit
einzuschtzen,
dass
konsistente
Sequenzvernderungen zu beobachten sind (<1000 Molekle). Im Falle von mehr als
1000 Ausgangsmoleklen ist eine PCR-Reaktion ausreichend. Die Quantifizierung
sollte fr jedes Primerpaar erfolgen, da die Anzahl von amplifizierbaren Moleklen
von der Produktlnge und der Primerqualitt abhngig ist.
Assoziierte Funde. Es sollten andere Proben desselben Fundortes vergleichbaren
Erhaltungszustand aufweisen. Gegebenenfalls sollten in Untersuchungen zu
menschlichen Proben Tierproben desselben Fundortes als Kontrolle mitgefhrt
werden.

Aktuelle Studien zeigen, dass es in manchen Fllen nicht ausreichend ist, alle Punkte dieser
Kriterienliste zu erfllen, wie es Cooper et al. (2004) an der Arbeit von Caramelli et al. (2003)
ber zwei palolithische Funde deutlich macht. Dies betrifft in erster Linie Arbeiten mit
menschlicher DNA. So fordert etwa Gilbert et al. (2005a) besonders von diesen Arbeiten
mehr Informationen zu den jeweiligen Proben sowie eine detaillierte und auch
selbstkritische Diskussion derselben. Als Beispiel wird angefhrt, dass insbesondere die
Probengeschichte fr eine abschlieende Interpretation wichtig sei. So kann letztlich die
Information ber die direkte Bergung einer Probe fr aDNA-Analysen whrend der
Ausgrabung selbst im Vergleich zu einer Museumsprobe, deren Behandlung/Bearbeitung
nach Jahrzehnten nur schwer rekonstruierbar ist, fr die Glaubwrdigkeit eines Ergebnisses
von entscheidender Bedeutung sein. Letztlich wird hieraus ein weiteres, aber notwendiges
Kriterium formuliert.
10. Kritische Beurteilung aller zustzlich erhltlichen Informationen. Thou shalt
interpret the veracity of the data by a critical consideration of all available
information. (zitiert nach Gilbert et al. 2005a, S.4).

58

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA

3.7 Verwendete genetische Marker


3.7.1 Eigenschaften der mtDNA und ihre Eignung als populationsgenetischer
Marker
3.7.1.1 Die Struktur der mitochondrialen DNA
Die mitochondriale DNA (mtDNA) ist ein doppelstrngiges, ringfrmiges Molekl, das
auerhalb des Zellkerns in den Mitochondrien der Eukaryoten-Zellen liegt. Sie ist ein
eigenstndiges Genom von ca. 16,6kB Gre (Anderson et al. 1981). In jedem Mitochondrium
befinden sich etwa 2-10 mtDNA-Molekle und in jeder somatischen Zelle findet sich eine
variierende Anzahl von etwa 1000-10.000 Mitochondrien (Lightowlers et al. 1997). Das
mitochondriale Genom codiert 13 Proteine, die vorwiegend den Elektronentransfer im
Rahmen der Atmungskette und die Energieproduktion (oxidative Phosphorylierung
(OXPHOS)) regulieren, sowie 22 Gene fr Transfer-RNA und 2 ribosomale RNAs (Anderson
et al. 1981, Passarge 2004). Der Aufbau des Genoms ist kompakt. Alle kodierenden Bereiche
liegen beieinander. Die nichtkodierenden Bereiche sind sehr kurz und treten nur in sehr
geringer Anzahl auf. Die Ausnahme bildet ein Bereich von ca. 1100bp Lnge, welcher
zwischen den Nukleotidpositionen (nps) 16024 und 577 liegt. Diese nichtkodierende Region
wird auch D-loop (displacement loop) oder control region genannt, da dort die Replikation
startet und auch die Promotoren fr die Transkription liegen.
Die Mutationen des mitochondrialen Genoms eignen sich aus mehreren Grnden als
populationsgenetisches Werkzeug. Die wesentlichen Charakteristika sind die hhere
Mutationsrate im Vergleich zur nukleren DNA, die rein maternale Vererbung, das Fehlen
von Rekombination und die Homoplasmie des Genoms.

3.7.1.2 Die maternale Vererbung und das Fehlen von Rekombination


Die Vererbung der mtDNA erfolgt nur ber die mtterliche Seite. Die Spermien tragen zwar
etwa einige hundert Mitochondrien, eine Eizelle jedoch Hunderttausende. Sollten bei der
Befruchtung einige mnnliche Mitochondrien in die Eizelle gelangen, so wren diese in den
nachfolgenden Generationen kaum mehr aufzufinden. Darber hinaus wird eine so
genannte Ubiquitinierung postuliert, eine Markierung der mnnlichen Mitochondrien in den
Spermien mit dem Polypeptid Ubiquitin, welches von Proteasen als Signal erkannt wird,
womit eine selektive Zerstrung der mnnlichen Mitochondrien in den frhen Phasen der
Embryogenese erfolgt (Sutovsky et al. 2004, Manfredi et al. 1997, Thompson et al. 2003).
Es werden wenige Flle von paternaler Vererbung von mitochondrialer DNA bei in vitro
Fertilisationen (St. John et al. 2004) diskutiert, jedoch sieht man die mglichen Ursachen
hierfr in der mangelnden Qualitt der Oozyten. Die wenigen Ausnahmen tragen jedoch
nicht dazu bei, dass eine paternale Vererbung unter natrlichen Voraussetzungen in Betracht
gezogen werden kann. Demnach ist die Vererbung mitochondrialer DNA ber die rein
mtterliche Seite allgemein akzeptiert.

59

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA
Die maternale Vererbung und das Nichtvorhandensein von Rekombination ermglicht die
einfache Verfolgung von individuellen genetischen Linien ber zahlreiche Generationen
hinweg und damit auch die Rekonstruktion ihrer Entwicklung im Laufe der Zeit. Allerdings
wurden von wenigen Autoren Beweise fr Rekombinationsereignisse postuliert, welche die
oben genannte Mglichkeit einschrnken. So wurden z.B. 1999 von Hagelberg und Kollegen
Haplotypen verffentlicht, deren Sequenzen mgliche Rekombination aufzeigen sollten.
Diese Arbeit wurde jedoch aufgrund eines Alinierungsfehlers der Sequenzen revidiert
(Hagelberg et al. 2000 Erratum). Weitere Arbeiten, die sich fr Rekombination aussprachen
(Awadalla et al. 1999, Eyre-Walker et al. 1999) wurden aufgrund methodischer Mngel bzw.
unpassender Datengrundlage stark kritisiert (Macauley et al. 1999a, Kivisild & Villems 2000,
Kumar et al. 2000). Zudem konnten in parallel gefhrten unabhngigen Analysen zum
Thema Rekombination (Ingman et al. 2000, Jorde & Bamshad 2000, Elson et al. 2001) sowie
Datenneubewertungen (Piganeau & Eyre-Walker 2004) keine Hinweise auf
Rekombinationsereignisse der mitochondrialen DNA erbracht werden. Das Fehlen von
Rekombination macht mtDNA zum single locus. Zusammen mit der maternalen Vererbung
hat dies zur Folge, dass die effektive Populationsgre im Vergleich zu autosomalen loci
etwa nur ein Viertel betrgt. Damit ist mtDNA als populationsgenetischer Marker sensitiver
fr viele demographische Vernderungen, wie z.B. genetische Drift.

3.7.1.3 Homoplasmie
Die mtDNA in unterschiedlichen Geweben ist theoretisch identisch. Dieser Zustand wird
Homoplasmie genannt. Er wird durch den Mechanismus des genetischen Flaschenhalses
(genetic bottleneck) erhalten bzw. erreicht: eine starke Verringerung der Anzahl an mtDNAs
tritt in Stadien der Eizellgenese auf (cytoplasmatische Segregation). Die anschlieende
Vermehrung zu reifen Eizellen fhrt zur Etablierung der gleichfrmigen mtDNA-Molekle
(Thorburn & Dahl 2001).
Da sich im Lauf der Lebenszeit eines Organismus Mutationen in den Geweben ansammeln
und sich daher die Mitochondrien in den Zellen unterscheiden knnen, spricht man hierbei
von Heteroplasmien. Dieser Zustand variiert in vivo in Abhngigkeit von Gewebe mit hohem
oder niedrigem Energiebedarf (s. Kap. 3.7.1.5 und Abbildung 11). Die Kopienzahl der
mutierten Zellen ist in den meisten Fllen so gering, dass die Wahrscheinlichkeit einer
Fehlbestimmung bei der Analyse von mtDNA zu vernachlssigen ist. Da es zudem sehr
unwahrscheinlich ist, dass sich Mutationen in unterschiedlichen Geweben wiederholen,
kann der eigentliche homoplasmische Zustand leicht bestimmt werden, indem die Versuche
aus unterschiedlichen Geweben wiederholt werden.

60

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA

3.7.1.4 Die Mutationsrate


Die Mutationsrate mitochondrialer DNA ist durchschnittlich etwa 10x hher als in nuklerer
DNA (Brown et al. 1979, Ingman & Gyllensten 2001). Fr das gesamte mitochondriale
Genom gibt Ingman et al. (2000) eine durchschnittliche Mutationsrate von 3.4 x 10-7 Basen
pro Generation an, wobei jedoch zu beachten gilt, dass diese Rate nicht gleichermaen auf
das Molekl verteilt ist. Sie ist relativ gering in der Protein und RNA kodierenden coding
region und hoch in der nichtkodierenden control region, und hier besonders in drei
Abschnitten innerhalb derselben. Diese drei Abschnitte sind besonders variabel und werden
demnach auch hypervariable region (HVR) oder hypervariable segments (HVS) genannt:
HVS I (np 16024-16365); HVS II (np 73-340) und HVS III (np 438-574).
Fr die gesamte coding region errechnete Parsons et al. (1997) eine Mutationsrate von etwa 5 x
10-7 bis 5 x 10-6 Basen pro Generation von 20 Jahren. Dies entspricht 0.025-0.26
Basenaustauschen pro Position pro Million Jahren. Die grte Variabilitt weist HVS I auf
(Vigilant et al. 1991, Lutz et al. 1998), wofr Richards et al. (2000) eine Mutationsrate von 3.6
x 10-6 Basen pro Generation angibt.
Fr die vergleichsweise hohe Mutationsrate der mtDNA werden allgemein folgende Grnde
angefhrt (Jobling et al. 2004, Bogenhagen 1999):
Die Funktion der Zellorganellen als Energielieferant der Zelle im Rahmen der
oxidativen Phosphorylierung (OXPHOS) erzeugt eine hohe Konzentration an freien
Radikalen, die wiederum mutagen wirken (vgl. endogene Mutagenese, Kap. 3.6.1.1).
mtDNA weist pro Zeiteinheit mehr Replikationsschritte auf als nuklere DNA.
Die Art und Weise der Replikation der mtDNA fhrt zu einer vergleichsweise langen
Zeitspanne, in der sie einzelstrngig und damit besonders anfllig bzw. verletzlich
fr Mutagene vorliegt. Dies betrifft im Besonderen die Kontrollregion. Zudem
unterliegt der grte Anteil der Kotrollregion keinem Selektionsdruck, was zur
schnellen Manifestierung von Mutationen fhrt und damit ebenfalls die ungleich
hohe Mutationsrate dieses Bereichs erklrt.
Im Vergleich zur Kern-DNA ist die mtDNA nicht in Histone eingepackt und somit
anflliger fr v.a. oxidative Schden.
Die Reparaturmechanismen der Mitochondrien sind weniger effektiv als die des
Zellkerns (vgl. Review in Shadel & Clayton, 1997, dagegen Mason & Lightowlers
2003).
Eine weitere Mglichkeit, die zur schnellen Fixierung von Mutationen fhren kann,
ist die theoretische Wahrscheinlichkeit, dass whrend der Reduzierung der mtDNAs
whrend der cytoplasmatischen Segregation (vgl. 3.7.1.3) per Zufall eine mutierte
Form die Mehrzahl annimmt.

61

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA

3.7.1.5 Die molekulare Uhr


Die Mutationsraten der DNA werden in der Evolutions- und Populationsgenetik dazu
eingesetzt, um Informationen zum zeitlichen Auftreten bestimmter Ereignisse zu gewinnen.
Die Hypothese der molekularen Uhr (Zuckerkandl & Pauling 1962) spielt hier die zentrale
Rolle. Sie setzt voraus, dass die Evolutionsrate in allen Linien gleichfrmig und ber die Zeit
hin konstant verluft. Unter dieser Prmisse ermglicht die molekulare Uhr somit, evolutive
Ereignisse zu datieren. Dabei ist jedoch zu beachten, dass sich die genaue Kalibrierung der
Uhr als schwierig darstellt, denn bereits die Mutationsrate stellt einen Schtzwert dar. Es gibt
daher zwei Formen der Kalibrierung: zum einen die direkte Kalibrierung, die rezente
Stammbaumanalysen als Grundlage nimmt und daher die Mutationsrate pro Generation
bestimmt. Zum anderen wird die indirekte Kalibrierung verwendet, die die Anzahl
divergierender Ereignisse oder umgekehrt die Menge der angesammelten Variabilitt ins
Verhltnis zu einem gut datierten Ereignis stellt. Hierbei stehen wiederum zwei
Mglichkeiten offen. Entweder whlt man die bekannte Neubesiedlung eines Gebiets oder
Kontinents (z.B. Amerika) und ermittelt die Anzahl der seitdem aufgetretenen Mutationen
oder man verwendet eine Auengruppe und ermittelt die Anzahl der Variationen seit dem
letzten gemeinsamen Vorfahren (most recent common ancestor oder MRCA). Am hufigsten
wird hierbei die phylogenetische Trennung von Mensch und Schimpanse und die jeweils
aktuelle palontologische Datierung des Ereignisses verwendet.
Kritik an der molekularen Uhr und den daraus erhobenen Datierungen wurde hufig gebt.
Letztlich sind die Datierungen von der genauen Kalibrierung der Uhr abhngig. Allerdings
wird mit dem fortgeschrittenen Wissen um die Faktoren, welche die Mutationsraten
unterschiedlicher Linien (Abbildung 11) beeinflussen und der ebenso erfolgenden
Verfeinerung der Referenzdatierungen auch die Verlsslichkeit der molekularen Uhr steigen
(Macauley et al. 1997, Jobling et al. 2004).

Abbildung 11. Faktoren, die Mutationsraten in unterschiedlichen Organismen beeinflussen


(lineage effects) (umgezeichnet nach Jobling et al. 2004).

62

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA

3.7.2 Short tandem repeats (STRs)

Ein groer Teil des menschlichen Genoms besteht aus nichtkodierender DNA, wovon
wiederum ein betrchtlicher Anteil hochrepetitiv ist. Diese repetitive DNA findet sich ber
das gesamte Genom verteilt, liegt jedoch gehuft im Heterochromatin der Centromer- bzw.
Telomerregionen vor. Sie besteht aus tandemartig hintereinander geschalteten
Wiederholungseinheiten, welche gem ihrer Lnge an einzelnen Wiederholungseinheiten
in verschiedene Klassen eingeteilt sind (Tabelle 3).
Tabelle 3. Die verschiedenen Klassen der hochrepetitiven DNA (nach Tautz 1993).

Typ

Anzahl der loci

Lnge der Wiederholungseinheiten

Satelliten

1-2 pro Chromosom

100-mehrere 1000bp

Minisatelliten

Mehrere 1000 pro Genom 9-100bp

Mikrosatelliten (STRs) Bis zu 105 pro Genom

2-6bp

Die Mikrosatelliten stellen hierbei die Klasse mit den krzesten repetitiven Einheiten dar,
weshalb sie weitaus hufiger als short tandem repeats (STRs) Erwhnung finden. Schtzungen
zufolge entfallen ca. 20% des Genoms auf STRs (Hummel 2003). Eine Wiederholungseinheit
der STRs umfasst per Definition ein bis sechs Basenpaare, die in direkte (bzw. auch leicht
abgewandelter
Form)
direkt
hintereinander
geschaltet
sind.
Ein
gesamter
Wiederholungsabschnitt von STRs erstreckt sich gewhnlich ber ~150bp. Innerhalb der
STRs finden sich Wiederholungseinheiten von zwei Basenpaaren, so genannten
Dinukleotidrepeats, am hufigsten.
Die Wiederholungseinheiten mit drei, vier, fnf und sechs Basenpaaren werden
dementsprechend Tri-, Tetra-, Penta- und Hexanukleotidrepeats genannt. Whrend hiervon
die Tri- und Hexanukleotidrepeats vorwiegend im klinischen Forschungsbereich von
Interesse sind, da sie teilweise mit Krankheiten assoziiert sind (Nasir et al. 1996, Li &
elMallakh 1997), eignet sich das Unterscheidungspotenzial der hochpolymorphen Tetra- und
Pentanukleotideinheiten fr zahlreiche weitere Fragestellungen, die ber die
Molekulargenetik hinausreichen.

Abbildung 12. Aufbau und Nomenklatur von STRs (modifiziert nach Hummel 2003).

63

Grundlagen zur Neolithisierung aus Sicht der Genetik und zur Analyse alter DNA
Die Variabilitt der einzelnen Allele eines diploiden STR-locus ermglicht in Kombination
mit anderen STR-loci eine hochauflsende Differenzierung, die auf Individualebene
hinabreicht. Hierbei bilden die beiden Allele eines STR-locus den Genotypen eines
Individuums, die Kombination mehrerer einzelner STR-locus-Genotypen bildet wiederum
den so genannten genetischen Fingerabdruck. Die statistische Wahrscheinlichkeit der
Einzigartigkeit eines solchen genetischen Fingerabdrucks ist letztlich abhngig von der
Hufigkeit, mit welcher ein einzelnes Allel in der betrachteten Population vorkommt.
Abhngig vom betreffenden genetischen Fingerabdruck und der Auswahl an STR-loci ist es
ab einer gewissen Anzahl von STR-loci statistisch hchst unwahrscheinlich, dass eine zweite
Person mit einem identischen kombinierten STR-Genotyp existiert (statistische
Ausschlusswahrscheinlichkeit; Pd power of discrimination) (Hummel 2003, Butler 2001).
Die Etablierung der PCR-Technik (Saiki et al. 1985, Mullis & Faloona 1987) hatte auch
bedeutenden Einfluss auf die nachhaltige Entwicklung (vgl. Kap. 3.5) der STRGenotypisierung. Sie ermglichte die fr eine uneingeschrnkte Individualisierung
erforderliche gleichzeitige Amplifikation mehrere unabhngiger STR-loci in einem Ansatz (so
genannter Multiplexansatz), welcher gleichzeitig kosten- bzw. zeitsparend erfolgen konnte,
so dass die Methode der Individualisierung heute eine breite und technisch sowie
methodisch weitgehend kommerzialisierte Anwendung findet (Butler 2001, Hummel 2003).
Das Haupteinsatzgebiet von STR-Analysen im Rahmen der genetischen Identifikation liegt
heute im Wesentlichen in der Rechtsmedizin, wo diese in forensischen Fllen jeglicher Art,
bei Sexualdelikten, bei Vaterschaftsgutachten, bei Massenkatastrophen und seltener bei
historischen Fragestellungen (vgl. Kap. 3.5.2 & 3.5.3) angewendet werden (Butler 2001).
Entsprechende wissenschaftliche Vergleichdatenbanken finden sich im Internet
(http://www.cstl.nist.gov/div831/strbase) bzw. sind gem den jeweiligen staatlichen
Institutionen nur bedingt ffentlich. Letztere werden je nach Magaben der geltenden
Rechtsprechung der einzelnen Staaten verwaltet, aktualisiert und im Rahmen der
Jurisdiktion
in
forensischen
Fllen
herangezogen.

64

Fragestellung

4. Fragestellung und Zielsetzung der Arbeit


In den beiden vorangegangen Kapitel wurden bereits die gngigen Theorien zur
Neolithisierung seitens der Archologie als auch der Populationsgenetik beleuchtet. Hieraus
wurde bereits deutlich, dass nicht ein einheitlicher Prozess oder ein Modell als Erklrung fr
die Neolithisierung ausreichend ist. Vielmehr ist unter dem aktuellen Wissenstand
anzunehmen, dass fr unterschiedliche Regionen, d.h. hauptschlich Naturrume,
unterschiedliche Zeitrume und auch unterschiedliche Modelle zu postulieren sind.
Dennoch bleiben fr die vorliegende Arbeit, allerdings auf die einzelnen Zeit- und
Naturrume bezogen, die generellen archologischen Fragestellung erhalten, die
nachfolgend mit weiteren populationsgenetischen Fragen ergnzt werden:
a) Bildeten die einzelnen archologisch definierten Kulturen mglicherweise tatschlich
existierende Einheiten, die sich auch genetisch differenzieren lassen?
b) Lassen sich eventuell charakteristische Unterschiede zwischen den zu prfenden
genetischen Einheiten feststellen?
c) Kann ein kultureller Einfluss oder gar ein Wandel, welcher sich in den
archologischen Hinterlassenschaften deutlich belegen lsst, auch in der Struktur der
betreffenden Bevlkerung nachgewiesen werden?
d) Inwieweit knnen Unterschiede zur heutigen Bevlkerung Europas als
populationsgenetische Dynamik gedeutet werden.
e) Knnen unter der Voraussetzung der Unterscheidbarkeit auch Richtungsdynamiken
in Raum und Zeit festgestellt werden, und somit Bewegungen von Bevlkerungen,
wie z.B. Migrationen oder Kolonisierungen postuliert werden?
f) Kann in diachroner Hinsicht eine Kontinuitt bzw. Diskontinuitt einer Bevlkerung
eines definierten Raumes nachgewiesen werden?
g) Knnen die Ergebnisse bereits formulierte Modelle zur Neolithisierung Europas
verifizieren bzw. falsifizieren?
Die Aufgabe der vorliegenden Arbeit ist die Bestimmung der mitochondrialen
Haplogruppen des maternalen Genpools einer neolithischen Stichprobe. Die umfassende
Zielsetzung ist es, Aussagen anhand der erhobenen neolithischen Daten im Vergleich mit
Rezentdaten aus populationsgenetischen Studien zu den oben genannten Fragestellungen
der Arbeit zu treffen.
Da die Analyse von alter menschlicher DNA aufgrund der Kontaminationsgefahr ein
Problemfeld darstellt, spielt die Authentifizierung der gewonnenen Daten eine
vordergrndige Rolle. Darber hinaus sollen anhand des erhobenen Datensatzes an
Sequenzen weitere Erkenntnisse zu Umfang und Art und Weise von post mortem Schden an
DNA-Moleklen gewonnen und charakterisiert werden.

65

Material und Methoden

5. Material und Methoden


5.1 Fundorte und Proben
Nachfolgend sind zunchst die wichtigsten archologischen Informationen zu den einzelnen
Fundorten angegeben, sofern Grabungsberichte und detaillierte Aufarbeitungen der
Fundkomplexe bis Oktober 2005 vorlagen. Die Titel der Fundbeschreibungen umfassen
Fundort und geographische Herkunft, gefolgt von der Kategorie sowie der wichtigsten
Referenz zum jeweiligen Fundort. Die Auflistung erfolgt in keiner chronologischen
Ordnung, sondern nach Lndern sowie alphabetisch geordnet. In Abbildung 14 ist die
geographische Lage der Fundorte aufgetragen und zum besseren berblick sind die
einzelnen Proben aus den jeweiligen Fundorten mit Angaben zu Probenmaterial und
Datierung in Tabelle 4 aufgelistet.

5.1.1 Fundorte in Deutschland


Bruchstedt, Kr. Langensalza, Thringen
Grberfeld
(Kahlke 1958/59)
Das Grberfeld von Bruchstedt wurde in den Jahren 1958/59 ausgegraben. Bereits zuvor war
es bei Baumanahmen angeschnitten worden (1933, 1950), wobei jeweils zwei Grber
zerstrt wurden. Im Laufe von weiteren Bauarbeiten konnte 1958/59 schlielich durch eine
Rettungsgrabung das Grberfeld bis zu seinem sdlichen und westlichen Rand erfasst
werden. Hierbei wurden weitere 52 Grber gefunden, die teilweise gestrt waren. Die
Beisetzungen erfolgten alle in Hockerstellung, die Ausrichtung hufig in nordostsdwestlicher Richtung. Kahlke (1959) sah hier auffllige Parallelen zum 20km entfernten
Grberfeld in Sondershausen. Unter anderem war die Strukturierung in Gruppen dicht
beieinanderliegender Grber mit Beigaben und isolierter eher beigabenloser Grber auch in
Bruchstedt beobachtbar. Allerdings konnten, bis auf eine Ausnahme, die
Doppelbestattungen und Spondylus-Schmuck in Bruchstedt nicht gefunden werden. Zudem
wiesen die Keramikbeigaben auf eine sptere Phase der Linearbandkeramik hin. Eine
zugehrige Siedlung befand sich ca. 300m vom Grberfeld entfernt.

Derenburg, Meerenstieg II, Ldkr. Wernigerode, Sachsen-Anhalt


Siedlung und Grberfeld
(Mller 2002)
Das Landesamt fr Archologie Sachsen-Anhalts fhrte in zwei Abschnitten die
Untersuchung eines Neubaugebietes am westlichen Ortsrand von Derenburg durch.
Meerenstieg I wurde bereits 1994/95 ergraben und von Meerenstieg II konnten in den Jahren

66

Material und Methoden


1997-99 drei ha archologisch untersucht werden. Die Gesamtschau der Funde weist auf eine
wiederholte Besiedlung des Areals hin, da datierbare Keramik der linearbandkeramischen,
sowie bronze- und eisenzeitlicher Kulturen vorlag. Ein Grabfund konnte gar der rmischen
Kaiserzeit zugeordnet werden.
Unter den neolithischen Befunden fand sich in allen Gelndebereichen Material sowohl der
lteren als auch der jngeren Linearbandkeramik. Stichbandkeramik trat seltener auf. Ein
Rckgang der Besiedlung nach dieser Periode schien sich in den wenigen Funden
mittelneolithischer Kulturen (Rssener Kultur, Ammenslebener Gruppe) zu spiegeln.
Es fanden sich deutliche Siedlungsspuren der bandkeramischen Kultur ber eine Weite von
mehr als 100 m. Die jetzige Befundsituation deutete darauf hin, dass ein erheblicher Teil der
Siedlung im noch nicht erfassten angrenzenden (Flur-)bereich liegen msste. Die
Rekonstruktion der bisher ergrabenen Siedlungsstruktur war durch erhebliche
Erosionserscheinungen erschwert und daher nur ausschnittsweise mglich. In
nordnordstlicher Richtung von der Siedlung ca. 70m entfernt befand sich ein
linearbandkeramischer Friedhof. Die Anlage hatte einen Durchmesser von ca. 25-30m und
enthielt 42 Grber. Die Erosionserscheinungen auf der Hochflche des Meerenstiegs hatten
auch hier zur Folge, dass einige Grber der Landwirtschaft zum Opfer gefallen waren, denn
teilweise lagen die Grabgruben sehr flach unter der Pflugschicht und waren demzufolge in
schlechtem Erhaltungszustand. Andere, tiefer im Lss gelegene Grber, zeigten eine sehr
gute Erhaltung. Alle Grber enthielten Krperbestattungen, Brandgrber wurden nicht
nachgewiesen, wobei die Einzelbestattung mit 35 Fllen vorherrschend war. Daneben fanden
sich eine Doppelbestattung, eine vermutete Nachbestattung, eine Grabgruppe mit drei
Individuen und zwei mgliche Leergrber. Die Orientierung erfolgte mehrheitlich - mit
geringen Abweichungen - in O-W-Richtung, W-O-Ausrichtung kam nur bei einem Viertel
der Belegung vor. Die Beisetzungen in Hockerstellung variierten von seitlicher Lage bis
Rckenlage, sowie von fast gestreckter bis zu extremer Hockerstellung.
Die Mehrheit der Grber wies Beigaben auf, teilweise mit hochwertiger Ausstattung. Als
grte Beigabengruppe fand sich erwartungsgem die Keramik, die berwiegend als
Kugelamphoren, Kmpfen und Schalen am Kopfende beigegeben wurden. Die vorlufige
Auswertung ergab Keramik sowohl im ursprnglicheren Flomborner Stil als auch
nachfolgender und spterer Phasen, was auf eine lngere Nutzung des Friedhofes schlieen
lie. An Felssteingerten fanden sich Dechsel, Schuhleistenkeile, Reibeplatten und Reibsteine
sowie als Schmuckgegenstnde auch Steinperlen.
Beachtlich war vor allem das Vorkommen von Spondylusmuscheln, da bislang nrdlich des
Harzes keine vergleichbaren Funde bekannt waren. Zudem war die isolierte Lage einzelner
Grber bzw. einer Bestattungsgruppe im Norden des Friedhofes auffllig, welche allesamt
Spondylusschmuck aufwiesen. Darber hinaus war das Auffinden von Armreifen aus
Spondylusmuscheln auch in einem Frauengrab bemerkenswert, ging man doch bisher davon
aus, dass die Beigaben geschlechtsspezifisch verteilt wurden, demnach die Klappen in
Frauengrbern und Armringe in Mnnergrbern zu finden seien (Willms 1985, Nieszery
1995).

67

Material und Methoden


Flomborn, Kr. Alzey, Rheinland-Pfalz
Grberfeld
(Richter 1968/69, Storch 1984/85)
Die ersten Funde wurden bereits 1900 beim Ausheben einer Kalkgrube gemacht. In den
darauffolgenden drei Jahren wurden 85 bandkeramische Grber freigelegt. Das
ursprngliche Ausma des Grberfelds war vermutlich grer, da im Westen der
Gemeindefriedhof und im Sden eine Strae das Grberfeld beschneidet. Die Ausgrabungen
scheinen im Norden und Osten die Grberfeldgrenze erreicht zu haben. Die Ausrichtung der
Grber war allgemein Ost-West mit Abweichungen nach Nord und Sd. Von den 85
bandkeramischen Grbern enthielten nur 67 Skelettreste, welche von Koehl (1903) als
linksseitige Hocker beschrieben wurden. 36 Skelette lagen mit dem Kopf im Osten und 31
mit dem Kopf im Westen, wobei keine Aufteilung nach Geschlecht nachzuweisen war. Drei
Grber enthielten weder Beigaben noch Bestattungen, 14 Grber waren so zerstrt, dass
keine Ausrichtung der Toten ermittelt werden konnte (Richter 1968/69). Richter berichtet,
dass von dem ursprnglich ins Wormser Museum gelangten Skelettmaterial ein Teil fehle
und dass es bei der Inventarisierung der Grabbeigaben in zwei Etappen Verwechslungen
gegeben habe, so dass einige Komplexe nicht ganz gesichert (Richter 1968/69) seien. Zudem
meldete und vermerkte Richter den Verlust einiger Beigabenstcke. Das Flomborner
Grberfeld war beigabenreich; das Beigabenspektrum umfasste Dechsel/Flachbeil, Keramik,
Pfeilspitzen, Schmuck, Reibstein, Klingen/Abschlag, Schnecke/Tierknochen, Rtel/Erz
(Storch 1984/85). Richter stellte bei der Verteilung der Beigaben eine Tendenz zu
Mnnergrbern fest. Ebenso zeichnete sich aufgrund der allgemein wenigen sicheren
Geschlechtsbestimmungen nur der Schuhleistenkeil als spezifisch mnnliche Beigabe ab.
Dahingegen konnte Spondylusschmuck, der bis dahin gern als Frauenbeigabe gedeutet
wurde, auch in als Mnnergrab angesprochenen Bestattungen gefunden werden. Auch
Storch (1984/85) kam bei einer erneuten Durchsicht des verbliebenen Materials im Rahmen
seiner vergleichenden Studie zu frhneolithischen Bestattungssitten zu wenigen neuen
Erkenntnissen hinsichtlich der Flomborner Funde. Die Trennung der Beigaben nach
Geschlechtern lie er jedoch aufgrund der schlechten Datenlage bewusst aus.

68

Material und Methoden


Halberstadt, Sonntagsfeld, Kr. Halberstadt , Sachsen-Anhalt
(Autze 2005)
Das Grberfeld auf dem Sonntagsfeld in
Halberstadt wurde im Jahre 2000 ergraben. Die
Bearbeitung ist zum gegenwrtigen Zeitpunkt
(August 2005) noch nicht abgeschlossen, ein
vorlufiger Bericht befindet sich im Druck (Autze
2005). Aus Grber- und Gesamtplan (Autze, pers.
Mitteilung) lie sich entnehmen, dass insgesamt
40 Grber geborgen wurden, die an Hand der
Beigaben
der
frhen
Linearbandkeramik
zuzuordnen waren (vgl. Abbildung 13). Diese
waren in fnf deutlich erkennbare Grabgruppen
unterteilt. Wenige weitere Grber der Rssener
Kultur sowieso Hinweise auf kaum bzw. nicht
erhaltene
Grabgruben
konnten
ebenfalls
nachgewiesen werden. Des Weiteren fanden sich
sechs Hausgrundrisse sowie hausbegleitende
Gruben. Das ergrabene Areal war durch mehrere
Palisadengrbchen unterteilt; ein mglicher
umfassender Graben konnte im Osten der
Grabung angeschnitten werden.
Abbildung 13. Individuum Halberstadt 2 (HAL2) aus
Grab 35. als exemplarisches Beispiel fr sehr guten
Erhaltungszustand (Landesamt fr Archologie,
Sachsen-Anhalt).

Schwetzingen, Gewann Schlzig, Rhein-Neckar-Kreis, Baden-Wrttemberg


Grberfeld
(Behrends 1989)
Eine erste Notgrabung wurde 1988 begonnen, 1989 fortgefhrt und abgeschlossen.
Insgesamt wurden 202 Grber bzw. Reste davon geborgen, wovon etwa 25 Grber bei
vorausgegangenen Bauarbeiten unbemerkt zerstrt wurden. Auch die landwirtschaftliche
Nutzung des Gelndes hat zu Verlust von Grbern gefhrt; sehr wahrscheinlich
Brandgrber, die nicht gengend eingetieft waren, wie an acht erhaltenen Beispielen dafr
erkannt werden konnte. Weitere 18 Fundpunkte waren als abgepflgte Grber zu deuten.
Das Grberfeld von 40 x 100m lag auf einem ehemaligen Dnenrcken im Rheintal mit einer
Ausrichtung im Streifen von Nordwesten nach Sdosten. Die Erhaltung der Skelette aus den
Krpergrbern war sehr unterschiedlich und abhngig von der Lage. Individuen aus dem
Dnensand waren teilweise mit Kalksinter berzogen und daher sehr gut erhalten. Die
Skelette und Grabbeigaben der darber liegenden dunklen und stark lehmigen Schicht,

69

Material und Methoden


welche vermutlich von berflutungen bzw. vom nahen Leimbach herrhren, waren
wesentlich strker aufgelst. Die Ausrichtung der meisten Grber geschah in NordostSdwest-Richtung und die Beisetzung erfolgte berwiegend in linksseitiger Hockerlage. An
Beigaben fanden sich hauptschlich Steingerte und Keramik. Mehrere Grber enthielten
Silexpfeilspitzen, die aufgrund der Lage zwischen Hinterkopf bzw. rechter Schulterregion,
als Niederlegung im Kcher zu deuten sind. Die chronologische Einordnung erfolgte anhand
der Keramik, welche ans Ende der Linearbandkeramik zu stellen ist. Wenngleich viele
Grber Keramikgefe enthielten, so bleibt die Typenauswahl gering und berwiegend auf
kleine Kmpfe beschrnkt, die am Kopfende des Grabes standen und vermutlich
Flssigkeiten enthielten. Die zugehrige Siedlung wurde bislang nicht entdeckt.

Seehausen, Kr. Frankenhausen, Thringen


Grbergruppe
(Kahlke 1957)
In Seehausen wurden 1955 drei Grber angeschnitten. Kahlke (1957) berichtet von der
vollstndigen Zerstrung des ersten Grabes (Hockerbestattung mit Halsflasche und Kumpf
der jngeren Linearbandkeramik). Zwei weitere Grber mit Hockerbestattungen konnten
geborgen werden. Als Beigaben fanden sich ein rot bemalter mittelgroer Kumpf im zweiten
und ein Bruchstck einer Zipfelschale im dritten Grab. In einiger Entfernung fand sich eine
sehr flach eingetiefte Restbestattung mit Bruchstcken der Armknochen und des Schdels.
Eine Zuordnung zur Bandkeramik lie Kahlke (1957) offen. Eine kraniologische
Untersuchung der Seehausener Funde wurde von Grimm 1964 publiziert. Demnach fand
sich in Grab I ein Mann, in Grab II eine Frau und in Grab III war die Zuordnung unsicher,
aufgrund der Gre jedoch vermutlich ein Mann. Grab IV enthielt zwei Kinder
unterschiedlichen Alters (Grab IVa Infans I und Grab IVb Infans II).

Sondershausen, Kyffhuserkreis, Thringen


Grberfeld
(Kahlke 1958)
In den Jahren 1949, 1950-52 und 1955 wurde im Nordosten der Stadt Sondershausen ein
bandkeramisches Grberfeld ausgegraben. Insgesamt konnten 44 (45?) Bestattungen gezhlt
werden, worunter sich zehn Doppelbestattungen fanden. Die Beisetzung erfolgte
berwiegend in seitlicher Hockerlage, teilweise wurden auch extreme Lagen beobachtet, die
nur durch ein Zusammenschnren der Leichen erklrt werden konnten. Grabbeigaben
waren nur sprlich vorhanden. Die Keramikgefe deuteten auf die ltere
Linearbandkeramik hin. Des Weiteren waren Spondylus-Muscheln mit tiefem V-frmigem
Ausschnitt in Frauengrbern hufig, bei Mnnern dagegen mehrheitlich Flachhacken zu
finden. Reibplatten mit intensiven Spuren von Rtel oder Manganerz wurden in Grbern
beiderlei Geschlechts gefunden. Eine einheitliche Ausrichtung der Grber war nicht zu

70

Material und Methoden


beobachten, mit einigen Abweichungen wurde mehrheitlich in Nordost(Kopf)-SdwestRichtung bestattet.
Auffallend war eine gruppenartige Hufung von Grbern in der Gesamtstruktur des
Friedhofes, Einzelgrber lagen meist abseits. Kahlke (1956, 1958) ging davon aus, dass die
Strukturierung des Grberfeldes in Gruppen der einer verwandtschaftlichen bzw.
gesellschaftlichen Verbindung der Siedlung oder Siedlungsgemeinschaft entsprach.

Unseburg, Kiesgrube, Ldkr. Aschersleben-Stafurt, Sachsen-Anhalt


Siedlung mit Siedlungsbestattungen
(Deffner 1999)
In der Kiesgrube bei Unseburg wurde in den Jahren 1992-1999 eine Flche von ca. 4,7 ha
ergraben und archologisch dokumentiert. Die Befunde umfassen den Zeitraum von der
Linearbandkeramik bis zum Frhmittelalter. Aus der Linearbandkeramik konnten
Grundrisse von zehn Husern aufgedeckt werden. Diese sind N-S-orientiert und ca. 20-45m
lang. In den hausbegleitenden Gruben fanden sich neben charakteristischer Keramik auch
Knochen, Feuerstein- und Steingerte wie Reibeplatten und Fragmente von
Schuhleistenkeilen. Ein Grberfeld zur Siedlung konnte nicht erfasst werden, dagegen
konnten innerhalb der Siedlung drei Bestattungen in Gruben in der Nhe der
Hausgrundrisse aufgedeckt werden. Hierbei handelt es sich um zwei erwachsene Individuen
und ein Kind, welche in linkseitiger Hockerlage mit Blickrichtung nach Sden beigesetzt
wurden. Die Grber sind beigabenlos, die brigen Befunde deuten auf eine Einordnung in
die mittlere bis spte Bandkeramik.

Vaihingen an der Enz, Kreis Ludwigsburg, Baden-Wrttemberg


Siedlung mit Siedlungsbestattungen sowie Bestattungen im Dorfgraben
(Krause 2002; 2003)
Der Fundort wurde in einer gro angelegten Grabungskampagne ergraben, die 1994 begann
und 2003 den vorlufigen Abschluss fand. Dabei wurden auf 8 ha Grabungsflche ca. 6 ha
Siedlungsstrukturen entdeckt. Eine Siedlungskontinuitt wurde durch die gesamte Dauer
der Bandkeramik hindurch nachgewiesen. Neben dem dichten Siedlungsbefund war ein
Grabenwerk sehr auffallend, welches vermutlich nur eine gewisse Zeitdauer hatte, da es im
Sden nicht vollendet wurde. Zudem erstreckten sich die Siedlungsspuren im Sdwesten
ber das Grabenwerk hinaus. Der Kalkgehalt im Lssboden war relativ hoch, so dass auch
Tier- und Menschenknochen gut erhalten blieben. Bis 2002 wurden 131 Skelette geborgen;
die meisten davon als Bestattungen im Dorfgraben am Nordrand der Siedlung, teilweise
auch als Siedlungsbestattungen. Die Grber waren vergleichsweise sprlich ausgestattet.
Daher ist die chronologische Einordnung der Siedlungsbestattungen ungewiss, denn die
wenigen Beigaben lieen eine eindeutige Korrelation zu den Siedlungsphasen nicht zu.
Jedoch zeigten sich auffallende Befunde anhand der Siedlungsstrukturen. Es wurden ca. 200
Hausgrundrisse rekonstruiert, die sich auf 6 ha verteilten und womit Vaihingen eine

71

Material und Methoden


vergleichsweise enge Siedlungsdynamik aufwies. Das von Lning aufgestellte Modell von
0,5 ha pro Langhaus und Wirtschaftseinheit kann hier nicht gegolten haben, vielmehr ist zur
Bltezeit der Siedlung eine geschlossene Gehftsiedlung mit Dorfcharakter anzunehmen.
Menschliche Skelettfunde aus zwei weiteren Fundorten (Eilsleben und Unterwiederstedt,
beide Sachsen-Anhalt) in Deutschland wurden im Rahmen der Magisterarbeit von Marc
Tnzer (2005) untersucht.

5.1.2 Fundorte in den Niederlanden


Ypenburg
Grberfeld
(Koot & van der Have 2001)
Die Ausgrabungen zur Dokumentation des Grberfelds von Ypenburg in der Nhe von Den
Haag wurden in den Jahren 1997/98 durchgefhrt. Das Grberfeld befand sich auf einem
fossilen Dnenrcken und wurde anhand der Befunde der spten Swifterbant-Kultur
zugeordnet. Diese frhneolithische Kultur in den Niederlanden wurde auf 6200- 5600 Jahre
v. h. datiert. Das Grberfeld zeigte zwei verschiedene cluster mit jeweils 13 bzw. 17
Grabgruben, in welchen insgesamt 44 Bestattungen erfasst werden konnten. Die beiden
Grab-cluster knnten mglicherweise als Familiengruppen interpretiert werden.
Schipluiden-Harnaschpolder
Grabgruppe
(Liesbeth Smits, mndliche Mitteilung)
Der niederlndische Fundplatz Schipluiden-Harnaschpolder wurde im Sommer 2003
ergraben. Die Auswertungen der archologischen Erfassung liegen zum gegenwrtigen
Zeitpunkt noch nicht vor, daher knnen kaum weitere Angaben gemacht werden. Eine grobe
vorlufige Zuordnung der Befunde deutete auf eine Zugehrigkeit zum spten SwifterbantKomplex hin, wobei jedoch vorab einige Details der Werkzeugbearbeitung deutlich auf eine
Erhaltung mesolithischer Einflsse sprechen.

5.1.3 Fundorte in sterreich


Asparn-Schletz
Aufgelassene Siedlung mit Skelettfunden im Grabensystem
(Windl 1996, 1999)
Die Siedlung von Asparn-Schletz wurde ab 1983 im nachfolgenden Jahrzehnt archologisch
ergraben und dokumentiert. Sie stellt in Zusammenhang der vorliegenden Arbeit eine
Ausnahme dar, da die Befundsituation deutlich auf eine kriegerische Auseinandersetzung

72

Material und Methoden


hindeutet, die die Ttung vermutlich aller Siedlungsbewohner und die Auflassung der
neolithischen Siedlung zur Folge hatten. Es lie sich um die Siedlung ein komplexes
Grabensystem nachweisen, dessen detaillierte stratigraphische Abfolge abschnittsweise noch
ungeklrt ist. Die lteste Besiedlungsphase datiert in die ltere Bandkeramik. Diese wird
gefolgt von Befunden der Phase der klassischen Notenkopfkeramik, fr welche auch
Langbauten nachgewiesen werden konnten. In den Sohlen der jngsten Grben fanden sich
Skelette von etwa hundert Individuen unregelmig verteilt und in irregulren Haltungen.
In der Grabenverfllung fanden sich weitere isolierte Skelettelemente. Bis auf eine
Ausnahme konnte im ergrabenen Areal keine regulre Bestattung nachgewiesen werden.
Die anthropologische Auswertung von 67 Skeletten (Teschler-Nicola et al. 1996; 1999) konnte
anhand zahlreicher Hiebverletzungen und Frakturen einen gewaltsamen Tod der Individuen
nachweisen. Die Befunde von Asparn-Schletz sowie hnlicher Funde, wie z.B. des
zeitgleichen Massengrabes im sddeutschen Talheim (Baden-Wrttemberg) und die
auffallende Zunahme an Grabenwerke als Schutz- bzw. Verteidigungsanlagen gegen Ende
der LBK werden von den Autoren als Hinweise auf unruhige Zeiten interpretiert und
knnen ihnen zu Folge mglicherweise als gewaltsames Ende der LBK gedeutet werden.

5.1.4 Fundorte in Ungarn


Szarvas 23
Grabgruppe
Beim Fundort Szarvas 23 (auch Szarvas 8/23 Egyhzfld) handelt es sich um eine
Notgrabung, die 1988 von Jnos Makkay durchgefhrt wurde (Makkay 1989). Dabei fanden
sich neben einigen Gefen bemalter Keramik auch einige Bestattungen. Absolute C14Datierungen liegen sowohl fr zwei Kohleproben (6620 BP (BM 1866R) und 6190 BP (BM
1865R)) als auch fr eine menschliche Rippe aus Grab 1 vor (5840-5630 BC (OxA-9375))
(Whittle et al. 2002).
Menschliche Skelettfunde aus weiteren sechs ungarischen Fundorten (Szarvas 8, Endrd 6,
Endrd 119, Ecsegfalva 23A, Dvavnya Barci Kishalom und Dvavnya Katonafldek)
wurden im Rahmen der Diplomarbeit von Guido Brandt untersucht (Brandt 2005).

5.1.5 Fundorte in Litauen


Donkalnis, Kretuonas und Plinkaigalis
Der Fundort Donkalnis befindet sich nrdlich des Birzulis-Sees im heutigen Litauen.
Insgesamt wurden sieben vollstndige und ungestrte Grber gefunden, die zunchst als
sptneolithisch, jedoch spter als mesolithisch eingestuft wurden. Im Nordosten Litauens
liegt am namensgebenden See Kretuonas der Fundort Kretuonas 1B. Hier fanden sich
sowohl Reste einer frhneolithischen Siedlung sowie auch eine kleine Grabgruppe von

73

Material und Methoden


insgesamt sechs frhneolithischen Bestattungen. Beim Individuum Plinkaigalis handelt es
sich um eine von zwei sptneolithischen schnurkeramischen Bestattungen, welche innerhalb
eines eisenzeitlichen Grberfeldes bei Plinkaigalis gefunden wurden. Die zugehrigen
Radiokarbondatierungen sprechen ebenfalls fr eine zeitliche Einordnung ins
Sptneolithikum (Jankauskas, persnl. Mitteilung).
Menschliche Skelettfunde aus weiteren zwei litauischen Fundorten (Spiginas und Kirsna)
sowie weitere Individuen aus Donkalnis wurden im Rahmen des Projektes (vgl. Kap. 1) von
Barbara Bramanti untersucht (Bramanti et al., in Vorbereitung).

5.1.6 Fundorte in Polen


Dudka
Grberfeld
Am Fundortplatz Dudka im heutigen Polen wurden sowohl Reste einer neolithischen
Siedlung als auch die zugehrgen Bestattungen gefunden. Insgesamt konnten 13 Grber mit
24 Bestattungen gefunden werden. Anhand des archologischen Fundgutes sowie der Daten
der Radiokarbondatierungen konnte eine langfristige Belegdauer vom Mesolithikum ber
die Szadmar-Gruppe, die Kugelamphorenkultur bis zur Schnurkeramischen Kultur der
ausgehenden Jungsteinzeit nachgewiesen werden.
Skelettfunde eines zweiten polnischen Fundortes (Drestwo) wurden ebenfalls von Barbara
Bramanti untersucht (Bramanti et al., in Vorbereitung).

5.1.7 Fundorte in Russland


Chekalino IV und Lebyazhinka IV
Einzelgrber
Die zwei Einzelgrber Chekalino und Lebyazhinka stammen aus der Region Samara stlich
der mittleren Wolga im heutigen Russland. Beide sind durch Beifunde mit der YelshankayaKultur assoziiert. Diese lokale autochthone meso-neolithische Kulturstufe wird in die zweite
Hlfte des siebten bis zum Anfang des sechsten Jahrtausends vor unserer Zeitrechung datiert
(Mamonov 1995, 2000; Crests 1996). Eine absolute Datierung liegt fr Muschelfunde aus der
Bestattungsschicht von Chekalino vor (GIN 7085, 8680 120). Weitere Grabfunde fr das
Individuum Chekalino, welches in gestreckter Rckenlage beigesetzt wurde, liegen nicht
vor. Beim Individuum aus Lebyazhinka, welches in gleicher Weise niedergelegt wurde,
fanden sich u.a. eine Knochenharpune, ein Steinartefakt und ein Gef (Jankauskas, persnl.
Mitteilung).

74

Material und Methoden

Abbildung 14. Herkunft und geographische Koordinaten der untersuchten Proben dieser Arbeit.
Fundorte, welche keine Ergebnisse ergaben, sind wei dargestellt. Daten von weiteren Fundorten und
Proben, die im Rahmen des Projekt von Mitarbeitern der Arbeitsgruppe Molekulare Archologie
und zur bergreifenden Interpretation sowie inhaltlicher Diskussion herangezogen wurden, sind grau
sowie kursiv dargestellt (Kartengrundlage: Ancient World Mappings; http://www.unc.edu/awmc/).
*Tnzer 2005 **Brandt 2005 ***Bramanti et al., in Vorbereitung.
Nr.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

Fundort
Bruchstedt
Derenburg Meerenstieg II
Flomborn
Halberstadt
Schwetzingen
Seehausen
Sondershausen
Unseburg
Vaihingen/Enz
Donkalnis
Kretuonas
Plinkaigalis
Schipluiden-Harnaschpolder
Swifterbant
Ypenburg
Asparn-Schletz
Dudka
Chekalino
Lebyazhinka
Szarvas

Breite
51.18 N
51.86 N
49.69 N
51.54 N
49.22 N
52.54 N
51.23 N
51.93 N
48.66 N

Lnge
10.78 E
10.9 E
8.15 E
11.04 E
8.39 E
11.45 E
10.52 E
11.5 E
8.58 E

Bundesland/Region
Thringen
Sachsen-Anhalt
Rheinland-Pfalz
Sachsen-Anhalt
Baden-Wrttemberg
Thringen
Thringen
Sachsen-Anhalt
Baden-Wrttemberg

55.23 N
55.41 N
51.59 N
52.34 N
52.05 N
48.56 N
51.93 N
53.31 N

26.05 E
23.66 E
4.19 E
5.38 E
4.22 E
16.46 E
21.71 E
48.44 E

46.51 N

20.35 E

Bekes Megye

21
22
23
24
25
26
27
28

Eilsleben*
Unterwiederstedt*
Endrd**
Devavanya**
Ecsegfalva**
Drestwo***
Kirsna***
Spiginas***

52.15 N
51.66 N
46.93 N
47.03 N
47.15 N
53.73 N
54.35 N

11.21 E
11.53 E
20.83 E
20.96 E
20.91 E
22.75 E
23.5 E

Sachsen-Anhalt
Sachsen-Anhalt
Bekes Megye
Bekes Megye
Bekes Megye

Zuid-Holland
Flevoland
Niedersterreich
Samarskaya Oblast

Land
Deutschland
Deutschland
Deutschland
Deutschland
Deutschland
Deutschland
Deutschland
Deutschland
Deutschland
Litauen
Litauen
Litauen
Niederlande
Niederlande
Niederlande
sterreich
Polen
Russland
Russland
Ungarn
Deutschland
Deutschland
Ungarn
Ungarn
Ungarn
Polen
Litauen
Litauen

75

Material und Methoden


Tabelle 4. Probenart und Datierungen der im Rahmen dieser Arbeit untersuchten Proben.
Fundort/Herkunft
Flomborn

Schwetzingen

Derenburg Meerenstieg II

Halberstadt

Sondershausen

Bruchstedt

Krzel
FLO 4a
FLO 4b
FLO 4c
FLO 6a
FLO 6b
FLO 6c
SCHWE 1a
SCHWE 1b
SCHWE 2a
SCHWE 2b
SCHWE 4a
SCHWE 4b
SCHWE 5a
SCHWE 5b
DEB 1
DEB 2a
DEB 2b
DEB 2c
DEB 3a
DEB 3b
DEB 4a
DEB 4b
DEB 5a
DEB 5b
HAL 1a
HAL 1b
HAL 1c
HAL 2a
HAL 2b
HAL 2c
HAL 3a
HAL 3b
SON 1
SON 2
SON 3
SON 4
SON 5
SON 6
SON 7
SON 8
SON 9
BRU 1
BRU 2
BRU 3
BRU 4
BRU 5
BRU 6
BRU 7
BRU 8

Material
M47
M48
M37
M18
M46
M16
M18
P45
Fuphalange rechts
M27
Ulna fragment
M28
Handphalange rechts
Metatarsus V links
M37
M37
M47
M38 oder M48
M26
M27
M28
M18
M16
M17
M37
M47
Handphalange
C33
P35
Fuphalange
M28
Caninus isoliert
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment

Kultur/Datierung
LBK, Stufe Flomborn

LBK, Stufe Flomborn

Spte LBK

LBK

LBK

LBK

LBK

76

Material und Methoden

Tabelle 4. Fortsetzung.
Fundort/Herkunft
Seehausen

Unseburg

Vaihingen/Enz
Asparn-Schletz
Dudka

Donkalnis

Kretuonas

Plinkaigalis

Lebyachkinka IV

Chekalino IV

Swifterbant
Ypenberg
SchipluidenHarnaschpolder

Szarvas 23

Krzel
SEE 1
SEE 2
SEE 3
UNS 1
UNS 2
UNS 3a
UNS 3b
VAI 3
ASP 2
DUD 1a
DUD 1b
DUD 1c
DUD 2a
DUD 2b
DON 1a
DON 1b
DON 1c
DON 1d
DON 1e
DON 2a
DON 2b
KRE 1a
KRE 1b
KRE 1c
KRE 2a
KRE 2b
KRE 2c
PLI 1a
PLI 1b
PLI 1c
PLI 1d
LEB 1a
LEB 1b
LEB 1c
LEB 1d
LEB 1e
LEB 1f
CHE 4a
CHE 4b
CHE 4c
SWI 6a
SWI 6b
YPB 2a
YPB 2b
SLH 1a
SLH 1b
SLH 2a
SLH 2b
SZA23 1a
SZA23 1b
SZA23 2a
SZA23 2b

Material
Langknochenfragment
Langknochenfragment
Langknochenfragment
54 (Kind)
Oberer Molar
Metacarpus rechts
Phalange
M3 superior
M38
M26
M27
M28
M38
M47
Untere Molaren
Obere Molaren
Femur rechts
Fibulafragment
Handphalange
M?8
Craniumfragment
M37/M38, P35
Femur links
Tibiafragment links
I41, I42, C43, P34
Tibiafragment links
Humerusfragment links
M48, M38, I32, C33
Femurfragment rechts
Tibiafragment rechts
Humerus fragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Langknochenfragment
Femurfragment rechts
Humerusfragment rechts
M37
M47
Humerusfragment
Femurfragment
Femurfragment
Humerusfragment
M36
M46
Molar isoliert
Femurfragment

Kultur/Datierung
LBK

LBK

LBK
LBK
Kugelamphorenkultur
473040 BP
Zedmar
4870110 BP
Mesolithisch, Kunda

Mesolithisch, Kunda
740545 BP
Narva
535065 BP (OxA-5926)
Narva
558065 BP (OxA-5935)
Schnurkeramik
403040 BP (OxA-5928)

Yelshanskaya Kultur

Yelshanskaya Kultur
8680120 (GIN 7085)
Swifterbant
Swifterbant
Swifterbant

Krs-Kultur
Krs

77

Material und Methoden

5.2 Methoden
5.2.1 Manahmen zur Kontaminationsvermeidung
Die Analyse alter oder degradierter DNA (aDNA) erfordert besonders sensible methodische,
sowie organisatorische und pragmatische Vorkehrungen. Die charakteristische
Problemstellung des Untersuchungsmaterials verlangt Strategien, die in erster Linie die
Authentifizierung der Ergebnisse gewhrleisten mssen. Aus diesem Grund wird in diesem
Kapitel der Problemkreis aDNA vor die eigentliche Methodenbeschreibung gestellt.
Das Ziel der Manahmen ist es, die stark fragmentiert vorliegende DNA, die meist nur noch
in einzelnen amplifizierbaren Kopien vorliegt, nicht dem Wettbewerb mit intakten Spuren
fremden Ursprungs auszusetzen. Da die PCR eine sehr sensitive Methode ist, ist die Gefahr
gro, dass die geringe echte Zielsequenz leicht von anderen Eintrgen, die ebenfalls im
Spurenbereich vorliegen, berlagert werden kann. Diese knnen durch ihre Qualitt, d.h.
ohne liegezeitbedingte Sequenzvernderungen (Hss et al., 1996), oder im schlimmsten Fall
auch durch ihre Quantitt whrend der initialen Zyklen der PCR favorisiert werden, was
wiederum zu falsch positiven Ergebnissen fhrt.
Die Mglichkeiten der Kontamination sind divers, z.T. schwer systematisch erfassbar und zu
jedem Zeitpunkt der Analyse wahrscheinlich. Im Folgenden sollen die putativen Quellen
bzw. Ursachen fr Kontaminationen sowie die im aDNA-Labor (Spurenlabor) des
Anthropologischen Instituts der Universitt Mainz getroffenen Gegenmanahmen erlutert
werden.
Carry over-Kontaminationen durch PCR-Produkte
Diese Form der Kontamination stellt die gefhrlichste dar, insofern die zu untersuchende
Zielsequenz mit den kontaminierenden Sequenzen identisch ist. Eine Identifikation
dieser Form der Kontamination kann unter Umstnden zeitlich erst sehr viel spter
durch eine statistisch ungewhnliche Hufung bestimmter Sequenztypen entdeckt
werden. Um diese Gefahr methodisch zu umgehen, sind im Anthropologischen Institut
der Universitt Mainz die Laborrume (pr)historischer Probenbearbeitung nicht nur
rumlich von den rezentgenetischen bzw. nachfolgenden Anwendungen (vor allem PCR,
Klonierung und Sequenzierung) getrennt, sondern gnzlich in zwei verschiedenen
Gebuden untergebracht. Damit soll die Mglichkeit einer carry over-Kontamination, das
heit der Eintrag von bereits amplifizierten Zielsequenzmoleklen unterbunden werden.
Die Trennung von Pr-PCR-Laborbereich und Post-PCR-Anwendungsbereich ist daher
mit einer strikten Einbahnstraenregelung versehen, wobei Chemikalien und
Verbrauchsstoffe ausschlielich nur einem Bereich zugeordnet sind. Fr alle Mitarbeiter
gelten strenge hygienische Vorgaben, sowie das strikte Einhalten einer Kleidervorschrift,
d.h. vor jedem Betreten des Spurenlabors sollte der Bearbeiter frisch geduscht sein und
ebenso frisch gewaschene Kleidung tragen, die keinesfalls mit der Kleidung, die im
Anwendungsbereich getragen wird, zusammengefhrt werden sollte. Durch eine ZweiRaum-Schleuse im Eingangsbereich des aDNA Spurenlabors, wo im ersten Raum die
frische Kleidung abgelegt und im zweiten die Schutz- bzw. Arbeitskleidung angelegt

78

Material und Methoden


wird, werden zudem die prventiven Manahmen zur Kontaminationsvermeidung mit
frischen Moleklen bzw. Amplifikaten getroffen.
Kontamination durch Bearbeiter
Die Kontamination durch Bearbeiter stellt vor allem im Bereich der humanen aDNA ein
besonders groes Problem dar. Dieses zieht sich durch alle Arbeitsschritte der
Bearbeitung, beginnend bei der archologischen Bergung der Proben bis hin zur
Interpretation der Ergebnisse.
Alle Arbeitschritte im Spurenbereich von der Probenvorbereitung bis inklusive der PCR
werden daher in geeigneter Schutzkleidung durchgefhrt, um den Eintrag von DNA
seitens der Laborbearbeiter mglichst gering zu halten. Dies beinhaltet das Tragen von
Reinstraumanzgen [DuPont Tyvek, Luxemburg], berschuhen, chirurgischem
Mundschutz, einer zustzlichen Stirn- und Haarhaube, mehreren Lagen
Einweghandschuhen und einem Schutzvisier. Die Anzge werden ber Nacht mit UVLicht (256nm)2 bestrahlt bzw. regelmig erneuert. Zustzlich werden fr einzelne
Arbeitsschritte verschiedene Anzge verwendet, z.B. wird fr die initiale
Probenbehandlung ein anderer Anzug als fr den Ansatz der PCRs getragen. Alle
weiteren Bestandteile der Schutzkleidung, die keine Einwegmaterialien sind, werden
nach dem jeweiligen Arbeitsschritt penibel gereinigt, sowie UV-bestrahlt.
Alle bestehenden Kontaminationen einer Probe selbst, die durch den Ausgrber, bei der
anthropologischen oder zoologischen Bearbeitung oder durch Prparierung und
Archivierung in Museen oder Sammlungen oder hnliche denkbare Situationen
entstehen, werden bei der Ankunft im Mainzer Spurenlabor weitestgehend beseitigt.
Dies geschieht durch allseitiges Bestrahlen mit UV-Licht sowie durch die mechanische
Entfernung der Probenoberflche. Mglichst alle erfassbaren Vor-Bearbeiter werden
ebenso wie alle im Spurenlabor ttigen Personen fr die entsprechenden DNAAbschnitte typisiert, um im letztmglichen Schritt per Vergleich der Ergebnisse putative
Kontaminatoren zu identifizieren.
Kontamination durch andere Proben (Kreuzkontamination oder cross contamination)
Die Proben selbst stellen ebenfalls eine mgliche Kontaminationsgefahr dar. So knnen
bei ungengender Reinigung von Gegenstnden, Arbeitsflchen und dergl. Molekle der
einen Probe eine andere verunreinigen. Dieser Gefahr kann nur mit strikter Einhaltung
der allgemeinen intensiven Reinigungsschritte zwischen jeglichen Arbeitsschritten durch
Seifenlsung, Natriumhypochlorid [DanKlorix; Palmolive-Colgate GmbH, Hamburg]
und Bestrahlung mit UV-Licht entgegengewirkt werden. Darber hinaus verfgt das
Spurenlabor in Mainz ber eine aufwendige UV-Anlage, die zeitschaltuhrgesteuert alle
sensiblen Arbeitsbereiche ber Nacht bestrahlt und daher Oberflchenkontaminationen
erfassen kann. Das Mitfhren von mehreren Leerkontrollen und Proben anderer Spezies
bei Extraktion und PCR kann ebenfalls helfen, mgliche Kontaminationen frhzeitig zu
erkennen, und ist in den Arbeitsprotokollen standardisiert.
UV-Bestrahlung bedingt eine Dimerisierung benachbarter Pyrimidine, wodurch die DNA bei einer
mglichen Amplifizierung inaktiviert ist. Diese Inaktivierung ist am effektivsten bei einer
Strahlungsintensitt von 400iW/cm2 (Cone & Fairfax 1993).

79

Material und Methoden


Kontamination durch externe Materialien, sowie Reagenzien und Lsungen
Alle Gegenstnde, Behltnisse und Verbrauchsmaterialien werden nach ihrer Ankunft im
Spurenlabor grndlichst mit Wasser, Seife und Natriumhypochloridlsung gereinigt und
in einem eigens vorgesehenen Raum fr mindestens 45 min/pro Seite UV-Licht
ausgesetzt. Jegliche Form und Art der Verpackung wird bereits zuvor entfernt und nach
den Reinigungsschritten durch laborseitige Behltnisse ersetzt. Dies soll die Mglichkeit
einer Kontamination durch Verbrauchsmaterialien, welche nicht DNA-frei sind,
weitestgehend verhindern. Bei Reagenzien und Chemikalien kann lediglich das Behltnis
intensiv gereinigt werden. Die Chemikalien selbst werden getestet. Ein fortwhrendes
monitoring der Extraktions- und PCR-Reagenzien durch Leerkontrollen ist daher
unumgnglich. Letzteres gilt auch fr alle Lsungen, die im Spurenlabor selbst angesetzt
werden. HPLC-Wasser (High Performance Liquid Chromatography), welches sowohl fr die
Anstze von Lsungen, als auch fr die Extraktionen und PCRs verwendet wird, wird
ber Nacht unter stetigem Rhren mit UV-Licht bestrahlt.
Das Leitungswasser, das zum Reinigen verwendet wird, wird zunchst durch
Umkehrosmose gefiltert [Umkehrosmoseanlage, IEM GmbH, Mainz] und vor
Verwendung mindestens 24 h mit Hilfe einer wasserdichten UV-Handlampe bestrahlt.
Mit diesen Manahmen soll die Vielzahl von mglichen Quellen als auch die Quantitt von
putativen Kontaminanten mglichst drastisch verringert werden, wenn sie auch nie gnzlich
ausgeschlossen werden kann (Krings et al, 1997). Alle Gegenmanahmen erfordern eine
hohe allgemeine Arbeitsdisziplin und Sorgfalt hinsichtlich der erforderlichen
Reinigungsschritte zwischen einzelnen Proben oder einzelnen Arbeitsschritten. Hinzu
kommt ein hoher Grad an Verantwortlichkeit der Laborgemeinschaft gegenber. Dies
erfordert zudem ein gewisses Ma an gegenseitiger Kontrolle sowie ein Vermeiden jeglicher
unntiger Schritte durch exakte Logistik und verlssliche Absprachen.

5.2.2 Probennahme und Probenvorbereitung


Da der uere, sichtbare Erhaltungszustand des Skelettes auch ein Kriterium fr die
Erhaltung der DNA sein kann, wurde bei der Probennahme darauf geachtet, dass mglichst
intakte und stabile Partien der Extraktion zur Verfgung standen. In der Regel wurden
Skelettteile gewhlt, deren substantia compacta noch gut erhalten war, oder Zhne mit
intakten Zahnwurzeln, die bedingt durch die Einbettung in den Kiefer und durch die
Dentinkrone besser vor ueren Einflssen geschtzt waren.
Alle Proben wurden uerlich 45min mit UV-Licht bestrahlt und die Zhne wurden
zustzlich mit Natriumhypochlorid gereinigt. Anschlieend wurden ca. 0,2-1 mm der
Oberflche der gewhlten Stelle oder des ganzen Zahnes mit einer Frse abgenommen
[Dremel Frsvorstze und Dremel Multi, Dremel, Utrecht, Niederlande]. Dieser Schritt
der mechanischen Oberflchenentfernung sollte bestehende Kontaminationen verringern.
Der Mglichkeit, dass DNA-Molekle durch den schwammartigen Knochenaufbau in das
Innere des Knochens diffundieren, wurde mit einem grozgigeren Abtrag der ueren
Probenschicht begegnet. Mit Diamanttrennscheiben und einer Rotationssge [Typ K10 EWL,

80

Material und Methoden


KaVo, Biberach/Riss] wurden gezielt Abschnitte ab- oder herausgetrennt und in Teilstcke
von ca. 5mm Kantenlnge zerkleinert. Teilweise wurde bei Molaren auf Wunsch der
Probengeber die Zahnkrone abgetrennt und zu weiteren Analysen retourniert.
Nach erneuter UV-Bestrahlung fr 45 min wurden die Probenstckchen in einem weiteren
mechanischen Zerkleinerungsschritt mit Hilfe einer Kugelschwingmhle [LaborSchwingmhle MM200; Retsch, Haan] zu Knochen- bzw. Zahnpulver gemahlen, welches in
15 ml Gefen bei 4C bis zum Einsatz gelagert wurde.
Alle Arbeitsschritte erfolgten unter den im vorigen Kapitel beschriebenen Manahmen zur
Kontaminationsvermeidung.

5.2.3 DNA-Extraktion
5.2.3.1 Isolation von DNA aus Knochen und Zhnen
a) Dekalzifizierungs- bzw. Lyseschritt
Im initialen Extraktionsschritt wurden Aliquots von 0,3 1 g Pulver in 5 ml/g 0,5 M
Ethylendiamintetraessigsure (EDTA, pH 8,3) [Acros Organics, Geel, Belgien]
aufgenommen. Der Chelatbildner EDTA bindet die zweiwertigen Mg2+ und Ca2+-Ionen aus
dem Hydroxylapatit des Knochens. Die Dekalzifikation bzw. die chemische Aufspaltung der
mineralischen Matrix fhrte zu einem Aussplen von DNA-haltigen Zellen (Osteoblasten)
und organischen Zellresten aus dem suspendierten Knochenpulver. Die Zugabe von 30-60il
Proteinase K [Roche Diagnostics GmbH, Mannheim] und 1/10 Volumen des Detergenz NLaurylsarkosin [Fluka Chemie, Buchs, Schweiz] pro Probe bedingte die Auflsung der
verbliebenen organischen Matrix sowie der Zellmembranen der Osteoblasten und fhrte zur
Freisetzung der DNA. Die Inkubation dieser Lysesuspension erfolgte in Rotation ber Nacht
bei 37C.
b) DNA-Isolierung aus der Lysesuspension
Die DNA-Isolierung aus der Lysesuspension beruhte auf einem modifizierten Protokoll der
klassischen Phenol-Chloroform Aufreinigung, allerdings ohne anschlieender Fllung durch
Ethanol in Anwesenheit von Natriumacetat (z.B. Sambrook et al., 1989; Hnni et al., 1995).
Stattdessen erfolgte eine Aufreinigung und Reduzierung des finalen Volumens ber 100kDa
Centricon-Filtereinheiten [Amicon, Millipore GmbH, Schwalbach] (Burger et al. 2004). Alle
Arbeits- und Zentrifugationsschritte erfolgten bei RT, soweit nicht anders angegeben. Die
DNA-Isolierung
erfolgte
durch
Zufhrung
von
1
Volumen
Phenol/Chloroform/Isoamylalkohol (25/24/1; pH 7,5-8,0) [Rotiphenol, Carl Roth GmbH,
Karlsruhe] zur Lysesuspension und Durchmischung fr ~2 min. Anschlieend erfolgte eine
Zentrifugation fr 10 min bei 1700xg, wodurch sich zwei Phasen bildeten: eine wssrige
obere Phase, in der sich die hydrophile DNA lste, und eine schwerere, hydrophobe
Phenolphase, in welcher Protein-, Lipid- und andere organische Reste gebunden wurden.
Zwischen diesen beiden Phasen, in der sogenannten Interphase wurden wasserlsliche
Proteine sedimentiert. Die obere Phase erhielt meist eine probencharakteristische Frbung,
welche den hydrophilen Bodenbestandteilen der jeweiligen Probe zugesprochen wurde und

81

Material und Methoden


wobei es sich vorwiegend um Humin- und Fulvinsuren handelte. Es folgte ein berfhren
der wssrigen Phase in ein neues Reaktionsgef und Verwerfen der organischen
Phenolphase sowie der Interphase. Dieser Schritt der Phenolzugabe kann optional
wiederholt werden (was vor allem bei starker Proteininterphase empfehlenswert ist) und
wurde im Verlauf der vorliegenden Arbeit bei allen Extraktionen durchgefhrt. Um
Phenolrckstnde zu entfernen, wurde 1 Volumen Chloroform [Trichlormethan/Chloroform
ROTISOLV, Carl Roth GmbH, Karlsruhe] zugegeben, die Probe fr 2 min durchmischt und
anschlieend ebenfalls 10 min bei 1700xg zentrifugiert. Hier erfolgte ebenfalls eine
Phasenbildung in eine hydrophile wssrige Phase und eine hydrophobe organische Phase.
Zur Aufreinigung der in der wssrigen Phase gelsten DNA wurde diese auf eine 100kDa
Centricon-Filtereinheit berfhrt. Zunchst wurde die Lsung bei max. 1000xg bis zur
vollstndigen Konzentration zentrifugiert (~30-45 min), whrenddessen darauf geachtet,
dass ein kleiner Film wssriger Lsung erhalten blieb und der Filter nicht trocken
zentrifugiert wurde. Hierbei sollten alle Bestandteile der vorangegangen Schritte
weitestgehend abzentrifugiert werden. Zudem sollten alle Koextrakte, die kleiner als 100kDa
sind, ebenfalls entfernt werden. Dies beinhaltete auch degradierte DNA-Fragmente unter
125bp (100kDA entsprechen ~125bp doppelstrngiger DNA), die in der nachfolgenden
Amplifikation inhibierend wirken knnten. Dieser initialen Konzentration erfolgte eine
Aufreinigung durch drei- bis fnffach wiederholte Zugabe von 1-2ml UV-bestrahltem
HPLC-Wasser zum Retentat mit einem nachfolgenden Zentrifugationsschritt bei max.
1000xg. Das Filtrat wurde jeweils verworfen. Die Zentrifugationsschritte zur Aufreinigung
erfolgten so lange bis die Probe mit mindestens 3,5ml UV-HPLC-Wasser gewaschen wurde
oder bis die Lsung klar wurde. Nach dem letzten Waschschritt erfolgten das Drehen der
Filtereinheit und die finale Zentrifugation bei 5000xg von durchschnittlich 50-200il DNAEluat des Retentats vom Filter in das Auffanggef der Filtereinheit. Das Eluat wurde in
Aliquots 30il bis zum Gebrauch bei 20C gelagert.

5.2.3.2 Isolation von DNA aus Mundschleimhaut


Nach Aufklrung ber Vorhaben und Zweck der Rezentkontrollen wurden
Mundschleimhautabstriche von Mitarbeitern und Probengebern, nach deren freiwilliger
Zustimmung, genommen. Die Abnahme erfolgte mittels kommerziellen Abstrichbestecks
[Heinz Herenz, Hamburg], wobei jede Wangeninnenseite fr 30s abgestrichen wurde. Die
genomische DNA aus Mundschleimhautabstrichen wurde mit Hilfe des Prinzips der
selektiven Zentrifugation ber Spinsulen mit einer Silica-Gel-Membran gewonnen [Invisorb
Spin Swab Kit, Invitek, Berlin]. Die Isolation erfolgte gem dem Protokoll des Herstellers.
Im ersten Schritt wurden die Zellen der Probe durch Inkubation mit Protease aufgebrochen.
Das Lysat wurde auf die Spinsule aufgetragen, wobei die freie doppelstrngige DNA unter
gepufferter hoher Salzkonzentration an die Membran bindet. Darauf folgten zwei
Zentrifugationsschritte mit unterschiedlichen Waschpuffern, die die Reinigung der
gebundenen DNA von Rckstnden zum Ziel hatten. Im finalen Elutionsschritt wurde die
gereinigte DNA unter pufferinduzierten Bedingungen (niedrige Salzkonzentration) wieder
von der Membran gelst und in das vom Hersteller bereitgestellte Auffanggef

82

Material und Methoden


zentrifugiert. Eluiert wurde in 50il elution buffer. Die durchschnittliche DNA-Konzentration
der verdnnten Extrakte betrug 20ng/il. Die Lagerung der Extrakte erfolgte bei -20C.

5.2.4 Die Polymerase-Ketten-Reaktion (PCR)


5.2.4.1 Das Prinzip der Polymerase-Ketten-Reaktion
Mit Hilfe der PCR (polymerase chain reaction) knnen DNA-Sequenzen in vitro spezifisch und
mit hoher Ausbeute (Effizienz) vervielfltigt (amplifiziert) werden (Mullis & Faloona 1987).
In drei eigenstndigen Temperaturschritten, die zyklisch wiederholt werden, wird die
Menge des von Startermoleklen (primer) eingerahmten Matrizenfragments verdoppelt. Im
nachfolgenden Zyklus dient die somit neu synthetisierte Matrizenmenge wiederum als
Ausgangsmaterial. Im ersten Schritt, der Denaturierung (denaturation) der DNADoppelstrnge (bei etwa 90-95C), wird die DNA in Einzelstrnge aufgeschmolzen. Beim
anschlieenden Annealing-Schritt (annealing), dessen Temperatur sowohl theoretisch als
auch empirisch ermittelt werden kann, werden die Startermolekle, sogenannte Primer
(Oligonukleotide) an die Matrize (template DNA) angelagert (hybridisiert). Diese dienen der
DNA-Polymerase im Elongationsschritt (bei ~72C) als Ausgangspunkt, um mit den jeweils
komplementren Basen (freie dNTPs, Desoxynukleotidtriphosphate) beide Matrizenstrnge
zu kopieren (elongation) (Gassen et al. 1994).

5.2.4.2 Primerdesign
Die Mehrzahl der Primer, die zur Amplifikation der Hypervariablen Region I der mtDNA
verwendet wurden, stammten aus bereits etablierten Protokollen der Literatur (Handt et al.
1996, Stone & Stoneking 1998, Endicott et al. 2003 bzw. Vigilant et al. 1991). Die brigen
Primer wurden innerhalb der Arbeitsgruppe erstellt und etabliert.
Das Design der Primer erfolgte computergesttzt mit Hilfe des Programms Primer Select des
Softwarepakets Lasergene 99 [DNA STAR, GATC Biotech AG, Konstanz]. Das Programm
ermglicht unter anderem die Ermittlung der theoretischen annealing-Temperatur der Primer
und auch die Analyse der Tendenzen zur Bildung von strenden Sekundrstrukturen, wie
primer dimer, primer self dimer und hairpins.
Des Weiteren kann in der Theorie das Anlagerungsverhalten des Primers an die Zielsequenz
aufgezeigt werden. Besonderer Wert wurde auf ein balanciertes G Profil mit leicht
ansteigenden Werten zum 3-Ende gelegt. Der erstellte Primer besitzt somit ber seine Lnge
hinweg eine ausgewogene Bindungsaffinitt, nur das 3-Ende hybridisiert spter, was eine
hhere Spezifitt des Primer gewhrleistet (Burger 2000, Rychlik, 1995a; 1995b). Alle
Primerpaare wurden hinsichtlich dieser Kriterien erstellt.
Zur Erstellung von Primern im Programm Primer Select wurde die Cambridge Reference
Sequence verwendet, welche unter der accession number J01415 in Genbank
(http://www.ncbi.nlm.nih.gov/ oder www.mitomap.org) abgelegt ist.

83

Material und Methoden

5.2.4.3 Amplifikation mitochondrialer DNA

5.2.4.3.1 Amplifikation der Hypervariablen Region I (HVR I)


Zur Bestimmung der mitochondrialen Haplogruppe der neolithischen Proben wurde ein
413bp (np 15997-16409) langer Bereich um das Hypervariable Segment I (HVS I, np16024np16365) amplifiziert und sequenziert. Die Amplifikation des langen DNA-Abschnitts
erfolgte mittels sich berlappender krzerer Fragmente (Abbildung 14, Tabelle 6). Zur
berprfung eines mglichen Erhalts langer DNA-Fragmente in den Extrakten wurde auch
der gesamte 413bp lange Abschnitt (L15996 H16410, hier Fragment V genannt) amplifiziert.

Abbildung 15. Strategie zur Rekonstruktion von lngeren Sequenzen durch Amplifikation
berlappender Fragmente. Fr die ersten drei Fragmente wurde in wenigen Fllen ein alternatives,
krzeres Primerpaar verwendet. Die Sequenzen und Fragmentlngen finden sich in Tabelle 6.

Der PCR-Ansatz zur Amplifikation mitochondrialer DNA erfolgte generell in einem


Volumen von 50il (Tabelle 5). Zur Erzielung mglichst groer Produktausbeuten bei
gleichzeitig geringer Entstehung von Primerdimeren und unspezifischen Nebenprodukten
wurden einzelne Parameter variiert. Im Rahmen der PCR-Optimierung wurden in dieser
Arbeit die optimalen Konzentrationen an Magnesiumchlorid (MgCl2), DNA-Polymerase und
Primern, sowie die empirische annealing-Temperatur der Primer ermittelt. Zudem erfolgte im
Verlauf der Arbeit eine Reduzierung des Gesamtvolumens der PCR auf 25il, was einer
Halbierung aller Reagenzien entsprach.

84

Material und Methoden


Tabelle 5. Standardprotokoll des PCR-Ansatzes (mtDNA). UNG wurde optional eingesetzt.

Reagenzien
10x PCR Gold Buffer
MgCl2 Lsung
dNTP Mix
AmpliTaq Gold
BSA
UNG
Primer (jeweils)
DNA-Extrakt
H2O (UV-HPLC)
Gesamt

Volumen in Pl
5
5
5
0,5
1
1
1
1-8
Ad 50
50

Konzentration
1x
2,5mM
0,2mM
2,5U
0,02ig
1U
0,2iM
nicht bestimmt

Hersteller
Applied Biosystems
Applied Biosystems
MBI Fermentas
Applied Biosystems
Roche
Sigma-Aldrich
Biosprings
ACROS Organics

Alle PCRs wurden in Thermocyclern [Eppendorf Mastercycler bzw. Mastercycler gradient,


Eppendorf; Hamburg] durchgefhrt. Diese verfgen ber einen (vor-)heizbaren Deckel
(105C), so dass auf eine Mineralberschichtung zur Evaporationsvermeidung verzichtet
werden konnte. Der initialen Aktivierung der Polymerase (6min bei 94C) folgten
unterschiedliche Zyklenzahlen mit jeweils 30-40s Denaturierung bei 94C, 30-40s bei 58C
und 30-40s Elongation bei 72C. Ein finaler Adenylierungsschritt in Anpassung zur
nachfolgenden Ligation mit einem T-Vektor (Kap. 5.2.7.2.1) wurde bei 60C fr 30min
angefgt. Anschlieend wurde die PCR gestoppt und auf 8C abgekhlt.
Die Anzahl zyklischer Wiederholungseinheiten belief sich je nach PCR auf 38-42 Zyklen.
In der Regel wurde nach fnf negativen Wiederholungen des Amplifikationsversuchs eines
Fragments die Probe verworfen.

Tabelle 6. Liste der verwendeten mitochondrialen Primer im Bereich der HVR I. Die Produktlnge
(in Klammern ohne Primer) ist jeweils beim variierenden light (L) bzw. heavy strand (H) Primer
angegeben. Die Namensgebung der Primer richtet sich nach der Nukleotidposition der 3 Base des
Primers (nach Anderson et al. 1981). Zur Amplifikation von Fragment V wurden die Primer L15996
und H16410 verwendet.
Name
Sequenz 5-3
Fragment 1
L15996 CTCCACCATTAGCACCCAAAGC
L16055 GAAGCAGATTTGGGTACCAC
H16142 ATGTACTACAGGTGGTCAAG
Fragment 2
L16117 TACATTACTGCCAGCCACCAT
H16218 TGTGTGATAGTTGAGGGTTG
H16233 GCTTTGGAGTTGCAGTTGATGTGT
Fragment 3
L16209 CCCCATGCTTACAAGCAAGT
H16303 TGGCTTTATGTACTATGTAC
H16348 ATGGGGACGAGAAGGGATTTG
Fragment 4
L16287 CACTAGGATACCAACAAACC
H16410 GCGGGATATTGATTTCACGG

Referenz

Lnge (bp)

Endicott et al. 2003,


Vigilant et al. 1991
Handt et al. 1996
Stone & Stoneking 1998

187 (145)
126 (87)

Haak et al. 2005b


Handt et al. 1996
Haak et al. 2005b

141(100)
162 (115)

Handt et al. 1996


Handt et al. 1996
Haak et al. 2005b

133 (94)
179 (138)

Handt et al. 1996


Handt et al. 1996

162 (122)

85

Material und Methoden


Die homogene annealing-Temperatur von 58C aller sich berlappender Primerpaare
ermglichte auch die Kombination der Primer untereinander. Mit dem kombinierten
Primerpaar L15996-H16410 (Fragment V) (Abbildung 15) konnte auch der gesamte Abschnitt
der vier krzeren berlappenden Fragmente I-IV amplifiziert werden. Diese Kombination
wurde zunchst fr alle modernen Vergleichsproben etabliert und angewandt. In einem alle
Extrakte umfassenden Versuch wurden nun alle Proben auf mglichen Erhalt und
Koextraktion von DNA-Moleklen o 440 Basenpaaren getestet.
Als PCR-Additivum wurde stets BSA (bovines Serumalbumin) [Roche Diagnostics GmbH,
Mannheim] zur PCR hinzugefgt, da sich im Zuge laborinterner Optimierungsprotokolle
dieser Schritt bei der Amplifikation von degradierter template DNA bewhrt hatte. Die
Wirkungsweise von BSA ist noch weitgehend ungeklrt. Es ist anzunehmen, dass BSA einen
stabilisierenden Einfluss auf die Prozessivitt der DNA-Polymerase hat, welche somit von
inhibierenden Stoffen weitgehend unbeeinflusst bleibt.

5.2.4.3.2 Verwendung von Uracil-N-Glykosylase


Um anhand der Sequenzen putative deaminierte Basenpositionen identifizieren zu knnen
und sie gegebenenfalls von echten polymorphen Positionen zu unterscheiden, wurde
teilweise in die PCRs einer Extraktion zustzlich Uracil-N-Glykosylase (UNG) [SigmaAldrich Chemie GmbH, Mnchen] eingesetzt. Das Enzym UNG trgt zur Spaltung der Nglykosidischen Bindung des Zuckers und der Base bei und fhrt damit zur Abspaltung von
Uracil, welches durch Deaminierung von Cytosinen entstanden sein kann. Diese Abspaltung
von Uracil (Depyrimidierung) im DNA-Molekl fhrt innerhalb der PCR-Reaktion zum
Abbruch der weiteren Strangextension. PCR-Produkte, deren DNA-Ausgangmolekle mit
UNG behandelt wurden, enthielten somit nur Repliken intakter Uracil-freier Molekle
und damit keine Transitionen von Cytosin zu Thymin wie sie durch die Deaminierung von
Cytosin zu Uracil im Reproduktionszyklus entstehen konnten.
Die Inkubation der gesamten PCR-Reaktion mit 1U UNG erfolgte bei RT fr ~30min.

5.2.4.3.3 Amplifikation von Bereichen der coding region


In Fllen, in welchen die Sequenzanalyse der Hypervariablen Region I zur eindeutigen
Haplogruppenbestimmung nicht ausreichend war, wurden Bereiche der coding region des
Mitochondriums, welche charakteristische Sequenzunterschiede enthalten, amplifiziert. Dies
galt in erster Linie fr Proben der beiden groen Haplogruppen H* und U*, die beide auf der
HVR I der Cambridge Referenz Sequenz entsprechen knnen oder auch wiederkehrende
polymorphe Positionen teilen (wie z.B. np T16311C). Somit wurden zur Besttigung der
vermuteten Haplogruppe jeweils die charakteristische Position auf der coding region gewhlt
und amplifiziert. Fr die Haplogruppe H* ist dies der Wegfall einer Alu I Schnittstelle an
Nukleotidposition (np) 7025 durch eine Mutation an np 7028, wodurch die
Erkennungssequenz fr das Restriktionsenzym Alu I zerstrt wird. Fr alle Individuen der

86

Material und Methoden


Haplogruppe U* ist eine Schnittstelle an np 12308 fr das Restriktionsenzym Hinf I
charakteristisch. Die Sequenzen der Primerpaare fr die beiden Bereiche und jeweiligen
Referenzen sind Tabelle 7 zu entnehmen. Die Amplifikationsparameter und der
Reaktionsansatz fr beide Systeme entsprachen dem Standard-PCR-Ansatz (Tabelle 5),
lediglich die Annealing-Temperatur lag fr beide Primerpaare bei 55C und die Zyklenzahl
wurde auf 45 erhht, um eine ausreichende Signalstrke (Kap. 5.2.6) fr den nachfolgenden
Restriktionsenzymverdau (Kap. 5.2.11) zu gewhrleisten. In wenigen Fllen wurde die PCRReaktion nach berprfung der Signalstrke nachamplifiziert, d.h. unter bestehenden
Parametern weitere fnf Reaktionszyklen angefgt.

Tabelle 7. Liste der verwendeten mitochondrialen Primer im Bereich der coding region.
Primernamen entsprechen der Nukleotidpositionen (np) der 3 Base und alle np sind nach Anderson
et al. 1981 wiedergegeben.
Name

Sequenz 5-3

Referenz

Hinf I Schnittstelle an np 12308


U5-12216

CACAAGAACTGCTAACTCATGC

Izagirre et al. 1999

U2-12339

ATTACTTTTATTTGGAGTTGCACCAAGATT

Torroni et al. 1996

Alu I Schnittstelle an np 7025


H3-6999

CAAACTCATCACTAGACATCG

Lalueza-Fox et al. 2004

H4-7066

GAATGAAGCCTCCTATGATGG

Lalueza-Fox et al. 2004

5.2.4.4 Amplifikation nuklerer DNA


5.2.4.4.1 Amplifikation von STRs mittels AmpFlSTR Profiler PlusTM
Die Amplifikation von nukleren short tandem repeats (STRs) erfolgte mit Hilfe des
AmpFlSTR Profiler PlusTM Kits [Applied Biosystems, Foster City; USA]. Dieses System
ermglichte in einem Multiplexansatz die simultane Amplifikation von neun autosomalen
STR-loci und dem geschlechtsspezifischen Marker Amelogenin (Tabelle 8).
Das finale Reaktionsvolumen der STR-PCR betrug 25il, was einer Reduzierung der
Herstellerangaben um die Hlfte entsprach. Der Reaktionsansatz beinhaltete 10il (1x) PCR
Reaction Mix, 5il (1x) Primerset, 0.5il (2.5 U) AmpliTaq Gold, sowie 1-5il DNA Extrakt und
die jeweilig bentigte Menge UV-HPLC-Wasser.
Bei generell 45 Zyklen wurde nach den folgenden PCR-Bedingungen verfahren. Der initialen
Aktivierung der Polymerase (6min bei 95C) folgten jeweils 60s Denaturierung bei 94C, 60s
annealing bei 59C und 60s Elongation bei 72C. Zur finalen Adenylierung erfolgte ein
Extensionsschritt bei 60C fr mindestens 2h oder wahlweise ber Nacht.

87

Material und Methoden

Tabelle 8. Die neun autosomalen loci und der geschlechtsspezifische Marker Amelogenin des
AmpFlSTR Profiler Plus Kits (modifiziert nach dem Profiler Plus User Manual).
Loci

Chromosom Motiv der Repeat-Einheiten

Lnge

Fluoreszenzmarkierung

Amelogenin X: p22.1-22.3 -

107

JOE

Y: p11.2

113

D3S1358

3p

TCTA (TCTG)1-3 (TCTA)n

114-142

5-FAM

D8S1179

(TCTR)n

128-168

JOE

D5S818

5q21-31

(AGAT)n

135-171

NED

vWA

12p12-ter

TCTA (TCTG)3-4 (TCTA)n

157-197

5-FAM

D21S11

21

(TCTA)n (TCTG)n [(TCTA)3 TA (TCTA)3 TCA 189-243

JOE

(TCTA)2 TCCA TA] (TCTA)n


D13S317

13q22-31

(GATA)n

206-234

NED

FGA

4q28

(TTTC)3 TTTT TTCT (CTTT)n CTCC (TTCC)2

219-267

5-FAM

D7S820

7q11.21-22

(GATA)n

258-294

NED

D18S51

18q21.3

(AGAA)n

273-341

JOE

Zur Bestimmung der Fragmentlngen wurden die PCR-Produkte der AmpFlSTR Profiler
PlusTM Reaktionen der automatisierten Kapillar-Elektrophorese [ABI 310 Genetic Analyzer,
Applied Biosystems] unterzogen (vgl. Kap. 5.2.10). Der Auftrag der PCR-Produkte erfolgte
unaufgereinigt. Je nach ermittelter Bandenstrke im vorgeschalteten Agarosegel (Kap. 5.2.6)
wurden 0,5-1il PCR-Produkt mit 12il Hi-Di Formamid und 1il internem Lngenstandard
[Genescan-ROX 500, Applied Biosystems] versetzt und in ein ABI 310 tube [Applied
Biosystems] berfhrt, welches mit einem Septum versehen wurde. Der Ansatz wurde 2min
bei 95C im Thermocycler denaturiert. Bei jedem Lauf der Kapillarelektrophorese wurde die
zugehrige Allelleiter mitgefhrt.
Die Amplifikation der kommerziellen STR-Multiplex PCR wurde an einer Auswahl 53
subjektiv beurteilten, gut erhaltenen Individuen vorgenommen. Da aufgrund der
Degradierung alter DNA mit einem geringen Amplifikationserfolg nuklerer DNA zu
rechnen war (Kap. 3.6), wurde in den meisten Fllen nur eine erste Amplifikation
durchgefhrt und ber die Auswertungen der Gelelektrophorese (Kap. 5.2.6) entschieden,
welche Proben durch die Kapillarelektrophorese (Kap. 5.2.10) analysiert werden konnten
und zur Reproduktion erneut amplifiziert werden sollten. Zeigte die Auswertung der ersten
Amplifikation einer Probe mindestens drei auswertbare loci, so wurden weitere MultiplexReaktionen derselben Proben durchgefhrt.
Von jeder erfolgreichen Probe wurden von jeder Extraktion mindestens zwei unabhngige
PCR-Reaktionen analysiert. Diejenigen peaks, deren Produktlnge im Elektropherogramm
einem existierenden Allel entsprachen, allerdings nur schwach nachgewiesen werden
konnten, wurden in Klammern aufgenommen.
Die Erstellung eines Konsensus-Genotyps fr die einzelnen Proben konnte dann erfolgen,
wenn die entsprechenden Allele eines locus mindestens dreimal besttigt werden konnten.

88

Material und Methoden


5.2.4.4.2

Amplifikation
von
STRs
mittels
Multiplex-PCR
Geschlechtsbestimmung und Verwandtschaftsanalyse.

zur

molekularen

Bei fnf Proben (DEB3, DEB4, HAL2, KRE1, KRE2), bei welchen bereits eine erfolgreiche
Amplifikation von nuklerer DNA durch das AmpFlSTR Profiler PlusTM Kit nachgewiesen
werden konnte, kam auch eine zweite STR-Multiplex-PCR zur Anwendung. Diese wurde
2003/4 im Rahmen einer Magisterarbeit der Arbeitsgruppe Molekulare Archologie am
Anthropologischen Institut der Johannes Gutenberg Universitt Mainz von Frauke Stock
M.A. entwickelt (Stock 2004). Die charakteristischen Eigenschaften dieser STR-MultiplexPCR sind die verkrzten maximalen Fragmentlngen der einzelnen Produkte, der in erster
Linie den Bereich bis ~200bp abdeckt und sich damit fr den Einsatz mit degradierten
Proben eignet. Zudem wurden fr diese Multiplex vermehrt gonosomale Marker verwendet,
um die Geschlechtsbestimmung des Markers Amelogenin zu besttigen (Tabelle 9).
Der Multiplex-PCR Ansatz entsprach der Standard-PCR-Reaktion in Tabelle 5 mit einem
Gesamtvolumen von 50il. Lediglich das Primerset wurde zuvor in einem gesonderten
Mastermix angesetzt, wovon pro PCR-Reaktion 27il eingesetzt wurden (Tabelle 10). Bei 45
Zyklen wurde nach den folgenden PCR-Parametern verfahren: die initiale Aktivierung der
Polymerase erfolgte fr 4min bei 94C, worauf jeweils 30s Denaturierung bei 94C, 30s
annealing bei 58C und 60s Elongation bei 70C folgten. Der finale Extensionsschritt zur
Adenylierung erfolgte bei 60C fr mindestens 2h oder wahlweise ber Nacht. Die
Probenvorbereitung fr die weitere Kapillarelektrophorese erfolgte wie bereits in Kapitel
5.2.4.4.1 beschrieben.

Tabelle 9. Der geschlechtsspezifische Marker Amelogenin, die fnf gonosomalen und die drei
autosomalen loci der STR-Multiplex-PCR .
Genort
Amelogenin

Chromosom Motiv der


Repeat-Einheiten
X: p22.1-22.3 -

Lnge
in bp
93/99

Fluoreszenzmarkierung
HEX

Y: p11.2

HPRTB

Xq26.1

TCTA

120-164

HEX

STRX-1/DXS981

Xq11.2-13.1

ATCT

169-189

6-FAM

DYS434

Yq11

CTAT

110-122

HEX

Y-GATA A7.1/DYS460

ATAG

118-142

6-FAM

DYS391

TCTA

191-215

6-FAM

TPOX

2p23-2ter

AATG

86-114

6-FAM

D13S317

13q22-q31

TATC

100-144

NED

CSF1

5q33.3-34

AGAT

182-230

HEX

89

Material und Methoden

Tabelle 10. Primerkonzentrationen des Multiplexansatzes.

Primer
Amelogenin
DYS434
HPRTB
CSF1
TPOX
Y-GATA-A7.1
STRX-1
DYS391
D13

Volumen in Pl
0,2
0,8
1,5
3,0
0,5
1,7
2,0
3,0
0,7

Konzentration in PM
0,08
0,32
0,6
1,2
0,2
0,68
0,8
0,12
0,28

5.2.5 Aufreinigung der PCR-Produkte


a) Aufreinigung ber Silicafilter
PCR-Produkte, die mit Restriktionsenzymen verdaut oder sequenziert werden sollten,
wurden aufgereinigt, um Unreinheiten zu entfernen, welche die Verdau- bzw.
Sequenzierreaktion beeinflussen oder inhibieren knnen. Die Aufreinigung der PCRProdukte erfolgte mit dem Qiaquick PCR Purification Kit [Qiagen, Hilden] oder dem
Invisorb Spin PCRapid Kit [Invitek GmbH; Berlin-Buch]. Beide Kits beruhen auf dem
Prinzip der Sulenzentrifugation in drei Schritten ber eine silicabasierte Membran. Dabei
wurde das PCR-Produkt zusammen mit einem speziellen Puffer auf die Sule geladen und
zentrifugiert. Der Puffer garantierte die optimalen Bedingungen (sauer bis neutral) fr die
Adsorption der doppelstrngigen DNA an die Silica-Membran. Ein Waschpuffer auf
Ethanolbasis entfernte im darauf folgenden Zentrifugationsschritt berschssige Reagenzien
und Unreinheiten wie z.B. Puffer, Salze, l, ungebundene Primer und dNTPs. Im dritten
Schritt wurde mittels eines speziellen Elutionspuffers unter kontrren, also basischen
Bedingungen die gereinigte DNA von der Membran gelst und durch dieselbe hindurch in
ein Reaktionsgef zentrifugiert. Die Elutionsmenge betrug 40il. Alle Aufreinigungsschritte
richteten sich nach den Protokollen der Hersteller.
b) Enzymatische Aufreinigung mit SAP und ExoI
Als kostengnstigere Alternative zur oben genannten Aufreinigung ber Silicafilter wurde
fr die Aufreinigung der Produkte aus den Kolonie-PCR-Reaktionen eine enzymatische
Aufreinigung mit SAP und ExoI angewendet. Hierbei wurden in einem single tube Schritt
die PCR-Produkte mit den Enzymen Exonuclease I (ExoI) und Shrimp Alkaline Phosphatase
(SAP) versetzt, welche berschssige Primer und dNTPs, sowie einzelstrngige DNA aus
der PCR-Reaktion entfernten (Sambrook et al. 1989, Werle et al. 1994). Die Exonuclease I
degradiert einzelstrngige DNA und Oligonukleotide (Primer) in 3>5 Richtung und SAP
lst die Phosphatgruppen der freien Nukelotide auf, so dass diese in der Sequenzierreaktion
das Verhltnis von dNTPs und markierten ddNTPs nicht stren.

90

Material und Methoden


Der Reaktionsansatz wurde zunchst 30min bei 37C und anschlieend im Thermocycler bei
80C fr 15min inkubiert, um die Enzyme zu deaktivieren.

Tabelle 11. Protokoll der enzymatischen Aufreinigung.

SAP 1U/il
ExoI 20U/il
10x Reaction Buffer
PCR Produkt

Volumen in Pl
1
1
0,5
15

Konzentration
0,5 U
0,5 U
1x

Hersteller
MBI Fermentas
MBI Fermentas
MBI Fermentas

5.2.6 Agarose Gelelektrophorese


Zur Separierung und Identifizierung von DNA-Fragmenten dient die Agarose
Gelelektrophorese. Dabei wandert die negativ geladene DNA horizontal in einem
elektrischen Feld konstanter Strke innerhalb eines Gels von der Kathode, dem
Auftragungsort, zur Anode. Kleinere DNA-Fragmente passieren die Gelmatrix einfacher
und schneller als grere, folglich werden die Molekle ihrer Gre nach aufgetrennt. Die
Auftrennungsstrke kann durch Variation der Agarosekonzentration beeinflusst werden.
Durch Zugabe der fluoreszierenden Substanz Ethidiumbromid (EtBr), die sich zwischen den
Wasserstoffbrcken des DNA-Doppelstrangs einbaut, knnen die DNA-Banden
anschlieend unter UV-Licht (254nm) sichtbar gemacht, lokalisiert und dokumentiert
werden.
Zum Nachweis von PCR-Produkten wurden diese auf ein 2%-iges Agarosegel aufgetragen.
Es wurden jeweils 10il PCR-Produkt mit 1il Schwerelsung (Bromphenolblau) vermischt
und auf das mit 3il Ethidiumbromid [10mg/ml UltraPURE Ethidiumbromide solution,
GIBCO BRL Life technologies; Karlsruhe] versetzte Gel geladen. Zur Einordnung der
Produktgren wurden in den ueren Geltaschen 50bp Leitern [GeneRulerTM 50bp DNA
Ladder, MBI Fermentas] aufgetragen. Die Laufzeiten wurden variiert, die PCR-Produkte
liefen zur berprfung der PCR 30-40min bei 140V. Zur Kontrolle von Verdaureaktionen
von Restriktionsenzymen wurde die Laufzeit auf 50min erhht. Als Gel- bzw. Laufpuffer
diente 1xTBE-Puffer (Kap. 10.2 im Anhang). Die Dokumentation erfolgte unter UV-Licht
[Spectroline Transilluminator TR-302; Spectronics Corporation; Westbury, USA] mit einer
Polaroid Kamera [MP-4 Land Camera/Filme Typ 667] bei Blende 8 fr 20-25s. Im Laufe der
vorliegenden Arbeit wurde dieses System durch eine digitale Geldokumentation ersetzt
[INTAS Science Imaging Instruments GmbH, Gttingen].

91

Material und Methoden

5.2.7 Klonierung
5.2.7.1 Prinzip der Klonierung
Vor Erfindung und Etablierung der PCR diente die Klonierung als Standardmethode zur in
vivo Vervielfltigung von DNA Ausgangsmoleklen fr weitere nachgeschaltete Analysen.
Das Prinzip der Klonierung beruht auf dem intentionellen Einbau von doppelstrngiger
DNA in Plasmide. Dies sind kleine, ringfrmige extrachromosomale DNA-Molekle in der
Zelle, welche ihre DNA unabhngig replizieren knnen (Replikone). Sie werden isoliert und
mit einem geeigneten Enzym an einer bestimmten Stelle aufgeschnitten und prpariert, so
dass in einem weiteren in vitro Schritt mit Hilfe des Enzyms (Ligase) fremde DNA eingebaut
werden kann. Plasmide knnen je nach Klonierungzweck unterschiedlich prpariert sein, in
unserem Fall (pucC18) tragen sie zwei besondere Gene; eines bedingt die
Antibiotikaresistenz und ein zweites, welches zur Umsetzung eines Farbstoffes (X-Gal) dient.
Plasmide, die nach der Ligation Fremd-DNA - ein insert enthalten, werden Vektoren
genannt. Beim nachfolgenden Schritt, der so genannten Transformation werden die Vektoren
in Wirtszellen (berwiegend Bakterien oder Pilze, hier Escherichia coli) eingeschleust. Vorab
wird das Verhltnis von Vektoren und elektrokompetenten Zellen (Wirtszellen) zu Gunsten
Letzterer angepasst, so dass gewhrleistet wird, dass pro Wirtszelle nur ein Vektor
aufgenommen wird. Die Zellen werden nach der Transformation in Nhrlsung
aufgenommen (LB-Medium) und anschlieend auf Agarplatten ausgestrichen (vgl. Kap. 10.2
im Anhang). Die Agarplatten entsprechen der Nhrlsung, enthalten jedoch, neben
Ampicillin (Antibiotika) und Agar agar zur Gelierung, auch den Farbstoff X-Gal (5-Brom-4Chlor-3-Indolyl-b-D-Galaktosid) [Carl Roth GmbH, Karlsruhe] und den Induktor IPTG
(Isopropyl-thio-galaktosid) [BioTech Trade & Service GmbH, St. Leon-Rot]. Aufgrund der
Antibiotikaresistenz knnen die Zellen auf den Nhrbden wachsen und mittels der so
genannten Blau-Wei-Selektion knnen nach einiger Zeit sichtbare Zellkolonien, welche ein
insert tragen (wei), von solchen unterschieden werden, die keines tragen (blau). Das IPTG
im Nhrboden dient hierbei als Induktor zur Ablsung des Repressor-Proteins, d.h. zur
Aktivierung der Operon Funktionseinheit, welche das LacZ Gen beinhaltet. Bei intaktem
Leseraster codiert das LacZ Gen die p-Galaktosidase. Die p-Galaktosidase setzt das X-Gal im
Nhrboden enzymatisch um und bildet Galaktose sowie den blauen Farbstoff 5-Bromo-4Chloro-3-Indol. Zellen mit intaktem Leseraster, also ohne insert, erscheinen daher blau. Da
die Insertionsstelle fr die Fremd-DNA bewusst im LacZ Gen platziert ist, wird durch den
Einbau das Leseraster des Gens gestrt. Somit kann die p-Galaktosidase nicht synthetisiert
und X-Gal kann nicht umgesetzt werden und die bleiben Kolonien farblos (wei). Diese
weien Zellkolonien, die folglich ein
insert in den Plasmiden tragen, werden nun ausgewhlt und weiter vermehrt. Anschlieend
werden die Plasmide wieder isoliert und die entsprechenden inserts analysiert. Statt diese in
vivo Vervielfltigung nun wieder zusammenzufhren, ist bei der Analyse von alter DNA die
prismenartige Aufspaltung der Ausgangs-DNA von besonderem Interesse. Sie ermglicht es,
heterogene DNA, in unserem Fall PCR-Produkte aufzuschlsseln und somit Molekle
unterschiedlicher Herkunft (z. B. Original und Kontamination oder postmortal
sequenzvernderte Molekle, d.h. Mischspuren) voneinander zu trennen. Die Identifikation

92

Material und Methoden


von kontaminierenden Sequenzen ist selbstverstndlich abhngig von der Auflsungsstrke
des untersuchten locus bzw. der generellen Mglichkeit der Unterscheidbarkeit.
In der vorliegenden Arbeit wurden je PCR- Produkt mindestens fnf, durchschnittlich zehn
Klone sequenziert. Es wurden nur diejenigen Proben kloniert und sequenziert, bei welchen
die fr Reproduktion erforderliche Mindestanzahl von acht Fragmenten (die jeweils vier
berlappenden Fragmente aus zwei unabhngigen Extraktionen) vorlag.

5.2.7.2 Protokoll der Klonierung


5.2.7.2.1 Vorbereitende Schritte
Herstellung elektrokompetenter Zellen
Zur Herstellung elektrokompetenter Zellen wurde zunchst die Menge einer Impfse einer
Escherichia coli Stammkultur in 50ml LB-Medium bei 37C ber Nacht inkubiert. Weitere
500ml LB-Medium wurden mit 2ml dieser bernachtkultur angeimpft und solange auf
einem Schttler [Becton Dikinson GmbH, Heidelberg] bei 37C inkubiert bis das Medium
eine optische Dichte von ~0,6nm erreicht hatte. Alle nachfolgenden Arbeitsschritte wurden
auf Eis durchgefhrt. In einem Zentrifugationsschritt bei 4C fr 15min bei 4360xg wurden
die kultivierten Zellen pelletiert [Hettich Zentrifugen GmbH & Co. KG, Tuttlingen]. Darauf
folgten zwei Waschschritte unter Zugabe von 100ml eisgekhltem, autoklavierten HPLCWasser, Resuspension und Zentrifugation bei 4C fr 20min. Im dritten Waschschritt
wurden 100ml 10%-iges Glycerin zugegeben, resuspendiert und die Zellen unter gleichen
Bedingungen zentrifugiert. Das Pellet wurde in ~10ml 10%-igem Glycerin aufgenommen, zu
Aliquots von 50il aufgeteilt und bei 80C gelagert.
Herstellung des T-Vektors und T/A cloning
Als Basis fr die Herstellung des T-Vektors diente ein pUC 18 Plasmid [Spende des Instituts
fr Molekulargenetik, Mainz], welches in Escherichia coli (RRI Stamm) transformiert wurde.
Die Menge einer Impfse des Klones wurde in 3ml LB-Medium (10% Ampicillin) ber Nacht
bei 37C kultiviert. 100il der Kultur wurden mit 50% Glycerin versetzt und bei -20C als
Reserve fr die Neuanzucht gelagert. Aus den bernachtkulturen wurden anschlieend mit
Hilfe des kommerziellen Plasmid Prep Kits [Macherey-Nagel GmbH & Co. Kg, Dren] die
Plasmide isoliert und gepoolt. Die ringfrmigen Plasmide wurden mit dem
Restriktionsenzym SmaI (10U) bei 30C fr 1h verdaut. Die Schnittstelle liegt auf der multiple
cloning site (MCS) innerhalb des LacZ Gens. SmaI erzeugt sogenannte glatte Enden (blunt
ends). Die Linearisierung der Plasmid-DNA durch den Verdau wurde durch eine
Gelelektrophorese (Kap. 5.2.6) berprft. Die Verdaureaktion wurde anschlieend gefllt
(Kap. 5.2.9) und die finale Konzentration des linearisierten Vektors auf 50ng/il eingestellt.
Die Herstellung eines T-Vektors erfolgte nach dem Prinzip der PCR (Kap. 5.2.4). Jedoch
wurden hierbei nicht alle vier Nukleotidtriphosphate hinzugegeben, sondern nur das
gewnschte dTTP (Deoxynukleotidtriphosphat). Somit wurde jedem linearisierten Vektor
ein Thymin angehngt. Es entstanden so genannte sticky ends (berhngende Enden), die

93

Material und Methoden


eine effektive Ligation mglich machten, da diese mit dem komplementren Adenin der
finalen Adenylierung der PCR-Produkte durch die Taq-Polymerase binden konnten.

5.2.7.2.2 Ligation und Ligationsfllung


Bei der Ligation wird jeweils ein Molekl des PCR-Produkt-Pools mit Hilfe des Enzyms T4
Ligase mit dem T-Vektor verbunden. Der Vektor (mit inserierter Fremd-DNA) ist
anschlieend wieder annhernd ringfrmig.
Es wurden generell 4il PCR-Produkt in die Ligation eingesetzt, um den Gebrauch von
HPLC-Wasser zum Erreichen des Reaktionsvolumens und daher eine mgliche
Kontamination im postPCR-Bereich beim sensiblen Schritt der Ligation zu vermeiden. Die
Reaktion wurde unter einer PCR-Haube [DNA/RNA UV Cleaner, MS Laborgerte, Schrder
OHG, Wiesloch] angesetzt (siehe Tabelle 12), worunter auch die benutzten Reaktionsgefe
zuvor fr 45min mit UV-Licht bestrahlt wurden.

Tabelle 12. Ligationsansatz.


Volumen in Pl

Konzentration

Hersteller

PCR-Produkt

T4-Ligase 1U/il

0,4U/il

MBI Fermentas

10x T4-Puffer

1x

MBI Fermentas

T-Vektor (~50ng/il)

~5ng

Eigene Herstellung

Endvolumen

10

Der Ligationsansatz wurde ber Nacht bei 16C im Thermomixer [Eppendorf, Hamburg]
inkubiert. Am nchsten Tag wurde der Ansatz fr 1h bei 400rpm im Thermomixer
geschttelt. Die nachfolgende Deaktivierung der Ligase erfolgte fr 10min bei 72C im
Thermocycler. Zur Fllung des Ligationsansatzes wurde dieser mit 10il HPLC-Wasser und
10il Chloroform versetzt und anschlieend fr 10min bei 16.000xg zentrifugiert. Der
Zentrifugationsschritt bewirkte die Trennung von zwei Phasen; die untere organische Phase
des Chloroforms, in welcher die Ligase gelst war, wurde mit der Pipette abgezogen und
verworfen. Die anschlieenden Zentrifugationsschritte entsprachen der Fllung von
Sequenzierprodukten (siehe Kap. 5.2.9), lediglich die Volumina wurden entsprechend
angepasst. Dementsprechend erfolgte hier eine Zugabe von 2il 3M Natriumacetat pH 4,6
(1/10 Volumen) und 50il EtOH 100% zur wssrigen Phase. Das getrocknete Pellet wurde in
10il HPLC-Wasser gelst.

94

Material und Methoden


5.2.7.2.3 Transformation/Elektroporation und Ausplattieren
Als Transformation wird in der Genetik u.a. der Austausch von genetischer Information
bezeichnet. Dies bedeutet in unserem Fall das Einschleusen des Vektors in eine andere Zelle.
Das Einschleusen selbst erfolgt durch den Schritt der Elektroporation. Hierbei erzeugt ein
kurzer elektrischer Puls Poren in der Cytoplasmamembran der betreffenden Zellen (Calvin
et al. 1988). Durch diese Membranporen kann nun der Vektor eindringen.
Der gesamte gefllte Ligationsansatz (10il; Kap. 5.2.7.2.2) wurde mit 50il
elektrokompetenten Zellen (Kap. 5.2.7.2.1) des Stammes Escherichia coli RRI (K12 Derivat,
Sicherheitsstufe 1) versetzt und in eine gekhlte Elektroporationskvette [peqLab
Biotechnologie GmbH, Erlangen] berfhrt. Die Kvette wurde 1min auf Eis inkubiert.
Anschlieend erfolgte die Elektroporation im Elektroporator (Spannung: 2500V, Feldstrke:
25F, Shunt Resistor: 201R) [EQUIBIO Easyject Prisma Elektroporator, peqLab
Biotechnologie GmbH, Erlangen] und eine sofortige berfhrung in 1ml LB-Medium. Ein
variierender Teil (15-100il, abhngig von der Konzentration der elektrokompetenten Zellen)
des LB-Mediums mit den transformierten Zellen wurde im Anschluss auf LB-Agarplatten
(siehe Anhang) ausgestrichen. Ein Wachstum der Kolonien auf den Platten erfolgte bei 37C
ber Nacht im Brutschrank.

5.2.7.2.4 Vervielfltigung der Klone


Im Laufe der Arbeit wurden ab dem unten folgenden Schritt der Blau-Wei-Selektion die
Arbeitsprotokolle gendert und sind nachfolgend als Alternativen A (vor der nderung)
und B (nach der nderung) angegeben. Aus Grnden der Zeitersparnis kam die Methode
der Kolonie-PCR (Alternative B) nach ihrer Etablierung bevorzugt zur Anwendung.
Alternative A)
Anzchten der Klone in LB-Medium mit anschlieender Plasmid-Isolation und Kontrollverdau
derselben
Fr jedes PCR-Produkt wurden von den bernachtkulturen durchschnittlich 12 weie
Kolonien ausgewhlt und mit einem sterilen Zahnstocher von der LB-Platte auf eine neue
Kontrollplatte gepickt und anschlieend in ein 15ml Falcon Gef mit 3ml LB-Medium
berfhrt. Letzteres war zuvor mit 300il Ampicillin (10mg/ml) versetzt worden, um ein
Wachstum nicht Antibiotika resistenter Organismen in der Lsung zu verhindern. Die
Vermehrung der selektierten Zellkolonien im LB-Medium erfolgte auf einem Schttler bei
37C ber Nacht.
Die Isolation der Plasmid-DNA am darauffolgenden Tag erfolgte mit Hilfe eines
kommerziellen Kits [NucleoSpinPlasmid Quick Pure Kit, Macherey-Nagel, Dren] nach
Angaben des Herstellers. Das Prinzip der Plasmid Isolation beruhte auf initialer alkalischer
Lyse der pelletierten Zellen und anschlieender Trennung der freigesetzten Plasmide von
der chromosomalen DNA durch selektive Zentrifugation. Die Aufreinigung der Plasmide
erfolgte in weiteren Zentrifugationsschritten ber Silicamembranen. Die Inkubation mit

95

Material und Methoden


Elutionspuffer im finalen Schritt wurde auf 10min erhht, um die DNA-Ausbeute zu
erhhen.
Vor der Sequenzierung des insert wurde ein Kontrollverdau der einzelnen Plasmidextrakte
vorgenommen, um zu prfen, ob das insert die erwartete Lnge aufweist. Erfahrungsgem
knnen u.a. auch Primerdimere oder einzelne Nukleotide whrend der Ligation mit dem TVektor verbunden werden, woraus ebenfalls weie Kolonien entstehen knnten. Mit Hilfe
zweier Restriktionsenzyme (EcoRI und HindIII), deren Schnittstellen in der - das insert
umfassenden multiple cloning site (MCS) liegen, wurden die Plasmidextrakte geschnitten
(siehe Tabelle 13 fr den Reaktionsansatz). Der Verdau erfolgte fr ein bis zwei Stunden bei
37C. Die berprfung der somit erhaltenen Fragmentlngen (Vektor bzw. Insert +
anlagernder MCS-Sequenz) erfolgte auf einem 2%-igen Agarosegel (Kap. 5.2.6).
Tabelle 13. Ansatz des Plasmidverdaus.

4il Plasmid-DNA
Eco RI 10 U/il
Hind III
10x Puffer R+, enthlt BSA
HPLC-Wasser
Endvolumen

Volumen in Pl
4
0,5
0,5
1
4
10

Konzentration
5U
5U
1x
-

Hersteller
MBI Fermentas
MBI Fermentas
MBI Fermentas
-

Alternative B)
Kolonie PCR
Als Alternative zur Anzucht der selektierten weien Kolonien kam die direkte Amplifikation
der weien Kolonien zum Einsatz. Hierbei wurden die universellen Primer M13 forward und
reverse verwendet (Tabelle 14), welche in der MCS lokalisiert sind. Das Standardprotokoll
des PCR-Ansatzes kann Tabelle 15 entnommen werden. Die PCR-Parameter beinhalteten
eine initiale Denaturierung bei 94C fr 5min und 25 Zyklen von 30s Denaturierung bei
94C, 30s annealing bei 58C und 30s Elongation bei 72C. Die berprfung des PCR-Erfolgs
und gleichzeitig der richtigen Fragmentlnge (Insert + MCS-Sequenz) erfolgte mittels
Gelelektrophorese (Kap. 5.2.6). Kolonie-PCR-Produkte mit erwarteter Lnge wurden mit
Hilfe des Invisorb Spin PCRapid Kit (Invitek, Berlin] nach Angaben des Herstellers
aufgereinigt (Kap. 5.2.5).

Tabelle 14. Sequenz des M13 Primerpaars.

Name
M13/pUC Sequencing Primer forward
M13/pUC Sequencing Primer reverse

Sequenz 5-3
GTAAAACGACGGCCAGT
CAGGAAACAGCTATGAC

96

Material und Methoden


Tabelle 15. Standardprotokoll des Kolonie-PCR-Ansatzes .

Reagenzien
10x PCR Puffer
MgCl2 Lsung
dNTP Mix
ABgene Polymerase
Primer M13 (jeweils)
H2O (HPLC)

Volumen in Pl
2,5
2,5
2,5
0,1
0,5
16,4

Gesamt

25

Konzentration
1x
2,5mM
0,2mM
0,5U
0,2iM

Hersteller
ABgene
ABgene
MBI Fermentas
ABgene
Biosprings
ACROS Organics

5.2.8 DNA-Sequenzierung
Cycle sequencing
Die Sequenzierreaktion, die auf dem Prinzip nach Sanger beruht (Sanger et al. 1977),
unterscheidet sich von einer klassischen PCR-Reaktion durch die Zugabe von nur einem
Primer sowie zustzlich fluoreszierend markierten ddNTPs (Dideoxynukleotidtriphosphate).
Whrend der Elongationphase der Reaktion werden von der Polymerase im Zufallsprinzip
neben normalen dNTPs auch ddNTPs eingebaut. Das Fehlen einer weiteren
Hydroxylgruppe am 3-Kohlenstoff der farbmarkierten Basen verhindert nach deren Einbau
eine weitere Extension am 3-Ende, wonach die Synthetisierung des Stranges abbricht. Es
entstehen unterschiedlich lange DNA-Einzelstrnge mit jeweils einer farbmarkierten Base
am Strangende. Jede der vier Basen ist mit einem anderen Rhodaminfarbstoff markiert (hier
ROX bei ddCTPs, R110 bei ddGTPs, Tamra bei ddTPs und R6G bei ddATPs), so dass die
Reaktion in einem Ansatz durchgefhrt werden kann (Engelke et al. 1988).
Zur Sequenzierreaktion wurde der Big Dye Terminator Cycle Sequencing Ready Reaction
Mix [Applied Biosystems, Weiterstadt] verwendet. Der Ansatz bestand aus 1il Big Dye
Ready Reaction Mix, 3,5il 5x Sequenzierpuffer, 10pmol (0,3iM) M13 forward oder reverse
Primer, 2-4il PCR-Produkt, dessen Einsatzmenge sich nach der Signalstrke auf dem
Agarosegel (Kap.5.2.6) richtete, und entsprechender Menge HPLC-Wasser zur Einstellung
des Reaktionsvolumens von 25il. Die Reaktion erfolgte im Thermocycler in 25 Zyklen fr
30s bei 94C, 15s bei 58C und 2min bei 60C. Im Zuge von Optimierungsschritten wurde im
Laufe der Arbeit die Einsatzmenge der Big Dye Reagenzien auf die Hlfte reduziert. Fr
die Direktsequenzierung der modernen Kontrollproben sowie fr einige neolithische Proben
wurde jeweils ein Primer des entsprechenden Fragments aus Tabelle 6 verwendet. Die
Sequenzierung der Plasmidextrakte (Abschnitt 5.2.7.2.4, Alternative A), als auch der KoloniePCR-Produkte (Alternative B) erfolgte wahlweise mit den universellen pUC M13 forward
oder reverse Primern.

97

Material und Methoden

5.2.9 Fllung von Sequenzierprodukten


Die Fllung zur Aufreinigung der Sequenzierprodukte (20il) erfolgte bei RT mit 50il 99%
Ethanol in Anwesenheit von 2il 3M Natriumacetat (pH 4,6). Zur Pelletierung wurde 30min
bei 13.000xg bei RT zentrifugiert [Eppendorf Centrifuge 5402, Hamburg]. Der berstand
wurde abgenommen und verworfen. Das Pellet wurde in 250il 70% Ethanol gewaschen und
erneut fr 15min bei 13.000xg zentrifugiert. Der berstand wurde erneut abgenommen und
das Pellet bei 37C getrocknet, um verbleibendes Ethanol zu entfernen. Das Pellet wurde in
10il Formamid [Hi-Di-Formamide, Applied Biosystems, Weiterstadt] aufgenommen. Zur
Vorbereitung auf die automatisierte Kapillar-Elektrophorese (Kap. 5.2.10) wurden 5il des
gelsten Sequenzierprodukts und 15il Formamid in ein ABI tube [Applied Biosystems,
Weiterstadt] berfhrt und mit einem Septum [Applied Biosystems, Weiterstadt] versehen.

5.2.10 Die Kapillar-Elektrophorese


Die automatisierte Kapillar-Elektrophorese [ABI Prism 310 Genetic Analyzer, Applied
Biosystems, Weiterstadt] trennt sowohl die Produkte der Sequenzierreaktion als auch die
Fragmente der AmpFlSTR Profiler PlusTM PCR-Produkte nach ihrer Gre auf. Die
Elektrophorese erfolgt ber eine Kapillare, die mit einem viskosen Polymer gefllt ist [POP
6; Applied Biosystems, Weiterstadt]. Die Auftrennung basiert auf der unterschiedlichen
Mobilitt der Molekle, welche wiederum durch deren Gre und Ladung bestimmt ist. Die
Trennstrke dieser Gelmatrix aus linearen Polymerketten ist so effizient, dass
Grenunterschiede von einem Nukleotid aufgelst werden knnen.
Die nach Gre aufgetrennten markierten Produkte/Fragmente passieren nacheinander ein
Fenster in der Kapillare, wo ein Argonlaser die unterschiedlichen Farbmarkierungen am
Ende der Produkte zur Fluoreszenz anregt. Das emittierte Licht wird von einem Hohlspiegel
prismenartig aufgespalten, von einer CCD-Kamera registriert und mit Hilfe einer Software
[ABI Prism Sequencing Analysis 3.0; Applied Biosystems, Weiterstadt] analysiert.
Die Ergebnisse der Sequenzierreaktion lassen sich in Form eines Elektropherogramms
darstellen, worauf die Signale der einzelnen ddNTPs als verschiedenfarbige peaks dargestellt
werden, die durch eine programminterne Matrix wiederum den entsprechenden Basen
zugeordnet werden.
Die Dauer der Sequenzierung ber die Kapillar-Elektrophorese ist abhngig von der
Produktlnge, wobei die Intensitt der Signale durch Verlngerung der Injektionszeit der
Kapillare in der Probe verstrkt werden kann. Die Lauf- bzw. Analyseparameter der
jeweiligen Probenart, welche in der vorliegenden Arbeit zur Anwendung kamen, knnen
Tabelle 16 entnommen werden.

98

Material und Methoden

Tabelle 16. Parameter der Kapillar-Elektrophorese fr verwendeten Proben und Systeme.


Polymer

Module

InjT

InjV

RunV

RunC

RunT

Probe/System

POP-6TM

GS STR POP6 (1ml) F

5s

15.0kv

15.0kv

60

36min

STRs Profiler Plus

POP-6TM

GS STR POP6 (1ml) A

5s

15.0kv

15.0kv

60

36min

STRs Anthrofiler 2004

POP-6TM

SeqPOP6 Rapid (1ml) E

30s

15.0kv

15.0kv

50

variiert

Direktseq

POP-6TM

SeqPOP6 Rapid (1ml) E

40s

15.0kv

15.0kv

50

variiert

Klonseq

5.2.11 Enzymverdau der PCR-Produkte der coding region


Die PCR-Produkte aus den kodierenden Regionen des mitochondrialen Genoms, die
putative Haplogruppen-spezifische Mutationen aufweisen, die zur Bildung oder zum
Verlust einer Restriktionsschnittstelle fhren, wurden nach der PCR mit dem
entsprechenden diagnostischen Enzym verdaut (Tabelle 17). Eine Aufreinigung der
Produkte war nicht erforderlich. Der Verdau erfolgte bei 37C in einem Thermomixer
[Eppendorf, Hamburg] fr 60-90min in einmintigen Intervallen von Stillstand und Mischen
bei 450rpm. Die Fragmentlngen der Verdaureaktion wurden auf 2-3%-igen Agarosegelen
(Kap. 5.2.6) berprft.

Tabelle 17. Standardprotokoll des Enzymverdaus.

Volumen in Pl
PCR-Produkt
9
Enzym
Hinf I 0,5
oder
Alu I 1
10x Puffer
1
Endvolumen
10-10,5

Konzentration
unbestimmt
25U
10U
1x
-

Hersteller
MBI Fermentas
MBI Fermentas
MBI Fermentas

99

Material und Methoden

5.3 Auswertung
Alle Sequenzdaten wurden mit Hilfe der Programme Seqman und Megalign des
Softwarepakets DNAStar [Versionen 4.05 und 5.08, DNASTAR, Inc.] berprft und aliniert.
Als Referenzsequenz diente die Cambridge Reference Sequence (CRS; Anderson et al. 1981,
accesssion nummer J01415, revidiert in Andrews et al. 1999).
Die Fragmentlngenanalyse der STRs erfolgte ebenfalls Software-gesttzt [Genescan;
Applied Biosystems]. Aufgrund der bekannten Lngen des jeweiligen internen Standards
konnten mit Hilfe des local Southern algorithms die Lngen der jeweiligen Peaks berechnet
werden. Da der mit rotem Fluoreszenzfarbstoff ROX versehene interne Lngenstandard
konformgem in jeder Probe mitgefhrt wurde, diente er als Eichkurve und konnte somit
immanente Laufunterschiede der Elektrophorese ausgleichen.
Die Bestimmung der Haplogruppen erfolgte per Vergleich mit bestehenden Daten der
Literatur und den jeweiligen Datenbanken (Richards et al. 2000, Rhl et al. 2001, Genbank,
Estonian Biocentre Database).
In die Analyse der Haplogruppenfrequenzen und deren Verteilung flossen die eindeutig
bestimmten Proben der begleitenden Arbeiten von Guido Brandt (2005) und Marc Tnzer
(2005) mit ein. Daraus ergab sich eine Stichprobe von 26 Individuen der LBK, ein
Individuum der AVK, 10 Individuen der Krs-Kultur und sechs Individuen der
Sammelkategorie Nordost (s.u.). Die Sammelkategorie Nordost umfasste alle Proben aus
Litauen, Polen und Russland, welche zeitlich als auch kulturell angrenzen.
Um etwaige Tendenzen bezglich der Herkunft der frhbuerlichen Haplogruppen zu
eruieren, wurde der Datensatz der neolithischen Proben mit zwei Referenzgebieten (A und
B) aus dem Datensatz von Richards (et al. 2000) verglichen. Fr das Referenzgebiet A wurde
der Datensatz von Richards auf 1139 Individuen der Gebiete sdstlicher Mittelmeerraum,
Sdosteuropa, Mittel- und Nord- und Nordosteuropa eingeschrnkt, um dem Gebiet der
neolithischen Stichprobe der LBK/AVK/Krs-Kultur zu entsprechen. Das Referenzgebiet
B, welches auch als solches bei Richards angefhrt wird, umfasste insgesamt 1296
Individuen aus dem heutigen Nahen Osten.

5.3.1 Definition und Berechnung der post mortem Substitutionsrate


Zur Bestimmung der post mortem Substitutionsrate eines Individuums wurden alle
Sequenzvernderungen quantifiziert, die nicht fr die Haplogruppenbestimmung der Probe
relevant waren. Hierfr wurde der gesamte vorliegende Datensatz an sequenzierten Klonen
von 38 eindeutig bestimmbaren Individuen verwendet, welche nicht mit UNG (Kap.
5.2.4.3.2) behandelt wurden. Dieser Datensatz beinhaltete auch die Sequenzen der
Diplomarbeit von Guido Brandt (Brandt 2005) und der Magisterarbeit von Marc Tnzer
(Tnzer 2005).
Die post mortem Substitutionsrate (Spcr) wurde durch die Gesamtzahl der Substitutionen pro
Probe und PCR (Npcr), die Gesamtzahl an beobachtbaren Linien pro PCR (Lpcr) und die
Fragmentlnge des PCR-Produktes (F) bestimmt. Dazu wurde zunchst die post mortem

100

Material und Methoden


Substitutionsrate der einzelnen Fragmente I-IV gem der Formel Spcr = Npcr/Lpcr/F x 1000
errechnet, die post mortem Substitutionsrate des Individuums wurde anschlieend durch das
arithmetische Mittel aller das Individuum betreffenden Raten (Sind) der einzelnen Fragmente
gebildet.
Als Linie wurde jede Sequenz mit (einem) eigenstndigen Ereignis/Ereignissen betrachtet,
d.h. eine Linie kann auch in mehreren Klonen vorhanden sein. Die Bestimmung der
einzelnen Linien wurde zudem durch weitere Faktoren bedingt. Nicht als eigenstndige
Linie aufgenommen wurden kontaminierende Klone, sofern sie als solche durch
Gesamtschau aller Sequenzen aller Fragmente eines Individuums identifiziert werden
konnten. Haplogruppenrelevante Positionen wurden ausgeschlossen. Dagegen wurden
diejenigen Positionen, die eindeutig als Rckmutation interpretiert werden konnten, mit
aufgenommen. Chimre bzw. Mosaiksequenzen, wie sie durch PCR jumping entstehen
knnen (Pbo 1989, Hofreiter et al. 2001a), wurden ebenfalls aufgenommen, sofern sie sich
als solche charakterisieren lieen und je eine eigenstndige Linie darstellten, da sie ebenso
dazu beitragen, den Zustand der alten DNA-Molekle zu beschreiben.
Die Bestimmung der allgemeinen Substitutionsrate hat daher einen deskriptiven Charakter.
So knnen aus dem errechneten Wert im Vergleich mit anderen Individuen bzw. Individuen
des gleichen Fundortes indirekt Aussagen ber den allgemeinen Erhaltungszustand der
DNA-Molekle des jeweiligen Individuums getroffen werden.
Dieser Datensatz diente dazu, das Verteilungsmuster der Substitutionen ber die gesamte
untersuchte Lnge darzustellen und gleichermaen das charakteristische Verhltnis der
Substitutionsformen zueinander zu erfassen und mit bereits beschriebenen Daten (Hofreiter
et al. 2001a, Hansen et al. 2001, Gilbert et al. 2003a; 2003b) zu vergleichen.

5.3.2 Definition und Berechung der Sttigungsrate


Zur nherungsweisen Quantifizierung der Ausgangsmoleklzahl einer PCR wurde anhand
des beschriebenen Datensatzes (vgl. Kap. 5.3.1) eine Sttigung der Klonsequenzen mit
unterschiedlich substituierten Linien beschrieben. Die Sttigungsrate (Spcr) eines PCRProdukts wurde durch das Verhltnis der Gesamtzahl an unterscheidbaren Linien innerhalb
eines klonierten PCR-Produktes (Lpcr) durch die Gesamtzahl der sequenzierten Klone einer
PCR (Kpcr) bestimmt. Demnach galt die Formel: Spcr = Lpcr/ Kpcr.
Die Sttigungsrate Spcr diente in erster Linie als quasiquantitative Interpretationshilfe. Es
wurde davon ausgegangen, dass mehr Ausgangsmolekle in einer Reaktion vorhanden
waren, wenn der Spcr eines PCR-Produktes gegen den Wert 1 strebte. In Verbindung mit der
allgemeinen post mortem Substitutionsrate (vgl. Kap. 5.3.1) konnten somit indirekt Aussagen
ber die Menge der Ausgangsmolekle einer PCR gemacht werden. Zwar wurden auch
arithmetische Mittelwerte fr alle Individuen errechnet, jedoch waren diese nur in den
Extrembereichen (gegen 1 bzw. gegen 0) fr eine weitere Interpretation hilfreich.

101

Material und Methoden

5.3.3 Definition und Berechnung deaminierender hot spot- bzw. cold spotPositionen
Im Hinblick auf die Sequenzanalyse zur Haplogruppenbestimmung wurden die
Hufigkeiten der Substitutionen an einzelnen Nukleotidpositionen nher untersucht. Da sich
post mortem Artefakte letztendlich auch auf die Haplogruppenbestimmung auswirken
knnen, sofern sie konsistent und nicht zufallsverteilt auftreten, sollte statistisch geprft
werden, ob deaminierende Basenaustausche an gewissen Nukleotidpositionen signifikant
hufiger (hot spots) oder signifikant weniger hufig (cold spots) als andere vorkommen.
Die Datengrundlage der post mortem Substitutionsrate (Kap. 5.3.1) sowie der Sttigungsrate
(Kap. 5.3.2) wurde auch zur Quantifizierung von bestimmten Basenaustauschen
herangezogen. Hierbei sei nochmals darauf hingewiesen, dass diejenigen Klonsequenzen
nicht analysiert wurden, die entweder mit UNG behandelt waren oder die eindeutig als
Kontamination gedeutet werden konnten. Substitutionen an Nukleotidpositionen, die fr die
Haplogruppe der jeweiligen Probe charakteristisch sind, wurden ebenfalls nicht
bercksichtigt. Dagegen wurden Rckmutationen an diesen Positionen einbezogen.
Um den untersuchten Bereich des mitochondrialen D-loop auf das Vorkommen von
putativen hot spot bzw. cold spot-Positionen zu testen, wurde zunchst die post mortem
Substitutionsrate der einzelnen Nukleotidpositionen bestimmt (Snp). Diese errechnete sich
aus der Anzahl an beobachteten Substitutionen (Nnp) an der betrachteten Nukleotidposition
geteilt durch die Anzahl an Linien (Lnp) aller Sequenzen dieses Fragments. Demnach galt:
Snp = Nnp/Lnp.
Anschlieend wurde der Datensatz pro Nukleotidposition fr die entsprechende,
beobachtete deaminierte Transition (CaT, GaA, TaC, AaG; demzufolge Ndeamin)
reduziert. Post mortem entstandene Rckmutationen an Haplogruppen-relevanten Positionen
wurden hier ebenfalls bercksichtigt. Somit erhielt man pro Position die beobachtete
postmortem-Deaminierungsrate: Dnp = Ndeamin/Lnp. Die Deaminierungsraten fr die einzelnen
Basen wurden jeweilig ber die gesamte Region arithmetisch gemittelt. Da den vorliegenden
Transitionen vom Typ I und II jeweils nur eine biochemisch wahrscheinliche Ursache
zugrunde liegt, wurde fr die Basen A und T (Transition Typ I, A/CaG/T) sowie C und G
(Transition Typ II, C/GaT/A) jeweils das kombinierte arithmetische Mittel errechnet (DCG
bzw. DAT). Um den Erwartungswert E der jeweiligen Nukleotidposition zu erhalten, wurde
die durchschnittliche Deaminierungsrate (DCG bzw. DAT) der entsprechenden Basen mit der
Anzahl aller beobachteten Linien dieses Fragmentes bzw. des berlappenden Bereiches
multipliziert. Somit konnte die absolute Hufigkeit an Deaminierungsereignissen an einer
Nukleotidposition mit dem Erwartungswert E verglichen werden. Dies geschah mit Hilfe
eines s2-Tests auf dem 95% Signifikanzniveau. Als Nullhypothese H0 wurde hier formuliert,
dass keine hot bzw. cold spot-Positionen im untersuchten Abschnitt existieren. Fr diejenigen
Werte, die auf dem 95% Signifikanzniveau (p t 0,05) signifikant vom Erwartungswert E
abwichen, wurde H0 verworfen. Demzufolge wurden diese Positionen unter
Alternativhypothese H1 als hot bzw. cold spots definiert, insofern deren beobachtete Werte
den Erwartungswert E ber- bzw. unterschritten.

102

Material und Methoden

5.3.4 Netzwerke

Die Erstellung von Netzwerken hat besonders bei Datenstzen hochvariabler Bereiche im
Vergleich zu phylogenetischen Dendrogrammen eine Reihe von Vorteilen.
Mit Hilfe von Netzwerken knnen komplexe Beziehungsgeflechte dargestellt werden, wie
sie durch das Vorkommen von Parallel- und/oder Rckmutationen auftreten knnen.
Letztere stellen erfahrungsgem in phylogenetischen Bumen Konfliktsituationen dar, die
nach whlbaren Kriterien (nach Prinzipien der Hufigkeit, Sparsamkeit oder auch per Zufall)
entschieden werden mssen. Dabei knnen scheinbar eindeutige Beziehungen
widergespiegelt werden, die nicht der eigentlichen Datenlage entsprechen. Das Netzwerk ist
in der Lage durch Bildung von Rechtecken (sich wiedertreffende ste) solche
Konfliktsituationen unter Beibehaltung aller Information wiederzugeben; es bietet demnach
die Mglichkeit alternative Wege zweidimensional darzustellen. Weiterhin kann in
Netzwerken das Mengenverhltnis der einzelnen Datenpunkte (in unserem Fall Haplotypen)
durch proportionale Darstellung angegeben werden. Darber hinaus knnen aus dem
Muster des Beziehungsgeflechts Aussagen ber die Dynamik der phylogenetischen
Entwicklung abgelesen werden. So deutet beispielsweise eine Sternform auf eine (aktuelle)
Expansion bspw. einer bestimmten Haplogruppe hin.
Ein weiterer Vorteil des Netzwerkes ist die Mglichkeit der Definition von anzestralen
Typen, bergangsformen sowie von erwarteten, mglicherweise ausgestorbenen Linien.
Median joining Netzwerke wurden mit Hilfe des Programms Network 4.1.1.1 [Fluxus
Technology Ltd., Clare, Suffolk, UK, http://www.fluxus-engineering.com] erstellt. Die
Anleitung hierfr befindet sich auf der zugehrigen website und weiterfhrende
Instruktionen wurden Bandelt et al. 1999 entnommen. Epsilon entsprach jeweils dem Wert 0
und die Standardgewichtungen des Programmes wurden bernommen, soweit nicht anders
vermerkt. Diejenigen Daten, welche starke Retikulationen verursachten, wurden bei der
Netzwerkanalyse auer Acht gelassen (Bandelt et al. 2002). Bezglich des N1a-Netzwerkes
waren dies alle Einzeldaten, die an Nukleotidposition 16147 ein Thymin aufwiesen (jeweils
ein Individuum aus Indien (Kivisild et al. 1999), Armenien (Richards et al. 2000), Usbekistan
(Villems, unpubliziert), Trkei (Calafell et al. 1996), und gypten (Dinka) (Krings et al.
1999)).
Mit Hilfe des Programms Network wurden auch Schtzwerte fr das Alter einzelner
abgrenzbarer Zweige und Sternformen der Netzwerke mit Hilfe des u-Wertes nach Forster
1996 errechnet. Hierzu wurde die Anzahl der Proben eines bestimmten Haplotyps bestimmt
und mit der Anzahl der bestehenden Mutationen zum anzestralen Haplotypen multipliziert.
Dies geschah fr alle zugehrigen Hapotypen eines definierbaren Bereichs. Der u-Wert
definiert sich allgemein durch die Summe dieser Produkte im Verhltnis zur Gesamtanzahl
aller beteiligten Proben dieses Bereiches, damit entspricht der u-Wert der durchschnittlichen
Anzahl an Mutationen, die vom anzestralen Typus abweichen. Um das Alter eines Musters
zu bestimmen, wurde der u-Wert mit der Mutationsrate multipliziert, sofern diese bekannt
war. Im vorliegenden Fall wurde die Annahme einer Transition innerhalb der
Nukleotidpositionen 16090-16365 in einem Zeitraum von durchschnittlich 20.180 Jahren

103

Material und Methoden


zugrunde gelegt (Forster et al. 1996). Die Standardabweichung fr die jeweiligen u-Werte
wurden mit Hilfe des Programmes Network nach Saillard et al. 2000 berechnet.
Insgesamt konnte von sechs neolithischen Proben keine 100%-ige bereinstimmung des
Haplotyps in der Literatur gefunden werden. Hierbei konnte zwar in jeden Fall der
Haplotyp der Probe eindeutig bestimmt werden, die HVR I Sequenzen der Proben HAL2,
UWS5, ECS1 (alle N1a), SCHWE4 (H), VAI3 (U3), LEB1 (U5) wichen jedoch alle in einer bzw.
zwei (ECS1) Nukleotidposition(en) von einem entsprechenden in der Literatur
dokumentierten Haplotyp ab.
Fr Proben, fr die keine 100%-ige bereinstimmung des Haplotyps in der Literatur
gefunden wurde, wurden Netzwerke erstellt, um die jeweilige genaue phylogenetische
Beziehung der einzelnen Individuen innerhalb der Haplogruppe zu eruieren und
gegebenenfalls mit Hilfe des u-Wertes das Alter einer Haplogruppe bzw. eines Zweiges von
Haplotypen zu bestimmen.
Die modernen Daten der jeweiligen Hgs sind der Literatur entnommen; die Angaben hierzu
finden sich in den Erluterungen zu den entsprechenden Netzwerken.

5.3.5 Populationsgenetische Simulation mit dem Programm Simcoal 2.0


Um
bestehende
Unterschiede
in
Haplogruppenfrequenzen
zwischen
Beobachtungszeitpunkten zu erfassen und nher zu beschreiben, wurde im Falle der
Haplogruppe N1a die discrete-generation coalescent Methode nach Laval & Excoffier (2004)
angewandt. Damit sollte die Hypothese getestet werden, ob die moderne europische
Bevlkerung des LBK-Gebiets als direkte Nachfahren der neolithischen Bauern angesehen
werden knnen. Hierzu wurden extern populationsgenetische Simulationen mit dem
Programm Simcoal durchgefhrt. Diese sollten prfen, ob genetische Drift fr eine 150-fache
Ausdnnung der hohen Frequenz der Haplogruppe N1a in der neolithischen Probe als
wahrscheinlich anzunehmen ist. Als heutige Vergleichsbevlkerung fr das Referenzgebiet
der Linearbandkeramik dienten Daten aus der Literatur (Rhl et al. 2001, Villems,
unpublizierte Daten, Estonian Biocentre Database 2005, Forster 1996, Lahermo et al. 2000,
Pfeiffer et al. 1999; 2001, Poetsch et al. 2003). Unter 2300 Individuen der modernen
Bevlkerungsgruppen des linearbandkeramischen Verbreitungsgebietes konnten fnf N1a
Haplotypen gefunden werden. Fr die Frequenz der Hg N1a, die in der neolithischen
Stichprobe mit 25% vertreten ist, diente als Ausgangswert mit 8% der untere Wert der
Binominalverteilung (95% Konfidenzintervall). Als Simulationszeitraum wurden hierfr
7425 Jahre bzw. 275 Generationen fr eine Generationsdauer von 27 Jahren veranschlagt. Das
Bevlkerungswachstum wurde mit 0,45% fr die ersten 25 Generationen und mit 0,1% fr
die weiteren 250 Generationen angenommen. Die Simulation wurde 4000 mal wiederholt
und dabei die Anzahl der N1a Haplotypen in der simulierten modernen Bevlkerung
gezhlt. Ausgehend von 2300 Individuen der modernen Bevlkerung wurden Genealogien
entgegen der Zeitachse erstellt. Bei Erreichen des Zeitpunktes 275 Generationen vor heute
wurden den jeweiligen anzestralen Linien mtDNA Linien zugeordnet, welche der
Ursprungspopulation entsprechen sollte. Hierauf wurden die resultierenden Frequenzen

104

Material und Methoden


aller Nachfolger dieser anzestralen Linien in der modernen Population erfasst. Anschlieend
wurde die Simulation unter verschiedenen demographischen Annahmen getestet. Pro
Generation knnen multiple Koaleszenz- sowie Migrationsereignisse zugelassen werden.
Zunchst wurde eine genetische Isolation der zu untersuchenden Bevlkerung
angenommen, nachfolgend auch verschiedene Migrationsraten zwischen der zu
untersuchenden und einer greren umgebenden Population getestet. Im vorliegenden Fall
wurde eine Migrationsrate von 1% pro Generation ber 7425 Jahre zwischen der
neolithischen Stichprobe und den umgebenden Bevlkerungsgruppen zugelassen. Um das
Simulationsmodell einfach zu halten, wurde davon ausgegangen, dass in der umgebenden
Population die mtDNA Linie N1a nicht vorkommt und zudem von entsprechender Grsse
ist, um eine Rckwanderung dieser Linie in die zu untersuchende Population zu
ermglichen. Die Simulation mit dem Programm Simcoal 2.0 wurde von Shuichi Matsumura
und Peter Forster (McDonald Institute for Archaeological Research, University of
Cambridge, UK) durchgefhrt.

105

Material und Methoden

5.4 Authentifizierung
Kriterien der Ergebnisreproduktion und Sequenzanalyse
Die Einhaltung bestimmter Authentizittskriterien bei der Gewinnung von aDNA-Daten
wurde in den vergangenen Jahren gehuft gefordert (z.B. Handt et al. 1996, Cooper 1997,
Ward & Stringer 1997, Burger et al. 1999, Cooper & Poinar 2001, Balogh et al. 2003, Burger et
al. 2004, Pbo 2004, Willerslev & Cooper 2005). Die Notwendigkeit hierfr ist in erster Linie
darauf zurckzufhren, dass einige Resultate aus frheren Verffentlichungen, v. a. sehr
alter, fossiler DNA-Sequenzen, inzwischen als nicht reproduzierbar und damit als Artefakte
gelten (z.B. Cano et al. 1992, DeSalle et al. 1992).
Grundstzlich empfiehlt sich fr den fraglichen Erhalt alter DNA eine unabhngige
Besttigung durch unabhngige, nichtgenetische Methoden, welche Hinweise auf den Erhalt
von Biomoleklen liefern knnen. Fr die vorliegende Arbeit wurde als Anhaltspunkt fr
den mglichen Erhalt von endogener DNA die SAXS-Analyse (small angle X-ray scattering)
als nichtgenetische Methode herangezogen. Die SAXS-Analyse beschreibt die Gre und
Form der Kristalle des Hydroxylapathits bzw. dessen Um- und Abbauprodukte im Knochen.
Nach Hiller (et al. 2003) korreliert das Verhltnis von Formparameter (v-Wert) und
Kristalldicke (T) eng mit dem Erhalt von Biomoleklen wie Proteinen und DNA. Die SAXSAnalyse wurde extern von Jennifer Hiller (FFEGI, University of Newcastle upon Tyne)
durchgefhrt. Insgesamt wurden 14 Proben von menschlichem Knochenmaterial untersucht,
wofr auch sieben neolithische Proben bereitgestellt wurden.
Fr die genetischen Analysen selbst gilt als grundlegende Voraussetzung zur
Authentifizierung der Ergebnisse als oberstes Kriterium die Vermeidung bzw. Eindmmung
von Kontaminationen. Die umfangreichen Manahmen zur Kontaminationsvermeidung
wurden bereits in Kap. 5.2.1 beschrieben. Gerade im Bereich humaner DNA stellt sich hier
das Problem, dass Bearbeiter und der Gegenstand der Untersuchung derselben Spezies
angehren. So lassen sich auch trotz strengster Vorkehrungen die Mglichkeiten der
Kontamination nur weitestgehend minimieren und (zumindest derzeit) nicht gnzlich
ausschlieen. Die Authentifizierung von Ergebnissen ist daher besonders von der
unabhngigen Reproduktion von Einzelergebnissen abhngig. Hierzu wurden bereits im
Vorfeld der Arbeiten Schemata bzw. Vorgehensweisen zur Reproduktion, sowie
Sequenzauthentifizierung entwickelt, die im Folgenden en dtail dargestellt werden:

106

Material und Methoden

Abbildung 16. Schema der Ergebnisreproduktion. Optionale Wiederholungen von PCRs bzw.
Extraktionen sind grau dargestellt.

Von jedem Individuum werden pro Fragment (vgl. Kap. 5.2.4.3.1) mindestens zwei
unabhngige PCR-Produkte aus zwei unabhngigen Extraktionen kloniert und sequenziert,
sofern die hieraus resultierende Mindestanzahl von acht PCR-Produkten pro Individuum
erfolgreich amplifiziert werden konnte (Abbildung 16). Darber hinaus werden von einer
Extraktion zustzliche PCRs mit UNG amplifiziert, um mgliche deaminierte
Nukleotidpositionen zu identifizieren. Optional, d.h. sowohl bereits bei Divergenzen im
Rahmen der Amplifizierbarkeit unterschiedlicher Probenmaterialien (Zhne, Knochen)
sowie bei divergierenden Ergebnissen der Sequenzierung kann eine dritte bzw. vierte
unabhngige Extraktion mit nachgeschalteten PCRs herangezogen werden.
Der Einsatz von berlappenden Primerpaaren zur Rekonstruktion von lngeren
Sequenzabschnitten dient nicht nur der Amplifikation von degradierten (und daher kurzen)
DNA-Moleklen, sondern darber hinaus der Authentifizierung von Ergebnissen. Diese
Vorgehensweise ermglicht es, dass eine bestimmte Mutation, die in einem berlappenden
Bereich vorliegt, im gnstigen Fall doppelt so hufig besttigt werden kann. Befinden sich
zwei Mutationen auf einem Fragment, wovon eine in einem berlappenden Bereich liegt, so
wird diejenige, die nicht im berlappenden Bereich liegt, durch erstere ebenfalls doppelt,
wenn auch indirekt, besttigt. Weiterhin addieren sich die Ergebnisbesttigungen aus
unabhngigen Versuchen fr einen phylogenetisch sinnvollen Haplotypen ber die vier
verwendeten berlappenden PCR-Produkte. Die somit rekonstruierbare Konsensussequenz
wird letztlich in ihren Nukleotidpositionen unterschiedlich hufig direkt bzw. indirekt
besttigt, wie in Abbildung 17 gezeigt wird.

107

Material und Methoden

Abbildung 17. Schema der Sequenzrekonstruktion durch berlappende Klone. Die berlappenden
Klone zweier unabhngiger Extraktionen A und B sind in vier unterschiedlichen Farben dargestellt.
Orangefarbene vertikale Linien sollen beispielhaft beobachtete konsistente Sequenzvernderungen
darstellen. Die resultierende Konsensussequenz von 413bp wird aus acht Teilergebnissen
zusammengesetzt. Die jeweiligen Sequenzvernderungen sind von links nach rechts zweimal, viermal
und indirekt viermal unabhngig besttigt.

Da die Klonierung jedes PCR-Produkts die prismenartige Aufspaltung in Einzelmolekle


erlaubt, knnen aus der Art und Zusammensetzung der sequenzierten Klone ebenfalls
Aussagen zur Authentizitt abgeleitet werden (siehe Abbildung 18). Allerdings knnen diese
nur im Rahmen einer Gesamtschau aller Klone eines Individuums erfolgen.

Abbildung 18. Schema der prismenartigen Aufspaltung von DNA-Moleklen durch die
Klonierung. Die grn und blau markierten DNA-Molekle entsprechen abweichenden Moleklen,
welche mgliche Kontaminationen sein knnen oder sequenzvernderte Molekle, wie sie durch
postmortale Phnomene entstehen.

108

Material und Methoden


Die Gesamtschau beinhaltet die Erfassung und Beschreibung der Integritt eines PCRProdukt-Pools. Auf dieser Grundlage knnen heterogene Klonsequenzen innerhalb eines
PCR-Produkts erkannt und gedeutet werden, welche einerseits urschlich durch postmortale
Sequenzvernderungen alterieren oder aber von Kontaminationen herrhren knnen. Im
letzteren Fall vermag unter gnstigen Umstnden ein Abgleich mit den Ergebnissen
ebenfalls typisierter Bearbeitern helfen, kontaminierende Sequenzen zu identifizieren und
somit indirekt die echte alte Sequenz zu bestimmen. Lassen sich kontaminierende
Sequenzen eindeutig einer bestimmten Haplogruppe zuordnen und darber hinaus von post
mortem-Degradierungserscheinungen abgrenzen, so knnen diese quantifiziert und mit den
als authentisch definierten Sequenzen in Relation gestellt werden.

Abbildung 29. Kategorien zur Authentifizierung von Sequenzen. (Erluterungen im Text).

109

Material und Methoden


Fr die Synthese aller Einzelergebnisse der Klonsequenzen aus den berlappenden
Amplifikationen eines Individuums wurde ein Mastab zur inhaltlichen Authentifizierung
in sieben Kategorien erstellt (Abbildung 19), die nachfolgend erlutert werden:
In Kategorie 1 fallen die Ergebnisse derjenigen Individuen, deren Sequenzen eindeutig und
reproduzierbar aus den jeweiligen unabhngigen Versuchen hervorgehen.
Kategorie 2 beinhaltet diejenigen Individuen, in deren Klonsequenzen eine eindeutige und
aus unabhngigen Versuchen reproduzierbare Linie festgestellt werden kann, daneben
jedoch in den einzelnen Fragmenten einzelne Abweichungen vorkommen, die nicht
reproduzierbar sind und nicht eindeutig einer bekannten Linie entsprechen.
In Kategorie 3 werden diejenigen Individuen aufgenommen, die neben einer eindeutigen
und reproduzierbaren Linie eine weitere Linie aufweisen, die nicht reproduzierbar, einer
eindeutig identifizierbaren Kontaminationsquelle zugeordnet werden kann.
Kategorie 4 basiert auf Kategorie 3, jedoch unter der Annahme, dass fr keine der beiden
oder mehrer Linien eine Zuordnung zu einem mglichen Kontaminationsursprung mglich
ist. Ausgehend von der Nullhypothese H0, dass eine gleichmige Kontamination aller Teile
eines Skelettindividuums durch einen putativen Kontaminanten mit steigender Anzahl an
unabhngigen Versuchen (d.h. Extraktionen aus Material aus anatomisch unterschiedlichen
Regionen) zunehmend unwahrscheinlicher wird, kann optional eine dritte bzw. beliebig
weitere Extraktion durchgefhrt werden. Im Sinne von Kategorie 4 wird die reproduzierbare
Linie als authentisch angesehen.
In Kategorie 5 werden diejenigen Individuen aufgenommen, die neben einer eindeutigen
und reproduzierbaren Linie eine weitere Linie aufweisen, die ebenfalls (in mindestens einem
Fragment) reproduzierbar, einer eindeutig identifizierbaren Kontaminationsquelle
zugeordnet werden kann.
Kategorie 6 basiert auf Kategorie 5, jedoch unter der Annahme, dass fr keine der beiden
(oder mehrerer) reproduzierbarer Linien eine Zuordnung zu einem mglichen
Kontaminationsursprung mglich ist. Ausgehend von der Nullhypothese H0, dass eine
gleichmige Kontamination aller Teile eines Skelettindividuums durch einen putativen
Kontaminanten mit steigender Anzahl an unabhngigen Versuchen (d.h. Extraktionen aus
Material aus anatomisch unterschiedlichen Regionen) zunehmend unwahrscheinlicher wird,
kann optional eine dritte bzw. beliebig weitere Extraktion durchgefhrt werden. Kann keine
eindeutige Tendenz zugunsten einer Linie festgestellt werden, werden die Ergebnisse
verworfen, da unter der Alternativhypothese H1 eine Kontamination nicht von der echten
authentischen DNA unterschieden werden kann und folglich eine plausible
Authentifizierung allein auf Ebene der Sequenzen unter Kategorie 6 nicht mglich ist.
In Kategorie 7 fallen diejenigen Individuen, in deren Sequenzen sich keine eindeutigen und
reproduzierbaren Linien feststellen lassen.

110

Material und Methoden


Abweichende Sequenzen, die nachvollziehbar als post mortem Modifikationen identifiziert
werden, flieen nicht in die oben angefhrte Kategorisierung ein.
Weiterhin knnen mit Hilfe der Klonierung Hinweise auf die der Amplifikation zugrunde
liegenden Ausgangsmolekle gegeben werden. Eine exakte bereinstimmung aller
Nukleotidpositionen mehrerer sequenzierter Klone kann einerseits die Sauberkeit eines
Extraktes bzw. die Homogenitt der Ausgangsmolekle bedeuten, andererseits jedoch auch
auf eine sehr geringe Anzahl an Ausgangsmoleklen zurckfhrbar sein. Letzteres kann
beispielsweise dann angenommen werden, wenn konsistente aber ungewhnliche
Sequenzvernderungen beobachten werden knnen, die wiederum nur als postmortal zu
erklren sind.
Andererseits weisen sequenzierte Klone, welche alle unterschiedliche, als postmortal
definierte, Sequenzvernderungen zeigen, darauf hin, dass eine statistische Sttigung mit
Klonen noch nicht erfolgt ist (Bower et al. 2005, Gilbert et al. 2003b). Umgekehrt bedeutet
dies auch, dass eine ausreichend groe Menge an Ausgangsmoleklen vorliegt, welche im
gnstigen Fall wenige kontaminierende Molekle berlagern kann.
Grundstzlich besteht die - wenn auch geringe theoretische Wahrscheinlichkeit, dass sich
unter der Alternativhypothese H1 trotz der vorgestellten Manahmen zur
Kontaminationsvermeidung und der Reproduktionsschemata eine systematische
Kontamination ebenfalls eindeutig und reproduzierbar im Sinne von Kategorie 1 durchsetzt.
Diese ist z.B. mglich, wenn aufgrund der unzureichenden Erhaltung in mehreren Proben
eines (pr-)historischen Individuums tatschlich keine endogene DNA mehr vorhanden sein
sollte. Aus diesem Grund spielt bei der Authentifizierung der Ergebnisse eines Individuums
die Beurteilung des makroskopischen Erhaltungszustandes der einzelnen Proben eine
zustzliche Rolle. Darber hinaus trgt der binnenstrukturelle Vergleich mit anderen Proben
desselben Fundortes ebenfalls zur Beurteilung der Ergebnisse im Rahmen der generellen
Authentifizierung bei. Dies geschieht unter der Prmisse, dass fr die Individuen eines
Fundortes vergleichbare Erhaltungsbedingungen vorlagen. Abschlieend fliet auch die
individuelle Geschichte (post excavation history; Gilbert et al. 2005) eines Fundortes bzw.
dessen zu untersuchender Proben in die Beurteilung mit ein. Diese Beurteilung erfolgt
gnzlich auf der Basis der Plausibilitt. So sind z.B. Ergebnisse von Proben, welche bereits
bei einer aktuellen Grabung unter weitestgehend sterilen Bedingungen genommen
wurden, solchen vorzuziehen, deren Verbleib und Behandlung bzw. Bearbeitung nach der
Grabung nur lckenhaft oder gar nicht nachvollzogen werden kann.

111

Material und Methoden


Abschlieend sind alle Kriterien, die der Authentifizierung von alten DNA-Sequenzen
dienen und die in der vorliegenden Dissertation angewandt wurden, nochmals
zusammengefasst:
1. Alle Versuche wurden in adquaten Rumlichkeiten durchgefhrt. Pr- und PostPCR-Bereich befinden sich in unterschiedlichen Gebuden.
2. Bei allen Versuchen wurden Extraktionskontrollen (leer und andere Spezies) und
PCR-Kontrollen (leer) mitgefhrt.
3. Pro Individuum wurden mindestens zwei unabhngige DNA-Extraktionen mglichst
aus anatomisch unabhngigen Krperbereichen angestrebt.
4. Pro Individuum wurden mindestens acht PCRs angesetzt. War die Mindestanzahl
von acht PCR-Produkten pro Individuum (vier Fragmente x zwei Extraktionen)
erreicht, so wurden diese kloniert und sequenziert. Durchschnittlich wurden zehn
Klone pro PCR-Produkt sequenziert, um heterogene Amplifikate zu detektieren. Ein
Minimum von fnf Klonen wurde nicht unterschritten.
5. Die DNA-Extrakte wurden auf Amplifizierbarkeit langer Fragmente (o 455bp)
geprft. Degradierte bzw. alte DNA sollte theoriekonform stark fragmentiert
vorliegen und Fragmente dieser Lnge nicht bzw. nicht berdurchschnittlich hufig
aufweisen.
6. Ein Teil der Knochenproben wurde mittels nichtgenetischem Verfahren (SAXSAnalyse) auf Erhaltungsaussichten von Biomoleklen getestet (Burger et al. 2004,
Hiller et al. 2003; 2004).
7. Zur Reproduktion von STRs wurden von jeder Probe je Extraktion mindestens zwei
unabhngige PCR-Reaktionen analysiert. Die Erstellung eines Konsensus-Genotyps
fr die einzelnen Proben konnte erfolgen, wenn die entsprechenden Allele eines locus
mindestens dreimal besttigt werden konnten.
8. Zur mglichen laborinternen Verfolgung von Kontaminationen wurden alle
Labormitarbeiter und Praktikanten des Mainzer aDNA Spurenlabors fr die zu
untersuchenden Genorte bzw. Bereiche typisiert. Sofern es die Situation ermglichte,
wurden auch die jeweiligen Probengeber bzw. diejenigen Personen, die zumindest
zuletzt an oder mit den Proben gearbeitet hatten, typisiert.
9. Der allgemeine makroskopische Erhaltungszustand der Proben wurde beurteilt.
10. Es wurde geprft, ob Individuen desselben Fundortes unter vergleichbaren
Verhltnissen (d.h. Liegemilieu und Alter) vergleichbare Ergebnisse zeigen.
11. Die post excavation history der Proben wurde beurteilt.

112

Ergebnisse

6. Ergebnisse
Der vorliegenden Disseration wurden im Rahmen des Gesamtprojekts zur Neolithisierung
Europas jeweils zwei Studienabschlussarbeiten (Brandt 2005, Tnzer 2005) zugeordnet, die
kleinere Teilgebiete des Untersuchungsraumes zum Inhalt hatten. Grtenteils wurde bei
diesen auf bereits extrahierte bzw. amplifizierte Proben zurckgegriffen.
Aus diesem Grund wurden in der nachfolgenden Darstellung der Ergebnisse teilweise auch
Resultate dieser Abschlussarbeiten mit aufgenommen, da diese einerseits auf vorbereitenden
und begleitenden Arbeitsschritten der vorliegenden Arbeit beruhen und andererseits
sinnvoll im Rahmen der Datenerweiterung herangezogen werden konnten bzw. zur
umfassenden Gesamtanalyse in der abschlieenden Diskussion von weiterer Bedeutung
waren. Des Weiteren wurde innerhalb der Arbeitsgruppe parallel an einer mesolithischen
Stichprobe gearbeitet. Der Einbezug von Ergebnissen oder Teilergebnisse ist an den
entsprechenden Stellen vermerkt.

6.1 Probenerhaltung und Amplifikationserfolg


6.1.1 Amplifikationserfolg
Insgesamt wurde im Laufe der vorliegenden Arbeit DNA von 87 neolithischen Individuen
extrahiert, wovon 57 aus dem ehemaligen Verbreitungsgebiet der Linearbandkeramik
stammten.
Die Amplifikation von vier sich berlappenden Fragmenten (Abbildung 17, Kap. 5.2.4.3.1)
erfolgte aus mindestens zwei unabhngigen Extraktionen. So lagen bei Proben mit guter
DNA-Erhaltung mindestens acht PCR-Produkte vor, die zur Klonierung und Sequenzierung
herangezogen wurden. Eine eindeutige Bestimmung der Haplogruppe konnte bei insgesamt
43 Individuen (74%) durchgefhrt werden, wovon 29 Individuen im Rahmen dieser Arbeit
typisiert wurden. Bei 16% der Individuen konnte durch die Klonierung das Vorhandensein
mehrerer Linien (d.h. mitochondrialer Haplotypen) nachgewiesen werden. Die
verbleibenden Individuen erbrachten entweder keinen positiven Nachweis des Erhalts
mitochondrialer DNA durch Amplifikation oder keinen wiederholbaren bzw. letztlich
reproduzierbaren Nachweis aller vier Fragmente.
Zur Amplifikation der vier berlappenden Fragmente (inklusive der krzeren Alternativen,
Kap. 5.2.4.3.1) wurden insgesamt 60 PCR-Anstze mit 695 Reaktionen durchgefhrt, welche
sich mit 500 positiven PCR-Produkten im durchschnittlichen Amplifikationserfolg von ca.
72% niederschlug. Der unterschiedliche Amplifikationserfolg der einzelnen Fragmente ist in
Abbildung 20 dargestellt. Die krzeren Alternativen der Fragmente II und III kamen jeweils
nur in einem PCR-Ansatz zur Anwendung und flossen daher hier nicht in die Berechung ein.
Der prozentuale Amplifikationserfolg des umfassenden Fragments V (~18,5%) wurde als
Vergleichwert mit einbezogen.

113

Ergebnisse
Weiterhin wurde der Amplifikationserfolg der vier berlappenden Fragmente nach Einsatz
von UNG separat berechnet. Hier lieen sich keine aufflligen Abweichungen vom
allgemeinen Amplifikationserfolg bzw. vom Erfolg der Reaktionen ohne UNG-Zugabe
feststellen.
Amplifikationserfolg in %

Gesamt

mit UNG

ohne UNG

100
90
80
70
60
% 50
40
30
20
10
0
440bp

187bp

179bp

162bp

162bp

III

II

IV

Fragmente/Lnge

Abbildung 20. Amplifikationserfolg der Fragmente I-V in der Reihenfolge ihrer Produktlnge.

Der Amplifikationserfolg der einzelnen Proben wurde auf vergleichbare Weise berechnet
(Abbildung 21). Hierbei wurden Proben der Arbeiten von Brandt und Tnzer (2005)
bercksichtigt, insofern sie im Rahmen dieser Arbeit extrahiert und amplifiziert worden
waren.
Es wurde lediglich ein allgemeiner Amplifikationserfolg der Probe berechnet, ungeachtet
dessen, ob die Probe ein reproduzierbares Ergebnis ergab oder nicht. Bei 21 von 55 hierin
erfassten Proben (38,2%) konnte ein Amplifikationserfolg von 100% beobachtet werden,
wenn nur die vier kurzen Fragmente betrachtet wurden. Darber hinaus war auf Grundlage
aller fnf Fragmente festzustellen, dass unter einem (hier hypothetischen) Schwellenwert
von ~50% nur etwa 12,8% der Proben lagen.

114

115
Abbildung 21. Durchschnittlicher Amplifikationserfolg der einzelnen neolithischen Proben mit
und ohne Einbezug der Ergebnisse des 440bp langen Fragments V.
0%

25%

50%

75%

100%

BRU2
SLH1
SLH2
SON2
SWI6
YPB2
SEE2
UNS1
SON1
DUD1
YPB4
BRU3
DEB2
TRE1
SON5
LEB1
DEB3
KRE1
SZA8 1
SEE1
VAI3
SCHWE1
SCHWE4

Gesamt

DEB5

ohne Fragment V

DEB1
FLO1

HAL2

Amplifikationsrate

SCHWE2
ECS1
END6 2
SCHWE5
DON1
ASP2
BRU4
DUD2
DON2
DBK1
DKF1
END6 1
END6 3
HAL3
SZA23 3
SZA8 3
DEB4
FLO6
FLO4
UNS2
HAL1
KRE2
END119 1
END119 2
SZA23 2
SZA8 2
CHE4
SZA23 1

Ergebnisse

Ergebnisse

6.1.2 Kontamination der Kontrollen

Im Rahmen der Gesamtzahl an PCR-Anstzen zur Amplifikation der mitochondrialen HVS I


wurden insgesamt zehn Anstze bzw. Teile des PCR-Ansatzes verworfen, wenn mehrere
Leerkontrollen positive Signale zeigten bzw. die entsprechenden Tier- und
Extraktionskontrollen eines gemischten Ansatzes aus mehreren Extraktionen positiv waren
(Kap. 5.2.1). In 67 PCR-Anstzen mit 140 Leerkontrollen waren sechs positiv (~4,3%). Der
durchschnittliche Anteil an positiven Extraktionskontrollen lag bei 13,5% und der
durchschnittliche Anteil positiver Tierkontrollen bei 32%.
Der Anteil an positiven Kontrollreaktionen der einzelnen Fragmente ist in Abbildung 22
dargestellt. Hier war zu beobachten, dass die Hufigkeit von positiven Leer- und
Extraktionskontrollen besonders bei der Amplifikation der krzeren Fragmente zunahm.
Gleichermaen kann das absolute Ausbleiben von positiven Signalen bei insgesamt 59
Kontrollreaktion der 292 PCR-Reaktionen des Fragments V festgehalten werden.

Anteil positiver Kontrollreaktionen in %

LK positiv

EXLK positiv

TK positiv

100

80

60
%
40

20

0
440bp

187bp

179bp

162bp

162bp

III

II

IV

Fragmente/Lnge

Abbildung 22. Prozentualer Anteil an positiven Kontrollreaktionen in den unterschiedlichen


Fragmenten. LK = Leerkontrolle, EXLK = Extraktionsleerkontrolle, TK = Tierkontrolle (vgl. Kap.
5.2.1).

Ob in einigen Fllen trotz negativer Leerkontrollen Proben von sporadischen oder


systematischen Kontaminationen betroffen waren, konnte erst nach der Sequenzierung und
Abgleich aller Ergebnisse eines Individuums bestimmt werden. Nach Auswertung der
sequenzierten Klone beinhalteten 77% der untersuchten Proben putative kontaminierende
Sequenzen.

116

Ergebnisse
In Abbildung 23 wurde der Anteil an kontaminierenden Klon-Sequenzen mit dem
allgemeinen prozentualen Amplifikationserfolg der Proben aus den vier entsprechenden
kurzen Fragmenten I-V verglichen. Sieben von 11 Individuen, die einen Amplifikationserfolg
von 100% aufwiesen, zeigten keine kontaminierenden Sequenzen. Dahingegen wiesen alle
anderen Individuen Spuren von Kontaminationen im Bereich von 1,2% (HAL3; DON1)
44,1% (BRU4) auf. Die deutlichsten Anteile an kontaminierenden Sequenzen zeigten BRU4
und UNS2 mit 44,1% und 41,6%, respektive. Die kontaminierenden Sequenzen entsprachen
in beiden Fllen dem direkten Bearbeiter und konnten daher eindeutig identifiziert werden.
Ingesamt lie sich im Hinblick auf den hheren Amplifikationserfolg eine Tendenz zu
Gunsten von Zahnproben entdecken, zumal bei der Mehrzahl der Proben mit 100%
Amplifikationserfolg jeweils DNA aus Molaren extrahiert wurde.

Kontamination vs. Amplifikationserfolg

Kontaminierende Klone in %

60

80

100

Amplifikationserfolg in %

SZA23 1

KRE2

HAL1

DEB4

ASP2

DEB1

HAL3

CHE4

HAL2

SZA23 2

FLO4

UNS2

FLO6

DON1

SCHWE4

DUD2

VAI3

SEE1

DEB5

SCHWE2

KRE1

BRU4

SCHWE1

LEB1

DEB3

DEB2

20

40

Individuen

Abbildung 23. Anteil der kontaminierenden Klon-Sequenzen im Vergleich mit dem


durchschnittlichen Amplifikationserfolg der erfolgreich typisierten Proben aus den vier kurzen
Fragmenten I-IV.

117

Ergebnisse

6.1.3 Untersuchungen zur Diagenese mittels SAXS-Analyse


Die Ergebnisse der SAXS-Analyse sind in Abbildung 24 und 25 dargestellt.

eta vs. T
0,0600
UNS 1,1
SZA23 2B

0,0500

SPI3,3
KR2,2

0,0400

DK4,2

eta

SWI6A
0,0300

LEB1A
DR1,3
DR2,3

0,0200

BAD2,2
SCHWE4

0,0100

SEE1
SON1
DON1C

0,0000
3

3,5

4,5

5,5

MHS 1

Dicke T in nm

Abbildung 24. Ergebnisse der SAXS-Analyse. Das Punktediagramm zeigt die paarweisen Werte fr
den Index der Kristallstruktur (Y-Achse) sowie die Dicke der Kristalle (X-Achse). Farbig dargestellt
sind die Ergebnisse von untersuchten neolithischen Proben (Dreiecke), sowie bronzezeitliche und
mesolithische Proben (Kreise). Das rote Quadrat entspricht der Referenzprobe eines modernen
menschlichen Knochens (MHS).

eta vs. T Rind und Mensch


0,060

0,050

eta

0,040

0,030

0,020

0,010

0,000
2

2,5

Mensch
Rind
Rind moderne Referenz jung

3,5

4,5

5,5

Dicke T in nm

Mensch moderne Referenz


Rind moderne Referenz alt

Abbildung 25. Ergebnisse der SAXS-Analyse im Vergleich mit Rinderproben.

118

Ergebnisse

6.2 Untersuchte genetische Marker


6.2.1 Mitochondriale DNA
6.2.1.1 Hypervariable Region I (HVR I)
Alle Ergebnisse der mitochondrialen Sequenzanalyse wurden nach dem in Abbildung 17
gezeigten Reproduktionsschema erstellt. Eine Ausnahme stellte die Probe SCHWE 5 dar, fr
die versuchsweise ein umgekehrter Ansatz verfolgt wurde, nmlich eine Reproduktion der
Sequenzen ber Direktsequenzierung mehrerer unabhngiger PCR-Produkte. Von 29
Individuen (inklusive SCHWE 5) konnte in 27 Fllen an Hand konsistenter Basenaustausche
in den Klonsequenzen eine eindeutige Bestimmung der Haplogruppe im Sinne der
Kategorisierung gem angewendeter Authentizitts- bzw. Reproduktionskriterien nach
Abbildung 19 durchgefhrt werden (Tabelle 18). Die Haplogruppenbestimmung der 27
bestimmbaren Proben (inklusive der unsicheren Proben (BRU4, DEB2, UNS2) ergab 24
unterschiedliche Haplotypen (Tabelle 19). Die vier berlappenden Primersysteme zur
Analyse der HVR I Kernregion (Kap. 5.2.4.3.1) und der anschlieenden Sequenz im Bereich
der Nukleotidpositionen 15997-16409 lieen sich aus 63% aller aDNA-Extrakte amplifizieren.
Im Rahmen dieser Arbeit wurden insgesamt 2434 Klone von 26 Individuen (ohne SCHWE5)
sequenziert. Die Alignments aller Sequenzen der untersuchten Proben sind im Anhang
aufgefhrt (Kap. 10.5).
Bei zwei Individuen (DUD1, DON2) konnten massive Kontaminationen festgestellt werden.
Die Ergebnisse dieser Proben wurden verworfen, da in beiden Fllen gleich mehrere Linien,
d.h. Haplotypen in den Klonsequenzen beobachtet werden konnten.
Die zum laborinternen Abgleich verwendeten entsprechenden Sequenzabschnitte aller
typisierten Bearbeiter der neolithischen Proben sowie der Mitarbeiter der Arbeitsgruppe sind
anonymisiert in Tabelle 10.1 und 10.2 im Anhang aufgefhrt.

Tabelle 28. Kategorisierung der Sequenzdaten der Individuen hinsichtlich der Authentizitts- bzw.
Reproduktionskriterien.
Kategorie
1
2
3
4
5
6
7

Individuen
ASP2, DEB1, DEB4, HAL1, KRE2, SZA23 1
CHE4, DEB5, HAL2, HAL3, KRE1, SCHWE1, SCHWE5, SEE1, SZA23 2, VAI3
DEB3, DON1, FLO4, FLO6, LEB1
DEB2, DUD2, SCHWE4
BRU4, SCHWE2, UNS2
DON2, DUD1

Eine detaillierte Errterung der einzelnen Proben im Hinblick auf die Authentizitt der
Ergebnisse erfolgt in einer Gesamtbetrachtung aller Teilergebnisse (Probengeschichte,
Amplifikationserfolg, Substitutionsrate, Sequenzierung der HVR I, RFLP-Analyse, STRTypisierung usw.) in der Diskussion (Kap. 7.2).

119

Ergebnisse

Tabelle 19. Reproduzierte Ergebnisse der Sequenzanalyse und Haplogruppenbestimmung.


Aufgefhrt sind die abweichenden Positionen im Bereich der HVR I von Nukleotidposition 1599716409. Unsichere/Rekonstruierte Bestimmungen sind kursiv gezeichnet. Bei der Bestimmung der
Haplogruppen wurden die Ergebnisse der RFLP-Analyse bereits mit einbezogen. Die reproduzierten
Ergebnisse der Arbeiten von Brandt (2005) und Tnzer (2005) sind grau dargestellt.
Krzel
ASP2
BRU4
DEB1
DEB2
DEB3
DEB4
DEB5
EIL1
FLO1
FLO2
FLO3
FLO4
FLO5
FLO6
HAL1
HAL2
HAL3
SCHWE1
SCHWE2
SCHWE4
SCHWE5
SEE1
UNS2
UWS2
UWS5
VAI3
DBK1
DKF1
ECS1
END119 1
END6 1
END6 2
SZA23 1
SZA23 2
SZA23 3
SZA8 1
SZA8 2
DON1
KRE1
KRE2
DUD2
CHE4
LEB1

HVR I Sequenz
CRS
16192.T 16256.T 16270.T 16362.C
16147.A 16172.C 16223.T 16248.T 16355.T
16224.C 16311.C
16147.A 16172.C 16223.T 16248.T 16320.T 16355.T
16311.C
16311.C
CRS
16147.A 16172.C 16223.T 16248.T 16320.T 16355.T
16093.C
16311.C
16126.C 16294.T 16304.C
16224.C 16311.C
16224.C 16249.C 16311.C
16298.C
16086.C 16147.A 16172.C 16233.T 16248.T 16320.T 16355.T
16093.C 16126.C 16294.T 16296.T 16304.C
16126.C 16294.T 16296.T 16304.C
16126.C 16292.T 16294.T 16296.T
16286.T 16304.C
16126.C 16294.T 16296.T
16069.T 16126.C
16223.T 16292.T
16224.C 16249.C 16311.C
16129.A 16147.A 16154.C 16172.C 16223.T 16248.T 16320.T 16355.T
16319.A 16343.G
16294.T 16296.T
16069.T 16126.C
16147.A 16172.C 16189.C 16223.T 16248.T 16274.A 16355.T
16224.C 16311.C
CRS
CRS
16223.T 16257.A 16261.T
16129.A 16223.T 16311.C 16357.C 16391.A
CRS
16311.C
16129.A 16223.T 16362.C
16192.T 16270.T
16192.T 16270.T
16192.T 16270.T
16189.C 16270.T
16192.T 16256.T 16270.T 16294.T
16192.T 16241.C 16256.T 16270.T 16399.G

Haplogruppe
H*
U5a1
N1a
K*
N1a
HV*
HV*
H*
N1a
H*
HV*
T
K*
K*
V
N1a
T
T
T
H*
T
J*
W
K
N1a
U3
T
J*
N1a
K*
H*
H*
N9a
I
H*
HV*
D4a
U5b2
U5b2
U5b2
U5b1
U5a1
U5a

120

Ergebnisse

6.2.1.2 Amplifikation und RFLP-Analyse von Abschnitten der coding region


Die Primersysteme fr die zustzliche Amplifikation von bestimmten Abschnitten der
kodierenden Region des Mitochondriums, welche bei Proben mit nicht eindeutig
bestimmbaren Haplogruppen durchgefhrt wurden, lieen sich bei allen Proben erfolgreich
amplifizieren. Eine Analyse des Schnittmusters lie sich in allen fraglichen Fllen
durchfhren. Da diese zustzliche Analyse erst zum Ende der Arbeit hin durchgefhrt
wurde, war nicht mehr fr alle in Frage kommenden Proben gengend Extrakt und/oder
Probenpulver vorhanden, um alle Ergebnisse der RFLP-Analyse zu reproduzieren. In Tabelle
20 sind Ergebnisse der Verdaureaktionen zusammengefasst.

Tabelle 20. Ergebnisse des Verdaus mit diagnostischen Restriktionsenzymen Hinf I und Alu I. Der
Status einer Schnittstelle fr das jeweilige Enzym an den designierten Nukleotidpositionen (np) ist
durch + (vorhanden) bzw. (nicht vorhanden) gekennzeichnet. Beachte: n.d. = nicht durchgefhrt.

Probe
ASP2
DEB4
DEB5
EIL1
FLO2
FLO3
HAL1
SCHWE4
END6 1
END6 2
SZA23 3
SZA8 1
DON1
KRE1
KRE2
DUD2
CHE4
LEB1

np 12308 Hinf I
n.d.
n.d.
n.d.
+
+
+
+
+
+

np 7025 Alu I
+
+
+
+
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.

mgliche Haplogruppe
H*
Nicht H*, nicht U*
Nicht H*, nicht U*
H*
H*
H*
Nicht H*, nicht U*
H*
H*
H*
H*
Nicht H*, nicht U*
U*
U*
U*
U*
U*
U*

121

Ergebnisse

6.2.1.3 Amplifikation langer PCR-Produkte


Die Ergebnisse der Amplifikationen des Fragments V sind in Tabelle 21 dargestellt. Die
Haplogruppenbestimmung erfolgte wie bereits beschrieben (Kap. 6.2.1.1).
Tabelle 21. HVR I Sequenzen und Haplogruppenbestimmungen aller amplifizierten 440bp-langen
Fragmente. Sequenzen, die der Konsensus-Sequenz der kurzen berlappenden Fragmente
entsprachen, sind fett gedruckt. Sequenzen, die mit der des Bearbeiters identisch waren, sind kursiv
dargestellt. Sofern ein PCR-Produkt kloniert wurde, ist die Anzahl der Klone in Spalte 2 vermerkt.
Probe
BRU1
BRU1
BRU1
BRU4
CHE4a
CHE4b
DEB1
DEB1
DEB3a
DEB3a
DEB4a
DUD2b
END119 1b
END119 2b
FLO2a
HAL1b
HRX1
KRE1a
KRE1a
KRE2a
KRE2a
SEE3
SON6
SZA23 1a
SZA23 1b
SZA23 2b
SZA8 2b
TRE1
UNS2
UWS10
UWS2b
UWS4
UWS4
UWS4
UWS6
UWS8b
UWS9
VIE1

Klone
1

5
2
3
2
5
6

2
5
1

HVR Sequenz
16189C 16311C
16189C 16311C
16189C 16311C
16189C 16311C
16192T 16256T 16270T 16294T
16192T 16256T 16270T 16294T
16147A 16172C 16223T 16248T 16355T
16147A 16172C 16223T 16248T 16355T
16189C (16267T ?)
16189C
16126C 16163G 16186T 16189C 16221T 16294T
16189C
16041G 16311C
16140C 16189C 16243C
16223T 16290T 16294T 16319A 16362C
CRS
16311C
16192T 16270T
16192T 16270T (16378T)
16192T 16270T
16192T 16270T
16309G
16172C 16223T 16227G 16278T 16292T 16362C
16223T 16257A 16261T
16223T 16257A 16261T
16129A 16223T 16311C 16357C 16391A
(16093C) 16129A 16223T (16249C) 16362C
16207G 16233T 16381C 16390A
16189C 16311C
16126C 16189C 16294T 16296T
16108T 16129A 16162G 16172C 16304C
16069T 16126C
(16223T) 16256T (16258G) 16270T (16399G?)
16256T 16270T (16399G)
16189C
16069T 16126C
16126C 16189C (16259T) 16294T 16296T
16189C 16311C

Hg
H*
H*
H*
H*
U5a
U5a
N1a
N1a
H*
H*
T1?
H*
B5b
I/A
H*
H*/HV
U5b2
U5b2
U5b2
U5b2
H*
W
N9a
N9a
I
D4a
?
H*
T
F
J
U5
U5
H*
J
T
H*

122

Ergebnisse

6.2.2 Nuklere DNA

6.2.2.1 Short tandem repeat (STR) Genotypisierung mittels AmpFlSTR Profiler


Plus
In Tabelle 22 ist eine Auswahl von neun erfolgreich reproduzierten typisierbaren Individuen
dargestellt. Aus dieser wird ersichtlich, dass bei diesen neun Individuen eine STRGenotypisierung mehrerer loci reproduzierbar durchgefhrt werden konnte, was einem
allgemeinen Genotypisierungserfolg von ~17% entsprach. Keine der Proben ergab eine
vollstndige Genotypisierung aller loci des Multiplexsystems. Lediglich bei der ungarischen
Probe SZA23 1 konnten bis auf D18S51 alle loci erfolgreich typisiert werden. Die brigen acht
Proben lieen sich vor allem im Bereich der krzeren Marker bis 200-250bp erfolgreich
typisieren. Die autosomalen loci D13S317, FGA, D7S820 und D18S51, deren Allele in diesem
Multiplexsystem einer Produktlnge bis zu 341bp entsprechen, konnten nicht erfolgreich
amplifiziert werden. Die Ergebnisse aller einzelnen Typisierungen sind in Tabelle 10.3 im
Anhang aufgefhrt. Hufig zeigte die Mehrzahl der untersuchten Proben eine Bande auf
dem Agarosegel im erwarteten Lngenbereich von 107-341bp, die sich jedoch nach der
sensitiven Analyse durch die Kapillar-Elektrophorese (Kap. 5.2.10) in den meisten Fllen als
Artefakte der Multiplexreaktion herausstellten, da diese nicht einem Allel der mitgefhrten
Allelleiter entsprachen. Es konnte ebenso beobachtet werden, dass mehrheitlich nur ein Allel
von einem oder wenigen Genorten der Multiplex bestimmt werden konnte. Damit konnte
ein hoher Anteil an allelic dropout, d.h. ein durch die Degradierung und Fragmentierung der
DNA bedingter Ausfall von erwarteten Allelen, festgestellt werden.
Die Kontaminationsrate der PCR-Anstze mit dem AmpFLSTR Profiler Plus Kit war mit
~0,8% sehr niedrig. So zeigten nur zwei Reaktionen der insgesamt 260 Leer-, Extraktionsund Tierkontrollen eine Bande auf dem Agarosegel. In beiden Fllen konnten durch die
Kapillarelektrophorese auch hier nur Artefakte nachgewiesen werden.
Ein Beispiel eines Elektropherogrammes anhand der Probe HAL2 ist in Abbildung 26
gezeigt.

123

Ergebnisse

Abbildung 26. STR-Genotypisierung der Probe HAL2 mittels AmpFLSTR Profiler Plus. Die
Produkte der neolithischen Probe sind orange dargestellt; die Farben der Allelleitern in den einzelnen
panels entspricht den jeweiligen Fluoreszenzfarbstoffen, wobei im Fall der loci D5S818, D13S317 und
D7S820 gelb durch grau ersetzt wurde. Das Elektropherogramm zeigt beispielhaft die stete Abnahme
der peak-Hhe der einzelnen PCR-Produkte bei gleichzeitig steigender Produktlnge (obere Skala ~
Lnge in bp). Die Allele der loci FGA, D21S11 und D13S317 sind nur noch sehr schwach zu erkennen.

124

Ergebnisse
Tabelle 22. Ergebnisse der STR-Genotypisierung mittels AmpFLSTR Profiler Plus ausgewhlter
Proben. Die Zusammenfassung der einzelnen Typisierungen zum Konsensus-Genotyp ist jeweils grau
hinterlegt. Die Ergebnisse aller Typisierungen finden sich in Tabelle 10.3 im Anhang. Die typisierten
loci (Spalten 4-13) sind entsprechend ihres Lngenbereichs sortiert. Allele in Klammern weisen auf
eine peak-Hhe t 10 % des Schwesterallels bzw. auf unsicheren oder generell schwachen Nachweis
hin. Beachte: ld = locus dropout.

Probe Extrakt PCR

Amel

D3S1358

D8S1179 D5S818

DEB1

NG8

N16.18 X

17

DEB1

NG8

N17.1 X

(14)/15/(17)/18 13

DEB1

NG8

N20.15 X

DEB1

NH

N16.1

DEB1

NM5

N79.2 X

16/17

DEB1

NM5

N80.2 X

18

17

DEB1

Artefakte

D21S11 D13S317

FGA

D7S820 D18S51

13/14
14

DEB3a NG10 N17.3

(14)/(17)/18

DEB3a NG10 N20.17 X

(17)/18

DEB3a NG10 N26.5

13
14

13

31.2/32.2 11/12/13

7-2

9
11/13

12

11

12

11/13

12

11/13

12

N16.3 X

DEB3a NH3

N26.4 X

17/18

DEB3b NK4

N47.4 X

(17)/18

DEB3b NK4

N46.4 X

18

(10)/11

12

(17)/18

11/13

12

12
14
14

DEB3a NH3

DEB3

vWA

(16)/17
(16)/17

DEB4a NC

N11.13 X/Y

18/19

13/14

11/13

16/17

(30)

9/(12)

DEB4a NC

N13.3 X/Y

18/19

13/14

11/13

16/17

(29/30

9/(12)

(24)

(10)

DEB4a NF

N12.3 X/Y

18/19

13/14

13

16/17

(30)

(23)

(10)

DEB4a NF3

N26.10 X/Y

18/19

13/14

11/13

16/17

DEB4b NK5

N47.5 X/Y

18/19

13

16/17

DEB4b NK5

N46.5 X/Y

18/19

13/14

13

X/Y

18/19

13/14

(11)/13 16/17

(10)

DEB4

HAL2a NK7

N47.7 X/Y

16/18

8/13

12

(15)/16/18 (28)/30

(11)

(24)

HAL2a NK7

N46.7 X/Y

16/18

8/13

12

16/18

28/30

(9)

(21)/24

HAL2b NL9

N64_19 X/Y

16/18

8/13

12

16/18

28/30

10/(12)

HAL2b NL9

N64_9 X/Y

16/18

8/13

12

16/18

28/30

X/Y

16/18

8/13

12

16/18

28/30

HAL2
KRE1a NJ13

N19.13 X

16/17

11/15

11/12

15/16

KRE1a NJ13

N20.4 X

(15/16/17)

11/15

12

15/16

29

21

KRE1a NJ13

N26.9 Y?

16/17

11/15

12

(15)/16

(28)

(14)

KRE1a NM12 N79.4 X

16/17

11/15

(12)

16

28/29

KRE1a NM12 N80.4 X

16/17

11/(15)

(12)

16

28/29

KRE1b ND4

N15.3

KRE1b ND4

N26.7 X

(10)/(14)/16 13

KRE1b NG3

N14.3

11/12

KRE1b NG3

N26.6 X

KRE1

21

21
(21)
(20)
(13)

21

28/29

16/17

11/15

12
24

12

(15)/16

28/29

(21)

125

Ergebnisse
Tabelle 22. Fortsetzung.
Probe Extrakt PCR Amel

D3S1358

D8S1179 D5S818

KRE2a

NJ14

N19.14 X/Y 15/17

(13)/14/(15) 11/12

KRE2a

NJ14

N20.5 X/Y 15/17

9/14

11/12

KRE2a

NJ14

N26.10 X/Y 15/17

9/14

11/12

KRE2a

NM11 N79.3 X/Y 15/17

(14)

KRE2a

NM11 N80.3 X/Y 15/17

(14)

KRE2b

NK14 N47.14

KRE2b

NK14 N46.14

KRE2

(11)

(14)/15

vWA

D21S11

D13S317

FGA

D7S820 D18S51

15/16
28
16/18

10/14

20

(28)

16

28

16/18

28

(19)/20

19

Artefakte

9/(13)/14
X/Y 15/17

9/14

11/12

16/ld

28

SZA23 1a NN1

N79.6 X/Y 14

13/14

11

14/16

26/29.2/30 11/13

SZA23 1a NN1

N80.6 X/Y 14

13/(14)

(11)

14/16

26/(29.2-30) 11+2/13+2 22/23

(7/8)

SZA23 1b NO1

N81.1 X/Y 14/19

13/14

11

14/16

26/30

11+2/13+2 22/23

7/8

SZA23 1b NO1

N82.1 X/Y 14

13/14

11

14/16

26/29.2+

11+/13+

22/23

(7/8)

SZA23 1b NO1

N204.1 X/Y 14

13/14

(10)11 14/16

26/30

12/14

SZA23 1b NO1

N219.1 X/Y 14

13/14

11

14/16

26

X/Y 14

13/14

11

14/16

26/(30)

11/13

22/23

7/8

18/19

(30)h

11/(12)

(21)

(12)h

(21)h

SZA23 1
SZA23 2a NN2

N79.7 X

15

12

11/13

SZA23 2a NN2

N80.7 X

15/17

12

11

SZA23 2a NN2

N203.1 X

15/17

SZA23 2a NN2

N218.1

SZA23 2b NO2

N81.2 X

17

SZA23 2b NO2

N82.2 X

15/17

12

SZA23 2b NO2

N204.2 X

(14)15

SZA23 2b NO2

N219.2 X/Y 14

13/14

(10)/11 12/14/16 26/30

(8)/12

11

ld/19
14/17

SZA23 2

15/17

11
(11)/12

18/19

8/(10)/13

(19)
11

22/23

7/8

19

N79.8 X/Y 15/17

13/(14)

12/13

SZA23 3a NN3

N80.8 X/Y 15/17

13/14

12/(13) 14/17

SZA23 3a NN3

N203.2 X/Y 15/17

13/14

12/13

(13)14/17 28/29

SZA23 3b NO3

N81.3 X/Y 15

13/14

12/13

14/17

28/28.2-29 11

20

(16)

SZA23 3b NO3

N82.3 ld/Y 15/17

13/14

14/17

28

(9)/10+2

20+

(9)

SZA23 3b NO3

N204.3 X/Y 15

21

X/Y 15/17

(12/15)

15/16

SZA23 3a NN3

SZA23 3

(12/15)

28
28/29

13/14

13

14/17

13/14

12/13

14/17

28/(29)

20+2/\21-2
-

(20)

126

Ergebnisse

6.2.2.2 Short tandem repeat (STR) Genotypisierung mittels Anthrofiler 2004


Bei fnf ausgewhlten Proben (DEB3, DEB4, HAL2, KRE1, KRE2) konnten mehrere loci des
Multiplexansatzes Anthrofiler 2004 wiederholt erfolgreich amplifiziert werden.
Kontaminationen der Kontrollen wurden keine festgestellt. Eine Zusammenfassung aller
Typisierungen ist in Tabelle 23 gezeigt.

Tabelle 23. Ergebnisse der STR-Genotypisierung mittels Anthrofiler 2004. Die Zusammenfassung
der einzelnen Typisierungen zum Konsensus-Genotyp ist jeweils grau hinterlegt. Die typisierten loci
(Spalten 2-9) sind entsprechend ihres Lngenbereichs sortiert. Allele in Klammern weisen auf eine
peak-Hhe t 10% des Schwesterallels bzw. auf unsicheren oder generell schwachen Nachweis hin.
Beachte: ad = allelic dropout, af = Artefakte.
Probe

Amel

TPOX

DYS434

D13

DEB3a
DEB3a
DEB3a
DEB3a
DEB3b
DEB3b
DEB3
DEB4a
DEB4a
DEB4a
DEB4a
DEB4b
DEB4b
DEB4
HAL2a
HAL2a
HAL2b
HAL2b
HAL2
KRE1a
KRE1a
KRE1b
KRE1b
KRE1
KRE2a
KRE2a
KRE2b
KRE2b
KRE2

af
af
af
af
af
af

8/11
8/11
8/11
8/11
11
8
8/11
8
8
8
8
8
8
8
8/11
8/11
8/11
8/11
8/11
8
8

11
af
11
af
af
af

9/13
9/13
9/13
13
13
13
(9)/13
9/12
9/12
9/12
9/12
9/12
9/12
9/12
9/11
9/11
9/11
9/11
9/11
13/14
11/13

X/Y
X/Y
X/Y
X/Y
X/Y
af
X/Y
ad/(Y)
X/Y
X/Y
ad/Y
X/Y
af/(Y?)
af
af
af
af
af
af
af

8/9
8/9

9
9
9
9
9
af
9
9
9
9
9
9
af
af
af
af
af
af
af
af

Y-GATA

STRX1

CSF1

13.3?
13.3
13

10
10
10
10
10
10
11
11
11
11
11

(13)
10/14
10/14

HPRTB
13
af

13
13
13
13
13
13
13
14
14
14
14
14
14/15
14/15

13.3

13.3
13.3
13.3
13.3
13.3
13.3

(11/12)
11

af
10
10

13
13

13.3

(11/13)

In der hochauflsenden Kapillar-Elektrophorese (Kap. 5.2.10) zeigte sich, dass einige


Primersysteme im Multiplexansatz vermehrt Artefakte bildeten. Dies betraf vor allem die der
loci Amelogenin und DYS434, welche jeweils in drei von fnf Fllen nicht typisiert werden
konnten (siehe auch Abbildung 27). Weiterhin konnte bei Individuum HAL2, allelic dropout
bei Amelogenin festgestellt werden, wenngleich die lngeren Produkte der brigen loci
eindeutig und reproduzierbar bestimmt werden konnten.

127

Ergebnisse
Da insgesamt festgestellt wurde, dass der Multiplex-Ansatz Anthrofiler 2004 im Vergleich
mit AmpFlSTR Profiler Plus Kit keine wesentlichen Vorteile bietet, wurden keine
weiteren Versuche mit dem Anthrofiler 2004 durchgefhrt.

Abbildung 27. STR-Genotypisierung der Probe DEB4 mittels Anthrofiler 2004. Die Farbgebung
der peaks der PCR-Produkte ist an die entsprechenden Fluoreszenzfarbstoffe der loci angelehnt. Die
Allelleiter ist orange wiedergegeben (fr DYS391 lag zum Zeitpunkt der Untersuchung keine
Allelleiter vor). Das Elektropherogramm zeigt die erfolgreiche Amplifikation aller loci auer CSF1.
Einige Systeme bildeten jedoch im Multiplexansatz vermehrt Artefakte, wie vor allem im Bereich von
Amelogenin, DYS434 und Y-GATA zu sehen ist.

128

Ergebnisse

6.2.2.3 Vergleich zwischen morphologischer und genetischer Geschlechtsbestimmung


In neun Fllen, in welchen eine Bestimmung des Geschlechts molekulargenetisch mglich
war, konnte das Ergebnis mit der morphologischen Geschlechtsbestimmung abgeglichen
werden, sofern diese am Skelett ermittelt werden konnte. Der Vergleich beider Methoden ist
in Tabelle 24 zusammengefasst. Es konnte festgestellt werden, dass beide Methoden in allen
vergleichbaren Fllen bereinstimmten. Zudem konnten durch die Kombination beider
Methoden morphologisch nicht absolut entscheidbare Flle wie z.B. DEB1 und DEB3 in ihrer
Tendenz besttigt werden. Da beim Multiplex-Ansatz des Anthrofiler 2004 besonders
beim Marker Amelogenin hufig Artefakte zu beobachten waren, erfolgte die
Geschlechtsbestimmung in erster Linie durch Kombination der gonosomalen Marker
HPRTB, DYS434, Y-GATA und STRX1 (Kap. 5.2.4.4.2). Das bedeutete fr Proben von
weiblichen Individuen mgliche Heterozygotie bei X-chromosomalen Systemen und ein
Negativnachweis (Nichtamplifikation) von Y-chromosomalen Markern. Fr mnnliche
Proben waren der Nachweis von Y-chromosomalen Markern sowie der Status fr Xchromosomale Marker erforderlich.

Tabelle 24. Vergleich der genetischen und morphologischen Geschlechtsbestimmung.


Beachte: nd = nicht durchgefhrt.
Individuum AmpFlSTR Profiler Plus Anthrofiler 2004
Amelogenin

Morphologische
Geschlechtsbestimmung

DEB 1

nd

wahrscheinlich weiblich

DEB 3

X?

wahrscheinlich weiblich

DEB 4

X/Y

X/Y

mnnlich

HAL 2

X/Y

X/Y

mnnlich

KRE 1

X?

weiblich

KRE 2

X/Y

X/Y?

mnnlich

SZA23 1

X/Y

nd

mnnlich

SZA23 2

nd

weiblich

SZA23 3

X/Y

nd

mnnlich

129

Ergebnisse

6.3

Quantifizierung und Charakterisierung der postmortalen


Sequenzvernderungen

6.3.1 Allgemeine post mortem Substitutionsrate


In Abbildung 28 sind die Substitutionsraten Sind aller erfassten Individuen dargestellt. Die
durchschnittliche post mortem Substitutionsrate Sind aller erfasster Individuen lag bei 13,08.
Hierbei wurden auch die Sequenzen der erfolgreich reproduzierten Proben der Arbeiten von
Brandt (2005) und Tnzer (2005) einbezogen. Die zugrunde liegenden Werte der einzelnen
Fragmente (Spcr)sind in Tabelle 10.4 im Anhang aufgefhrt.

Substitutionsrate

25

20

15

10

FLO5
SZA8 1
SZA8 2
CHE4
SEE1
FLO2
UWS5
LEB1
END6 1
END6 2
UWS2
FLO4
SZA23 1
SZA23 3
HAL2
KRE1
KRE2
DKF1
ESC1
SZA23 2
FLO1
DEB1
DEB3
END119
HAL3
DBK1
FLO3
DON1
HAL1
FLO6
SCHWE4
DEB4
DEB5
VAI3
EIL1
SCHWE2
ASP2
SCHWE1

Individuen

Abbildung 28. Post mortem Substitutionsraten Sind der untersuchten neolithischen Individuen. Die
Proben wurden nach Hhe der Substitutionsrate (in ) angeordnet. Die Individuen der integrierten
Abschlussarbeiten von Brandt (2005) und Tnzer (2005) sind in hellerem Grauton abgesetzt.

Fr die einzelnen berlappenden Fragmente, die zur Amplifikation der HVR I verwendet
wurden, wurde ebenfalls eine Substitutionsrate (Sfrag) ermittelt. Die Ergebnisse sind in
Abbildung 29 dargestellt. Hierbei lie sich eine auffllige Tendenz der Zunahme an
Substitutionen bei gleichzeitiger Abnahme der Produktlnge des Fragments feststellen. Eine
Interpolation dieser Daten ergab eine Zunahme der Substitutionsrate um 1,66 pro
Abnahme der Produktlnge um 10bp.
Somit lie sich zusammenfassend feststellen, dass bei der Verwendung von krzeren
Fragmenten zwar der Amplifikationserfolg erhht wurde (vgl. Kap. 6.1.1), jedoch
gleichzeitig die Zunahme von post mortem Substitutionen beobachtet werden konnte.

130

Ergebnisse

Substitutionsrate der einzelnen Fragmente

20

18,90
17,36

18
16

14,02

14

16,79

14,59

12,70

12
10

8,88

8
6
4
2
0
187bp

179bp

162bp

162bp

141bp

133bp

126bp

III

IV

II

IIk

IIIk

Ik

Fragmente

Abbildung 29. Substitutionsrate der einzelnen Fragmente I-IV und deren krzere Alternativen (Ik,
IIk, IIIk). Die Fragmente sind nach der jeweiligen Produktlnge sortiert.

131

Ergebnisse

6.3.2 Sttigungsrate
Die Werte der Sttigungsrate Spcr fr die einzelnen PCR-Produkte sowie fr die Individuen
sind in der nachfolgenden Tabelle 25 aufgefhrt.

Tabelle 25. Sttigungsrate Spcr der Fragmente I-IV sowie arithmetischer Mittelwert der
betreffenden Proben. Angaben von zwei bzw. drei Werten pro Spalte eines Fragments beziehen sich
auf unabhngige PCR-Produkte aus unterschiedlichen Extraktionen.
Individuum
ASP2
SEE1
HAL3
HAL2
HAL1
DEB3
DEB4
DEB5
FLO4

I
0,6364
0,3000
0,5000

0,6364
0,7500
0,8000
0,6250
0,6667
0,2500
0,2500

Sttigungsrate der einzelnen Fragmente


IIa
II
IIIa
III
0,7778
0,8333
0,4167
0,0909
0,6429
0,6250
0,6667
0,8000
0,6667
0,5556
1,0000
0,7273
0,4545
0,8000
1,0000
0,7143
1,0000
0,8182
0,6667
0,8750
0,7778
0,3000
0,5000
0,6667
0,6667
0,4167
0,5833
0,6667
0,4545
0,7273

SCHWE1

0,7273
0,6000
0,5000

SCHWE2
DON1

0,4167
0,4286

KRE1
KRE2

0,3333
0,6667
0,9091

CHE4
LEB1
VAI3
FLO5

0,2727
0,5714
0,6000
0,2857

0,4545
0,5000
0,8000

FLO2
FLO6

0,5000
0,3333
0,3333

0,6667
0,2500
0,6000

SCHWE4

0,4000

0,8750

UWS5

0,5000
0,2500

0,8333
0,4000
0,6000

DEB1

0,5556

0,2857
0,6667
0,3636
0,5000

0,3636

0,8571
0,1667
0,5000
0,4286

0,7778

0,1667

0,9000

0,2500

0,5556

0,3000

0,3636

0,3333
0,0909
1,0000
0,4000
0,4444
0,2000
0,8000
0,1667
0,5714
1,0000
0,1818
1,0000
0,8750
1,0000

IV
0,6667
0,5455
1,0000
0,4615
0,6000
0,5556
0,8333
0,7500
0,5714
0,7778
0,7778
0,9167
0,3846
0,2000
0,5833

Mittelwert
0,7285
0,3383
0,6518

0,2857
0,6667
0,4000
0,8750
0,4444
0,6000
0,6667
0,3750
0,5000
0,3333
0,6000
0,6667
0,1000
0,2500
0,5714
0,1429
0,7778

0,4898

0,6074
0,7196
0,8161
0,7620
0,7620
0,4526
0,6185

0,4201
0,5137
0,5451
0,4767
0,2879
0,6679
0,6167
0,2560
0,4289
0,6565
0,6142

0,6250
0,5000
1,0000

0,6583

132

Ergebnisse
Tabelle 35. Fortsetzung
Individuum
UWS2

I
0,5714
0,8571

Sttigungsrate der einzelnen Fragmente


IIa
II
IIIa
III
0,6250
0,7500
0,8000
1,0000

FLO1
FLO3

SZA8 1
SZA8 2
END119 1
END6 1
END6 2
ESC1
ESC1
DBK1
DKF1
SZA23 1
SZA23 2
SZA23 3
Mittelwert

0,5000
0,7000
0,3333
1,0000
0,2500
0,5000
1,0000
0,4545
0,7500
0,6000
0,7500
0,8571
0,2500
0,1250
0,1250
0,2500
0,8750
0,7143
0,5000
0,5000
0,5455
0,5000
0,4286
1,0000
0,6000
0,3750
0,5349

0,4000
0,8571
1,0000
1,0000
0,1667
0,4000
0,4286
0,7500
0,6667
0,8333
0,1667
0,7143
0,5000
1,0000
0,8000
1,0000
0,6250
0,6250
0,7500
0,4167
0,5455
1,0000
0,5000
1,0000
0,3750
0,6391

IV
0,6000
0,6250
0,7143
1,0000

Mittelwert
0,7821

0,8000
0,8000

0,1667
0,7778
1,0000

0,3556
0,8268

0,5000
0,1250
0,2857
0,7500
0,6000
0,2222
0,5714
0,5714
0,8750
0,6250
0,6000
0,7500
0,6667
0,8750
0,6667
0,6250
0,5000
0,4167
0,4167
0,5000
0,5000
0,5000
0,7143
0,6068

1,0000
0,5000
0,2500
0,1667
0,8182
0,5556
1,0000
0,8000
0,6250
0,1667
0,7500
0,4286
0,6000
0,7500
0,8750
0,6250
0,6250
0,5833
0,3000
0,6667
0,2857
0,5556
0,4286
0,5884

0,5060

0,8750
0,7500
1,0000
1,0000

0,4726
0,6021
0,6616
0,5766
0,5541

0,7976
0,5938
0,4655
0,6101
0,5686

133

Ergebnisse

6.3.3 Charakterisierung und Verteilung postmortaler Sequenzvernderungen


Der zugrunde liegende Datensatz beinhaltete 2434 Sequenzen bzw. 285.859
Nukleotidpositionen. Zunchst wurden die jeweiligen Basenaustauschmglichkeiten auf
dem light strand des Bereichs np 15997-16410 einzeln quantifiziert. Die prozentualen Anteile
der mglichen Typen eines Basenaustausches sind in Abbildung 30 gezeigt. Die exakten
Werte hierzu bzw. die Aufschlsselung der einzelnen Fragmente finden sich in Tabelle 10.5
im Anhang.

Anteil d er einzelnen B asen austau sche


80%
75,68%
70%

60%

50%

40%

30%

20%
14,06%
10%
4,03%

3,98%
0,19%

0,42%

C >G

C >A

0,42%

0,14%

0,09%

0,00%

T >G

T >A

G >T

G >C

0,70%

0,28%

0%

C >T

T >C

G >A

A>T

A>G

A>C

Abbildung 30. Prozentualer Anteil der mglichen Formen der Basensubstitution.

Aus Abbildung 30 wurde ersichtlich, dass die Transition von Cytosin zu Thymin mit ~76%
die hufigste Form des Basensaustauschs darstellte. Darauf folgte die komplementre
Transition GaA mit ~14%. Die komplementren Transitionen TaC und AaG stellten mit
jeweils ~4% einen geringeren Anteil dar.
Transversionen bleiben deutlich unter 1%. Die theoretisch mgliche Transversion GaC
wurde nicht nachgewiesen.

134

Ergebnisse
Die anschlieende Einteilung in die von Hansen et al. (2001) erstellten Kategorien der
Transitionen und Transversionen, nach welchen fr die Transitionen vom Typ I bzw. II
jeweils nur eine biochemisch wahrscheinliche Substitution zugrunde liegt, ergab die in
Abbildung 31 gezeigte Verteilung. Die Typ II Transitionen, welche die komplementren
Substitutionen C/GaT/A beinhalten, stellten mit ~90% die hufigste post mortem DNAModifikation dar. Die Typ I Transitionen, welche die komplementren aber reversen
Substitutionen T/AaC/G umfassen, waren mit ~8% nur in geringerem Mae festzustellen.
Die Transversionen spielten mit insgesamt ~2% der post mortem Substitutionen eine
vernachlssigbare Rolle.

Verhltnis der Basenaustausch-Typen

Transversion
Purin-Pyrimidin

1,08%

Transversion
Pyrimidin-Purin

1,17%

8,01%

Transition Typ I

89,74%

Transition Typ II

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

Abbildung 31. Anteil der post mortem Substitutionen in den Kategorien der Transversionen und
Transitionen. Die Transition Typ I entspricht T/AWC/G und Typ II C/GWT/A.

Der Datensatz wurde auf die Transitionen des Typs I und II reduziert, um festzustellen, ob
innerhalb der untersuchten Region der mitochondrialen control region von np 15997-16409
Bereiche bzw. einzelne Positionen besonders oder weniger hufig mutierten. Bezglich der
Typ II Transitionen konnte festgestellt werden, dass mit jeweils einer Ausnahme (C an np
16040 und G an np 16273) alle anderen Nukleotidpositionen, die ein C bzw. G tragen
mindestens einmal deaminiert waren. Zunchst wurde geprft, ob die beobachteten
Hufigkeiten an C und G eine Normalverteilung aufwiesen. Die Nullhypothese H0, dass eine
Normalverteilung vorlag, konnte mit Hilfe des Kolmogorov-Smirnov-Anpassungstests auf
dem 95% Signifikanzniveau besttigt werden (pCytosin =0,483 und pGuanin = 0,608).

135

Ergebnisse
Auf der Basis dieses Datensatzes mit jeweils kombinierten Erwartungswerten fr die Typ I
und II Transitionen wurden diejenigen Nukleotidpositionen bestimmt, welche signifikant
hufiger bzw. weniger hufig postmortal ausgetauscht waren. Insgesamt konnten somit 39
hot spots und 17 cold spots definiert werden, wobei cold spots nur bei den sehr hufigen und
normalverteilten C und G Positionen festzustellen waren (Tabelle 26, Abbildung 32).
Anhand der Verteilung der hot spots lieen sich drei kurze Abschnitte herausstellen, die
besonders anfllig fr Deaminierungen waren. Bei allen drei Abschnitten handelte es sich
um poly-Nukleotid-stretches, d.h. um Bereiche in welchen eine Base gehuft hintereinander
vorkommt.
Zum einem betraf dies den Abschnitt np T16090-T16092-T16093-T16094, wo eine signifikante
Hufung von TaC auftrat, welches das benachbarte C an np 16095 ebenfalls beinhaltete,
wobei das Adenin an np 16091 nicht betroffen war.
Die zweite Hufung konnte im poly C-stretch von np 16184-16193 erkannt werden, wobei
neben den Cytosin-Positionen C16184- C16188 und C16190 auch das Adenin an np 16183
sowie das Thymin an np 16189 signifikant vom Erwartungswert E abwichen. Die
beobachteten Deaminierungshufigkeiten der brigen Cytosine in diesem poly C-stretch
lagen ebenfalls ber dem Erwartungswert E des Bereichs, waren jedoch nicht signifikant.
Der dritte Bereich mit signifikanter Hufung von Deaminierungen betraf ebenfalls einen
poly C-stretch. Dieser umfasste sechs Cytosine in Folge an np 16375-16380, wovon lediglich
Position C16380 nicht signifikant hufiger deaminiert war.
Eine Systematik im Verteilungsmuster der verbleibenden hot spots bzw. cold spots konnte
nicht festgestellt werden. Ein Abgleich mit bereits in der Literatur erwhnten putativen hot
spot Mutationen sowie eine detaillierte Errterung derselben erfolgt im Rahmen der
Diskussion (Kap. 7.1.7).

136

Ergebnisse

Tabelle 26. Hot & cold spots von np 15997 16410.


np

Y Mutationen

Y Linien

G16000

245

0,0041

7,1905

5,3296

0,0209666

T16002

245

0,0122

0,5649

10,4983

0,0011949

T16025

245

0,0122

0,5649

10,4983

0,0011949

G16033

245

0,0041

7,1905

5,3296

0,0209666

C16040

245

0,0000

7,1905

7,1905

0,0073291

T16090

258

0,0116

0,5948

9,7254

0,0018174

T16092

258

0,0116

0,5948

9,7254

0,0018174

T16093

258

0,0116

0,5948

9,7254

0,0018174

T16094

258

0,0116

0,5948

9,7254

0,0018174

C16095

19

258

0,0736

7,5720

17,2475

0,0000328

C16099

14

258

0,0543

7,5720

5,4568

0,0194927

G16106

258

0,0078

7,5720

4,1003

0,0428758

C16114

14

258

0,0543

7,5720

5,4568

0,0194927

G16118

560

0,0125

16,4354

5,4168

0,0199441

T16126

560

0,0071

1,2911

5,6837

0,0171228

C16133

26

560

0,0464

16,4354

5,5661

0,0183115

C16150

15

302

0,0497

8,8634

4,2487

0,0392800

T16172

302

0,0232

0,6963

57,0718

0,0000000

C16173

302

0,0099

8,8634

3,8788

0,0488995

A16183

302

0,0099

0,6963

7,6224

0,0057648

C16184

15

302

0,0497

8,8634

4,2487

0,0392800

C16185

16

302

0,0530

8,8634

5,7463

0,0165239

C16186

17

302

0,0563

8,8634

7,4694

0,0062755

C16187

22

302

0,0728

8,8634

19,4701

0,0000102

C16188

23

302

0,0762

8,8634

22,5471

0,0000021

T16189

302

0,0099

0,6963

7,6224

0,0057648

C16190

19

302

0,0629

8,8634

11,5927

0,0006621

G16196

302

0,0033

8,8634

6,9762

0,0082600

G16213

605

0,0083

17,7561

9,1641

0,0024681

C16221

35

583

0,0600

17,1104

18,7041

0,0000153

C16222

28

583

0,0480

17,1104

6,9304

0,0084742

T16224

583

0,0137

1,3441

32,9591

0,0000000

C16242

15

303

0,0495

8,8927

4,1943

0,0405604

G16244

303

0,0066

8,8927

5,3425

0,0208111

C16245

303

0,0033

8,8927

7,0052

0,0081274

T16249

303

0,0099

0,6986

7,5820

0,0058953

C16259

25

303

0,0825

8,8927

29,1748

0,0000001

C16260

15

303

0,0495

8,8927

4,1943

0,0405604

G16273

303

0,0000

8,8927

8,8927

0,0028631

C16282

303

0,0099

8,8927

3,9048

0,0481484

T16298

600

0,0083

1,3833

9,4559

0,0021047

G16303

576

0,0122

16,9050

5,8036

0,0159938

T16311

576

0,0156

1,3280

44,3231

0,0000000

G16319

576

0,0104

16,9050

7,0345

0,0079952

G16336

576

0,0069

16,9050

9,8515

0,0016970

G16346

576

0,0139

16,9050

4,6909

0,0303234

T16356

297

0,0135

0,6847

16,0514

0,0000616

C16366

297

0,0034

8,7166

6,8314

0,0089571

C16375

24

297

0,0808

8,7166

26,7971

0,0000002

C16376

17

297

0,0572

8,7166

7,8716

0,0050217

C16377

17

297

0,0572

8,7166

7,8716

0,0050217

C16378

17

297

0,0572

8,7166

7,8716

0,0050217

C16379

19

297

0,0640

8,7166

12,1317

0,0004957

C16394

15

297

0,0505

8,7166

4,5293

0,0333185

A16399

297

0,0101

0,6847

7,8285

0,0051430

T16406

297

0,0101

0,6847

7,8285

0,0051430

Dnp

Z2

137

138
Abbildung 32. Verteilung der hot und cold spot Positionen der Typ I und II Transitionen innerhalb
des Bereichs von np 15997-16409. Zugrunde liegt die prozentuale reduzierte, d.h. nur auf Typ I und II
bezogene, Deaminierungsrate Dnp der einzelnen Basen.
0

15997
16002
16007
16012
16017
16022
16027
16032
16037
16042
16047
16052
16057
16062
16067
16072
16077
16082
16087
16092
16097
16102
16107
16112
16117
16122
16127
16132
16137
16142
16147
16152
16157
16162
16167
16172
16177
16182
16187
16192
16197
16202
16207
16212
16217
16222
16227
16232
16237
16242
16247
16252
16257
16262
16267
16272
16277
16282
16287
16292
16297
16302
16307
16312
16317
16322
16327
16332
16337
16342
16347
16352
16357
16362
16367
16372
16377
16382
16387
16392
16397
16402
16407

Ergebnisse

Ergebnisse

6.4 Vergleichende Analysen der Haplogruppenverteilung


In die Analyse der Haplogruppenfrequenzen und deren Verteilung flossen die eindeutig
bestimmten Proben der begleitenden Arbeiten von Guido Brandt (2005) und Marc Tnzer
(2005) mit ein. Daraus ergab sich eine Stichprobe von 26 Individuen der LBK, einem
Individuum der AVK, 10 Individuen der Krs-Kultur und sechs Individuen der
Sammelkategorie Nordost (s.u.).
Da aus archologischer Sicht die Beziehung der LBK zur Krs-Kultur von
vordergrndigem Interesse ist (Kap. 2.3), wurde zunchst die Verteilung der bestimmten
Hgs auf der Ebene der assoziierten Kultur dargestellt (Abbildung 33).

LBK/AVK

Krs

Nordost

100
90
80
70
60
50
40
30
20
10
0
U3

N9a

D4a

H*

HV

N1a

U5

Abbildung 33. Anteil der Haplogruppen in den unterschiedlichen frhneolithischen Kulturen. Da


nur eine Probe der AVK-Kultur untersucht wurde und diese zudem kontemporr zur LBK zu sehen
ist, wurde diese zur Stichprobe der LBK zugeordnet. Die Stichprobe Nordost umfasst alle Proben
aus Litauen, Polen und Russland, die anderen Kulturstufen zuzuordnen sind. Es wurden nur
Haplogruppen aufgetragen, die innerhalb der neolithischen Stichprobe typisiert wurden (Die exakten
prozentualen Werte sind in Tabelle 10.6 im Anhang aufgefhrt).

Hierbei lieen sich einige Unterschiede zwischen den Kulturen bzw. Stichproben feststellen.
So fanden sich unter der kleinen Stichprobe von zehn Individuen zwei Haplotypen (N9a,
D4a), die heute nur in Asien vorkommen (s.u.). Demgegenber fanden sich unter der
Stichprobe LBK auffallend viele Individuen mit der Hg N1a, die nicht in der Krs-Kultur
auftraten. Die brigen Haplogruppen (J, H, HV, K und T) fanden sich sowohl in der LBK als
auch in der Krs-Kultur. Die Haplogruppen U3, U5, W und V waren jeweils einmal in der
LBK-Stichprobe vertreten. Alle sechs Individuen der Sammelkategorie Nordost zeigten
ausschlielich Haplotypen, die Hg U5 zugehrig sind.

139

Ergebnisse

LBK/AVK

Krs

Heutiges Gebiet

45
40
35
30
25
20
15
10
5
0
U3

N9a

D4a

H*

HV

N1a

U5

Abbildung 34. Verteilung der Haplogruppen der neolithischen Stichproben der LBK/AVK und der
Krs-Kultur mit dem auf heute bertragenen Verbreitungsgebiet. Es wurden nur Haplogruppen
aufgetragen, die innerhalb der neolithischen Stichprobe typisiert wurden (Die exakten prozentualen
Werte sind in Tabelle 10.6 im Anhang aufgefhrt).

Der Vergleich der Frequenzen der Haplogruppen der frhneolithischen Kulturen ist in
Abbildung 34 aufgetragen. Aus dem Vergleich der neolithischen Proben mit der heutigen
Situation innerhalb desselben Gebietes wurde ersichtlich, dass es sich sowohl bei der Hg N1a
der LBK-Stichprobe als auch bei den asiatischen Hgs N9a und D4a der Krs-Kultur um
Ausnahmen der jeweiligen Kulturen handelte (vgl. Kap. 3.3).
Zudem war eine Dynamik innerhalb der brigen Haplogruppen feststellbar. Am
deutlichsten lie sich diese an der Hg H festmachen, die innerhalb der LBK-Stichprobe mit
15,4% (vier Individuen), in der Krs-Kultur mit 30% (drei Individuen) und im heutigen
Gebiet mit 43% vertreten ist. Eine Zunahme der Frequenz war auch fr Hg J und U5
festzustellen, wenngleich der hhere Wert der Krs-Stichprobe (10%) durch die geringe
Stichprobenzahl (n=1) relativiert wird.
Dagegen zeigten die Hgs HV, K, T und I ein umgekehrtes Verhltnis, da diese bei beiden
frhneolithischen Kulturen hufiger zu finden waren als bei Individuen des heutigen
Referenzgebiets. Die Hgs V, W und U3 waren unter den Individuen der Krs-Kultur nicht,
dagegen in der LBK/AVK-Stichprobe jeweils einmal vertreten und bleiben auch im heutigen
Referenzgebiet unter einer Frequenz von 5%.
Auffallend war ebenfalls die relativ hohe Frequenz der Hg U5 (10,3%) im heutigen
Referenzgebiet, wohingegen Hg U5 nicht bei den Stichproben der Krs-Kultur und
lediglich einmal bei unter Individuen der LBK/AVK auftrat.
Der Vergleich der Haplogruppenfrequenzen der neolithischen Stichprobe mit den
Stichproben der Referenzgebiete A und B (vgl. Kap. 5.3) ist in Abbildung 35 dargestellt.

140

Ergebnisse
Hieraus wurde erneut ersichtlich, dass sich Hg N1a mit einer hohen Frequenz (14,3%) in der
neolithischen Gesamtstichprobe deutlich vom Referenzgebiet B des Nahen Ostens und des
Kaukasus und vom auf heute bertragenen Verbreitungsgebiet (A) der frhneolithischen
Kulturen abhebt. Weitere hhere Frequenzen in der neolithischen Stichprobe fanden sich bei
den Hgs K (11,9%), T (14,3%) und U5 (16,7%), wobei letztgenannte Hg, wie bereits erwhnt,
mit einer Ausnahme fr die untersuchten Proben der Region nrdliches Osteuropa stand.
hnlichkeiten zwischen der neolithischen Stichprobe und dem Referenzgebiet
Nahost/Kaukasus war bei den Frequenzen der Hg H und HV festzustellen. Hg H war in
beiden Stichproben deutlich weniger hufig (<25%) als im heutigen Gebiet der LBK/KrsKultur (> 40%), Hg HV jedoch zeigte mit ~9 % eine hhere Frequenz als in Referenzgebiet A.
Die Hgs J und T1, die von Richards (et al. 2000) als neolithisch datiert wurden (vgl. Kap.
3.2.2), waren in der neolithischen Stichprobe nur sehr gering (Hg J, 4,76%) bzw. gar nicht (Hg
T1) vertreten.
Die asiatischen Hg N9a und D4a der Stichprobe der Krs-Kultur waren in keiner der beiden
modernen Stichproben zu finden.

141

0%

5%

10%

15%

20%

25%

30%

35%

40%

45%

HV

Ref A LBK/Krs heute

N*

N1a

T*

T1

Ref B Nahost+Kaukasus

U*

U3

U5

Neolithikum

div

Ergebnisse

Abbildung 35. Vergleich der Haplogruppenfrequenzen der neolithischen Gesamtstichprobe mit


den entsprechenden heutigen Referenzgebieten in Europa und im Nahen Osten. (Die exakten
prozentualen Werte sind in Tabelle 10.7 im Anhang aufgefhrt).

142

Ergebnisse

6.5 Netzwerke
Im Folgenden sind die Netzwerke der einzelnen Haplogruppen fr fnf der sechs
neolithischen Proben HAL2, UWS5, ECS1 (alle N1a), VAI3 (U3), LEB1 (U5), SCHWE4 (H)
dargestellt, fr die keine 100%-ige bereinstimmung des Haplotyps in der Literatur
gefunden wurde (Abbildungen 36-39).
(Fr SCHWE4 wurde kein Netzwerk erstellt, da die entscheidende HVR I Mutation np 16304
innerhalb der sehr groen und hufigen Hg H eine wiederkehrende Mutationen darstellte
und daher auf dem Niveau der Sub-Hgs von H sowohl bei H1*, H5, H7 als auch H* zu
finden war (Loogvli et al. 2004) und die nhere phylogenetische Auflsung der Hg H zum
Zeitpunkt der vorliegenden Arbeit noch Gegenstand der aktuellen Forschung ist.)
Da die Hg N1a im Vergleich mit Rezentdaten der europischen Bevlkerungsgruppen durch
die hohe Frequenz aufgefallen war und zudem drei Haplotypen aufwies, die bislang
undokumentiert waren, wurde sie bei weiteren Untersuchungen in den Vordergrund des
Interesses gerckt. Aus dem Netzwerk von 101 N1a Haplotypen wurde ersichtlich, dass die
Hg N1a eine phylogeographische Verzweigung aufwies, die sich durch bestimmte
Mutationen voneinander unterscheiden lieen (Abbildung 36). So konnte ein afrikanischer
Zweig durch die charakteristische Position 16147G von dem europischen und dem
zentralasiatischen Zweig unterschieden werden, welche die Mutation 16147A aufwiesen. Der
zentralasiatische Zweig unterschied sich weiterhin durch die Position 19189C vom
europischen Haplotyp.
Alle neolithischen Individuen, mit Ausnahme des Individuums ECS1, waren im
europischen Zweig zu finden. Die Individuen HAL2 und UWS5 lagen auf bislang
undokumentierten aber vorhersagbaren Nodien. Die Individuen DEB1, DEB3 und FLO1
belegten die zentralen Nodien des Netzwerks.
Identische Haplotypen mit Individuum DEB1 fanden sich im modernen Datensatz bei einem
Individuum aus Armenien (Richards et al. 2000) und einem gypter (Krings et al. 1999). Der
Haplotyp der Individuen DEB3 und FLO1 fand sich insgesamt 13-mal bei Individuen aus
dem Iran (Richards et al. 2000, Metspalu et al. 2004), Turkmenistan (Quintana-Murci et al.
2004), der Slowakei (Koledov 2005), dem russischen Tschawasch (Bermisheva et al. 2004),
Russland (Richard Villems, persnl. Mitteilung), zwei Individuen aus Jemen (Kivisild et al.
2004) sowie fnf Individuen aus Estland (Sajantila et al. 1995, Richard Villems, persnl.
Mitteilung).

143

Ergebnisse

Abbildung 36. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg N1a
(umgezeichnet nach Haak et al. 2005). Die Kreis- bzw. Kreisausschnittsgren entsprechen
proportional den jeweiligen absoluten Hufigkeiten. Das Netzwerk lsst sich durch drei
phylogeographische Zweige beschreiben, welche farblich hervorgehoben sind. Der afrikanische bzw.
sdwestasiatische Zweig (grn) enthlt N1a Haplotypen, die durch np 16147G charakterisiert sind,
wohingegen der europische Zweig (blau) und dessen zentralasiatischer Zweig (orange) durch np
16147A definiert sind. Rck- sowie Parallelmutationen sind kursiv wiedergegeben. Die neolithischen
Proben sind rot dargestellt, wovon sich zwei der Proben (UWS5 und HAL2) auf bislang nicht
dokumentierten, aber vorhersagbaren Nodien befinden. Die Probe ECS der ungarischen AVK-Probe
ECS1 ist ebenfalls noch undokumentiert. N1a: Rhl et al. 2001, Villems, unpublished data; Estonian
Biocentre Database 2005, Kivisild et al 1999, Richards et al. 2000, Calafell et al. 1996, Brehm et al. 2003,
Baig et al. 2004, Bermisheva et al. 2002, Babalini et al. 2005, Derenko et al. 2003, Forster 1996, Helgason
et al. 2001, Kivisild et al. 2004, Koledov 2005, Krings et al. 1999, Knight et al. 2003, Lahermo et al.
2000, Metspalu et al. 2004, Mountain et al. 1995, Opdal et al. 1998, Passarino et al. 2002, Pakendorf et
al. 2003, Poetsch et al. 2003, Pfeiffer et al. 1999; 2001, Pereira et al. 2000, Quintana-Murci et al. 2004,
Ricaut et al. 2004, Sajantila et al. 1995, Tambets et al., 2000, Watson et al. 1997,
http://www.ncbi.nlm.nih.gov/Genbank/index.html. 2005.

144

Ergebnisse
Durch das Netzwerk der Haplotpyen der Hg N9a (Abbildung 37) konnte gezeigt werden,
dass der Ht 16223 16257A 16261 des neolithischen Individuums SZA23 1 der Krs-Kultur
der zentralen Nodie des Netzwerkes entspricht. Die weitgehend sternfrmige Struktur des
Netzwerks wies zudem auf eine vergleichsweise junge Expansion der Hg N9a ausgehend
von dieser zentralen Nodie hin. Die Koaleszenzzeitberechung fr das gesamte Netzwerk
ergab einen u-Wert von 1,75 und ein Alter von 35.315 Jahren mit einer hohen
Standardabweichung von 10.751 Jahren. Insgesamt konnten sieben Individuen gefunden
werden, die den identischen Haplotyp aufwiesen: drei Han-Chinesen (Yao et al. 2002b), eine
Usbeke (Quintana-Murci et al. 2004), ein Miao-Chinese (Wen et al. 2005) sowie ein Uighure
und ein Kirgise (beide Richard Villems, persnl. Mitteilung).

Abbildung 37. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg N9a. Die Kreisbzw. Kreisausschnittsgren entsprechen proportional den jeweiligen absoluten Hufigkeiten. Die
neolithische Probe SZA23 1 ist schwarz dargestellt. Die Mutationen entsprechen der CRS 16000
(Anderson et al. 1981). Die modernen N9a Haplotypen sind folgender Literatur bzw. Datenbanken
entnommen: Richard Villems, unpublizierte Daten; Estonian Biocentre Database, Kivisild et al. 2002,
Yao et al. 2002a; 2000b, 2004, Horai et al. 1996, Fucharoen et al. 2001, Behar et al. 2004, Quintana-Murci
et al. 2004, Wen et al. 2005, Tanaka et al. 2004.

145

Ergebnisse
Aus dem Netzwerk der Haplogruppe U3 aus 234 Haplotypen moderner Daten wurde
ersichtlich, dass das Individuum VAI3 eine abgeleitete Variante des zentralen und
heutzutage hufigsten Haplotypen 16343 darstellte (Abbildung 38). Dieser Ht 16343 stellt
auch die anzestrale Form der Hg U3 dar, von welcher sich VAI3 durch eine weitere Mutation
an np16319 unterschied. Das Netzwerk der Hg U3 zeigte eine sternfrmige Struktur, die
darauf schlieen lie, dass die Verbreitung der Hg U3 im Vergleich zu anderen Hg relativ
rezent erfolgte. Die Datierungen der Hg U3 sind in Tabelle 27 dargestellt.
Tabelle 27. Koaleszenzzeitberechnungen fr die Verbreitung der Hg U3.

Form (Mutationen)
Innerer Kreis (1)
uerer Kreis (2)
Gesamtes Netzwerk

[-Wert
0,51351
0,905
1,2009

Jahre
10362,7
18262,9
24233,6

Standardabweichung
0,15846
0,22875
0,25009

SA in Jahren
3197,72
4616,10
5046,87

Abbildung 38. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Haplogruppe U3.
Die Kreis- bzw. Kreisausschnittsgren entsprechen proportional den jeweiligen absoluten
Hufigkeiten. Die neolithische Probe VAI3 ist schwarz dargestellt. Die Mutationen entsprechen der
CRS 16000 (Anderson et al. 1981). Die modernen U3 Haplotypen sind folgender Literatur bzw.
Datenbanken entnommen: Villems, unpublizierte Daten; Estonian Biocentre Database, Richards et al.
2000, Babalini et al. 2005, Pfeiffer et al. 1999, Koledov 2005, Lutz et al. 1998, Poetsch et al. 2003,
Crespillo et al. 2000, Palanichamy et al. 2004, Maca-Meyer et al. 2001, Metspalu et al. 2004, Pereira et
al. 2000, Behar et al. ,Quintana-Murci et al. 2004, Brehm et al. 2003, Passarino et al. 2002, Kivisild et al.
2004, Al-Zahery et al. 2003.

146

Ergebnisse
Das Netzwerk der Haplogruppe U5 wurde innerhalb eines Parallelprojekts der
Arbeitsgruppe in Kooperation mit der Arbeitsgruppe des Estonian Biocentre erstellt.
Insgesamt wurden ~9300 Haplotypen der Hg U5 untersucht. In Abbildung 39 ist der
Ausschnitt der beiden Sub-Hgs U5a1 und U5a dargestellt. Aus dem Netzwerk wurde die
phylogenetische Stellung der beiden mesolithischen russischen Individuen CHE4 und LEB1
und des linearbandkeramischen Individuums BRU4 ersichtlich.

Abbildung 39. Phylogenetisches Netzwerk der mtDNA HVR I Haplotypen der Hg U5 (modifizert
nach Bramanti et al. in Vorbereitung). Die Nukleotidpositionen entsprechen der revidierten CRS
(Andrews et al. 1999). Diagnostische Mutationen der coding region sowie auerhalb der HVR I sind in
eckigen Klammern dargestellt. Die proportionalen Anteile der Proben LEB1, CHE4 und BRU4 sind
schwarz wiedergegeben.

147

Ergebnisse
Es konnte gezeigt werden, dass die Probe LEB1 bislang undokumentiert war und sich durch
eine Transversion an np A16241C von dem hufigen anzestralen Haplotyp U5a1
unterschied, der insgesamt 123 mal in der modernen Stichprobe der Hg U5 vertreten war
(Bramanti et al. in Vorbereitung). Der Haplotyp des Individuums CHE4 konnte jeweils noch
einmal in einer deutschen und einer tschechischen modernen Stichprobe gefunden werden.
Der Haplotyp des Individuums BRU4 fand sich insgesamt 16-mal in europischen
Populationen.
Da es fr die nachfolgende Diskussion von Interesse ist, soll hier angefgt werden, dass sich
unter drei weiteren meso- und neolithischen Individuen aus Polen und Litauen, die im
Rahmen einer von Barbara Bramanti parallel durchgefhrten Studie der Arbeitsgruppe
untersucht wurden, ebenfalls zwei Individuen der Hg U5 und eines der Hg U4 befanden. Bei
zwei weiteren bronzezeitlichen Individuen aus Litauen wurden andere Haplotypen (H und
T2) festgestellt.

6.6

Populationsgenetische Simulation mit Hilfe des Programmes


Simcoal 2.0

Die Ergebnisse der Simcoal Simulationen (Kap. 5.3.5) ergaben, dass unter den 2300
Individuen
der
heutigen
Vergleichsbevlkerung
des
linearbandkeramischen
Referenzgebietes mindestens 74 Individuen der Haplogruppe N1a zu finden sein mssten.
Darber hinaus endeten 95% der Lufe mit einer Anzahl von 119 bis 259 N1a Individuen in
der simulierten modernen Stichprobe. Die Simulationen unter Zulassung von
Migrationsereignissen zeigte, dass die angenommene Migrationsrate von 1% pro Generation
nicht ausreicht, um die niedrige moderne N1a-Frequenz zu erklren, da nur 5,5% aller Lufe
mit einer Anzahl unter sechs Individuen endete. Die zugrunde liegende Hypothese, dass die
moderne europische Bevlkerung des LBK/AVK-Gebiets direkte Nachfahren der
neolithischen Individuen sind und die geringe N1a-Frequenz durch genetische Drift
entstanden war, konnte abgewiesen werden.

148

Diskussion

7. Diskussion
7.1. Methodendiskussion
Die postmortale Labilitt der DNA-Molekle stellt fr die Analysen alter DNA ein zentrales
methodisches Problem dar. Bereits die ersten aDNA-Analysen wiesen auf die starke
Fragmentierung sowie post mortem Schdigung der DNA hin, welche demnach lediglich eine
Amplifikation von DNA-Fragmenten im Bereich von 100-500bp ermglicht (Pbo 1989,
Handt et al. 1994, Hss et al. 1996b, siehe auch aktuelle Reviews von Mitchell et al. 2005,
Pbo et al. 2004, Willerslev & Cooper 2005). darstellen
Gleichzeitig ist im Bereich humaner alter DNA der Bearbeiter selbst - als
Kontaminationsquelle - als methodenimmanentes Risiko zu betrachten, dessen mgliche
(passive) Beeintrchtigung von Ergebnissen nur durch aufwndige Arbeitsstrategien bzw.
Ausschlusskriterien eingeschrnkt werden kann.
Im Folgenden soll daher die Diskussion der einzelnen Methoden bzw. der angewandten
Strategien vor der Diskussion der Einzelergebnisse einer jeweiligen Probe im Gesamtansatz
gefhrt (Kap. 7.2) werden.

7.1.1 Amplifikationserfolg
Es lsst sich anhand der gewonnenen Ergebnisse beobachten, dass der Amplifikationserfolg
deutlich negativ mit Zunahme der Produktlnge korreliert (Kap. 6.1.1, Abbildung 20).
In dieser Hinsicht entspricht mit Ausnahme des Fragments IV die Zunahme des allgemeinen
Amplifikationserfolgs bei gleichzeitiger Abnahme der Produktlnge den Erwartungen bzw.
den bisherigen eigenen Erfahrungen (appropriate molecular behaviour nach u. a. Willerslev &
Cooper 2005, Pbo et al. 2004 bzw. vgl. Kap. 3.6.3, Punkt 3: theoriekonformes Verhalten
degradierter Molekle).
Auch bei der Amplifikation der einzelnen loci der STRS war der generelle
Amplifikationserfolg theoriekonform, d.h. er korrelierte negativ mit der zu erwartenden
Produktlnge der Allele.
Der Amplifikationserfolg einer Probe, der sich in den Daten der vorliegenden Arbeit aus
mindestens acht unabhngigen Versuchen berechnen lsst, liefert, sofern die Klonsequenzen
in der Gesamtansicht keine Zeichen von kontaminierenden Linien zeigen, einen deutlichen
Hinweis auf die Erhaltung von endogener Proben-DNA im Rahmen der Fragmentlngen der
untersuchten PCR-Produkte (vgl. Kap. 6.1.1). Dies ist vor allem fr die Proben SZA23 1,
KRE2, HAL1, DEB4, ASP2 und DEB1 anzunehmen (vgl. Kap. 7.2).
Finden sich jedoch Anzeichen fr Kontaminationen kann der prozentuale Wert des
Amplifikationserfolgs nur noch als Annherungswert dienen. Erstaunlicherweise zeigt sich,
dass der Amplifikationserfolg bei Proben, die kontaminierende Sequenzen aufweisen, nicht
automatisch 100% betrgt bzw. hher liegt als dieser Wert bei unkontaminierten Proben. Aus
Abbildung 23 wird deutlich, dass eher das Gegenteil der Fall ist, d.h. bei hherem Anteil an

149

Diskussion
kontaminierenden Sequenzen ist auch eine Abnahme des Amplifikationserfolgs zu
beobachten (Kap. 6.1.1). Dies lsst sich mglicherweise dadurch erklren, dass auch die
kontaminierenden DNA-Molekle durch die DNA-feindlichen Manahmen der
Kontaminationsvermeidung (Kap. 5.2.1) ebenfalls fragmentiert vorliegen bzw. depurinierte
oder dimerisierte Positionen aufweisen, die eine Amplifikation aufgrund zahlreicher
Strangabbrche inhibieren. Weiterhin denkbar wre, dass die endogene DNA in stark
fragmentiertem und modifiziertem Zustand, aber in ausreichender Menge vorliegt, so dass
die Amplifikation von wenigen intakten Moleklen sowohl der endogenen DNA als auch
von
wenigen
kontaminierenden
DNA-Moleklen
einfachen
stochastischen
Wahrscheinlichkeiten unterliegt.
Ob andere mgliche Koextrakte wie z.B. Huminsuren die PCR ebenfalls beeinflussen, kann
nur erahnt werden. So genannte spiking Experimente, bei welchen ein PCR-Ansatz rezenter
Kontroll-DNA mit variierenden Konzentrationen eines fraglichen inhibierenden Extraktes
versetzt werden, um festzustellen, ob dieses auch die Amplifikation ausreichend intakter
DNA beeinflusst, wurden nicht vorgenommen (Pusch & Bachmann 2004, Bollongino 2005,
Serre et al. 2004b).
Es lsst sich generell feststellen, dass der allgemeine Amplifikationserfolg dem Alles oder
Nichts-Prinzip folgt. Aus Abbildung 20 in Kap. 6.1.1 wird ersichtlich, dass 75% der Proben
einen Amplifikationserfolg von 75% und deutlich hher aufweisen. Die Tatsache, dass nur
10, 6 % der Proben einen Amplifikationserfolg unter 50% besttigt die Beobachtung, dass der
allgemeine Amplifikationserfolgs abrupt abbricht, was gleichermaen einen raschen
Abbruch des Nachweises von DNA suggeriert.
Dies bedeutet, dass in den meisten Fllen mitochondriale DNA entweder gut erhalten und
amplifizierbar oder aber keine DNA mehr vorhanden war.
Die Klonsequenzen des Beispiels DUD1 (47,6%) zeigen, dass die PCR-Produkte eine
mosaikartige Verteilung von Mutationen aufweisen, die grtenteils als sporadische
Amplifikation von Hintergrundkontaminationen zu deuten ist. In beiden Fllen kann davon
ausgegangen werden, dass keine endogene DNA mehr vorhanden ist oder mit den
verwendeten Fragmentlngen nicht mehr amplifizierbar ist. Mglicherweise kann daraus
gefolgert werden, dass ab einem bestimmten Schwellenwert des Amplifikationserfolgs (hier
50%) nicht mehr mit dem Erhalt von authentischer endogener DNA zu rechnen ist.

7.1.2 SAXS-Analyse
Ergnzend zum Amplifikationserfolg knnen die Ergebnisse der nichtgenetischen SAXSAnalyse angefhrt werden, welche indirekt einen Anhaltspunkt fr die
Erhaltungsaussichten von Biomoleklen liefern sollten (vgl. Kap. 6.1.3). Mit einem
simultanen Test auf Erhaltung von Makro- bzw. Biomoleklen wird damit den
Authentizittskriterien der aDNA-Forschung entsprochen (vgl. Kap. 3.6.3, Punkt 7:
Biochemischer Erhaltungszustand).
Da zum Zeitpunkt der Analyse schon Amplifikationsergebnisse vorlagen, konnte daher aus
einem Spektrum an gut erhaltenen und amplifizierbaren (z.B. SZA23 2, SEE 1, DON1) und
schlecht erhaltenen, weniger gut (SON1) oder gar nicht amplifizierbaren Proben (SWI 6)

150

Diskussion
ausgewhlt werden. Dies ermglichte eine bessere Einschtzung der Ergebnisse der SAXSAnalyse. Die Daten zur kristallinen Struktur der Knochenmatrix sowie zur
durchschnittlichen Gre derselben besttigen weitestgehend die Ergebnisse, sowohl der
visuellen Einschtzung des Erhaltungszustand nach Konsistenz (und Farbgebung) als auch
der Amplifikations- bzw. Reproduktionserfolge. So konnte z.B. die Probe SWI6 des
niederlndischen Fundortes Swifterbant nicht erfolgreich amplifiziert werden (Abbildung 21
und 24). Im Vergleich mit anderen Proben fllt SWI6 durch eine hheren T-Wert auf, welcher
der Kristalldicke entspricht. hnliches gilt fr die Probe SON1, welche durch eine hohen vWert von den anderen Proben abweicht. Fr sie liegen zwar Amplifikationserfolge vor,
allerdings sprechen diese fr eine mgliche Kontamination der Probe. Dasselbe ist fr die
Probe UNS1,1 anzumerken, die aus einer dieser Arbeit angeschlossenen Untersuchung
entstammt. Da nach angegebenem T-Wert (5,51nm) ein Amplifikationserfolg nicht zu
erwarten wre, und die Sequenzanalyse der Probe ebenfalls auf eine Kontamination
hindeutet, kann davon ausgegangen werden, dass es sich hierbei nicht um endogene DNA
des Knochens handelte.
Die Ergebnisse der SAXS-Analyse zeigen, dass sowohl Struktur und Gre der Kristalle im
Knochen Hinweise auf mglichen Erhalt von endogener DNA im jeweiligen Abschnitt geben
knnen. Allerdings erlaubt die SAXS-Analyse nicht, aus den indirekten Daten (Struktur und
Gre der Kristalle) auf die Quantitt und Qualitt der DNA zu schlieen. So kann aus den
vorliegenden Werten (Kap. 6.1.2) nicht auf das Vorhandensein von nuklerer DNA wie bei
Probe SZA23 geschlossen werden. Darber hinaus knnen die weiteren Fragen, ob anhand
des gezeigten Datensatzes eindeutige Korrelate vorliegen bzw. wo die jeweiligen
Schwellenwerte fr betreffende Aussagen liegen, nicht beantwortet werden. Ein Vergleich
mit parallel untersuchten Rinderproben zeigt, dass vor allem die modernen Proben eine
groe Streubreite hinsichtlich der Indices aufweisen (welche letztlich vom biologischen Alter
des Individuums abhngig ist, siehe Abbildung 25). Daher kann hier postuliert werden, dass
fr Aussagen, die mehr als nur deskriptiver Art sein sollen, mehr degradierte
Vergleichsdaten und vor allem auch mindestens drei moderne Referenzen unterschiedlichen
biologischen Alters (z.B. juvenil - adult/matur senil) ntig sind.

7.1.3 Verwendung von UNG


Der Einsatz von UNG in der PCR-Reaktion war zu Beginn der vorliegenden Arbeit dafr
vorgesehen, artifizielle Basensubstitutionen, wie sie durch die post mortem Deaminierung von
Cytosinen entstehen, von echten Mutationen unterscheiden zu knnen. UNG entfernt das zu
Uracil deaminierte Cytosin aus dem DNA-Doppelstrang und schafft somit einzelstrngige
Lcken, die bei der Hitzedenaturierung der PCR den betreffenden Strang fragmentieren, so
dass dieser nicht mehr zur weiteren Amplifikation zur Verfgung steht (vgl. Kap. 5.2.4.3.2
und Hofreiter et al. 2001).
In der Tat kann bei der Verwendung von UNG eine starke Reduzierung der G/CaA/T
Basensubstitutionen beobachtet werden (z.B. ASP2, Fragmente III und IV im Anhang unter
Kap. 10.5). Im Rahmen der Datenauswertung der vorliegenden Arbeit kann jedoch auch

151

Diskussion
gezeigt werden, dass die angewandten Strategien der Reproduktion sowie die Klonierung
der PCR-Produkte ausreichend sind, um echte Mutationen von post mortem entstandenen
Basensubstitutionen zu unterscheiden. In keinem der 42 Flle, in welchen eine Haplogruppe
eindeutig bestimmt werden konnte, war eine fr den Sequenzhaplotyp bestimmende
Position fraglich, so dass sie durch eine nachgeschaltete weitere Amplifikation mit UNG
entschieden werden musste. Wie die Auswertung der Daten im Hinblick auf hot spot
Mutationen zeigt (Kap. 5.3.3), sind zwar einige der definierten hot spots auch fr die
Bestimmung von Haplogruppen von Bedeutung, im Rahmen der angewandten
Reproduktionsstrategie ist es jedoch sehr unwahrscheinlich, dass genau die betreffende
Position mehrfach unabhngig besttigt wird. Somit kann festgehalten werden, dass die
Verwendung von UNG zur Lsung von unklaren Nukleotidpositionen nicht ntig ist, sofern
eine dezidierte Reproduktionsstrategie verfolgt, d.h. eine fragliche Nukleotidposition
mindestens zweimal unabhngig reproduziert wird und zudem eine Klonierung der PCRProdukte erfolgt.
Bereits Hofreiter und Kollegen (2001) stellen fest, dass es bei der Klonierung von PCRProdukten nur dann zum scheinbar konsistenten Durchschlag von post mortem entstandenen
Mutationen kommt, wenn die Ausgangszahl an endogenen Moleklen in der PCR sehr
gering ist. Zudem weist Hofreiter darauf hin, dass bei der Verwendung von UNG in solchen
Fllen gleichzeitig die Gefahr besteht, die letzten endogenen DNA-Molekle von der
Amplifikation auszuschlieen. Dabei erhht sich zustzlich die Wahrscheinlichkeit, dass
wenige Molekle einer bestehenden Hintergrundkontamination aufgrund ihres intakten
Zustandes bevorzugt amplifiziert werden. Dies lsst sich im vorliegenden Datensatz an
mehreren Beispielen u. a. der Schwetzinger Stichprobe zeigen (vgl. Kap. 7.2 und 11), welche
allesamt eine vergleichbar geringe Ausgangmenge an endogenen Moleklen aufweisen. Bei
SCHWE1 zeigt das UNG-PCR-Produkt von Fragment I der Extraktion B kontaminierende
Sequenzen. Die mit UNG behandelten PCR-Produkte der Probe SCHWE2 und UNS2 zeigen
kontaminierende Sequenzen des Bearbeiters. Weitere, als kontaminierend bestimmte,
Sequenzen finden sich in den mit UNG amplifizierten PCR-Produkten der Individuen
SCHWE4, SEE1 und SON1.
Somit lsst sich insgesamt die Hypothese Hofreiters besttigen, wonach einmal mehr die
Verwendung von UNG in Frage gestellt wird. Im Zuge der Interpretation der hier
gewonnenen Ergebnisse lsst sich sagen, dass der Einsatz von UNG fr zuknftige aDNAStudien an menschlichen Proben aufgrund der groen Gefahr der gezielten Verstrkung der
Hintergrundkontamination nicht empfohlen werden kann.
Ein mgliches Einsatzfeld bleiben aDNA-Analysen tierischer Proben, bei welchen durch
gezielte
Primerwahl
die
vornehmlich
menschliche
Hintergrundkontamination
ausgeschlossen werden kann und eine Klonierung der PCR-Produkte nicht
notwendigerweise immer durchgefhrt werden muss (vgl. Bollongino 2005).

152

Diskussion

7.1.4 Kontaminationen, Kontaminationsraten und Kontaminationsvermeidung


Mit Kontaminationen ist bei der Analyse alter DNA, insbesondere von humaner alter DNA,
stets zu rechnen. Zwar kann durch die vorgestellten Manahmen zur
Kontaminationsvermeidung das Ausma eingeschrnkt und zudem knnen einige Formen
der Kontamination grtenteils logistisch vermieden werden, ein absoluter Ausschluss an
Kontaminationen ist im Bereich menschlicher aDNA derzeit nicht denkbar (Kap. 5.2.1).
Es lsst sich insgesamt feststellen, dass der berwiegende Anteil der beobachteten
Kontaminationen
durch
keine
der
angewandten
Manahmen
zur
Kontaminationsvermeidung erfasst wird. Dies wird darin deutlich, dass sich nur die
wenigsten kontaminierenden Sequenzen eindeutig zuordnen lassen. Prinzipiell ist dies auf
die Amplifikation in berlappenden Fragmenten zurckzufhren, wobei im Falle einer
begleitenden Kontamination abweichende Sequenzen meist nur in einem Fragment, selten
ber mehrere Fragmente hinweg verfolgt werden knnen. Letzteres ist z.B. nur bei der stark
kontaminierten Probe DON2 der Fall. In den meisten Fllen ist eine mosaikartige Verteilung
von unterschiedlichen kontaminierenden Sequenzen in variierenden Anteilen innerhalb der
vier Fragmente zu erkennen (z.B. DEB5, DON1, KRE1).
Es lsst sich weiterhin beobachten, dass die Rckfhrung von Kontaminationen zu deren
Quelle von der Form und dem Zeitpunkt der Kontamination abhngig ist. So knnen
Kontaminationen der einzelnen Fragmente, die sich in anderen Fragmenten nicht wieder
finden bzw. verfolgen lassen, hauptschlich auf sporadische Kontaminationen der PCRReaktionen zurckgefhrt werden. Da sich diese jedoch nicht reproduzieren lassen, kann die
eigentliche Quelle, d.h. Reagenzien, Gefe oder Spuren weniger DNA-Molekle, die im
Rahmen der Probenvorbereitung nicht eliminiert wurden, nicht genauer eingegrenzt
werden. Anhand der errechneten Kontaminationsrate lsst sich jedoch im Vergleich
feststellen, dass diese Form der sporadischen, d.h. nicht identifizierbaren sowie nicht in der
Probe selbst und in anderen Proben reproduzierbaren, Kontamination meist unter 15% liegt
(vgl. Kap. 6.1.2 sowie Abbildung 22).
In seltenen Fllen ist eine eindeutige Bestimmung einer kontaminierenden Linie und somit
eine direkte Identifizierung der Kontaminationsquelle mglich (z.B. UNS2, DEB2, BRU4
durch den direkten Bearbeiter bzw. FLO6 und SCHWE4 durch weitere Labormitarbeiter).
Eine Identifizierung eines Probengebers war nur in einem Fall (DON2) mglich. Inwieweit
sich diese Form der Kontamination reproduzieren lsst, hngt in erster Linie vom
Arbeitsschritt ab, in welchem die Probe kontaminiert wurde. So deutet die Kontamination
nur eines Fragments auf eine Verunreinigung der PCR-Reaktion hin (z.B. FLO6, SCHWE4),
wohingegen der Nachweis in mehreren Fragmenten einer Extraktion fr eine Kontamination
whrend der Extraktion der DNA oder in hierfr vorbereitenden Schritten sprechen.
Weiterhin lsst sich feststellen, dass diese Form der Kontamination durch den Bearbeiter sich
deutlich strker niederschlgt, wobei in Rahmen des Vergleichs der Kontaminationsraten
Werte um 40% zu beobachten sind (vgl. Kap. 6.1.2, Abbildung 23). Entscheidend ist jedoch,
dass in den Fllen DEB2, BRU4 und UNS2 die Kontaminationsquelle identifiziert und damit
ausgeschlossen werden kann, womit die verbleibenden Ergebnisse, sofern sie den

153

Diskussion
Anforderungen der Reproduktionsstrategien (vgl. Kap. 5.4) gerecht werden, unter Vorbehalt
als authentische DNA angesehen werden knnen.
Eine systematische Form der Kontamination, wie sie durch den Eintrag von PCR-Produkten
denkbar wre, ist in keinem einzigen Fall zu beobachten. Allein die Tatsache, dass innerhalb
der 43 meso- und neolithischen Individuen, fr die Ergebnisse vorliegen, 29 verschiedene
Haplotypen festgestellt werden konnten, schliet das Vorkommen von systematischen
Kontaminationen im Rahmen des Untersuchungszeitraumes aus. Dieser Umstand der hohen
beobachtbaren Variabilitt kann somit als Beweis dafr gesehen werden, dass systematische
Kontaminationen in Form von carry over bzw. crossing overKontaminationen keine Rolle
gespielt haben knnen. Zudem unterscheidet sich auch unter der Annahme von starken
Verdnnungseffekten die Zusammensetzung der Hgs in der neolithischen die Stichprobe
deutlich von der einer naheliegenden Kontaminationsstichprobe, wie sie sich aus zufllig
gewhlten Probengebern bzw. Labormitarbeitern ergbe.
Eine besondere Form der Kontamination stellt die wiederkehrende Beobachtung einer
bestimmten DNA-Sequenz im Rahmen der vorliegenden Arbeit dar. Hierbei handelt es sich
um eine kontaminierende Linie mit der charakteristische Position 16309G, die sich jedoch
nicht identifizieren lsst, d.h. weder in den Proben noch in den Labormitarbeitern bzw. den
Probengebern zu finden ist. Eine somit quasi-systematische Kontamination mit genannter
Linie kann in den Proben DUD1, UNS2, SEE1, DEB5 und SCHWE2 beschrieben werden. Eine
genaue Eingrenzung der Kontaminationsquelle kann jedoch nicht erfolgen, da die
betreffende Position in Sequenzen aus sieben unabhngigen PCR-Reaktionen sowie vier
unabhngigen Extraktionen zu finden ist. Zudem stammen die Proben von vier
verschiedenen Probengebern und wurden zu unterschiedlichen Zeitpunkten bearbeitet.
Mglicherweise handelt es sich in diesem Fall um sehr geringe Spuren einer konstanten
Hintergrundkontamination, wie sie mglicherweise in einer Charge von externen PCRReagenzien
vorhanden
sein
kann,
welche
von
den
laborseitigen
Dekontaminationsmanahmen nicht erfasst werden knnen.3
Als ergnzende Kontrollen fr Analysen von humaner aDNA wird seitens der
Authentizittskriterien der aDNA-Forschung die Verwendung von assoziierten Tierfunden
vorgeschlagen (vgl. Kap. 3.6.3, Punkt 9). Fr die untersuchten neolithischen Individuen
konnten keine assoziierten Tierproben der zugehrigen Fundpltze akquiriert werden, so
dass zur Extraktionskontrolle vier Rinderproben der parallel laufenden Arbeit (Bollongino
2005) des gemeinsamen Projekts herangezogen wurden.
Die Verwendung von Tierproben kann im Rahmen dieser Arbeit nur unter Vorbehalt
diskutiert werden, da die Bearbeitungsschritte bis zur Extraktion nicht den kontrollierten
Bedingungen der Versuche des Bearbeiters unterlagen. Aufgrund der Tatsache, dass bei der
Amplifikation der vier Tierproben einerseits gehuft positive Signale erhalten wurden und
sie nicht direkt mit den untersuchten Fundorten assoziiert sind, wurde die Verwendung
3

Die Verwendung von UNG bei der Amplifikation von aDNA spielt ebenfalls eine nicht zu unterschtzende
Rolle bei der Detektion bzw. Quantifizierung von mglichen Kontaminationsquellen. Diese Problematik wird in
Kapitel 7.1.2 gesondert behandelt.

154

Diskussion
derselben als Versuchskontrollen nach wenigen Versuchen (jeweils drei PCRs fr die
Fragment II und III, vier PCRs fr die Fragmente I und IV und 11 PCRs fr Fragment V)
eingestellt. Dadurch lsst sich auch der hohe Anteil von 100% positiver Tierkontrollen (drei
aus drei Versuchen) in Abbildung 22 relativieren. Die gehuften positiven Signale lassen sich
zum einen dadurch erklren, dass die in dieser Arbeit verwendeten Primer nicht auf
Ausschluss der Amplifikation von Rinder-DNA getestet wurden. Zum anderen kann die
Mglichkeit einer menschlichen Kontamination der Rinderproben nicht a priori
ausgeschlossen werden. Dessen ungeachtet ist eine Verwendung von Tierproben als
Kontrolle nur dann sinnvoll, wenn sie unmittelbar mit der zu bearbeitenden menschlichen
Probe assoziiert ist und unter allen Umstnden die identische Behandlung whrend und
nach deren Ausgrabung (post excavation history) aufweist (Gilbert et al. 2005a; 2005b). Dies ist
in der Praxis allerdings nur in den wenigstens Fllen, d.h. bei aktuellen Grabungen, zu
erwarten.
Zusammenfassend lsst sich feststellen, dass die Kontaminationsgefahr bei der Bearbeitung
von humaner aDNA sehr gro und allgegenwrtig ist. Im vorliegenden Fall zeigen die
erhaltenen Daten allerdings, dass unter Einhaltung der in Kap. 5.2.1 beschriebenen
Manahmen zur Kontaminationsvermeidung sowie durch die in dieser Arbeit verwendeten
Reproduktions- und Authentifizierungsstrategien (vgl. Kap. 7.1.6) valide Ergebnisse erzielt
werden knnen, indem kontaminierende Anteile definiert und ausgeschlossen werden (siehe
im Gegensatz hierzu auch Pbo et al. 2004).

7.1.5 Amplifikation langer mtDNA Fragmente und nuklerer DNA (ncDNA)


Die Ergebnisse der Amplifikation des langen mtDNA Fragments V, welches der
Gesamtlnge des Bereichs der berlappenden vier kurzen Fragmente entspricht, zeigt
deutlich, dass nur in seltenen Ausnahmen noch intakte Molekle der entsprechenden Lnge
(> 440bp) vorliegen. Der Amplifikationserfolg liegt unter 20%, wobei dieser Wert aus den
nachfolgenden Grnden zu vernachlssigen ist. Der Abgleich der Sequenzierungsergebnisse
mit den Sequenzen der kurzen Abschnitte zeigt nur in sieben Fllen eine bereinstimmung.
In zwei vergleichbaren Fllen (UNS2, BRU4) tritt bei der Sequenzierung des langen
Fragments deutlich die kontaminierende Linie des Bearbeiters vor, die auch zu einem
geringeren Anteil innerhalb der Klonsequenzen der kurzen Fragmente zu finden ist. Daraus
kann bereits geschlossen werden, dass in den Fllen, in welchen keine bereinstimmung
vorliegt, von einer Kontamination ausgegangen werden kann (BRU1, VIE1). Diese Annahme
wird zum einen durch die Tatsache bekrftigt, dass bei einigen Proben lange Fragmente
amplifiziert werden konnten, welche bei der Amplifikation der kurzen Fragmente keine oder
nur geringe Amplifikationserfolge aufwiesen (SEE3, TRE1 und auch BRU4, UNS2, und
DUD2) und welche aus diesem Grund frhzeitig verworfen wurden.
Zum anderen kann bei Proben, deren Ergebnisse bereinstimmen, in den meisten Fllen
auch ein reproduzierbares Ergebnis bei der Analyse der nukleren Genorte festgestellt
werden (KRE1, KRE2, SZA23 1, SZA23 2, DEB1). Gerade weil bereits in vivo in der Zelle ein
ungleiches Verhltnis der Kopienzahl von mtDNA und ncDNA zu Ungunsten letzterer

155

Diskussion
vorliegt, kann auch in der postmortalen Situation davon ausgegangen werden, dass, sofern
sich ncDNA nachweisen lsst, auch die mtDNA in grerer Menge vorliegt. Weiterhin lsst
dieser Umstand es plausibel erscheinen, dass bei einer ausreichend groen Menge an
mtDNA Kopien noch einige intakte lange Molekle fr eine Amplifikation zur Verfgung
stehen.
Ein weiterer Grund fr die Annahme, dass es sich bei der erfolgreichen Amplifikation langer
mtDNA Fragmente (bei nicht bereinstimmenden Sequenzen) in erster Linie um
Kontaminationen handelt, liegt in der Beschaffenheit der putativen Kontaminationsquelle
begrndet. Es kann als sehr wahrscheinlich angesehen werden, dass die Mehrzahl der
Kontaminationen einer Probe von Zellen abgestoener Hautschuppen stammen. Zwar wird
durch die bereits beschriebenen Manahmen ein Eintrag dieser Hautzellen minimiert, kann
jedoch nicht gnzlich verhindert werden (Kap. 5.2.1). Eine charakteristische Eigenschaft der
abgeschilferten Hautzellen besteht darin, dass in den meisten Fllen der Zellkern bereits vor
der Abschilferung abgebaut wurde (vgl. Balogh et al. 2002). Dies gilt jedoch nur
eingeschrnkt fr die Mitochondrien der Zellen. Die Wahrscheinlichkeit der Kontamination
mit mtDNA ist daher um ein vielfaches grer als die nuklerer DNA. Diese Tatsache
spiegelt sich deutlich im Anteil der kontaminierten Leerkontrollen wider (vgl. Kap. 6.1), die
sich bei der Amplifikation von mtDNA in Werten bis zu 32% (Tierkontrollen) niederschlgt,
in allen Versuchen zu nuklerer DNA jedoch bei 0% liegt.

Abbildung 40. Hypothetische Anteile von aDNA-Moleklen und Hintergrundkontamination. Die


unterschiedlich grauen Flchen stellen Beispiele fr die Gesamtmenge an endogenen DNA-Moleklen
zweier Proben dar. Die gepunktete Linie verdeutlicht ein hypothetisches Niveau an Moleklen einer
(gemischten?) Hintergrundkontamination, deren Anzahl der Molekle die der endogenen DNA je
nach Probe berschreitet.

Der Grad der DNA-Degradierung und -Fragmentierung hngt in erster Linie von der
individuellen Geschichte der Probe und damit von den diversen Einflussfaktoren innerhalb
dieser Zeitspanne ab (Pbo et al. 2004, Willerslev & Cooper 2005, Mitchell et al. 2005).
Entscheidend fr die Beurteilung einer Probe hinsichtlich der Authentizitt ist sicherlich die

156

Diskussion
aus mehreren Analysen gewonnene Einschtzung des allgemeinen Erhaltungszustands (vgl.
Kap. 7.2). In Abbildung 40 ist ein hypothetisches Schema der DNA-Erhaltung dargestellt.
Darin wird deutlich gemacht, dass der Gesamteindruck von einer Probe Hinweise auf die
Wahrscheinlichkeit des Erhalts valider Ergebnisse liefern kann. Der kritische Punkt
bezglich des Erhalts endogener DNA ist dann erreicht, wenn ihr Anteil an Fragmenten
einer gewissen Lnge den Anteil der Hintergrundkontamination erreicht bzw.
unterschreitet.
Die Amplifikation nuklerer aDNA STR loci macht im Rahmen einer populationsgenetischen
Fragestellung nur eingeschrnkt Sinn. Zwar weisen die Allele der einzelnen Genorte in
phylogeographischer Hinsicht auch Unterschiede zwischen einzelnen Bevlkerungen auf,
allerdings bemessen sich diese in Frequenzunterschieden einzelner Allele. Die hierzu
bentigten Stichprobengren knnen bislang nicht nur in der vorliegenden Arbeit, sondern
auch generell innerhalb von aDNA-Analysen aufgrund der grundstzlich limitierten
Erhaltung nuklerer DNA, nicht erreicht werden.
Im Rahmen dieser Arbeit hat die Amplifikation nuklerer STR-Genorte daher die Funktion
des zustzlichen Informationsgewinns, der aufgrund der Auflsung auf Individualebene
eine mgliche berwachung hinsichtlich systematischer Kontaminationen bietet. Zudem
liefert die erfolgreiche und reproduzierbare Amplifikation von einigen loci wichtige
Anhaltspunkte fr die Interpretation der Ergebnisse aller Untersuchungen zu einem
Individuum, insofern sich diese in ihrer Tendenz besttigen und ein plausibles Gesamtbild
liefern. Eine besondere Rolle spielt vor allem die Geschlechtsdiagnose, die mit der
klassischen morphologisch-anthropologischen Bestimmung abgeglichen werden kann. Im
Falle der Funde von Derenburg, Szarvas 23, Kretuonas, in welchen mehrere Individuen eines
Fundortes untersucht wurden, liegen nuklere Ergebnisse fr mehrere Individuen vor. Da
sich die Profile der STR-Genotypisierungen voneinander unterscheiden, kann a) eine
systematische Kontamination aber auch b) eine nhere Verwandtschaft der Individuen
untereinander ausgeschlossen, jedoch c) generell gute Erhaltungsbedingungen fr den
jeweiligen Fundort attestiert werden, die eine Empfehlung fr eine detaillierte
Binnenanalyse zulassen.

7.1.6 Reproduktionsstrategien zur Validierung und Authentifizierung


Es zeigt sich in den Daten der vorliegenden Arbeit, dass zwar eine Kontamination nie
absolut ausgeschlossen, aber die Wahrscheinlichkeit einer Fehlinterpretation der Ergebnisse
zugunsten von kontaminierenden Linien durch die Synthese von mehreren Ergebnissen aus
unterschiedlichen unabhngigen Versuchen in hinreichendem Mae verringert werden
konnte (vgl. Reproduktionsschemata in Abbildungen 16 und 17, sowie die Kriterien zur
Authentifizierung von Sequenzen in Abbildung 19, alle Kap. 5.4). Die Verwendung von
berlappenden Fragmenten zur Amplifikation eines langen DNA-Abschnitts erweist sich als
groer Vorteil (sofern die berlappenden Bereiche ausreichend gro gewhlt sind), da
hierdurch diagnostische Positionen, die in diesen Bereichen liegen, und somit indirekt auch
weitere phylogenetisch sinnvolle Positionen derselben Sequenzen, welche nicht im

157

Diskussion
berlappenden Bereich liegen, mehrfach unabhngig besttigt werden. Dies macht
weitgehend eine Wiederholung der PCR eines Fragments berflssig und daher ist eine
Amplifikation pro Fragment pro Extraktion ausreichend, um charakteristische Positionen
vierfach zu besttigen. Es zeigt sich zudem an den vorliegenden Daten, dass die
beschriebene Mindestzahl an Versuchen innerhalb des Reproduktionsschemas ausreichend
ist, um eine Validitt der Ergebnisse im Sinne der verwendeten sieben Kriterien zu
gewhrleisten (vgl. Abbildung 19). Da dennoch eine theoretische Wahrscheinlichkeit besteht,
dass sich eine systematische Kontamination ebenfalls eindeutig und reproduzierbar im Sinne
einer der sieben Kategorien durchsetzen kann, spielt bei der endgltigen Authentifizierung
der Ergebnisse eines Individuums die Beurteilung aller Informationen zu den einzelnen
Proben eine bedeutende Rolle (Gilbert et al. 2005a). Die Diskussion aller Ergebnisse im
Rahmen einer Gesamtanalyse auf Individualebene wird daher in Kapitel 7.2 gefhrt.
Im Hinblick auf zuknftige Analysen knnen aus den Erkenntnissen der vorliegenden
Arbeit Empfehlungen fr alternative Reproduktionsstrategien ausgegeben werden. Im
Rahmen einer Kostenreduzierung kann generell die Anzahl der Klone auf durchschnittlich
acht, jedoch mindestens fnf pro PCR-Produkt reduziert werden, sofern PCR-Produkte aus
zwei unabhngigen Extraktionen vorliegen. Mim Bowers und Kollegen (2005) empfehlen
dagegen pro PCR-Produkt die Sequenzierung von mindestens 20 Klonen, um innerhalb
eines PCR-Produktgemischs die Erfassung aller mglichen Molekle hinsichtlich des 95%
Konfidenzintervalls zu garantieren. Dennoch weisen die Autoren nachdrcklich auf die
wesentlich wichtigere Bedeutung der mehrfachen unabhngigen Reproduktion hin.
Daher wre auch denkbar, nur die PCR-Produkte einer Extraktion zu klonieren, wobei die
Besttigung der Ergebnisse durch eine Direktsequenzierung der PCR-Produkte aus einer
bzw. optional zwei weiteren Extraktionen folgen sollte, insofern das zur Verfgung stehende
Probenmaterial nicht ein limitierender Faktor darstellt.
Von einem gnzlichen Verzicht der Klonierung, wie sie bei SCHWE5 exemplarisch
angewandt wurde, sollte jedoch aufgrund der Zusatzinformation, die die Klonsequenzen
liefern knnen (vgl. Kap. 7.2), bei der Analyse menschlicher aDNA abgesehen werden.

7.1.7 Zur post mortem Substitutionsrate und Sttigungsrate


Die Berechnung der allgemeinen post mortem Substitutionsrate liefert in mehreren Aspekten
einen Anhaltspunkt zur Interpretation der gewonnen Daten (vgl. Kap. 6.3.1 und 7.2). Es lsst
sich feststellen, dass die ermittelten post mortem Substitutionsraten unterschiedlicher
Individuen desselben Fundortes hnlich hohe oder niedrige Werte aufweisen. So sind z.B.
die post mortem Substitutionsraten der drei Proben aus Schwetzingen hnlich (SCHWE4,
17,6; SCHWE2, 22,6; SCHWE1, 23,3) hoch. Dagegen sind die Werte der beiden
Proben des Fundortes Szarvas 8 (SZA8 1 und 2) mit 4,0 und 4,2 vergleichbar gering.
Eine allgemeine bereinstimmungen der Hhe der post mortem Substitutionsrate kann auch
fr die Funde aus Kretuonas (KRE1 und 2), Szarvas 23 (SZA23 1, 2 und 3) sowie fr
Derenburg (DEB1, 3, 4 und 5) beobachtet werden. Es kann daher eine direkte Abhngigkeit
der post mortem Modifikationen von den vorherrschenden Bodenverhltnissen postuliert

158

Diskussion
werden. Mglicherweise knnen die hydrolytischen und oxidativen Schden der DNA
unmittelbar auf die Einflussfaktoren Feuchtigkeit und Sauerstoffgehalt der jeweiligen Bden
zurckgefhrt werden. Die post mortem Substitutionsrate lsst somit Rckschlsse auf
generell vorherrschende Erhaltungsbedingungen zu. Ergnzend hierzu lsst sich bei Proben
des Fundortes Flomborn eine auffllige Streuung der Werte der post mortem Substitutionsrate
feststellen, die sich von 3,15 bis 17,6 erstreckte. Dieser Umstand kann leicht durch den
unterschiedlichen Erhaltungszustand der Proben erklrt werden.
In Kombination mit der Sttigungsrate lassen sich auch Aussagen ber die Menge und
Qualitt der endogenen DNA treffen. Eine hohe post mortem Substitutionsrate kann daher als
fortgeschrittener Zustand der Degradierung betrachtet werden. Knnen innerhalb einer
bestimmten Anzahl Klone dieselbe Anzahl an Linien anhand unterscheidbarer
Substitutionen festgestellt werden, so deutet dies auf eine nicht erreichte Sttigung der
Klonsequenzen mit unterschiedlich substituierten Moleklen hin, was wiederum als
Indikator fr eine ausreichend groe Ausgangszahl an Moleklen zu Beginn der PCR
gesehen werden kann.
Entsprechend kann eine vergleichsweise niedrige post mortem Substitutionsrate einerseits auf
eine ausreichend groe Menge intakter Molekle hindeuten, andererseits auf nur noch
wenige erhaltene Molekle. Hierbei kann auch die Sttigungsrate nicht zur Interpretation
herangezogen werden, da sie lediglich das Verhltnis der Anzahl der Klone zur Anzahl der
beobachtbaren Linien beschreibt und in beiden Fllen einen vergleichbar niedrigen Wert
annimmt. Als Interpretationshilfe dient hierbei die Tatsache, dass im Falle weniger
erhaltener Molekle die wenigen beobachtbaren Substitutionen in mehreren Klonsequenzen
konsistent auftreten.
Sofern die post mortem Substitutionsrate getrennt fr die einzelnen Fragmente berechnet
wird, lsst sich ein deutlicher Trend feststellen, der Aussagen zur Art und Weise der DNADegradierung bzw. Fragmentierung zulsst. Es kann durch Interpolation der gewonnenen
Daten gezeigt werden, dass bei abnehmender Produktlnge um 10bp eine Zunahme der post
mortem Substitutionsrate um 1,66 vorliegt (vgl. Kap. 6.3.1 und Abbildung 29). Die
krzeren Alternativen der Fragmente I-III knnen die allgemeine Tendenz, trotz der
geringen Anzahl an durchgefhrten PCR-Reaktionen und somit der reduzierten Datenlage,
besttigen. Dieses Ergebnis legt die Vermutung nahe, dass die Mechanismen, welche zur
Fragmentierung und Modifikation von DNA-Moleklen fhren, nicht getrennt verlaufen.
Der Umstand, dass krzere Fragmente von Moleklen vergleichsweise mehr
Basenmodifikationen aufweisen, hat zudem Einfluss auf die Frage, ob sich anhand der
Hufung von Mutationen an einzelnen Positionen und deren Verteilung innerhalb der HVR
I signifikante Muster erkennen lassen (siehe Kap. 6.3.1).
Das arithmetische Mittel der Sttigungsrate (Kap. 6.3.2) aller PCR-Produkte ist nur in
extremen Fllen (nahe bzw. gleich 0; nahe bzw. gleich 1) aussagekrftig. Die Sttigung eines
Fragments ist zuvorderst von der Menge an Ausgangsmoleklen whrend der initialen
Reaktionszyklen abhngig, welche wiederum einerseits stochastischen Prozessen unterliegt
und andererseits von der Einsatzmenge an Extrakt bzw. letztlich der verwendeten
Extraktionsmenge bzw. des Probenmaterials bei unterschiedlichen Extraktionen abhngt.
Die Sttigungsrate ist daher nur als Annherungswert bei der Betrachtung der einzelnen

159

Diskussion
PCR-Produkte sinnvoll und kann aufgrund der quasi-quantitativen Eigenschaften das
Auftreten von kontaminierenden Sequenzen innerhalb eines Individuums erklren.

7.1.8 Charakterisierung und Verteilung postmortaler Sequenzvernderungen


Die beobachteten Anteile der einzelnen Formen der Basensubstitutionen (Kap. 6.3.3,
Abbildung 30 & 31) entsprechen im Wesentlichen der Verteilung vorausgegangener
Publikationen (Hansen et al. 2001, Hofreiter et al. 2001a, Gilbert et al. 2003b, Bollongino 2005,
Binladen et al. 2005). Die Tatsache, dass die Transition vom Typ II (C/GaT/A) mit ~90%
vertreten ist, macht deutlich, dass die Deaminierung der Cytosine durch hydrolytische
Prozesse die weitaus hufigste Ursache fr Basensubstitutionen bei alter DNA darstellen.
Mit einem Anteil von ~8% ist die Transition vom Typ II (A/TaG/C) am zweithufigsten
vertreten, wobei hier die Deaminierung der Adenine im Vordergrund steht. Das Verhltnis
der Deaminierungen von C und A von 40:1, wie es von Lindahl (1993) in vivo beobachtet
wird, kann jedoch - wie auch schon von Gilbert (et al. 2003b) konstatiert nicht besttigt
werden. Basierend auf der Annahme, dass auch postmortal nur die biochemische
Deaminierung von C und A als wahrscheinlich erachtet werden kann (Hofreiter et al. 2001a,
Hansen et al. 2001), ist anhand des vorliegenden Datensatzes fr die kombinierten
postmortalen Transitionen I und II ein wesentlich geringeres Verhltnis von 11:1
festzustellen.
Der Anteil von 2,25% Transversionen kann mglicherweise als Summe von
Polymerasefehlern gedeutet werden. In einer Gesamtzahl von 285.859 analysierten
Basenpaaren konnten 48 Transversionen festgestellt werden, womit die Fehlerrate der
Polymerase bei 1,68 x 10-4 liegt. Die Fehlerrate bzw. Genauigkeit fr die AmpliTaq Gold
Polymerase wird vom Hersteller [Applied Biosystems] als 1-2 x 10-5 angegeben. Die
Berechnung der Fehlerrate der Polymerase gestaltet sich jedoch schwierig, da an der
endgltigen Ausprgung der vorliegenden Sequenzen der Klone nicht nur eine, sondern
mehrere Polymerasen als Einflussquellen beteiligt sind. So sind dies insgesamt vier
Polymerasen: die AmpliTaq Gold Polymerase der initialen Amplifikation, die ABgene Taq
Polymerase [ABgene] der Kolonie-PCR, die Polymerase der in vivo Replikation durch E. coli
und die Polymerase der finalen Sequenzierreaktion [Applied Biosystems]. Der zehnfach
hhere beobachtete Wert an Transversionen kann daher als Resultat der einzelnen
Fehlerraten der hintereinander geschalteten Polymerasen betrachtet werden.
Die Qualitt der DNA-Ausgangsmolekle fr die jeweilige PCR spielt hinsichtlich der
mglichen Fehleinbauten der Polymerase sicherlich eine ebenfalls nicht zu unterschtzende
Rolle. Weiterhin wre denkbar, dass einige kontaminierende Sequenzen, die nicht als solche
erkannt wurden, die Berechnung des Anteils an Transversionen verflschen. Dem kann
jedoch entgegnet werden, dass der Anteil an Transversionen innerhalb der regulren
Mutationen ebenfalls sehr gering ist und daher die wenigen echten Transversionen in der
Regel als charakteristisch fr einige Haplogruppen gelten, was wiederum eine Identifikation
einfach macht.

160

Diskussion
Es ist lange bekannt, dass innerhalb der HVR I hufig wiederkehrende Mutationen in
phylogenetisch entfernten mitochondrialen Linien zu finden sind (Richards et al. 1996).
Besonders fr die Klassifizierung von Haplogruppen stellen Parallel- und Rckmutationen
besondere Probleme dar. Finnil et al. (2001) weisen darauf hin, dass in der HVR der Anteil
an Parallelmutationen 31-fach hher ist, als im kodierenden Bereich des mitochondrialen
Genoms. Es scheint daher, dass eine gewisse Heterogenitt bezglich der Mutationsraten
innerhalb der HVR I herrscht, obwohl diese Region keinem selektiven Druck unterliegt.
Hinsichtlich der Verteilung der HVR I Mutationen und deren Hufigkeiten existieren seitens
rezenter Daten bereits einige Hypothesen, die eine unterschiedliche Mutationsrate
bestimmter Positionen zu erklren versuchen. Studien zu Mutationen in Keimbahn-,
Tumorzellen, sowie Heteroplasmien in Stammbaumstudien, weisen ebenfalls darauf hin,
dass hier auffllig hufig Positionen betroffen sind, die auch als phylogenetisch polymorphe
Positionen der HVR I bekannt sind (Stoneking 2000, Tully et al. 2000, Fliss et al. 2000,
Sigurdardottir et al. 2000, Forster et al. 2002).
Zahlreiche populationsgenetische Arbeiten beschreiben die unterschiedlichen Mutationsbzw. Substitutionsraten der einzelnen Positionen innerhalb der mtDNA Variabilitt und
definieren in unterschiedlichen Anstzen Positionen, die eine gesteigerte Mutationsrate
besitzen und daher als fast sites (Excoffier & Yang 1999), hot spots (Stoneking 2000) oder auch
als speedy transitions (Bandelt et al. 2002) bezeichnet werden. In Tabelle 28 sind zum
Vergleich die als post mortem hot spots definierten Positionen der vorliegenden Arbeit mit
Werten aus Studien zu in vivo Mutationsraten aufgetragen (Malyarchuk & Rogozin 2004,
Bandelt et al. 2002, Excoffier & Yang 1999, Wakeley 1993, Hasegawa et al. 1993). Eine
vergleichbare Arbeit zu Degradierungsmustern, post mortem Substitutionsraten und deren
Verteilung auf der HVR I auf Basis von Daten alter DNA liegt bisher nur von Gilbert (et al.
2003ab) vor.
Anhand der Tabelle 28 wird deutlich, dass bezglich der Definition von Positionen mit
hoher Mutationsrate bereits einige Differenzen bestehen, die mglicherweise auf die
unterschiedlich verwendeten methodischen Anstze zurckzufhren sind (Malyarchuk &
Rogozin 2004, Gilbert et al. 2003a). Innerhalb des vergleichbaren Bereichs aller Studien (np
16092-16362) sind insgesamt 110 hochvariable Positionen zu beobachten. Von den 39
signifikanten hot spots dieser Arbeit fallen 28 in diesen Bereich. Die Gesamtzahl von 110
fraglichen hot spot-Positionen scheint entsprechend der untersuchten Lnge von 271
Basenpaaren sehr hoch zu sein. Tatschlich sind davon 37 Positionen (33,6%) nur von jeweils
einer einzigen Studie besttigt. Darunter befinden sich neun Positionen welche sich lediglich
durch Daten alter DNA von Gilbert (et al. 2003b, Erratum) (A16219) sowie in der
vorliegenden Arbeit (T16094, T16095, T16099, C16133, C16185, C16190, C16222, C16259)
definiert werden.

161

Diskussion
Tabelle 28. Vergleich derjenigen Positionen, fr die eine gesteigerte Mutationsrate festgestellt
wurde. Fr die Ergebnisse der vorliegenden Arbeit sind nur die P-Werte der signifikant
unterschiedlichen Positionen (t0,05) angegeben. Die Daten von Gilbert et al. 2003b, Erratum (G03),
Excoffier & Yang 1999 (EY99) und Meyer et al. 1999 (M99) wurden als Quartile standardisiert, welche
einer durchschnittlich x-fach hheren Mutationsrate entsprechen. Die Positionen mit signifikant
hherer Mutationsrate aus den brigen Arbeiten (Malyarchuk & Rogozin 2004, MR04; Bandelt et al.
2002, B02; Wakeley 1993, W93 und Hasegawa et al. 1993, H93) sind mit X angegeben. Der hellgrau
hinterlegte Bereich entspricht dem vergleichbaren Abschnitt aller acht Studien. Die Querbalken
begrenzen den untersuchten Bereich der einzelnen Arbeiten: 15997-16409 vorliegende Arbeit; 1605616409 (G03); 16092-16365 (MR04); 16051-16365 (B02); 16024-16362 (EY99); 16024-16382 (M99), 1613016379 (W93) und 16024-16362 (H93).

T
T
A
A
T
T
T
T
T
C
C
C
C
T
G
C
T
T
G
C
C
C
G
A
A
C
C
C
T
C
C
C
A
A
C
C
C
C
C
T
C
C
C
T
A
G
C
A
T
C
A
C
C
C
T
A
A
T
C
A
C
A
C

np

16002
16025
16051
16078
16086
16090
16092
16093
16094
16095
16099
16111
16114
16126
16129
16133
16136
16140
16145
16147
16148
16150
16153
16163
16166
16167
16168
16169
16172
16173
16176
16179
16182
16183
16184
16185
16186
16187
16188
16189
16190
16192
16193
16209
16212
16213
16214
16216
16217
16218
16219
16221
16222
16223
16224
16227
16230
16231
16232
16233
16234
16235
16239

0,0012
0,0012

np

X
X
X
0,0018
0,0018
0,0018
0,0018
0,0000
0,0195
0,0195
0,0171

X
X

X
X

3
1

X
X
X
X

X
X
X
X

4
4

X
X

0,0183
X

X
X
X

0,0393

X
X
X
X
X

X
2

X
X

X
3

0,0000

X
X
X
X
X
X

X
X
X

2
2

3
2

X
0,0058
0,0393
0,0165
0,0063
0,0000
0,0000
0,0058
0,0007

1
2

4
4

1
1
1
1

X
X
X
X
X
X
X
X
X

X
X
X
X
X
X
X
X
X
X
X
X

3
4

X
X
X
X

X
X

4
4

X
1
0,0000
0,0085

2
4

0,0000

X
X

X
1

3
X

X
X

X
X
X

X
X
X

2
3
2

A
C
T
C
C
T
G
C
C
A
C
C
C
T
C
A
C
C
T
G
C
C
T
A
C
C
C
A
C
C
C
T
A
C
T
A
T
A
A
G
C
T
C
C
A
C
T
C
C
T
T
C
C
C
C
C
C
C
C
A
A
T

16241
16242
16243
16245
16248
16249
16255
16256
16257
16258
16259
16260
16261
16263
16264
16265
16266
16270
16271
16274
16278
16287
16288
16289
16290
16291
16292
16293
16294
16295
16296
16298
16300
16301
16304
16309
16311
16316
16318
16319
16320
16325
16327
16335
16343
16344
16352
16354
16355
16356
16357
16360
16362
16375
16376
16377
16378
16379
16394
16399
16402
16406

p
0,0406

X
X
X
X
X

0,0059

X
X
0,0000
0,0406
X
X
1
4
2
2

3
1
1
2

X
X
X
X
X
X

X
X
X
X
X
X

0,0021

0,0000

1
1
2

X
X
X
X

2
1
3

X
X
X
X
X
X

X
X

X
X

X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X

X
2

2
2

4
X
4

2
4

X
X

2
4
4
4

X
X

2
3
4

X
X

X
X

X
X
X
X
X

4
4
4

3
4

2
2

X
X

2
0,0001

X
X
X
X
X
X

X
X
X
X
X
X
X

0,0000
0,0050
0,0050
0,0050
0,0005
0.0333
0,0004
0,0051
0,0051

162

Diskussion
Dagegen stimmen insgesamt 20 von 28 Positionen in ihrer gesteigerten Mutationsrate mit
sowohl in vivo als auch post mortem-Daten berein. Dies entspricht 71,4% der hot spots dieser
Arbeit und 18,2% aller Positionen des vergleichbaren Bereichs. Hierunter finden sich die
sechs Positionen T16093, T16172, C16187, T16189 und T16311, die von mindestens sieben der
acht beteiligten Studien besttigt sind und die allesamt als Parallelmutationen in
verschiedensten Haplogruppen vorkommen (z.B. Richards et al. 2000). Weitere 14
signifikante Positionen der vorliegenden Arbeit (T16092, C16114, C16150, A16183, C16184,
C16186, C16188, C16221, T16224, C16242, T16249, A16260, T16298 und T16356) stimmen mit
Daten mindestens einer der rezenten Studien berein und finden sich ebenfalls vermehrt als
Parallelmutationen in den unterschiedlichen mtDNA-Linien. Insgesamt acht signifikante hot
spots finden keine Entsprechung in den Daten der zum Vergleich stehenden Arbeiten
(T16094, T16095, T16099, C16133, C16185, C16190, C16222, C16259). Bis auf Position T16099
kommen nur alle Mutationen mindestens einmal in einer Haplogruppe vor
(http://www.mitomap.org/, Richards et al. 2000), die Positionen T16094, C16185, C16222,
C16259 sind als Parallelmutationen sogar in mindestens drei Haplogruppen vertreten,
wovon jedoch keine fr eine bestimmte Hg bestimmend ist.
Umgekehrt finden sich auch 18 Positionen, die bereinstimmend eine erhhte Mutationsrate
in vivo aufweisen (und mindestens von vier der sechs Studien besttigt sind), welche auf
Basis der vorliegenden aDNA-Sequenzen alle von Deaminierung betroffen sind, aber keine
signifikant hhere post mortem Mutationsrate zeigen (C16111, C16148, T16209, C16223,
C16234, C16256, G16274, C16278, C16290, C16291, A16293, C16294, T16304, A16309, G16319,
C16320, C16355, C16362).
Stattdessen finden sich unter den 13 cold spots der vorliegenden Arbeit, die fr den
vergleichbaren Bereich definiert wurden, vier Positionen, die in vivo eine erhhte
Mutationsrate aufweisen und von mindestens einer Studie besttigt werden (C16173 (B02);
G16213 (MR04, B02, W93); C16245 (MR04, B02) sowie die Position G16319 (alle Studien auer
EY99)).
Insgesamt zeigt sich in 16 bereinstimmungen mit den Daten von Malyarchuk & Rogozin
(2004) die grte hnlichkeit, gefolgt von Bandelt et al. 2002 (15), Hasegawa et al. 1993
(neun), Wakeley 1993 (acht) und Excoffier & Yang 1999 und Meyer et al. 1999 (je sieben).
Erstaunlicherweise zeigen sich zur vergleichbaren post mortem-Studie von Gilbert (et al.
2003b) nur acht bereinstimmungen. Die Erluterungen hierzu werden weiter unten
dargelegt.
Es lsst sich grundstzlich feststellen, dass bezglich der Hufigkeiten von
Basensubstitutionen und deren Verteilung innerhalb der vergleichbaren Region der HVR I
Unterschiede zwischen der in vivo und post mortem Mutagenese bestehen. Es zeichnet sich ab,
dass die hydrolytische Deaminierung als hufigste Ursache von Basensubstitutionen (vgl.
Kap. 3.6.2) innerhalb der untersuchten Region von np 15997-16409 gleichfrmige und
grtenteils zufllige Verteilung aufweist. Fr die beobachteten sehr hohen post mortem
Substitutionsraten der Basen C und G, welche ebenfalls auf eine Deaminierung des Cytosins
auf dem H-Strang zurckzufhren sind (Hofreiter et al. 2001, Gilbert et al. 2003b), liegt eine
Normalverteilung vor (vgl. Kap. 6.3.3).

163

Diskussion
Es kann daher angenommen werden, dass im Rahmen der postmortalen hydrolytischen
Prozesse je nach Fortschritt der DNA-Degradierung die Wahrscheinlichkeit fr eine
Deaminierung beispielsweise jedes Cytosins als gleich hoch angesehen und daher die
Hufung der Substitutionen als zufllige Summe erachtet werden kann, die sich im Laufe
der Zeit an der betreffenden Position ansammelt.
Die Definition von fraglichen hot spots auf Basis von degradierten bzw. modifizierten DNASequenzen ist allgemein als schwierig zu betrachten. Es konnte deutlich nachgewiesen
werden, dass die Anzahl der Substitutionen eines PCR-Produkts von der Produktlnge
abhngt (vgl. Kap. 6.3.1, Abbildung 29). Das bedeutet gleichermaen, dass bei
fortgeschrittener Degradierung und direkt bedingter Fragmentierung von DNA-Moleklen
ebenfalls eine erhhte Anzahl von Substitutionen zu finden ist. Dass dieser Umstand einen
direkten Vergleich mit anderen aDNA-Daten erschwert, lsst sich an einem Beispiel von
Gilbert (et al. 2003a) erlutern. Gilbert berichtet von einer low damage region (LDR1) von ca.
25 Basenpaaren im Bereich von np 16370-16395 und postuliert ferner einen mglichen Schutz
dieses Bereichs durch eine Assoziation mit einem Protein, wie auch fr den Bereich MT5 (np
16194-16208, Ohno et al. 1991, Meyer et al. 1999) angenommen wird. Aus den Angaben der
Publikation wird jedoch deutlich, dass dieser Abschnitt durch ein insgesamt ca. 400bp langes
PCR-Produkt (np 16055-16410) amplifiziert wurde. Eine Amplifikation ber diese Lnge ist
jedoch im Rahmen von Analysen degradierter DNA unblich. Dennoch macht es deutlich,
dass in diesem Fall nur diejenigen Molekle amplifiziert wurden, welche noch intakt waren,
d.h. ohne Depurinierungen bzw. vielen Deaminierungen. Es ist demnach nicht
ungewhnlich, dass ein Produkt dieser Lnge daher vergleichsweise weniger Substitutionen
aufweist als ein Krzeres. Diese Beobachtung lsst sich anhand der wenigen Klone, die fr
das lange 440bp lange Fragment V vorliegen, besttigen.
Der Vergleich mit Werten dieser Arbeit, in welcher der betreffende Bereich der LDR1 durch
das 162bp lange Fragment IV amplifiziert wurde, zeigt stattdessen, dass gerade in diesem
Bereich eine Hufung von Deaminierungen vorliegt, die vor allem im Bereich des C-stretches
(np 16375-16380) fnf signifikante Positionen aufweist (vgl. Kap. 6.3.3).
Einen weiteren Hinweis auf die formal unzulssige Vergleichbarkeit mit den Daten von
Gilbert (et al. 2003a, Erratum) liefert die Tatsache, dass die Positionen 16129, 16172, 16187
und 16189, deren Daten ebenfalls nur durch die Amplifikation des genannten langen
Abschnitts erhoben wurden, sich deutlich von Ergebnissen der brigen (inkl. der
vorliegenden) Arbeiten unterscheiden (Tabelle 28). Dieser Umstand ist insofern misslich, als
dass diese vier der sechs Positionen darstellen, in welchen eine sehr deutliche
bereinstimmung der in vivo und post mortem berechneten Daten der vorliegenden Arbeit
vorliegen, somit aber keine weitere Besttigung durch aDNA-Daten erfahren.
Als Ursache fr die unterschiedlichen Mutationsraten in vivo wie auch post mortem wird
hufig die Sekundrstruktur der DNA herangezogen (Malyarchuk & Rogozin 2004), welche
mglicherweise auch fr die Situation nach dem Tod des Organismus eine Rolle spielt
(Gilbert et al. 2003b), was jedoch bislang nicht nachgewiesen werden konnte. Als weitere
Faktoren, die neben den Reparaturmechanismen (Bogenhagen 1999) die Integritt des DNAMolekls in vivo bestimmen, knnen Bereiche angefhrt werden, die eine (mgliche)

164

Diskussion
funktionale Aufgabe besitzen. Dies betrifft den Bereich des stop codons des 7S DNA
Stranges (16104-16106) als auch den eines mglichen Kontrollelements MT5 (np 16194-16208;
siehe oben bzw. Ohno et al. 1991, Meyer et al. 1999, Gilbert et al. 2003a). Bei der Betrachtung
der Mutationsraten beider Bereiche zeigt sich jedoch keine signifikante Verringerung der
Mutationsrate (vgl. Abbildung 32).
Auch die von Malyarchuk & Rogozin (2004) als cold beschriebenen CAT Trinukleotide, die
sich im Rahmen des Motivs GTACAT (bzw. KTNCNK) wiederholt an np 16099-16101, 1611516117, 16159-16161, 16236-16238, 16306-16308, 16313-16315, 16321-16323, 16332-16334 und
16339-341 wieder finden und deren Funktion auch in vivo ungeklrt ist, knnen innerhalb
des vorliegenden Datensatz nicht als konserviert beschrieben werden.
Die Gesamtbetrachtung der Hufigkeitsverteilung der post mortem Mutationsrate legt die
Vermutung nahe, dass, sofern in vivo etwaige Mechanismen oder Assoziationen bestehen
(welche in der Literatur ebenfalls nur als Vermutungen formuliert werden), die die
Heterogenitt der post mortem Substitutionsrate direkt beeinflussen, diese postmortal keinen
erkennbaren Einfluss auf die Konservierung bzw. Degradierung bestimmter Bereiche haben.
Ferner lsst sich feststellen, dass auch jegliche Interpretation von Hufigkeitsverteilungen
der Mutationen seitens der Untersuchungen degradierter DNA nur unter Vorbehalt zu
betrachteten sind. Daher sind Rckschlsse auf die Situation in vivo, wie sie von Gilbert (et
al. 2003b) angedeutet werden, nicht zulssig.
Insgesamt kann festgestellt werden, dass die post mortem entstandenen Basensubstitutionen auch wenn sie, wie gezeigt werden konnte, in geringem Anteil den existierenden Mutationen
und vor allem den bekannten Parallelmutationen entsprechen - fr die
Haplotypenbestimmung keine wesentliche Rolle spielen, da sie durch die verwendete
Reproduktionsstrategie als solche erkannt werden und daher bei der Bestimmung der
Haplogruppe ausgeschlossen werden knnen.

165

Diskussion

7.2 Die Authentizitt der Proben in der Gesamtanalyse


Im Folgenden ist eine umfassende Gesamtbeurteilung der Einzelergebnisse zu den
jeweiligen Individuen im Hinblick auf deren Authentizitt aufgefhrt. Hierbei soll in erster
Linie die allgemeine Plausibilitt des Erhalts endogener DNA diskutiert werden. In die
individuelle Ergebnisdiskussion zur Authentizitt der untersuchten Proben flieen in erster
Linie die Ergebnisse der Haplogruppenbestimmung (Kap. 6.2.1.1) und der RFLP-Analyse
(Kap. 6.2.1.2) unter den in Kap. 5.4 (Abbildung 19) vorgestellten Kategorien ein. Diese wird
durch die Ergebnisse der morphognostisch beurteilten Probenerhaltung, der externen
Diagenese-Studie mittels SAXS-Analyse (Kap. 6.1.2), des Amplifikationserfolgs (Kap. 6.1.1)
und der Amplifikation von langen mtDNA Fragmenten (Kap. 6.2.1.3) sowie von nuklerer
DNA (Kap. 6.2.2) untersttzt. Ergnzend wird auch die allgemeine post mortem
Substitutionsrate (im Vergleich von Proben gleicher Fundorte) angefhrt (Kap. 6.3.1).
Die Gesamtanalyse der Ergebnisse erfolgt in alphabetischer Reihenfolge und die
Klonsequenzen sind in ebensolcher im Anhang aufgefhrt (Kap. 10.5). Wurden mehrere
Individuen eines Fundortes/Grberfeldes untersucht, folgt auf die Einzeldiskussion eine
Gesamtbeurteilung im Fundkontext. Hierbei soll weitestgehend der Forderung nach einer
umfassenden Diskussion aller Einzelergebnisse unter Einbezug der post excavation history der
Proben entsprochen werden, wie sie vermehrt in der aktuellen Literatur gefordert wird
(Gilbert et al. 2005ab).
Die Probe ASP2 des sterreichischen Fundortes Asparn-Schletz zeigt in allen 79
Klonsequenzen von acht PCR-Produkten aus zwei unabhngigen Extraktionen eines
Molaren reproduzierbar keine Abweichung von der Cambridge Reference Sequence CRS
(Anderson et al. 1981). Es sind keine kontaminierenden Linien feststellbar. Somit kann mit
groer Wahrscheinlichkeit Hg H angenommen werden. Da sich jedoch auch einige
Haplotypen der Hg U bzw. R im Bereich der HVR I nicht von der CRS unterscheiden, wurde
zur genaueren Hg-Bestimmung ein Enzymverdau mit Hinf I und Alu I charakteristischer
Positionen der coding region nachgeschaltet. Hierdurch kann Hg H sowohl durch den fr Hg
H charakteristischen Wegfall der Alu I Schnittstelle sowie durch das negative Ergebnis von
Hinf I, welches ASP2 zudem von Hg U ausschliet, besttigt werden. Der
Amplifikationserfolg der vier berlappenden Primerpaare von 100% deutet auf eine
ausreichend groe Menge an mtDNA-Moleklen der entsprechenden Lnge von ca. 200bp
hin. Die allgemeine post mortem Substitutionsrate der Produkte ohne UNG-Verwendung
zeigt mit 22,64 im Vergleich den zweitgrten Wert aller untersuchter Proben. Von den
acht PCR-Produkten aus zwei unabhngigen Extraktionen wurde pro Fragment eines mit
UNG amplifiziert. Die UNG-Klonsequenzen knnen besttigen, dass jedoch auch intakte
Molekle derselben Lnge amplifizierbar sind. Dagegen war die Amplifikation des langen
mtDNA Fragments V sowie von nuklerer DNA nicht mglich.
Insgesamt kann bei ASP2 ein fortgeschrittener Zustand der DNA-Degradierung bzw.
Fragmentierung festgestellt werden, das Ergebnis jedoch im Rahmen der Gesamtanalyse als
authentisch im Sinne der Kategorie 1 betrachtet werden. ASP2 ist die einzige vorliegende

166

Diskussion
sterreichische Probe der frhen LBK. Eine weitere Diskussion im Rahmen des
Fundortkontexts kann daher nicht erfolgen.
In den Klonsequenzen von BRU4 des Thringer Fundortes Bruchstedt knnen drei
verschiedene Linien verfolgt werden. Es sind dies Haplotyp 16189C, 16311C (Hg H) des
Verfassers der vorliegenden Arbeit, deren charakteristische Positionen in fnf von acht PCRProdukten festgestellt werden und Haplotyp 16304C (Hg H), dessen Sequenz ebenfalls bei
einem Labormitarbeiter zu finden ist, in Klonen eines PCR-Produkts. Schliet man diese
Klonsequenzen als Kontamination der naheliegenden putativen Quellen aus, so verbleiben
Sequenzen des Haplotyps 16192T, 16256T, 16270T, 16362C, die als Hg U5a1 (Tambets et al.
2004) bestimmt werden knnen. Diese vier Nukleotidpositionen knnen jeweils aus allen
vier Fragmenten der unabhngigen Extraktionen besttigt, Hg H dagegen nur in zwei
Fragmenten reproduziert werden. Die Amplifikation des 440bp langen Fragments V ist bei
einer Extraktion erfolgreich und die Direktsequenzierung zeigt ebenfalls Ht 16189C, 16311C
(Hg H) des direkten Bearbeiters. Da die Kontaminationsrate bei BRU4 mit 44,2% sehr hoch
ist, wurde keine allgemeine post mortem Substitutionsrate bestimmt. Der
Amplifikationserfolg liegt bei etwa 73,7%, welcher jedoch aufgrund der hohen
Kontaminationsrate wenig aussagekrftig ist. Da die beiden unabhngigen Extraktionen an
einem Langknochenfragment durchgefhrt wurden und eine dritte unabhngige
Reproduktion aus einer weiteren anatomischen Region nicht unternommen werden konnte,
kann die authentische Konsensussequenz im Sinne von Kategorie 3 bestimmt werden.
Die 84 Klonsequenzen aus zwei unabhngigen Extraktionen des mesolithischen russischen
Individuums CHE4 aus Samara Guberna zeigen einen reproduzierbaren eindeutigen
Haplotyp 16192T, 16256T, 16270T, 16294T (Hg U5a1). Lediglich ein Klon des Fragments II
und einer des Fragments III weichen von dieser Sequenz ab. Der erfolgreiche Verdau mit
Hinf I in der coding region kann die Einordnung in Hg U besttigen. Die geringe
Kontaminationsrate (2,6%), der Amplifikationserfolg (100%) und die Reproduzierbarkeit des
Haplotyps durch die erfolgreiche Amplifikation der langen mtDNA Fragmente V aus beiden
Extraktionen weist auf eine sehr gute Erhaltung mitochondrialer DNA hin. Die
Amplifikationen der Extraktion A wurden alle mit UNG durchgefhrt. Die post mortem
Substitutionsrate der PCR-Produkte der Extraktion B ist mit 5,43 sehr gering und scheint
den allgemein guten Zustand der DNA-Molekle zu besttigen. Dieser Umstand entspricht
im Wesentlichen auch der subjektiv als sehr gut beurteilten, allgemeinen Erhaltung der
Knochenmatrix des Individuums. Die Amplifikation von nuklerer DNA blieb dagegen auf
zwei loci beschrnkt und war zudem nicht reproduzierbar. Eine weitere Einbindung in den
Kontext des Fundortes kann bei diesem Fund nicht erfolgen. Insgesamt kann jedoch der
definierte Haplotyp des Individuums CHE4 als authentisch (Kategorie 2) betrachtet werden.
Die 88 Klonsequenzen aus jeweils unabhngigen Extraktionen eines Molaren des
Individuums DEB1 des linearbandkeramischen Fundortes Derenburg beinhalten keine
kontaminierenden Sequenzen (0% Kontaminationsrate). Als Haplotyp kann eindeutig und
reproduzierbar 16147A, 16172C, 16223T, 16248T, 16355T und damit Hg N1a bestimmt
werden. Die Amplifikation der Fragmente II, III und IV wurden bei Extraktion A mit UNG

167

Diskussion
durchgefhrt. Die brigen PCR-Produkte zeigen mit 13,5 eine durchschnittliche post
mortem Substitutionsrate. Die Amplifikation des langen mtDNA-Fragments V ist bei zwei
von drei Extraktionen erfolgreich und kann den Haplotyp des Individuums besttigen. Fr
einen generell guten Erhaltungszustand der DNA von DEB1 spricht weiterhin der hohe
Amplifikationserfolg von 100% der berlappenden Fragmente I-IV bzw. 71,4% inklusive
langer Fragmente und die erfolgreiche Amplifikation von kurzen nukleren loci bis ~150bp.
Zudem stimmt die molekulargenetische Geschlechtsbestimmung mit der morphologischen
berein. Aufgrund der Gesamtbetrachtung der Einzelergebnisse sowie der Tatsache, dass
DEB1 die sehr seltene Hg N1a trgt, sind die Sequenzen des Individuums DEB1 als
authentisch (Kategorie 1) zu sehen.
Bei Individuum DEB2 zeigen die Sequenzen von insgesamt 114 Klonen eine hohe
Kontaminationsrate von 38,6 %. Dies ist vor allem damit zu begrnden, dass die
Amplifikationen der Fragmente I-IV der Extraktion A mit UNG eindeutig von den
Klonsequenzen der Extraktion B abweichen. Die Klonsequenzen von Extraktion B zeigen den
Haplotyp 16224C, 16311C der Hg K, die UNG-Sequenzen der A Extraktion zwei Linien (u.a.
16189C; eine Kontamination durch den Verfasser der vorliegenden Arbeit kann jedoch
ausgeschlossen werden). Die wiederholte Amplifikation von Extraktion A ohne UNG kann
die Positionen 16224C, 16311 besttigen, so dass diese in berlappenden Bereichen gelegenen
Positionen von jeweils vier unabhngigen PCR-Reaktionen bestimmt sind. Lange mtDNA
Fragmente knnen nicht amplifiziert werden. Initiale Versuche zur Amplifikation von
nukleren Markern ergaben bis auf Amelogenin ebenfalls keine Ergebnisse. Der
Amplifikationserfolg aus den Extrakten zweier Molaren zeigt mit 57,1% den geringsten Wert
im Vergleich mit allen typisierbaren Proben. Die allgemeine post mortem Substitutionsrate
wurde nicht bestimmt, da die Klone hufig konsistente post mortem Artefakte zeigen
(Fragment I und III). In der Gesamtbetrachtung der Ergebnisse wird deutlich, dass die
wenigen erfolgreichen PCR-Reaktionen auf eine sehr geringe Anzahl an Moleklen
zurckgehen, die zudem noch stark modifiziert sind. In Anbetracht der sehr reduzierten
Menge intakter Molekle ist die Amplifikation weniger kontaminierender aber intakter
Molekle durch die UNG-PCR nicht verwunderlich (vgl. Kap. 7.1.4). Das Individuum DEB2
stellt in somit ein Grenzfall der DNA-Erhaltung dar, dessen Authentifizierung nur auf der
Tatsache der mehrfachen unabhngigen Reproduktion der Hg K beruht (Kategorie 4).
Die 87 Klonsequenzen aus unabhngigen Extraktionen zweier Molaren des Individuums
DEB3 zeigen die teilweise aus vier unabhngigen PCR-Reaktionen reproduzierten
Positionen 16147A, 16172C, 16223T, 16248T, 16320T, 16355T und somit einen Haplotyp der
Hg N1a. Vier Sequenzen des Fragments III weichen von den brigen ab (16311C). Pro
berlappendes Fragment wurde jeweils eines mit UNG amplifiziert. Die post mortem
Substitutionsrate der PCR-Produkte ohne UNG-Einsatz liegt mit 14,21 vergleichbar nahe
bei DEB1. Die Amplifikationsrate fllt mit 64% gering aus, lsst sich aber grtenteils auf das
lngste berlappende Fragment I (187bp) sowie das lange Fragment V zurckfhren.
Letzteres konnte jedoch bei einer dritten Extraktion erfolgreich amplifiziert werden. Die
Sequenz weicht jedoch von der der kurzen berlappenden Fragmente ab, womit fr dieses
Produkt eine Kontamination angenommen werden muss. Dagegen zeigen die Produkte der
nukleren PCR-Reaktionen reproduzierbare Ergebnisse aus allen drei Extraktionen bis zu
einer Lnge von ca. 200bp. Auch die Ergebnisse der Geschlechtsbestimmung beider

168

Diskussion
Methoden stimmen berein. Insgesamt lsst sich feststellen, dass aufgrund der allgemeinen
erfolgreichen Reproduzierbarkeit der HV Region, der STR-Genotypisierung und der
Tatsache, dass DEB3 mit Hg N1a eine seltene europische Hg aufweist, die sich jedoch von
DEB1 unterscheidet, von einem Erhalt endogener DNA ausgegangen werden kann
(Kategorie 3).
Bei Individuum DEB4 ist in 68 Klonsequenzen keine kontaminierende Sequenz zu sehen (0%
Kontaminationsrate). Die charakteristische Position 16311C kann durch vier unabhngige
PCR aus wiederum zwei unabhngigen Extraktionen zweier Molaren besttigt werden. Die
genauere Einordnung die Hg erfolgt mittels Enzymverdau diagnostischer Positionen der
coding region, da 16311C in der HVR I als hufig wiederkehrende Mutation (siehe auch hot
spot Mutationen, Kap. 7.1.7) sowohl bei Hg U, H, HV als auch R zu beobachten ist (Richards
et al. 2000). Der Enzymverdau ergab den Ausschluss der Hg U und H, so dass HV (bzw. R)
als Hg bestimmt werden konnte. Der Amplifikationserfolg der vier kurzen Fragmente liegt
bei 100%, die Amplifikation des langen mtDNA-Fragments ist nur einmal in fnf Versuchen
erfolgreich. Die Sequenzierung ergibt den Haplotyp 16126C 16163G 16186T 16189C 16221T
16294T (Hg T1). Eine wiederholte Amplifikation und Direktsequenzierung der vier kurzen
Fragmente kann die Position 16311C besttigen, so dass die Sequenz des Fragments V als
Kontamination eingestuft werden kann. Die post mortem Substitutionsrate von 17,6 des
Individuums liegt im oberen Drittel aller neolithischer Proben. Die Klonsequenzen der
einzelnen Fragmente zeigen keine konsistenten post mortem Artefakte, so dass von
modifizierten Moleklen in ausreichender Menge ausgegangen werden kann. Der Erhalt
nuklerer DNA konnte ebenfalls nachgewiesen und die Ergebnisse von sechs von zehn
Markern reproduziert werden. Das molekulargenetisch definierte Geschlecht des
Individuums stimmt ebenfalls mit der morphologischen Bestimmung berein. Insgesamt
betrachtet, kann aufgrund der reproduzierbaren Ergebnisse und der subjektiven exzellenten
Erhaltung der Molaren vom Erhalt endogener DNA des Individuums DEB4 ausgegangen
werden (Kategorie 1).
Die 89 Klonsequenzen des fnften Individuum aus Derenburg DEB5 zeigt ebenfalls
reproduzierbar die Position 16311C und kann mit Hilfe des Enzymverdaus in die Hg HV
bzw. R eingeordnet werden. Fnf Klonsequenzen weichen von den beobachteten ab
(Kontaminationsrate 3,4%). Eine davon kann als Rckmutation von 16311 durch eine post
mortem erfolgte Deaminierung erklrt werden. Ein weiterer Klon des Fragments III kann
durch np 16223T, 16255A, 16278T, 16300G als Teilsequenz der Hg X bestimmt werden. Die
fr Hg X weiterhin charakteristische Mutation 16189C kann jedoch in den Klonen des
Fragments II nicht festgestellt werden. Drei weitere Sequenzen zeigen die Mutation 16309G.
Beide kontaminierende Sequenzen sind nicht unter den typisierten Labormitarbeitern oder
betreffenden Archologen zu finden. Das lange mtDNA-Fragment V sowie nuklere DNA
lieen sich nicht nachweisen. Eine mgliche verwandtschaftliche Beziehung des
Individuums zu DEB4 des gleichen Haplotyps kann daher nicht festgestellt, jedoch auch
nicht ausgeschlossen werden, so dass im Rahmen der weiteren populationsgenetischen
Analyse dieser Haplogruppe nur ein Individuum einflieen kann. Die post mortem
Substitutionsrate von DEB5, dessen PCR-Produkte alle ohne den Einsatz von UNG
amplifiziert wurden, liegt mit 17,7 im Bereich der vier anderen Individuen aus Derenburg.
Der hohe Amplifikationserfolg von 81,9%, die eindeutige Reproduzierbarkeit der Ergebnisse

169

Diskussion
und der allgemeine vergleichbar gute Erhaltungszustand der Probe lassen den Nachweis
authentischer alter DNA plausibel erscheinen (Kategorie 2).
Die fnf untersuchten Individuen des Grberfeldes bei Derenburg/Meerenstieg II zeigen im
Allgemeinen vergleichbare valide Ergebnisse, die weiterhin plausibel begrndet werden
knnen. Ein Vorteil der Derenburger Proben ist, dass sie zum Zeitpunkt der Probennahme
frisch geborgen waren und in ungewaschenem und unbearbeitetem Zustand khl lagerten.
Bei allen fnf Proben wurden Molaren zur DNA-Extraktion verwendet, die bei der
Probennahme noch in den Alveolen geschtzt waren. Dieser Umstand engt den Rahmen von
mglichen Kontaminationen vor der Bearbeitung weitgehend ein. Die subjektive Beurteilung
des Erhaltungszustand aller Molaren sowie der Erhaltung der Knochenmatrix der Proben
kann als sehr gut bezeichnet werden, somit ist der hohe Amplifikationserfolg sowie die
Reproduzierbarkeit von eindeutigen Ergebnissen nicht berraschend. Die vergleichbaren
post mortem Substitutionsraten der Proben weisen auf einheitliche vorherrschende
Bodenverhltnisse in Derenburg hin.
Unter den 79 Klonsequenzen des mesolithischen litauischen Individuums DON1 ist nur eine
Sequenz (16311C) in Fragment III zu beobachten, die von den brigen abweicht, womit die
Kontaminationsrate bei 1,7% liegt. Die charakteristischen Positionen des Haplotyps 16192T,
16270T der Hg U5a1 lassen sich eindeutig in den Sequenzen der unabhngigen Extraktionen
aus zwei Molaren bestimmen und besttigen. Die Zugehrigkeit zu Hg U kann durch
Enzymverdau mit Hinf I ebenfalls besttigt werden. Der Amplifikationserfolg ist mit 89%
berdurchschnittlich und die post mortem Substitutionsrate von 17,53 liegt vergleichbar
mit anderen reproduzierten Proben im Rahmen der erwarteten Modifikationen alter DNA.
Die Amplifikation des langen mtDNA Fragments sowie von nuklerer DNA ist bis auf einige
Signale des Markers Amelogenin nicht erfolgreich. Fr eine Probe des Femurs des
Individuums liegen Ergebnisse aus der externen SAXS-Analyse vor. Die Werte fr die
Indices der Dicke und Struktur der Kristalle der Knochenmatrix von DON1 weichen nicht
von den Werten der rezenten Vergleichskontrolle ab, so dass eine Erhaltung von endogener
DNA als wahrscheinlich erachtet werden kann. Die Gesamtbeurteilung der Ergebnisse fr
DON1 lassen den Erhalt authentischer DNA plausibel erscheinen (Kategorie 3).
Die 105 Klonsequenzen des Individuums DON2 zeigen insgesamt sieben identifizierbare
mtDNA Linien. Der besseren bersicht wegen sind diese in Tabelle 29 wiedergegeben:

Tabelle 29. Identifizierbare mtDNA-Linien in DON2. Erluterungen im Text.


Linie

HVR I Sequenz

Hg

Extraktion/Fragment

16145A 16176G 16209C 16223T 16390A

N1b

A II, IV

B II, III, IV

16257T

A III

B III

16223T 16298C 16325C 16327T 16355T

A II, III, IV

16192T 16256T 16270T

U5

A II, III

16294T 16296T 16304C

A III

CRS

H?

A III

16215G 16224C 16311C

B II, III, IV

170

Diskussion
Anhand der tabellarischen bersicht lsst sich feststellen, dass in Sequenzen aus der
Extraktion A eines Molaren sechs verschiedene Linien zu verfolgen sind und in den
Sequenzen der B Extraktion eines Kranialfragments drei Linien feststellbar sind. Die Linien 1
und 2 lassen sich in Sequenzen beider Extraktionen in unabhngigen PCR-Reaktionen
nachweisen. Linie 2 entspricht dem Haplotyp des Probengebers, eine Kontamination der
Probe durch diesen scheint daher sehr wahrscheinlich und kann aufgrund der Zuordnung
ausgeschlossen werden. Linie 1 knnte nach Kriterien der Reproduzierbarkeit die mgliche
echte Sequenz des Individuums DON2 darstellen, kann jedoch nur in zwei Fragmenten
reproduziert werden. Die Ergebnisse der Probe werden daher aufgrund der insgesamt
hohen Anzahl an kontaminierenden Linien in Sinne von Kategorie 7 verworfen.
hnlich verhlt es sich mit den 89 Klonsequenzen des polnischen mittelneolithischen
Individuums DUD1. Lediglich in den Sequenzen des Fragments II lsst sich np 16192T
reproduzieren. In Extraktion A desselben finden sich zustzlich Sequenzen, die der CRS
entsprechen. Die Sequenzen der brigen Fragmente zeigen ebenfalls mehrere Linien, jedoch
ist vor allem in den berlappenden Bereichen keine Konsistenz einer Position zu beobachten,
d.h. keine derselben lsst sich reproduzieren. Die einzelnen Positionen finden sich in
bekannten Hgs wieder, stellen jedoch ber die vier Fragmente verteilt eine mosaikartige
Verteilung dar. Aufgrund der beobachteten Situation wurden keine weitere Extraktionen
oder PCR-Reaktionen mehr unternommen und die Ergebnisse des Individuums DUD1
verworfen (Kategorie 7).
In den 97 Klonsequenzen des Individuums DUD2 lassen sich mindestens zwei mtDNALinien feststellen. Eine Linie entspricht dem Haplotyp des Verfassers der vorliegenden
Arbeit (16189C, 16311C) und ist nur in den Klonen der Extraktion B zu sehen. Die andere
Linie kann durch die np 16189C, 16270T als Hg U5b1 bestimmt werden. Die Position 16270T
kann in Fragment III durch drei unabhngige PCR besttigt werden, wenngleich in den
Sequenzen der B Extraktion jeweils nur durch einen Klon. Acht Sequenzen der B-Extraktion
entsprechen in Fragment III zudem der CRS, womit in diesem Fragment eine dritte Linie
gezeigt werden kann. In Klonsequenzen der erfolgreichen Amplifikation des langen mtDNA
Fragments V aus Extraktion B findet sich ebenfalls der Haplotyp 16189. Dahingegen kann die
Mutation 16270T in keinem der Klone festgestellt werden. Aus mehreren PCR-Reaktionen
der Extraktion A zur Amplifikation nuklerer DNA knnen sogar reproduzierbare Allele
von drei kurzen STR-loci bestimmt werden, eine Besttigung durch Ergebnisse aus
Extraktion B ist jedoch nicht erfolgt. Ein Problem fr die Interpretation stellt Position 16189C
dar, die sich als hufig wiederkehrende Mutation sowohl im putativen Haplotyp von DUD2,
im Haplotyp des langen Fragments als auch in dem des Verfassers wiederfindet. Aus diesem
Grund kann fr die Sequenzen von Fragment II der B-Extraktion ebenfalls ein Anteil an
Kontaminationen angenommen werden, die jedoch nicht unterschieden werden knnen.
Hiermit wird die Berechung der Kontaminationsrate (27,8%) ungenau. Der
Amplifikationserfolg von 75% der Probe ist aus diesem Grund ebenso nur als
Nherungswert zu sehen. Die Gesamtinterpretation der Authentizitt der Ergebnisse ist
durch die wiederkehrende Mutation 16189C erschwert, die zudem ein hot spot darstellt (vgl.
Kap. 7.1.7). Folgt man dessen ungeachtet streng den Kriterien der Reproduktion, so kann fr
DUD2 die Hg U5b1 angenommen werden (Kategorie 4).

171

Diskussion
Von 94 Klonsequenzen des Individuums FLO4 zeigen 79 reproduzierbar die Positionen
16126C, 16294T, 16304C der Hg T2. Alle drei Positionen liegen innerhalb der berlappenden
Bereiche, so dass sie jeweils durch vier unabhngige PCR-Reaktionen aus zwei
unabhngigen Extraktionen zweier Molaren besttigt sind. Fragment III der Extraktion A
zeigt in acht Sequenzen zustzlich die charakteristischen np 16224C, 16311C der Hg K. Ein
identischer Haplotyp findet sich auch unter den Labormitarbeitern. Weitere sieben
abweichende Sequenzen finden sich in Fragment I und III der Extraktion A. Die
Einzelpositionen knnen jedoch nicht eindeutig einer Hg zugeordnet werden. Das lange
mtDNA Fragment sowie nuklere DNA knnen nicht erfolgreich amplifiziert werden, der
Amplifikationserfolg der kurzen Fragmente liegt jedoch bei 100%. Allerdings zeigen die als
post mortem definierten Substitutionen (10,6) innerhalb der Klone mehrere Konsistenzen,
so dass insgesamt von einer geringen Menge an erhaltenen Moleklen ausgegangen werden
kann. In der Gesamtbetrachtung lassen sich die Ergebnisse des Individuums FLO4 in erster
Linie durch die Reproduzierbarkeit in Kombination mit dem hohen Amplifikationserfolg
und der subjektiv als gut beurteilten Erhaltung der beiden Molaren als authentisch ansehen
(Kategorie 3).
Die Sequenzen der Klone des Individuums FLO6 ergeben die Bestimmung des Haplotyps
16224C, 16249C, 16311C (Hg K). Insbesondere np 16224 und 16311 sind - im berlappenden
Bereich gelegen - durch vier unabhngige PCR aus Extraktionen zweier Molaren besttigt.
Die Fragmente I-III der Extraktion B wurden unter Verwendung von UNG durchgefhrt.
Hiervon weichen die Klonsequenzen des Fragments III vom Haplotyp FLO6 ab. Es lassen
sich Sequenzen mit den jeweiligen Positionen 16309A, 16311C feststellen, daneben auch
einige die in diesem Bereich der CRS entsprechen. Dementsprechend ist der Anteil an
kontaminierenden Sequenzen mit 25% im Vergleich zu anderen Proben hoch. Eine weitere
Amplifikation des Fragments III ohne UNG sowie eine Direktsequenzierung aller vier
Fragmente einer unabhngigen dritten Extraktion eines Molars besttigt jedoch den
Haplotyp 16224C, 16249C, 16311C der Hg K. Fragment V sowie nuklere DNA knnen nicht
nachgewiesen werden; der allgemeine Amplifikationserfolg der vier kurzen Fragmente liegt
bei 90%. Die hohe post mortem Substitutionsrate des Individuums FLO6 ist mit 17,6
vergleichbar mit Proben aus Derenburg. Der Anteil an Sequenzen mit post mortem
Substitutionen zeigt nur wenige Konsistenzen, womit eine Sttigung der Klone mit
variierenden post mortem Substitutionen noch nicht erreicht ist, was wiederum auf eine
modifizierte, aber ausreichende Menge an Ausgangsmoleklen hinweist. Als Summe der
Einzelergebnisse kann der Erhalt authentischer DNA des Individuums FLO6 als sehr
wahrscheinlich angesehen werden (Kategorie 3).
Im Rahmen der Magisterarbeit von Marc Tnzer (2005) wurden vier weitere Individuen
(FLO1, FLO2, FLO3, FLO5, vgl. Kap. 6) des linearbandkeramischen Grberfelds aus
Flomborn untersucht. Auch fr diese Proben liegen durchweg reproduzierbare Ergebnisse
fr die HVR I vor. Eine Amplifikation von nuklerer DNA war in keinem der Flle
erfolgreich. Ein langes mtDNA Fragment kann nur in einem Fall erfolgreich amplifiziert
werden, stellt jedoch eine Kontamination dar (vgl. Kap. 7.1.4). Soweit die generelle
Amplifizierbarkeit mitochondrialer DNA als vergleichendes Kriterium herangezogen
werden kann und kongruente Ergebnisse fr den Fundplatz Flomborn liefert, weichen doch
die post mortem Substitutionsraten der einzelnen Proben stark voneinander ab. Dieser

172

Diskussion
Umstand lsst sich durch zwei Beobachtungen erklren: zum einen weisen die Skelettfunde
von Flomborn unter subjektiver Beurteilung einen sehr heterogenen Erhaltungszustand auf
und zum anderen kamen im Gegensatz zu vergleichbaren Fundorten wie Halberstadt oder
Derenburg (bei welchen ausschlielich Molaren verwendet wurden) fr jedes Individuum
Proben unterschiedlicher anatomischer Regionen zum Einsatz, die sich ebenfalls in ihrer
spezifischen Eignung fr den Erhalt von Biomoleklen unterscheiden. Da der Fundplatz
Flomborn bereits vor ber 100 Jahren ergraben wurde, kann die post excavation history
(Gilbert et al. 2005) kaum erfasst werden (siehe auch Richter 1968/69). Die Tatsache jedoch,
dass bei sechs untersuchten Individuen sechs unterschiedliche Haplotypen valide bestimmt
werden konnten, spricht insgesamt gegen eine systematische Kontamination der Proben und
fr eine Authentizitt der erhaltenen DNA-Sequenzen.
In den 78 Klonsequenzen des linearbandkeramischen Individuums HAL1 aus Halberstadt
sind keine kontaminierenden Sequenzen nachzuweisen. Die fr die Bestimmung der Hg V
charakteristische Position 16298C liegt im berlappenden Bereich der Fragmente III und IV
und wird somit von vier unabhngigen PCR aus unabhngiger Extraktion zweier Molaren
besttigt. Bei zwei Sequenzen zeigt Position 16298 ein von Hg V abweichendes Thymin.
Diese beiden knnen als post mortem Deaminierungen bestimmt werden, da die betreffenden
Sequenzen weitere acht bzw. 12 CaT Transitionen aufweisen. Da die Position 16298C als
Einzelereignis im Bereich der HVR I auch bei Hg H zu finden ist, wurde ein Enzymverdau
mit Alu I durchgefhrt, wobei Hg H ausgeschlossen werden konnte. Der
Amplifikationserfolg der kurzen mtDNA Fragmente liegt bei 100% und die post mortem
Substitutionsrate des Individuums bei 17,5, wobei auch hier keine Sttigung der post
mortem Substitutionen in den Klonen festzustellen ist (0,72). Es knnen vereinzelt nuklere
loci mit kurzen Produktlngen amplifiziert jedoch nicht reproduziert werden. Das lange
mtDNA Fragment V kann in vier Versuchen ebenfalls einmal amplifiziert werden. Die
Sequenzierung ergibt eine bereinstimmung mit der CRS. Da dieses Ergebnis ebenfalls nicht
reproduziert wird (und in der coding region bereits H ausgeschlossen werden konnte), kann
hier von einer Kontamination ausgegangen werden. Insgesamt betrachtet kann der Erhalt
von endogener DNA fr das Individuum HAL1 als wahrscheinlich erachtet werden
(Kategorie 1).
Die 87 Klonsequenzen des Individuums HAL2 zeigen mit 16086C, 16147A, 16172C, 16223T,
16248T, 16320T, 16355T charakteristische Positionen der Hg N1a. Diese knnen in allen
Sequenzen sowohl aus Amplifikationen mit UNG (Extraktion B) als auch ohne (Extraktion
A) besttigt werden. Die Kontaminationsrate liegt bei 3,45% und der Amplifikationserfolg
der kurzen Fragmente bei 100%. Die post mortem Substitutionsrate liegt mit 10,9 unter den
Werten der beiden anderen untersuchten Individuen aus Halberstadt. Zum einen kann dies
aus der Tatsache resultieren, dass bei der Berechnung insgesamt weniger Sequenzen
einflossen, die nicht mit UNG behandelt waren. Zum anderen kann dies durch den
berdurchschnittlich guten Erhaltungszustand erklrt werden, der in Abbildung 13 (Kap.5.2)
deutlich wird. Letzterer besttigt sich im Amplifikationserfolg von nuklerer DNA. So liegen
fr sechs von zehn loci der STR-Genotypisierung reproduzierbare Ergebnisse vor. PCRProdukte, die eine Lnge von 250bp berschreiten, konnten jedoch nicht amplifiziert
werden. Die vergleichende Analyse der Einzelergebnisse des Individuums HAL2 macht den

173

Diskussion
Erhalt authentischer DNA sehr wahrscheinlich, zumal mit Hg N1a eine seltene europische
Hg nachgewiesen ist (Kategorie 2).
Von den 79 Klonsequenzen des Individuums HAL3 weist lediglich ein Klon in Fragment IV
eine abweichende Sequenz auf (16390A, Kontaminationsrate 1,26%). Die brigen Klone
zeigen im Vergleich zur CRS Mutationen an nps 16093C, 16126C, 16294T, 16296T, 16304C,
die charakteristisch fr Hg T2 sind. Bis auf Position 16093C knnen alle Positionen durch
vier unabhngige Versuche besttigt werden, da sie im berlappungsbereich der Fragmente
I und II, sowie III und IV liegen. Eine UNG-behandelte Amplifikation des Fragments I kann
den Erhalt von intakten Moleklen identischer Lnge besttigen. Der Amplifikationserfolg
der vier kurzen mtDNA Fragmente liegt bei 100%. Der Nachweis von nuklerer DNA sowie
des langen mtDNA Fragments V konnte jedoch nicht erbracht werden. Die post mortem
Substitutionsrate liegt mit 15 leicht ber dem Durchschnitt. Aufgrund der eindeutigen
Reproduzierbarkeit der Ergebnisse und des charakteristischen Degradierungsmusters,
welches in den Klonsequenzen bzw. durch die post mortem Substitutionsrate deutlich wird,
kann im Falle des Individuums HAL3 vom Erhalt authentischer DNA-Sequenzen
ausgegangen werden (Kategorie 2).
Die drei Individuen des neolithischen Fundorts Halberstadt zeigen durchweg
reproduzierbare Ergebnisse und weisen im Rahmen einer subjektiven Beurteilung einen sehr
guten Erhaltungszustand auf. Wie auch die Funde aus Derenburg wurden diese unmittelbar
nach der Grabung beprobt, bevor eine Weiterbearbeitung (Reinigung und morphologische
Bestimmung) der Skelette vorgenommen wurde. Dieser Umstand und die Tatsache, dass zur
Analyse der Individuen aus Halberstadt ausschlielich Molaren verwendet wurden, die zum
Zeitpunkt der Probennahmen noch geschtzt in den Alveolen vorlagen, verringert die
Wahrscheinlichkeit einer Kontamination im Zeitraum nach der Grabung.
Von den 62 Klonsequenzen des litauischen neolithischen Individuums KRE1 zeigen 58
reproduzierbar die charakteristischen Nukleotidpositionen 16192T, 16270T der Hg U5b. Vier
Klone des Fragments III aus Extraktion B zeigen die abweichenden Positionen 16217C,
16234T, 16235G. Die Kontaminationsrate liegt somit bei 8%. Eine Hg-Bestimmung der
fraglichen kontaminierenden Sequenzen kann nur unsicher erfolgen, denn es sind sowohl
die Positionen 16217C, 16234T (Sub-Hg B4) als auch 16217C, 16235G (Sub-Hg B4e) als
Mutationen in Sub-Hgs der asiatischen Hg B beschrieben (Yao 2002a; 2002b, 2004), jedoch
nicht in der vorliegenden Kombination bekannt. Dagegen besttigt die RFLP-Analyse die
Zugehrigkeit zur Hg Bestimmung U5b der HVR I. Die post mortem Substitutionsrate liegt
mit 11,5 unter dem Durchschnitt.
Fr den Erhalt ausreichend intakter Molekle spricht die erfolgreiche Amplifikation des
440bp langen mtDNA Fragments V aus einer Extraktion, welches ebenfalls die Positionen
16192T, 16270T der Hg U5b aufweist. Auch die Amplifikation nuklerer DNA ergab
reproduzierbare Ergebnisse. So konnten sieben von zehn STR loci erfolgreich und
wiederholbar typisiert werden. Die integrierte molekulargenetische Geschlechtsbestimmung
durch den Marker Amelogenin steht im Einklang mit der morphologischen
Geschlechtsbestimmung, womit das Individuum KRE1 eindeutig als weiblich bestimmt
werden kann. Die in allen Analysen konsistente Reproduzierbarkeit und der beobachtbare

174

Diskussion
allgemein gute Erhaltungszustand des Individuums KRE1 machen den Nachweis
authentischer DNA sehr wahrscheinlich (Kategorie 2).
In den 72 Klonsequenzen des Individuums KRE2 sind keine kontaminierenden Sequenzen
zu beobachten (Kontaminationsrate 0%). Die Mutationen der HVR I sind charakteristisch fr
Hg U5b. Der Amplifikationserfolg der kurzen mtDNA Fragmente liegt bei 100%. Die
einmalige Amplifikation des Fragments V besttigt ebenfalls den vorliegenden Haplotyp
16192T, 16270T. Darber hinaus kann auch die RFLP-Analyse die Zugehrigkeit zu Hg U
sicherstellen. Die post mortem Substitutionsrate des Individuums KRE2 ist mit 11,8 mit
KRE1 vergleichbar. Die STR-Genotypisierung des Individuums ergab ebenfalls
reproduzierbare Ergebnisse fr sechs von zehn untersuchten loci, wobei auch hier die
integrierte Geschlechtsdiagnose als mnnlich mit der morphologischen Einschtzung
bereinstimmt (Kategorie1).
Die beiden Individuen KRE1 und KRE2 des litauischen Fundortes Kretuonas zeigen ein sehr
hnliches Ergebnismuster, das sich im Erhalt langer mtDNA, nuklerer DNA und einer fast
identischen post mortem Substitutionsrate widerspiegelt. Da zudem der Haplotyp der beiden
Individuen bereinstimmt und dieser auch unter den weiblichen Labormitarbeitern zu
finden ist, war eine mgliche Kontamination der Proben und insbesondere des weiblichen
Individuums KRE1 nicht auszuschlieen. Das Ergebnis der STR-Genotypisierung schliet
jedoch die putative Labormitarbeiterin als Kontaminationsquelle aus, da keine
bereinstimmung der Allele feststellbar ist. Der Umstand, dass ein - wenn auch nicht
vollstndiger - genetischer Fingerabdruck vorliegt und die molekulargenetische
Geschlechtsbestimmung mit der morphologischen bereinstimmt, lsst zudem eine
anderweitige Kontamination sehr unwahrscheinlich erscheinen. So wre zwar theoretisch
mglich, dass KRE1 von einer weiblichen Person kontaminiert ist und KRE2 von einem
mnnlichen Individuum, die kombinierte Wahrscheinlichkeit, dass beide zudem den
identischen mitochondrialen Haplotyp aufweisen, ist dagegen sehr gering.
Die Gesamtbetrachtung der Ergebnisse lsst fr beide Individuen aus Kretuonas ein Erhalt
von authentischer DNA sicherstellen. Die Tatsache, dass beide Individuen einen identischen
Haplotyp zeigen, kann weitgehend als verwandtschaftliche Beziehung innerhalb der
Fundortsituation gedeutet werden, insofern sich die Datierungen berschneiden. Die STRGenotypisierung schliet aber eine nhere Verwandtschaft im Sinne einer
Blutsverwandtschaft ersten Grades (in diesem Falle von Bruder und Schwester oder von
Mutter und Sohn) aus, sodass die Art der verwandtschaftlichen Beziehung weitergefasst
werden muss.
Von den 60 Klonsequenzen des mesolithischen russischen Individuums LEB1 kommen zehn
Sequenzen als kontaminierend in Frage (Kontaminationsrate 16,7%). Dies sind zum einen
sechs Sequenzen in den Fragmenten II, III und IV, welche der CRS entsprechen und zum
anderen weitere vier Sequenzen in Fragment III und IV der Extraktion B, welche durch die
Positionen 16294T, 16304C als Teilbereich der Hg T identifiziert werden knnen.
Letztgenannte Positionen finden sich auch bei einem Labormitarbeiter. Da sich keine der
beiden kontaminierenden Linien reproduziert wieder finden, knnen diese ausgeschlossen
werden, zumal in den verbleibenden 50 Klonsequenzen eindeutig und reproduzierbar die
Positionen 16192T, 16241C, 16256T, 16270T, 1699G vertreten sind, welche charakteristisch fr

175

Diskussion
Hg U5a1 sind. Die Einordnung in Hg U wird weiterhin durch die RFLP-Analyse der np
12308 der coding region besttigt. Der allgemeine Amplifikationserfolg der vier kurzen
mtDNA Fragmente liegt bei 66,7%. Die Amplifikation des langen Fragments V sowie
nuklerer DNA blieb aus. Die post mortem Substitutionsrate des Individuums LEB1 ist mit
8,68 vergleichsweise gering. Dies kann mit Einschrnkungen auf die geringe Anzahl der
nicht mit UNG-behandelten Sequenzen (in diesem Fall nur Produkte der Extraktion B, die
keine Kontamination darstellen) zurckgefhrt werden, die in die Berechnung einflossen.
Aus genetischer Sicht sprechen fr die Authentizitt der Sequenzen bzw. der daraus
erfolgten Haplogruppenbestimmung von LEB1 die Reproduzierbarkeit der Ergebnisse und
das phylogenetisch sinnvolle Ergebnis. Einen indirekten Hinweis auf Erhalt von endogener
DNA kann im Falle von Individuum LEB1 das Ergebnis der SAXS-Analyse liefern. Die Werte
der Indices fr die Struktur und Dicke der Mineralkristalle im Knochen sind vergleichbar
mit Proben anderer Fundorte, welche ebenfalls authentische Ergebnisse zeigen (z.B. SZA23 2
und DON1), bzw. unterscheiden sich nicht wesentlich von rezenten Vergleichsdaten. Somit
kann trotz des vorliegenden Einzelergebnisses der Erhalt endogener DNA als
wahrscheinlich erachtet werden (Kategorie 3).
Die 88 Klonsequenzen des LBK-Individuums SCHWE1 zeigen an Positionen 16126C, 16294T,
16296T, 16304C die charakteristischen Mutationen der Hg T2. Alle Positionen befinden sich
innerhalb berlappender Bereiche der vier Fragmente, so dass alle Positionen durch vier
unabhngige Versuche besttigt sind. Eine von drei Amplifikationen von Fragment I der
Extraktion B wurde unter Verwendung von UNG durchgefhrt. In allen zehn hieraus
resultierenden Klonen kann die Position 16126C nicht besttigt werden. Stattdessen ist die
Position 16111T konsistent vertreten, welche in verschiedenen Haplogruppen (u. a. F, N9a, B,
M*) der sdostasiatischen Makro-Hg M auftritt. Eine genauere Eingrenzung der fraglichen
kontaminierenden Linie in SCHWE1 ist daher nicht mglich. Die Kontaminationsrate liegt
somit bei 11,4%. Der Amplifikationserfolg ist mit 71,4% vergleichsweise niedrig. Dies lsst
sich deutlich auf den starken Grad der Degradierung zurckfhren, welcher anhand der
sehr hohen post mortem Substitutionsrate von 23,3 abzuleiten ist. SCHWE 1 zeigt insgesamt
sehr viele konsistente Substitutionen innerhalb der Klone eines Produkte, was sich in einer
sehr geringen Sttigung der einzelnen PCR-Produkte zeigt (z.B. eine Sttigungsrate von
0,166 des Fragments III der B Extraktion) und in dieser Kombination auf sehr wenige
Ausgangmolekle schlieen lsst. Diesbezglich liegen auch keine Amplifikate nuklerer
sowie langer mtDNA Fragmente vor. Insgesamt lsst sich feststellen, dass im Falle des
Individuums SCHWE1 von einer fortgeschrittenen DNA-Degradierung und Fragmentierung
ausgegangen werden kann, so dass nur wenige intakte, aber stark basenvernderte Molekle
zur erfolgreichen Amplifikation zur Verfgung standen. Die Klonsequenzen zeigen jedoch,
dass trotz mehrfach konsistenter Basenaustausche valide Ergebnisse erzielt werden knnen,
die sich durch die in der Arbeit verwendeten Schemata der Reproduktion und
Authentifizierung (Kap.5.4) deutlich von post mortem Artefakten unterscheiden lassen
(Kategorie 2).
Die 89 Klonsequenzen des Individuums SCHWE2 zeigen mit 24,7% einen vergleichsweise
hohen Anteil an kontaminierenden Sequenzen. Jedoch kann bei 15 der 22 Sequenzen der
Haplotyp (16189C, 16311C) des Verfassers der vorliegenden Arbeit erkannt und damit als

176

Diskussion
Kontaminationsquelle identifiziert werden. Diese finden sich nur in den mit UNG
behandelten PCR-Produkte der Extraktion B wieder. Eine weitere Linie (16309G) mit sieben
Klonsequenzen findet sich in Fragment III der Extraktion A, kann jedoch nicht nher
eingegrenzt werden. Schliet man diese 22 Sequenzen aus, so knnen eindeutig und
reproduziert die Positionen 16126C, 16292T, 16294T, 16296T festgehalten werden, die fr
Bestimmung eines Haplotyps der Hg T3 diagnostisch sind. Alle vier Positionen sind wegen
ihrer Lage in berlappenden Bereichen vierfach unabhngig besttigt. Der
Amplifikationserfolg von 79% ist aufgrund des erhhten Anteils an Kontaminationen nur
bedingt informativ, jedoch scheint es plausibel, anzunehmen, dass der eigentliche Wert
darunter liegt. Nuklere DNA sowie das lange mtDNA Fragment V konnten nicht
nachgewiesen werden. Die post mortem Substitutionsrate liegt mit 22,6 ebenfalls
berdurchschnittlich hoch, womit sich ein mit SCHWE1 vergleichbares Gesamtbild
besttigen liee. Die endogene DNA liegt nur noch in stark fragmentiertem und
modifiziertem Zustand vor, was sich vor allem in den Versuchen mit UNG besttigt, in
welchen eine geringe Ausgangsmenge intakter kontaminierender Molekle scheinbar
bevorzugt amplifiziert wird.
Aufgrund der Reproduzierbarkeit der Sequenzpositionen und unter Ausschluss der
primren und offensichtlichen Kontaminationsquelle ist im Rahmen des charakteristischen
Erscheinungsbilds alter DNA im Falle von SCHWE2 die Authentizitt der Ergebnisse als
sehr wahrscheinlich anzunehmen (Kategorie 5).
Die 77 Klonsequenzen des Individuums SCHWE4 zeigen mit 22,1% ebenfalls einen hohen
Anteil an kontaminierenden Sequenzen. Die 17 betreffenden Sequenzen stammen aus UNGbehandelten PCR-Produkten der Fragmente III und IV der A-Extraktion. Die
kontaminierenden Linien unterscheiden sich im berlappenden Bereich, d.h. sie
entsprechenden in Sequenzen des Fragments III der CRS, wohingegen die Sequenzen des
Fragments IV die Positionen 16305T, 16362C aufweisen. Letztere finden sich in dieser
Kombination bislang nicht in Rezentdaten wieder (Richards et al. 2000, Poetsch et al. 2003,
Pfeiffer et al. 2001). Eine einzelne kontaminierende Sequenz in Fragment IV kann dem
Bearbeiter zugewiesen werden. Schliet man diese Sequenzen aus, so knnen in den
verbleibenden 60 Klonsequenzen die Positionen 16286T, 16304C durch zwei bzw. drei
unabhngige Versuche besttigt werden. Dieser Haplotyp ist ebenfalls bislang nicht in der
Literatur besttigt worden, so dass eine Einordnung im Sinne eines phylogenetisch
sinnvollen Ergebnisses, d.h. einem bereits existierenden Haplotyp entsprechend, nicht
vorgenommen werden kann. Sehr wahrscheinlich handelt es sich hierbei um einen
abgeleiteten Haplotyp der in Europa hufigen Hg H 16304C. Der Verlust der Alu I
Schnittstelle an np 7025 konnte durch die RFLP-Analyse nachgewiesen werden, womit die
Zugehrigkeit zur Hg H besttigt ist. Die post mortem Substitutionsrate von SCHWE4 liegt
mit 17,6 hnlich hoch wie die der vergleichbaren Schwetzinger Individuen SCHWE1 und
SCHWE2. Der Amplifikationserfolg kann mit 88,9% aufgrund des kontaminierenden Anteils
nur eingeschrnkt als Interpretationshilfe herangezogen werden. Die Amplifikation des
langen mtDNA Fragments sowie von nuklerer DNA blieb erfolglos. Die Ergebnisse der
SAXS-Analyse zeigen fr die Indices der Struktur und Dicke der Mineralkristalle im
Knochen vergleichbare Werte mit anderen Proben, welche ebenfalls authentische Ergebnisse
aufweisen (z.B. LEB1, SZA23 2 und DON1). In einer Gesamtbetrachtung der Ergebnisse kann

177

Diskussion
somit, jedoch hauptschlich aus Grnden der Reproduzierbarkeit, fr das Individuum
SCHWE4 vom Erhalt endogener DNA-Sequenzen ausgegangen werden (Kategorie 4).
Fr das Individuum SCHWE5 wurde eine alternative Reproduktionsstrategie angewandt.
Die PCR-Produkte des Individuum SCHWE5 wurden lediglich direkt sequenziert, allerdings
wurden fr jedes Fragment mindestens drei unabhngige PCR-Reaktionen herangezogen.
Eine Amplifikation nuklerer DNA sowie des mtDNA Fragments V blieb erfolglos, somit
liegen fr SCHWE5 lediglich die Ergebnisse der Direktsequenzierung zur Bewertung vor.
Eine Substitutions- bzw. Kontaminationsrate auf Basis von Klonsequenzen kann daher nicht
zum Vergleich herangezogen werden. Der Amplifikationserfolg der vier kurzen Fragmente
I-IV liegt bei 100%. In den Sequenzen lassen sich eindeutig und reproduzierbar die
Positionen 16126C, 16294T, 16296T der Hg T feststellen. Da diese Positionen in
berlappenden Bereichen liegen, sind sie nicht nur innerhalb eines Fragments aus
unabhngigen Extraktionen mehrfach besttigt, sondern zustzlich durch die Produkte des
berlappenden Nachbarfragments. Mgliche Beeintrchtigung bzw. Einschrnkungen der
Reproduzierbarkeit eines Ergebnisses durch post mortem Sequenzvernderungen oder durch
kontaminierende Sequenzen lassen sich jedoch nur bedingt feststellen. So zeigt z.B. eines von
sieben PCR-Produkten der Fragmente III und IV zustzlich zu den beschriebenen Positionen
auch 16304C, was mglicherweise auf eine kontaminierende alternative Hg T-Sequenz
zurckgefhrt werden knnte. Im Rahmen der Direktsequenzierung bleibt ein genauere
Definition dieser Position jedoch spekulativ. Zusammenfassend lsst sich sagen, dass bei
ausreichender Anzahl der unabhngigen Wiederholungen eines Experiments auch durch die
Direktsequenzierung valide Ergebnisse zur Haplogruppenbestimmung erzielt werden
knnen (Kategorie 2).
Die untersuchten Individuen des linearbandkeramischen Grberfelds Schwetzingen zeigen
in der vergleichenden Betrachtung - wie Derenburg, Halberstadt und Kretuonas
kongruente Einzelergebnisse bezglich der Gte der noch erhaltenen DNA. Im Falle von
Schwetzingen kann jedoch insgesamt von einem fortgeschrittenen Zustand der DNAFragmentierung sowie DNA-Modifizierung gesprochen werden, der sich deutlich in der
hohen post mortem Substitutionsrate, (eingeschrnkt) im Amplifikationserfolg sowie in der
Anflligkeit fr Kontaminationen beim Einsatz von UNG niederschlgt. Trotz dieses
weniger guten Erhaltungszustandes lassen sich eindeutige Ergebnisse erzielen.
Hervorzuheben ist hierbei vor allem die Hufung der T-Haplotypen, deren unterschiedliche
Sequenzen ebenfalls fr eine Authentizitt der Einzelergebnisse und gegen eine mgliche
systematische Kontamination sprechen.
Die 90 Klonsequenzen des Individuums SEE1 des linearbandkeramischen Fundortes
Seehausen zeigen in den mtDNA Fragment I und II eindeutig und reproduzierbar die
Positionen 16069T, 16126C, welche fr Hg J charakteristisch sind. Die Positionen sind durch
zwei bzw. vier PCR-Versuche besttigt. Die Amplifikationen der mtDNA Fragmente I-IV der
B-Extraktion wurden unter Verwendung von UNG durchgefhrt. Die Sequenzen derselben
stimmen bis auf Fragment III mit denjenigen der Extraktion A berein. Fragment III zeigt in
allen 11 Klonsequenzen der Extraktion die abweichende Position 16309G, was zu einer
Kontaminationsrate von 12,2% fhrt (siehe auch Kap. 6.1.2). Eine entsprechende Position
konnte nicht unter den Bearbeitern gefunden werden, womit der Ursprung der

178

Diskussion
Kontamination ungeklrt bleibt. Die Amplifikation von nuklerer DNA und des langen
mtDNA Fragments V blieb ohne Erfolg. Der allgemeine Amplifikationserfolg der vier kurzen
mtDNA Fragmente liegt bei 81,8% und die post mortem Substitutionsrate bei 6,92 weit
unter dem Durchschnitt von 13. In den Klonsequenzen lassen sich einzelne post mortem
Artefakte konsistent in mehreren Klonen verfolgen, was sich in der sehr niedrigen
Sttigungsrate (0,34) widerspiegelt. Die Ergebnisse der SAXS-Analyse besttigen den
mglichen Erhalt intakter DNA, da die Werte der Indices annhernd denjenigen der
rezenten Vergleichsprobe entsprechen. Insgesamt betrachtet lsst sich, aufgrund der
Reproduzierbarkeit der Sequenzpositionen in Kombination mit den Ergebnissen der
Diagenesestudie, der Erhalt von authentischer DNA postulieren (Kategorie 2), wenngleich
die weiteren Ergebnisse der Sequenzauswertung auf eine sehr reduzierte Anzahl qualitativ
gut erhaltener Molekle hindeuten.
In den Klonsequenzen des Individuums SZA23 1 des ungarischen Fundortes Szarvas 23
knnen keine kontaminierenden Sequenzen festgestellt werden. Die Positionen 16223T,
16257A, 16261T sind konsistent in allen unabhngigen Versuchen nachweisbar. Die
Amplifikation des 440bp langen Fragments V ist ebenfalls aus beiden Extraktionen
erfolgreich mglich und kann die Positionen des Haplotyps N9a besttigen. Der scheinbar
auerordentlich gute Erhaltungszustand der DNA der Probe spiegelt sich zum einen in
einem Amplifikationserfolg von 100% wider und zum anderen im reproduzierbaren
Nachweis von neun von zehn loci der STR-Genotypisierung (~280bp). Die post mortem
Substitutionsrate der Probe liegt mit 10,6 leicht unter dem Durchschnitt. Auch die
morphognostische Beurteilung des Erhaltungszustandes der bearbeiteten Molaren kann als
sehr gut bezeichnet werden. Da zum Zeitpunkt der Probennahme die untersuchten Wurzeln
der Molaren noch im festen Verbund und geschtzt in den Alveolen vorlagen, kann im
Rahmen einer Gesamtbetrachtung aller Ergebnisse sowie der Probengeschichte vom Erhalt
authentischer DNA ausgegangen werden (Kategorie 1).
Von den 60 Klonsequenzen des Individuums SZA23 2 zeigen fnf Sequenzen (8,3%)
Unterschiede zu den reproduzierten Positionen 16126A, 16223T, 16311C, 16357C, 16391A, die
als Haplotyp der Hg I bestimmt werden knnen. Die kontaminierenden Sequenzen
entsprechen in Fragment I der CRS bzw. zeigen in Fragment III np 16311C, ohne jedoch die
Position 16223T zu besttigen. Weitere drei Sequenzen im dritten Fragment zeigen
wiederum Position 16223T ohne 16311C zu besttigen. Mglicherweise handelt es sich
hierbei um eine Rckmutation der Position 16311 durch eine Deaminierung. Der
Amplifikationserfolg der Probe liegt bei 100% und auch das lange Fragment V konnte
einmalig erfolgreich amplifiziert werden und den bestehenden Haplotyp I belegen. Die
Amplifikation von nuklerer DNA ergab eine valide STR-Typisierung fr fnf von zehn der
untersuchten loci. Die post mortem Substitutionsrate entspricht mit 13 dem
durchschnittlichen Wert aller untersuchter Individuen. Die Werte fr die Indices der
Kristalldicke und -struktur des Knochenminerals weichen nur in geringem Mae von der
rezenten Vergleichsprobe ab. In der Gesamtbetrachtung aller Einzelergebnisse ist fr das
Individuum SZA23 2 der Erhalt von authentischen DNA Sequenzen (Kategorie 2) als sehr
wahrscheinlich anzunehmen.

179

Diskussion
Vom Fundort Szarvas 23 der Krs-Kultur wurde eine weitere Probe (SZA23 3) im Rahmen
der Diplomarbeit von Guido Brandt (2005) untersucht. Diese zeigt ebenfalls eindeutige und
valide Ergebnisse sowohl der mitochondrialen HVR I als auch der nukleren Genorte der
STR-Genotypisierung, so dass auch im Falle des Fundortes Szarvas 23 von kongruenten
Ergebnissen gesprochen werden kann.
Die 101 Klone des linearbandkeramischen Individuums UNS2 enthalten mit 41,6% den
zweitgrten Anteil an kontaminierenden Sequenzen (vgl. Kap. 6.1.2, Abbildung 22). Von
den insgesamt 42 Sequenzen, die als kontaminierend definiert wurden, knnen 36 dem
Haplotyp des Bearbeiters (16189C, 16311C) zugeordnet werden, weitere fnf zeigen die
mehrfach beobachtete Position 16309G und eine weitere Sequenz des Fragments IV
entspricht der CRS. Die verbleibenden Sequenzen zeigen reproduzierbar die Positionen
16223T, 16292T der Hg W. Diese Positionen liegen innerhalb der berlappenden Bereiche der
Fragmente II und III sowie III und IV, so dass sie jeweils durch vier unabhngige Versuche
besttigt werden knnen. Die Kontamination durch den Bearbeiter lsst sich ebenfalls in
beiden unabhngigen Extraktionen finden, allerdings nicht in allen Fragmenten. Aus diesem
Grund muss davon ausgegangen werden, dass die Kontamination der Probe in den
Arbeitsschritten vor der Extraktion stattgefunden hat. Die Amplifikation des langen
mtDNA-Fragments V ist in einem Fall erfolgreich, zeigt jedoch auch den Haplotyp des
Bearbeiters. Nuklere Genorte zur eindeutigen Identifizierung der Kontaminationsquelle
mittels STR-Genotypisierung knnen allerdings nicht erfolgreich amplifiziert werden. Der
Amplifikationserfolg von 90,5% ist nur bedingt aussagekrftig, weitere Raten wurden daher
nicht ermittelt. Die visuelle berprfung der putativen authentischen Sequenzen zeigt eine
starke Modifizierung der Sequenzen mit bis zu 13 Deaminierungen in einzelnen Fllen. In
der Gesamtbetrachtung lsst sich hier ein Fall an DNA-Erhaltung im Grenzbereich
beschreiben, der aufgrund des Ausschlusses der zahlreichen, aber identifizierbaren
kontaminierenden Sequenzen und der eindeutigen Reproduzierbarkeit der Hg W als
authentisch im Sinne der Kategorie 5 angesehen werden kann.
In den 47 Klonsequenzen des Individuums VAI3 des linearbandkeramischen Fundortes
Vaihingen a. d. Enz findet sich nur eine, von anderen divergierende, Sequenz (2,1%), welche
in Fragment III der CRS entspricht. Die verbleibenden Sequenzen knnen eindeutig und
reproduzierbar durch die Positionen 16319A, 16343G als Haplotyp der Hg U3 bestimmt
werden, da sie - im berlappenden Bereich von Fragment III und IV gelegen - durch vier
unabhngige Versuche besttigt sind. Der Amplifikationserfolg der vier kurzen mtDNA
Fragmente liegt bei 82%. Das lange mtDNA-Fragment V sowie nuklere Genorte knnen
nicht erfolgreich amplifiziert werden. Die Berechnung der post mortem Substitutionsrate
wurde nicht durchgefhrt, die visuelle berprfung der Basensubstitutionen deutet jedoch
aufgrund konsistenter Deaminierungen von Cytosinen in mehreren Klonsequenzen auf
keine Sttigung der Klone hin, woraus eine Limitierung der Ausgangsmoleklzahl zu
erkennen ist. Im Rahmen der Gesamtbetrachtung kann die Authentizitt der Sequenzen
(Kategorie 2) und die resultierenden Haplotypenbestimmung des Individuums VAI3
aufgrund der eindeutigen Reproduzierbarkeit der definierenden Mutationen als sicher
gelten.

180

Diskussion

7.3 Zur Populationsgenetik der ersten Bauern im frhen Neolithikum


7.3.1 Die phylogenetische und phylogeographische Auflsung der mtDNA
In nherer Zukunft wird die zunehmende Anzahl an Gesamtsequenzierungen des mtGenoms eine sehr hohe Auflsung der mtDNA Variabilitt bieten, wie z.B. aus
verschiedenen Publikationen ersichtlich wird (Ingman et al. 2000, Herrnstadt et al. 2002,
Finnil et al. 2001). Bereits jetzt zeigen diese Studien, dass die hchstmgliche Auflsung der
mtDNA auch deutlichere phylogeographische Muster ergibt, deren Ausprgung ansonsten
durch Rck- bzw. Parallelmutationen im Bereich der HVR I verflacht sein kann. Als Beispiel
kann hier die detaillierte Auflsung der Hg H genannt werden, deren Sub-Hgs Gradienten
innerhalb Europas zeigen (Loogvli et al. 2004, Achilli et al. 2005, Pereira et al. 2005).
Nicht alle europischen Haplogruppen zeigen im Rahmen der derzeit bekannten
phylogenetischen Auflsung ein phylogeographisches Muster bzw. ein Geflle innerhalb der
Frequenzen, welche zur weiteren Interpretation zur Ursprung und Verbreitungsrichtung(en)
einer Hg Hinweise geben knnen. Hinzu kommt, dass in vielen Studien zu
rezentgenetischen Verteilungsmustern nicht immer eine vergleichbar tiefe phylogenetische
Auflsung vorliegt. Meist muss letztere zugunsten der Vergleichbarkeit niedriger angesetzt
werden. Daher sind einige Haplotypen bzw. Hgs auch bezglich der Besiedlungsgeschichte
Europas whrend des frhen Neolithikums nur eingeschrnkt aussagekrftig, da sie
zumindest in heutigen Referenzgebieten eine homogene Verbreitung aufweisen. Dies betrifft
im Rahmen der vorliegenden Arbeit vor allem die Haplogruppen H, K, T und J. Im Hinblick
auf die Fragestellungen (vgl. Kap. 4) der vorliegenden Arbeit ist jedoch die
phylogeographische Auflsung, welche die Haplotypenanalyse auf der Basis der
Sequenzierung der HVR I und der RFLP-Analysen diagnostischer kodierender Bereiche
liefern kann, ausreichend.

7.3.2 Die Haplogruppen der neolithischen Individuen


Haplogruppe N1a
Die Hg N1a stellt mit 24% die hufigste Hg innerhalb der neolithischen Individuen im
Bereich der LBK (DEB1, DEB3, HAL2, FLO1, UWS5) sowie der zeitgleichen Alfld
Linearbandkeramik (ECS1) dar. Im Vergleich mit mtDNA-Daten aus modernen
populationsgenetischen Studien fllt auf, dass Hg N1a in heutigen europischen
Bevlkerungen nur noch mit einer Hufigkeit von durchschnittlich 0.2% zu finden ist
(Abbildung 41).
Alle neolithischen N1a-Individuen sind im europischen Zweig des phylogenetischen
Netzwerks zu finden. Eine Ausnahme bildet das Individuums ECS1, welches die
charakteristische Mutation 16189C des asiatischen N1a-Zweigs zeigt. Mglicherweise stellt
diese Position eine Parallelmutation im europischen Zweig der Hg N1a dar, da
gleichermaen eine Konfliktsituation mit der Mutation 16320T entsteht. Die neolithischen

181

Diskussion
N1a Individuen - auer ECS1 - belegen zentrale Nodien bzw. Nodien, die heute nicht mehr
dokumentiert sind (vgl. Kap. 5.3.4, Abbildung 36).

Abbildung 41. Verbreitung der drei Zweige der heutigen N1a Haplotypen. Blaue Kreise
entsprechen dem europischen Zweig, orangefarbene Kreise dem zentralasiatischen Zweig und grne
Kreise dem afrikanischen/sdwestasiatischen Zweig des N1a Netzwerk aus Abbildung 36. Die Kreise
entsprechen proportional der lokalen prozentualen Hufigkeit an N1a Haplotypen, wobei der kleinste
Kreis 0,18% entspricht.

Die Haplotypen der bislang undokumentierten Nodien, welche die linearbandkeramischen


Individuen HAL2 und UWS5 einnehmen, zeigen eine deutliche europische Affinitt. Die
durch eine weitere Mutation von UWS5 abgeleiteten N1a Linien finden sich rezent in
Norwegen (Opdal et al. 1998), Deutschland (Pfeiffer et al. 2001) und in einer kroatischen
Minderheit im italienischen Molise (Babalini et al. 2005). Die abgeleiteten Linien von HAL2
finden sich in Portugal (Pereira et al. 2000), Frankreich (Richard Villems, unpubliziert), der
Schweiz (Forster 1996), Ungarn (Lahermo et al. 2000) und Norwegen (Passarino et al. 2003).
Identische Haplotypen zum zentralen Haplotyp des Individuum DEB1 finden sich in der
Rezentbevlkerung bei einem Individuum aus Armenien (Richards et al. 2000) und einem
Individuum aus gypten (Krings et al. 1999). Interessanterweise stellt dieser Haplotyp im
Netzwerk die Verbindung zum afrikanisch/sdwestasiatischen Zweig der Hg N1a dar.
Der Haplotyp der Individuen DEB3 und FLO1 findet sich insgesamt 13 mal wieder; bei
Individuen aus dem Iran (Richards et al. 2000, Metspalu et al. 2004), Turkmenistan
(Quintana-Murci et al. 2004), der Slowakei (Koledov 2005), Tschawasch (Bermisheva et al.
2002), Russland (Richard Villems, unpubliziert), zwei Individuen aus Jemen (Kivisild et al.
2004) sowie bei fnf Individuen aus Estland (Sajantila et al. 1995, Richard Villems,
unpubliziert). Die Mehrzahl der durch eine weitere Mutation abgeleiteten Formen dieses
hufigen Haplotyps findet sich heute in Europa, weshalb hierfr eine Verbreitung in Europa
angenommen werden kann. Die Koaleszenzzeitberechnung fr das sternfrmige Muster der

182

Diskussion
betreffenden Linien beluft sich auf 10.763 3429 Jahre bzw. 14.294 7865 Jahre, wenn der
hufigste asiatische Haplotyp miteingerechnet wird. Die Expansion des zentralasiatischen
bzw. westsasiatischen N1a-Zweiges lsst sich auf 5765 3813 Jahre datieren. Da die
Datenanzahl verhltnismig klein ist, fallen die Werte der Standardabweichungen (hier in
Jahren) sehr gro aus.
Anhand des Netzwerkes (Abbildung 36, Kap. 6.5) und der geographischen Verteilung der
N1a Haplotypen, lsst sich folgern, dass die Verbreitung der asiatischen N1a Typen von
Europa aus erfolgt sein muss. Zum einen wird dies dadurch gesttzt, dass der asiatische N1a
Zweig dem paneuropischen zentralen Haplotyp entspringt, dem auch DEB3 und FLO1
angehren, und zum anderen durch die eindeutig sptere Expansionszeit der asiatischen
N1a-Linien. Darber hinaus finden sich in Westasien auch einige europische N1a Linien,
wie z.B. bei den Udmurten (Richard Villems, unpubliziert), Komi-Permjaken und
Tschawaschen (Bermisheva et al. 2002) und bei den Burjaten (Pakendorf et al. 2003).
Die eigentlichen asiatischen Linien, die durch die Mutation 16189C charakterisiert sind,
finden sich bei den turksprachigen Bashkiren, Turkmenen (Richard Villems, unpubliziert)
und Tschawaschen (Bermisheva et al. 2002), Altai (Derenko et al. 2003), Kalmyken, Kasachen
und Russen (alle Richard Villems, unpubliziert) und auch unter den Komi-Permjaken
(Bermisheva et al. 2002). Interessanterweise finden sich in der Nodie der hufigsten
asiatischen Linie auch zwei (pr-)historische Individuen. Dies ist zum einen ein
skythenzeitliches Individuum (Ricaut et al. 2003) und zum anderen ein Individuum aus
einem sarmatischen Kurgan (Joachim Burger, unpubliziert), welcher in einem Parallelprojekt
der Arbeitsgruppe untersucht wurde.
Die N1a Haplogruppen des sdwestasiatischen/afrikanischen Zweiges finden sich heute
hauptschlich in Jemen, thiopien, Eritrea (Kivisild et al. 2004), Tansania (Knight et al. 2004),
Somalia (Watson et al. 1997), der Trkei (Tambets et al. 2000), Indien (Mountain et al. 1995,
Baig et al. 2004) und auch in Griechenland und in Kabardino-Balkarskaja im Kaukasus
(Richards et al. 2000). Kivisild (et al. 2004) zieht hierfr die lange historische Beziehung der
Populationen um das Rote Meer und den Golf von Aden heran. Er sieht die afrikanischen
N1a Linien als sekundr nach Nordostafrika verbreitet an, wofr er die geringe Variabilitt
der afrikanischen Linien (die hufigste zentrale Nodie im Netzwerk) im Vergleich zu den
jemenitischen N1a Linien, die ebenfalls europische Haplotypen aufweisen, anfhrt. Die
Tatsache, dass die nordostafrikanischen N1a Linien zu den semitisch-sprechenden Amhara,
Tigrinen und Gurages zu zhlen sind, kann als weiteres mgliches Indiz fr eine sptere
Verbreitung nach Afrika gesehen werden.
Die Koaleszenzzeit fr den nicht sternfrmigen afrikanisch/sdwestasiatischen Zweig der
Hg N1a betrgt 23.849 .8506 Jahre, da jedoch nur wenige Daten vorliegen, kann nur bedingt
von einer Monophylie dieses Zweiges ausgegangen werden. Da Hg N1a in den rezenten
Populationen vergleichsweise selten zu finden ist, bestehen nur vereinzelt Daten zu
weiterauflsenden coding region Mutationen. Eine Gesamtsequenzierung eines bzw.
mehrerer N1a mt-Genome steht noch aus und sollte weiteres Licht in die phylogenetische
Beziehung der N1a Topologie bringen.
Insgesamt kann anhand der Daten der Hg N1a festgestellt werden, dass die Hg N1a eine
ungewhnlich weite Verbreitung aufweist und dass trotz dieser Verbreitung eine
ausgeprgte genetische Verbindung der pan-eurasischen Populationen besteht bzw. in der

183

Diskussion
Vergangenheit bestanden haben muss. Inwieweit diese einer (einzelnen) geschichtlichen
Epoche bzw. eines bestimmten Prozesses, wie in unserem Fall der Neolithisierung,
zugeordnet werden kann, bleibt abzuwarten.
Die Haplogruppen N9a, D4a
Die hohen Frequenzen der asiatischen Hg N9a, D4a in der Krs-Kultur (jeweils 10%) sind
mglicherweise auf die geringe Stichprobengre zurckzufhren und knnten in einer
reprsentativen Stichprobe niedriger liegen.
Der Haplotyp der Probe SZA23 1 entspricht der zentralen bzw. anzestralen HVR I Sequenz
(16223T, 16257A, 16261T) der Hg N9a (vgl. Abbildung 37), welche heute in Sdostasien ihre
hchste Frequenz (2-8%) aufweist (u.a. Yao et al. 2002a, Wen et al. 2005, Tanaka et al. 2004),
jedoch vereinzelt auch in westasiatischen Bevlkerungen zu beobachten sind, so z.B. in
Usbekistan (Quintana-Murci et al. 2004) und Kirgisistan (Comas et al. 1998).
Der Haplotyp der SZA8 2 (16129A, 16223T, 16362C) stellt ebenfalls die anzestrale HVR I
Sequenz der Sub-Hg D4a von Hg D4 dar, welche in (Nord-) bzw. Ostasien die grte
Hufigkeit zeigt (Wen et al. 2005, Tanaka et al. 2004). Eine genaue Entsprechung des
Haplotyps findet sich u.a. in einem Individuum aus Kirgisistan, drei Nanai (alle Richard
Villems, unpubliziert) sowie einem Uighuren (Yao 2000), Han-Chinesen (Yao et al. 2002a)
und Yao-Chinesen (Wen et al. 2005).
Die beiden asiatischen Hgs stellen innerhalb der Krs-Stichprobe ein unerwartetes Ergebnis
dar. Aus diesem Grund mssen die gewonnenen Daten umso mehr dem kritischen Vorwurf
standhalten, sie seien Beweise fr eine Kontamination mit moderner DNA von
Probengebern. Es ist bekannt, dass das heutige Gebiet Ungarns, d.h. insbesondere das
Karpatenbecken, mehrmals von innerasiatischen Bevlkerungsgruppen, wie den Skythen,
Hunnen, Awaren und den Magyaren besetzt bzw. besiedelt wurde (Kiszely 1979). Daher ist
es durchaus vorstellbar, dass im mitochondrialen Genpool der modernen Bevlkerung
Ungarns innerasiatische Einflsse, d.h. charakteristische asiatische Hgs zu finden sind. Die
genauere
Betrachtung
von
populationsgenetischen
Studien
der
heutigen
Bevlkerungsgruppen Ungarns zeigt jedoch ausnahmslos eine charakteristisch europische
Verteilung der Haplogruppenfrequenzen (Semino et al. 2000, Lahermo et al. 2000), d.h. es
finden sich keine asiatischen Hgs im maternalen Genpool der heutigen ungarischen
Bevlkerung.

Die Haplogruppen H, K, J, T, U3, I und W


Die phylogenetische Auflsung der Individuen der Hg H (ASP2, EIL1, FLO2, SCHWE4,
END6 1, END6 2, SZA23 3), K (DEB2, FLO5, FLO6 UWS2, END119), T (FLO4, HAL3,
SCHWE 1, 2 und 5, DBK1), U3 (VAI3), J (SEE1, DKF1), W (UNS2) und I (SZA23 2) ist
insgesamt zu gering, als dass allein von Seiten der Haplogruppen weitreichende Aussagen
zur geographischen Herkunft der Individuen gemacht werden knnten.
Fr die im eurasischen Raum hufigen Haplotypen der neolithischen Individuen mit den
Hgs J, K und T liegen kaum detaillierte Rezentdaten auf der Basis von
Gesamtsequenzierungen des mt-Genoms vor.

184

Diskussion
Haplogruppe J
Die Individuen der Hg J (SEE1, DKF1) zeigen beide die HVR I Sequenz 16069T, 16126C, die
den anzestralen Haplotyp der Hg J darstellen, welcher berall in Europa hufig ist (vgl.
Abbildung 42; Helgason et al. 2000, Richards & Macaulay 2000). Die Sub-Hgs J1a (16069T,
16126C, 16145A, 16231C, 16261T) und J1b1 (16069T, 16126C, 16145A, 16172C, 16222T,
16261T), fr die Richards & Macaulay eine europische Expansion postulieren, finden sich
nicht in der neolithischen Stichprobe. Dennoch kann eine Verbreitung der mtDNA-Linien J1a
und J1b1 im Rahmen der Verbreitung der buerlichen Lebensweise nicht ausgeschlossen
werden, da sie zu Beginn ihrer Expansion mit Sicherheit noch in geringerer Frequenz
vorlagen und sich die Auswirkung der Expansion erst in den nachfolgenden Epochen
deutlicher manifestiert haben kann. Ein Fehlen der beiden Sub-Hgs kann daher auch aus
stochastischen Grnden angenommen werden. Sollten die beiden Individuen SEE1 und DKF
1 als Anteil der Grndertypen zu rechnen sein, so kann deren Einfluss auf den europischen
Genpool als gering betrachtet werden.

Abbildung 42. Absolute Hufigkeiten des anzestralen Haplotyps der Hg J (modifiziert mit
freundlicher Genehmigung von Peter Forster, mtradius database 2005). Die grauen Kreisflchen
entsprechen proportional der absoluten Hufigkeit des Haplotyps 16069C, 16126T der Hg J. Der
schwarze Kreis lokalisiert den aus den Daten geschtzten Verteilungsursprung (centre of gravity).

Haplogruppe K
Die Haplotypen der Hg K von drei neolithischen Individuen (DEB2, FLO5, END119 1)
entsprechen der zentralen bzw. anzestralen HVR I Sequenz (16224C, 16311C) der Hg K.
Dieser Haplotyp ist mit 41% der hufigste innerhalb des Astes der Hg K (Richards et al.
2000). Dabei ist jedoch kein Geflle innerhalb Europas zu beobachten. Das phylogenetische
Netzwerk der Hg K ist nicht sternfrmig, daher kann angenommen werden, dass dessen
Expansion zeitlich weiter zurckliegt. Richards gibt als Koaleszenzzeit fr die Hg K und
damit fr den anzestralen Typ 10.000-15.000 Jahre an. Der K-Haplotyp (16224C, 16249C,
16311C) der Individuen UWS2 und FLO6 weicht durch die Mutation 16249C vom
anzestralen Haplotyp ab. Bemerkenswerterweise ist diese Linie sehr selten im eurasischen

185

Diskussion
Genpool und findet eine genaue Entsprechung nur in einem Individuum einer Stichprobe
von Uighuren (221 Individuen) und in einem weiteren in einer Stichprobe von 161 Usbeken
(Richard Villems, unpubliziert). In Europa selbst findet sich nur eine durch eine Mutation an
np 16180 abgeleitete Variante in Italien (Babalini et al. 2005) bzw. der zentralmediterranen
Stichprobe von Richards (et al. 2000).
Haplogruppe T
Die Individuen der Hg T zeigen allesamt unterschiedliche Haplotypen, die der
verschiedenen Sub-Hgs T2 zugeordnet werden knnen. Der Haplotyp des Individuums
SCHWE2 wird in der Literatur auch als T3 oder T2c bezeichnet (Koledov 2005, Richards et
al. 2000) und findet sich hufig in Europa sowie im Iran und in Indien (Metspalu et al. 2004).
Auch die brigen T2-Linien der Individuen SCHWE1 & 5, HAL3 und FLO4 finden sich
berall in Eurasien verteilt (Richards et al. 2000, Koledov 2005, Babalini et al. 2005, Behar et
al. 2004) und zeigen in der gegenwrtigen phylogenetischen Auflsung keinen
geographischen Schwerpunkt, der weitere Aussagen zuliee.
Es ist jedoch bemerkenswert, dass die verwandte Hg T1, die neben J und U3 als potentieller
genetischer Anteil des neolithic package beschrieben wird (Richards et al. 2000), nicht in der
prhistorischen Stichprobe zu finden ist, obwohl deren Frequenz (2,8%) im
gesamteuropischen Datensatz von Richards der der Hg T2 (2,4%) entspricht. Die Frequenz
von T1 ist im Nahen Osten mit 4 % deutlich hher als in Mitteleuropa (2,3%). Richards
datiert das Alter des T1 Zweigs auf 6100-12.800 Jahre v. h.. Mglicherweise stellt das Fehlen
von T1 ein stochastisches Problem der kleinen Stichprobe dar, oder aber es reflektiert die
Tatsache, dass die Expansion von T1 sich erst in postneolithischer Zeit im europischen
mtDNA-Pool manifestierte. Interessanterweise finden sich die meisten T2-Individuen in
Schwetzingen und Flomborn am westlichen Rand des LBK-Verbreitungsgebietes. Da T2 sehr
wahrscheinlich eine postglaziale Verbreitung in Europa erfahren hatte (9300-16.200 Jahre v.
h.) und zudem der Fundort Schwetzingen als mittel- bis sptlinearbandkeramisch anzusehen
ist, kann fr dieses Gebiet der LBK kein nahstlicher Einfluss festgestellt werden.
Haplogruppe U3
Zum U3 Haplotyp (16319A, 16343G) des Individuums VAI3 lassen sich keine detaillierten
Aussagen zur Herkunft treffen, da dieser bislang unbekannt ist. Es kann angenommen
werden, dass diese Linie entweder ausgestorben ist oder noch nicht dokumentiert wurde.
Die Hg U3 ist nicht sehr hufig, deren anzestrale Haplotyp weist jedoch eine Expansion vor
10.362,7 3197,72 Jahren auf. Diese anzestrale Linie, von der VAI3 durch die Mutation 16319
abgeleitet ist, weist eine weite Verbreitung in Eurasien auf. Sie findet sich sowohl von
Portugal im Westen (Pereira et al. 2000) als auch in der Altai Republik in Zentralasien
(Richard Villems, unpubliziert). Die hchste Frequenz des anzestralen Haplotyps findet sich
heute in der Trkei, der Kaukasus-Region (Richards et al. 2000, Tambets et al. 2000) und im
Iran (Metspalu et al. 2004).
Da sich die Expansionszeit von Hg U3 und das mgliche Ursprungsgebiet der Verbreitung
mit dem Beginn des Neolithikums decken, kann Hg U3 durchaus als potentieller Trger der
buerlichen Lebensweise betrachtet werden.

186

Diskussion
Haplogruppe H
Da die feinere phylogenetische Aufschlsselung der Hg H erst aktuell erfolgt ist (Loovli et
al. 2004, Achilli et al. 2004, Pereira et al. 2005), ist theoretisch die genaue Einordnung der
neolithischen Individuen der Hg H mglich, allerdings nur durch weiterfhrende Analysen
im kodierenden Bereich der mtDNA. Hierzu wird zunchst die Etablierung einer
hierarchischen RFLP-Analyse bzw. Sequenzierung und Klonierung diagnostischer
Abschnitte ntig sein, die dem Anspruch des geringsten Aufwandes an Probenmaterial
gerecht werden kann, welcher durch die Limitierungen der aDNA unweigerlich entsteht.
Weiterhin wird zu prfen sein, inwieweit mehrere diagnostische coding region Mutationen
durch RFLP-Analysen erfolgen knnen, da bereits gezeigt werden konnte, dass die hufigen
post mortem Mutationen auch die Schnittstellen eines Enzyms betreffen knnen (Haak et al.
2004). Die Individuen, welche in der HVR I der CRS entsprechen (ASP2, EIL1, END6 1 &2,
SZA23 3) knnen den Sub-Hgs H1, H2*, H2a, H3, H4, H7 bzw. H* zugeordnet werden. Mit
groer Wahrscheinlichkeit sind sie der Hg H1 zuzuordnen, da diese mit 30% die hufigste
Sub-Hg innerhalb der Hg H darstellt und ca. 13% des gesamteuropischen Genpools
ausmacht (Loogvli et al. 2004). Am hufigsten ist H1 auf der Iberischen Halbinsel vertreten,
wo diese Sub-Hg ca. 46% der Hg H-Variation bildet (Pereira et al. 2005), dagegen ist H1 im
Nahen Osten nur zu 6% vertreten und beinhaltet 14% der Hg H Variation (Loogvli et al.
2004). Als Koaleszenzzeit der Hg H1 gibt Loogvli 13.400 3000 Jahre an.
Individuen, welche wie FLO2 in der HVR I die Mutation 16093C zeigen, finden sich in den
Sub-Hgs H1, H2a, H4 und H* (Loogvli et al. 2004). Sehr wahrscheinlich kann aufgrund der
Hufigkeiten im rezenteuropischen mtDNA-Pool auch fr FLO2 die Zugehrigkeit zu SubHg H1 angenommen werden.
Der Haplotyp des Individuums SCHWE4 (16286T, 16304C) ist bislang undokumentiert. Sehr
wahrscheinlich ist dieser Haplotyp eine durch die Mutation 16286T abgeleitete Variante der
Sub-Hg H5* bzw. H5a. Als Koaleszenzzeit des Zweiges H5* gibt Loogvli 12.700 4.200
Jahre v.h. an, was fr eine postglaziale Expansion spricht.
Haplogruppe HV
Die Hg HV der Individuen DEB4, DEB5, FLO3 und SZA8 1 ist wenig bekannt, da sie in
vielen europischen Bevlkerungen nur in geringen Frequenzen (1,7% im Datensatz von
Richards et al. 2000) vorkommt. Der anzestrale Haplotyp dieses Zweiges, der in HVR I nur
durch np 16311C charakterisiert wird, zeigt rezent eine paneurasische Verbreitung, findet
sich jedoch am hufigsten im Iran (Metspalu et al. 2004), in der Trkei (Tambets et al. 2000,
Richards et al. 2000) und im Kaukasusgebiet (Metspalu et al. 1999).
Haplogruppe V
Der Haplotyp V des Individuums HAL1 zeigt den anzestralen Haplotypen der Hg V, die in
der HVR I durch die Mutation 16298C gekennzeichnet und mit einer Frequenz von 1-6% in
Europa vertreten ist. Fr die Hg V wird eine postglaziale Expansion aus dem
frankokantabrischen Refugium angenommen (Torroni et al. 1998, Torroni et al. 2001), da sie
mit einer deutlich hheren Frequenz in Westeuropa (~20% bei Basken und Katalanen
Spaniens) zu finden ist, dagegen jedoch sehr selten im Nahen Osten, wie z.B. der Trkei und
dem Iran (Richards et al. 2000, Tambets et al. 2000, Metspalu et al. 2004). Eine

187

Diskussion
nordeuropische Ausnahme bilden die Saami, bei welchen der Anteil an Hg V bei 40% liegt
(Sajantila et al. 1995, Tambets et al. 2004), die Diversitt allerdings sehr gering ist (Torroni et
al. 1998), woraus die Autoren auf einen Grndereffekt schlieen. In sehr niedriger Frequenz
(~0,8%) findet sich die Hg V auch in den turksprachigen Populationen Westasien bzw. den
innerasiatischen Steppen. Der mutmaliche Expansionszeitraum aus dem Rckzugsgebiet
wird von Richard (et al. 2000) vor 11.100-16.900 Jahren angegeben.
Haplogruppe W
Der Haplotyp des Individuums UNS2 der Hg W zeigt ebenfalls die anzestralen Linie
(16223T, 16292T) dieser Haplogruppe. Hg W ist mit einer geringen Frequenz von 1,9%
gleichmig in Mittel- und Westeuropa vertreten, dagegen nimmt die Frequenz in (Nord-)
Osteuropa zu (Richards et al. 2000) und fllt in Zentralasien wieder unter 2% (Metspalu et al.
2004). Metspalu fhrt zudem eine erhhte Frequenz von W in Westindien an und weist
gleichzeitig darauf hin, dass die errechnete Koaleszenzzeit in Indien (37.900 11.100 Jahre v.
h.) weiter zurckreichen, als im Nahen und Mittleren Osten (32.000 8700 Jahre v. h.) und in
Zentralasien (27.400 8300). Richards (et al. 2000) datiert die Verbreitung in Europa auf
17.100-28.400 Jahre vor heute.
Haplogruppe I
Der Sequenzhaplotyp 16129A, 16223T, 16311C, 16357A, 16391A des Krs-Individuums
SZA23 2 stellt innerhalb der Haplogruppe I eine abgeleitete Variante dar. Diese Variante
kann zumindest heute als sehr selten bezeichnet werden, da sich in den bislang
verffentlichten Daten nur eine Entsprechung in einem Individuum aus Deutschland findet
(Lutz et al. 1998). Hg I ist mit einer niedrigen Frequenz (< 2%) in Europa vertreten, wobei sie
im Gegensatz zu Hg W eher in West- und Nordeuropa verbreitet ist (Richards et al. 1998;
2000). Richards setzt fr Hg I ein Alter von 32.300-58.400 Jahren an.
Haplogruppe U5
Die Individuen der nordosteuropischen meso- bzw. neolithischen Vergleichsgruppe (KRE1,
KRE2, DON1, DUD2, CHE4, LEB1) zeigen alle einen Haplotyp der Hg U5. Die brigen mesound neolithischen Individuen der Paralleluntersuchung von Barbara Bramanti (vgl. Kap.
5.3.4), die ebenfalls der Haplogruppe U5 angehren, weisen bereits auf eine bemerkenswerte
Hufung der Hg U5 im Baltikum bzw. Osteuropa im ausgehenden Mesolithikum hin. Der
hchste Anteil an U5-Linien findet sich heute unter den finno-ugrisch sprechenden
Bevlkerungsgruppen Nord-Nordosteuropas, worunter besonders die Saami mit 42,5% zu
erwhnen sind (Tambets et al. 2004). Auch in den heutigen Populationen des vergleichbaren
Gebiets zeigt U5 eine hohe Frequenz (9-11%), wie z.B. in Polen, Russland (Malyarchuk et al.
2002) und Litauen (Kasperaviciute et al. 2004), wo U5 nach Hg H die zweithufigste Hg
darstellt. Die Individuen KRE1, KRE2 und DON1 knnen der Sub-Hg U5b zugeordnet
werden, wobei fr eine eindeutige Zuordnung zu U5b1 bzw. U5b2 eine detaillierte
Auflsung der mtDNA coding region ntig wre. Vor allem der Zweig U5b1 der sub-Hg U5b
ist im heutigen Europa hufig und weit verbreitet, wohingegen U5b2 vorwiegend in Westund Sdeuropa und in Skandinavien zu finden ist (Tambets et al. 2004, Bramanti et al. in
Vorbereitung). Der putative Haplotyp (16189C, 16270T) des Individuums DUD2 entspricht

188

Diskussion
der hufigsten zentralen mtDNA von U5b1. Der Haplotyp des Individuums LEB1
unterscheidet sich durch eine Transversion an np A16241C von dem hufigen anzestralen
Haplotyp U5a1. Der Haplotyp des Individuums CHE4 ist ebenfalls durch eine Mutation
(16294T) von der zentralen Nodie abgeleitet, findet jedoch in der modernen europischen
Bevlkerung eine exakte Entsprechung in Deutschland und Tschechien (Bramanti et al. in
Vorbereitung). Der Haplotyp U5a1 (16192T, 16256T, 16270T, 16362C) des einzigen
linearbandkeramischen U5-Individuums BRU4 findet eine genaue Entsprechung in 16
weiteren Individuen aus europischen Populationen (Bramanti et al. in Vorbereitung). Die
Haplogruppe U5 kann als Prototyp eines pan-westeurasischen cluster von Hgs angesehen
werden (Tambets 2003), deren Koaleszenzzeit auf ca. 45.000-50.000 Jahre v. h. datiert wird
(vgl. Kap. 3.3; Richards et al. 2000). Das phylogenetische Netzwerk von Hg U5 zeigt
insgesamt betrachtet kein sternfrmiges Expansionsmuster, allerdings weisen die
zahlreichen Sub-Hgs (z.B. U5a1, U5a, U5b1, U5b2) durchaus ein sternfrmiges Muster auf
(Tambets et al. 2004; vgl. Kap. 5.3.4, Abbildung 42). Erstaunlicherweise lassen sich diese
allesamt auf eine Koaleszenzzeit von ca. 11.000-13.000 Jahren v. h. datieren. Ein synchrones
Expansionsmuster bei allen sten der U5 Phylogenie kann nur durch umfassende
Vernderungen hervorgerufen werden, wie z.B. klimatische nderungen zum Ende des
Oberen Pleistozns (Tambets 2003).

189

Diskussion

7.4

Die Neolithisierung Europas im Spiegel der mtDNAHaplogruppen

Im Folgenden sollen die einzelnen Fragestellungen der Arbeit auf der Basis der gewonnenen
Ergebnisse diskutiert werden. Aus archologischer Sicht drngt sich zunchst die Frage nach
der genetischen Identitt der beiden frhbuerlichen Kulturen der Krs-Gruppe (Ungarn)
und der Linearbandkeramik (Mitteleuropa) auf.
Bilden a) die beiden archologisch definierten Kulturen mglicherweise tatschlich
existierende Einheiten darstellen, die sich auch in genetischer Hinsicht differenzieren
lassen? Wenn dem so ist, schliet sich unmittelbar die Frage an, ob
b) sich eventuell charakteristische Unterschiede zwischen den zu prfenden
genetischen Einheiten feststellen lassen? Hieraus ergibt sich folglich die
abschlieende Fragestellung, ob
c) ein kultureller Einfluss oder gar ein Wandel, welcher sich in den archologischen
Hinterlassenschaften deutlich belegen lsst, auch in der Struktur der betreffenden
Bevlkerung nachgewiesen werden kann?
Die populationsgenetischen Studien der hier untersuchten maternalen Linien der KrsKultur und der LBK belegen eine basale hnlichkeit zwischen beiden Kulturen. Diese
spiegelt sich in den vergleichbaren Frequenzen der europischen Haplogruppen H, K und J
wider. Sicherlich kann die Stichprobe der Krs-Kultur nur mit Einschrnkung als
reprsentativ angesehen werden, somit kann der Vergleich mit der LBK nur ein vages Bild
der genetischen Beziehungen liefern. Es lsst sich jedoch herausstellen, dass beide
frhneolithische Kulturen als Hintergrund einen sptpalolithisch bzw. mesolithisch
charakterisierbaren mtDNA Genpool aufweisen, der sich vornehmlich am Vorhandensein
der Hg H, HV, K, und T festmachen lsst, welche allesamt nach der Eiszeit in Europa
vorherrschend waren. Eine weitere Gemeinsamkeit ist das Fehlen der Hg U (mit der
Ausnahme von U3 bei VAI3 der LBK) in den Stichproben beider Kulturen. Es kann somit
zwar von einer grundstzlichen genetischen Beziehung der beiden Kulturen gesprochen
werden, doch ein direkter genetischer Einfluss von Seiten der Krs-Kultur auf die LBK, wie
er sich aus dem archologischen Fundmaterial herleiten lsst, kann anhand der vorliegenden
Datenlage nicht erkannt werden.
Weitaus deutlicher knnen Unterschiede zwischen beiden Kulturen herausgearbeitet
werden. Bei der Krs-Gruppe kann ein bemerkenswertes Auftreten von sd- bzw.
zentralasiatischen Haplogruppen beobachtet werden, welche auch in der greren
Stichprobe der LBK nicht zu finden sind. Im Bereich der benachbarten LBK sowie der
zeitgleichen Alfld Linearbandkeramik (AVK) ist dagegen die hohe Frequenz der Hg N1a
auffallend. Hier stellt sie mit 25% die hufigste Haplogruppe und bertrifft somit innerhalb
der LBK/AVK-Stichprobe die Hg H, welche sowohl in den modernen europischen
Bevlkerungen (Richards et al. 2000) als auch in der gesamtneolithischen Stichprobe die
hufigste Hg darstellt. Da sich das Vorkommen von N1a auf den Bereich der LBK/AVK
beschrnkt und zudem dort unerwartet hufig zu beobachten ist (sechs von 24 LBK/AVK

190

Diskussion
Individuen), kann man mglicherweise soweit gehen und im Fall von N1a von einem
genetischen Marker der (Linear-)Bandkeramik sprechen.
Die Koaleszenzzeitberechnungen der Hg (inklusive der Ergebnisse dieser Arbeit) zeigen,
dass, obwohl viele mtDNA-Linien (H, U4, U5, evtl. V) auch vor der letzten
Maximalvereisung in Europa vorhanden waren, die postglaziale Wiederbevlkerung
Europas im Wesentlichen den mitochondrialen Genpool bestimmt hat (Richards et al. 2000,
Tambets et al. 2002). Daraus ergibt sich die Vorstellung einer paloeuropischen
Bevlkerung entlang der Gletscherzonen, die in genetischer Hinsicht ber die Refugien
hinaus in Verbindung standen, und welche sich nach dem Rckzug des Eisschildes wieder
ber Europa verbreiteten. Hierzu knnen in erster Linie die Hgs K, T, W, V und N1a und
weitere Sub-Hgs von H und U gezhlt werden. Wie bereits erwhnt, kann der maternale
Genpool der bearbeiteten neolithischen Stichprobe (bzw. der europische mtDNA Pool zur
Zeit des frhen Neolithikums) als autochthon europisch bezeichnet werden. Die postglazial
charakterisierte Besiedlung bzw. Expansion der Hgs innerhalb Europas wird einerseits
durch die synchronen Koaleszenzzeiten der meisten Hgs gesttzt und andererseits durch die
Vielzahl der anzestralen mtDNA-Linien der Hg J, K, H, W, V, N1a und U5b, die sich unter
den neolithischen Individuen finden, besttigt.
Vor diesem Hintergrund lassen sich die weiteren Beobachtungen, die innerhalb der
neolithischen Stichprobe wie auch im Vergleich mit Daten aus modernen
populationsgenetischen Studien gemacht wurden, diskutieren.
Die entsprechenden Fragestellungen lauten:
d) Inwieweit knnen Unterschiede zur heutigen Bevlkerung Europas als
populationsgenetische Dynamik gedeutet werden?
e)
Knnen
unter
der
Voraussetzung
der
Unterscheidbarkeit
auch
Richtungsdynamiken festgestellt werden, und somit Bewegungen von
Bevlkerungen in Raum und Zeit, wie z.B. Migrationen oder Kolonisierungen
postuliert werden?
f) Kann in diachroner Hinsicht eine Kontinuitt bzw. Diskontinuitt einer
Bevlkerung eines definierten Besiedlungsraumes nachgewiesen werden?
g) Knnen die Ergebnisse bereits formulierte Modelle und Hypothesen zur
Neolithisierung Europas verifizieren bzw. falsifizieren?
Mgliche Szenarien und Hypothesen, welche sich auf die oben genannten Fragestellungen
beziehen, knnen meist exemplarisch an Hg N1a dargelegt werden. Im Vergleich mit Daten
aus modernen populationsgenetischen Studien fllt auf, dass Hg N1a in heutigen
europischen Bevlkerungen nur noch mit einer Hufigkeit von maximal 0.2% zu finden ist.
Die ca. 150-fach hhere Hufigkeit dieser Haplogruppe vor ca. 7500 Jahren lsst erkennen,
dass eine nicht zu gering einzuschtzende Bevlkerungsdynamik in Mitteleuropa nach dem
frhen Neolithikum zu einer starken Ausdnnung dieser mtterlichen Linie gefhrt haben
muss. N1a findet sich sowohl im Westen der LBK (im rheinhessischen Flomborn; FLO1) als
auch im ca. 800 km entfernten heutigen Ungarn (Ecsegfalva; ECS1). Dies bedeutet, dass es
sich bei der Verbreitung von Hg N1a nicht um ein kleinrumiges Phnomen gehandelt
haben kann, welches durch einen lokalen Grndereffekt entstanden ist. Dieses Bild

191

Diskussion
entspricht im Wesentlichen auch der heutigen Situation, in der N1a ebenfalls eine enorme
Verbreitung zeigt, allerdings in deutlich geringerer prozentualer Hufigkeit (vgl. Kap. 7.3.2,
Abbildung 41).
Die Ergebnisse der Simcoal Simulationen fr N1a zeigen, dass die Annahme von genetischer
Drift als alleiniger Ursache fr die starke Verdnnung der N1a-Frequenz nicht ausreicht und
daher andere populationsdynamische Prozesse eine Rolle gespielt haben mssen (Kap.
5.3.5). Da die Trger der Hg N1a allesamt zur frhbuerlichen linearbandkeramischen
Kultur (bzw. AVK) gerechnet und damit als Neolithiker bezeichnet werden knnen, kann
folgendes Szenario angenommen werden: Hg N1a ist unter den einwandernden
neolithischen Bauern hufig, wird jedoch in den nachfolgenden Generationen durch eine
Vermischung mit der zahlenmig berlegenen autochthonen Bevlkerung bald verdrngt.
Dies ist eine plausible Erklrungsmglichkeit, welche sich am Prinzip des archologischen
Modells der leap frog colonization (vgl. Kap. 2.2) orientiert. Weiterhin ist vorstellbar, dass
vorwiegend Mnner die mosaikartig verteilten fruchtbaren Lgebiete Mitteleuropas urbar
machten und dabei lokale Partnerinnen aus dem (noch mesolithischen) Umland whlten.
Unter der Annahme dieses Geschlechterverhltnisses (Mnner allochthon, Frauen
autochthon) wre der Anteil der allochthonen mtDNA-Linien bereits nach einer Generation
betrchtlich eingeschrnkt und knnte bald nicht mehr nachgewiesen werden.
Untersttzende Thesen zu dem angenommenen Szenario einschlielich der mglichen Form
der Partnerwahl finden sich in ethnohistorischen Beispielen, wie sie z.B. Bentley et al. (2003)
beschreiben. Die Ergebnisse dieser Studien, welche mit Hilfe der Analyse stabiler Isotopen
die regionale Herkunft neolithischer Individuen (u.a. auch aus Schwetzingen und Flomborn,
vgl. Price et al. 2001) untersucht, wurden hnlich interpretiert. Bentley et al. (2003) konnten
zeigen, dass ein gewisser Anteil der untersuchten Stichprobe sich vom lokalen IsotopenMuster deutlich abhob. Im Falle von Schwetzingen befanden sich unter der Anzahl dieser,
von ihm benannten Migranten, ein groer Anteil an Frauen.
Auch die Ergebnisse aktueller Simulationen von Currat & Excoffier (2005) knnen unter
diesem Gesichtspunkt interpretiert werden (vgl. Kap. 3.2.2). Die Autoren konnten zeigen,
dass unabhngig von der Geschlechterverteilung bereits ab einer hypothetischen 3%igen
Vermischung der neolithischen Immigranten mit der indigenen Bevlkerung Europas, die
Einwanderer heute nicht mehr nachweisbar seien.
Das letztgenannte Modell wrde analog zur Hg N1a auch die Abnahme der Frequenz der
Hg HV erklren, welche heute im Nahen Osten hufiger ist als in Mitteleuropa und im
Gegensatz dazu die Zunahme der autochthonen europischen Hg H begrnden. Allerdings
lsst sich in diesem Szenario nicht die ins Neolithikum datierte Expansion der Hg U3, T1
und J des vermeintlichen genetischen neolithic package beschreiben (vgl. Kap. 5.3.4). Mchte
man, dieser Annahme folgend, die Individuen mit der Hg U3, T1 und auch J als
einwandernde Bauern vom Nahen Osten bzw. Sdosteuropa sehen und verstnde man die
Verteilung der Stichprobe als Momentaufnahme der Situation im Frhneolithikum, so htte
dieser neue genetische Einfluss innerhalb der LBK/AVK/Krs-Gruppe einen Anteil von 9
%. Nimmt man N1a unter der obigen Annahme hinzu, vergrert sich der Anteil auf 27 %,
unter der weiteren Annahme von Hg HV als nahstlichen Einfluss steigt dieser weiter auf
~36 %. Hinzu kommt der asiatische Einfluss der Hg N9a und D4a, der in dieser Rechnung
bei 6 % liegt. Fasst man diese Hg als erweitertes genetisches neolithic package zusammen,

192

Diskussion
stellt sich heraus, dass der Anteil an sicher autochthonen mtDNA-Linien mit ~58 % dennoch
berwiegt.
Ein Problem dieses Erklrungsansatzes, der N1a als neolithischen Einfluss in Mitteleuropa
ansieht, welcher sich schnell verdnnt, stellt die Tatsache dar, dass in der Krs-Stichprobe
kein N1a Individuum gefunden wurde. Zieht man den rezenten Datensatz der N1a
Individuen zum Vergleich heran, zeigt sich auch hier, dass im geographischen Gebiet des
Nahen Ostens bzw. in Sdosteuropa nur sehr wenige N1a Individuen zu finden sind.
Darber hinaus zeigt sich, dass gerade dieser Anteil durch einen spteren Einfluss von
zentralasiatischen turksprachigen Bevlkerungen erklrt werden kann (vgl. Abbildung 41 in
Kap. 7.3.2). Darber hinaus lsst sich bereits hier grundstzlich feststellen, dass nicht nur die
Stichprobengren (v.a. der Krs-Kultur) zur Klrung der Fragestellungen vergrert
werden, sondern auch zeitgleiche Individuen des Nahen Ostens sowie Meso- und
Palolithiker Europas einbezogen werden mssen.
Eine weitere mgliche Erklrung setzt die Annahme voraus, dass Hg N1a vor und whrend
des Neolithikums in Mitteleuropa generell hufiger auftrat und dessen Frequenz bis zum
heutigen Zeitpunkt schlichtweg verdriftet ist. Hierbei ist es unerheblich, ob eine autochthone
oder allochthone Bevlkerung oder beide Trger einer hohen N1a Frequenz sind. Gegen
diese Mglichkeit sprechen jedoch, wie bereits erwhnt, die Ergebnisse der Simcoal
Simulation, die zeigen konnten, dass genetische Drift als alleinige Ursache nicht ausreichend
ist, um bei der vorliegenden hohen N1a-Frequenz im Zeitraum der vergangenen 7500 Jahre
die niedrige heutige Frequenz der Hg N1a zu erreichen, die berall in Eurasien und
Nordwestafrika gleichmig gering ist. Fr die bemerkenswerten asiatischen Hgs N9a und
D4a, die bei der Stichprobe der Krs-Kultur zu finden waren, mag die Annahme von
genetischer Drift als Ursache fr das Fehlen im rezenten europischen mtDNA-Genpool
zutreffend sein. Es ist durchaus anzunehmen, dass sich die kontinentale Trennung der
MHg M und N in einen eurasischen Raum und ein zentral- bzw. ostasiatischen Raum nicht
als absolut zu sehen ist. Vielmehr kann davon ausgegangen werden, dass diese
vermeintliche geographische Trennung ein Produkt genetischer Drift ber Jahrtausende von
Jahren hinweg darstellt. Somit kann plausibel erscheinen, dass zum Zeitpunkt des frhen
Neolithikums vor ca. 7500-8000 Jahren auch mtDNA-Linien in geringer Frequenz in Europa
vorkamen, die heute als klassisch asiatische Hgs bezeichnet werden. Die gnzliche
Verdrngung von (asiatischen) Hgs mit sehr niedrigen Frequenzen scheint zumindest in
Europa, dessen hohe Bevlkerungsdynamik bekannt ist, nicht verwunderlich zu sein.
Schliet man genetische Drift fr die Verdnnung der N1a-Frequenz aus, so bleibt als
Erklrungsansatz nur eine postneolithische Bevlkerungsdynamik, die zur heute
beobachteten Frequenz gefhrt hat. Die archologischen Belege fr sptere vergleichbar
enorme Umwlzungen wie die der Neolithischen Transition, die gleichermaen die
Annahme einer Auswirkung auf die europischen Populationen in genetischer Hinsicht
rechtfertigen, sind gering. Das Ende der Bandkeramik und die Entstehung der
nachfolgenden jungsteinzeitlichen Kulturen in Mitteleuropa erfolgt nicht so abrupt
(Gronenborn 2005b), als dass hierfr bereits ein Hinweis auf einen Wandel zu erkennen ist,
der sich mglicherweise im mtDNA Genpool widerspiegeln sollte. Die

193

Diskussion
populationsgenetischen Prozesse, die zur Herausbildung der heutigen Situation gefhrt
haben, sollten vielmehr als Produkt unzhliger grerer und kleinerer (pr-)historischer
Bevlkerungsbewegungen gesehen werden, wobei mit den bronzezeitlichen Hochkulturen
im Nahen Osten, dem Antiken Griechenland, dem Imperium Romanum, den Kelten und der
nachfolgenden Vlkerwanderung nur die bekanntesten Beispiele fr Ereignisse genannt
werden, die einen stndigen und immer neu berlagernden Einfluss auf den europischen
maternalen Genpool gehabt haben knnen.
Whrend die Situation in Mitteleuropa in genetischer Hinsicht komplex wirkt, liefern die
Ergebnisse der mtDNA-Analysen an den Individuen aus Polen, Litauen und Russland ein
sehr reduziertes Bild. Da neben neolithischen auch mesolithische Funde untersucht wurden,
knnen die Ergebnisse auch im Hinblick auf diachrone Trends betrachten werden. Unter
Einbezug von weiteren Individuen der gleichen Region aus einer begleitenden Arbeit (vgl.
Kap. 7.3.2) kann deutlich von einer genetischen Kontinuitt whrend der neolithischen
Transition im nrdlichen Osteuropa gesprochen werden. Dies lsst sich im uniformen
mtDNA-Pool der kleinen Stichprobe erkennen, die sich bis auf ein Individuum (Hg U4) aus
Varianten der Hg U5 zusammensetzt. Erst unter bronzezeitlichen Individuen finden sich
andere Haplogruppen. Die vordergrndig genetische Kontinuitt im baltischen Raum deckt
sich weitgehend mit den archologischen Hinweisen, dass die Neolithisierung im
waldreichen Osteuropa langsamer vorgeschritten ist und dementsprechend erst in der
eigentlichen Bronzezeit die vollstndige Neolithisierung, wie sie in Mitteleuropa definiert
wird, erreicht (Dennell 1992, Price 2000, Zvelebil & Lillie 2000). Auffallend ist, dass Hg U5,
trotz der Hufung in diesem Gebiet, offensichtlich in der LBK/Krs-Gruppe nicht
vorkommt (wenn man die Probe BRU4 ausklammert, vgl. Kap.7.2). Mglicherweise kann
dies bedeuten, dass weder die LBK noch die sdosteuropischen Kulturen (in genetischer
Hinsicht) eine wesentliche Rolle bei der Transition im nrdlichen Osteuropa gespielt haben.
Zvelebil und Lillie (2000) besttigen dieses Bild, in dem sie fr das stliche Baltikum eine
sehr langsam verlaufende Neolithisierung ansetzen, die sie trotz der umgebenden
frhbuerlichen Kulturen im Sdwesten als auch im Westbaltikum in der zeitlich sehr
verzgerten Annahme der buerlichen Lebensweise durch die indigene Bevlkerung sehen.
Im Folgenden soll auf Basis der hier angefhrten Erklrungsmglichkeiten fr die
frhneolithische Variabilitt in Europa ein hypothetisches und mglichst parsimonisches
Bild der Auswirkungen der Neolithisierung auf den europischen mtDNA Genpool erstellt
werden. Hierzu werden einige grundstzliche Annahmen gemacht. Es stellt sich die kritische
Frage, ob sich die Bevlkerungsgruppen im Nahen Osten und in Europa nacheiszeitlich
genetisch unterschieden haben? War die letzte Maximalvereisung zeitlich ausreichend lange,
um Unterschiede in den sdeuropischen Refugien zu etablieren? Nicht zuletzt stellt auch
der Nahe und Mittlere Osten ein Refugium dar, woraus bereits die Frage resultiert, ob nicht
dort bereits eine Durchmischung von europischen und westasiatischen mtDNA-Linien
stattgefunden hat, die eine sptere Aufschlsselung whrend des Neolithikums unmglich
macht?
Dies stellt aus genetischer Sicht ein Problem der ungengenden phylogenetischen Auflsung
dar, denn es wrde bedeuten, dass die Analyse von frhneolithischen Individuen

194

Diskussion
Sdosteuropas und Westasiens kaum eine Trennung erkennen lassen drften. Diese
Annahme wird sich jedoch erst durch weitere ausgedehnte Untersuchungen verifizieren
oder falsifizieren lassen.
Im Gegensatz hierzu besteht durchaus die Wahrscheinlichkeit, dass sich einerseits in den
Refugien durch Isolation und damit verbundenen Grndereffekten bestimmte
Frequenzverschiebungen zugunsten einzelner Hg ereigneten. Andererseits besteht auch die
Mglichkeit, dass whrend der Wiederbesiedlung aus den Eisrandzonen Sdosteuropas
bzw. Westasien ebenfalls durch Grndereffekte einzelne regionale Hufungen entstanden
sind. Theoretisch sollten sich nach der Wiederbesiedlung Europas regionale Charakteristika
ergeben, die mglicherweise noch whrend des Neolithikums erkennbar sind, denn ohne
Zweifel stellt die heutige Situation in Europa, wie sie durch die modernen Daten
dokumentiert ist, nur ein stark verwaschenes und abgeflachtes Bild der
Haplogruppenverteilung dar.
Unter dieser zweiten Annahme versteht sich auch die folgende Rekonstruktion der Situation
im Neolithikum basierend auf den hier gewonnenen Ergebnissen. Die berwiegende
Mehrheit der neolithischen mitteleuropischen Bevlkerung besitzt, wie gezeigt werden
konnte, charakteristische europische Hgs, die je nach Region in ihrer Frequenz variieren.
Hinweise darauf zeigen die Fundorte Schwetzingen, wo Hg T dominiert, Mitteleuropa
nrdlich der Donau, wo N1a vorherrschend ist und das stliche Baltikum, wo U5 sehr hufig
ist. Grundstzlich treffen im Bereich der LBK, d.h. im gesamten Mitteleuropa Einflsse aus
mehreren Richtungen aufeinander. Im Westen der LBK finden sich im Wesentlichen die
(sd-) westeuropischen Hgs H, V, T und K, wohingegen in Mitteldeutschland neben diesen
auch die Hgs N1a, W, HV anzutreffen sind. Mag auch die Hg HV durch ihre heutige
Hufigkeit im Nahen Osten eine Verbindung zu diesem Gebiet darstellen, die auch in der
Krs-Kultur zu finden ist, so zeigt vor allem letztere, prinzipiell autochthon europisch
(H,K,T,J) geprgt, eine Verbindung zu Populationen Zentralasiens (N9a, D4a). Eine
Verbindung zu westasiatischen bzw. osteuropischen Populationen kann im Vergleich mit
heutigen Populationen auch in den Hgs K und N1a gesehen werden (vgl. Kap. 7.3.2),
wenngleich in umgekehrter Richtung von Westen nach Osten. Besttigungen fr
Beziehungen in dieser Richtung liegen auf archologischer Basis bislang nur wenige vor.
Dies lsst sich hauptschlich mit der politischen Lage der vergangenen Jahrzehnte
begrnden und bedeutet keinesfalls, dass die Fundsituation sprlich ist. Die wenigen
Erkenntnisse, die bislang vorliegen, deuten jedoch auf die Wichtigkeit dieser Gebiete
hinsichtlich der kulturellen (wie auch genetischen) Vernetzung hin (Detlef Gronenborn,
mndl. Mitteilung).
Der Einfluss von weiteren vermeintlich neuen neolithischen Linien wie J, T1 und U3 ist zum
Zeitpunkt des frhen Neolithikums nur schwach bis gar nicht ausgeprgt. Dies zeigt, dass
zwar die geschtzte Expansionszeit dieser Hgs im Zeitrahmen des Neolithikums einsetzt, es
bleibt jedoch zu prfen, wann in prhistorischen Stichproben die Frequenzen der
vermeintlichen Hgs des neolithic package zunehmen.
Nachfolgend sollen ergnzend einige grundstzliche kritische Bemerkungen zur
vorliegenden Arbeit angefhrt werden. Dies betrifft zunchst die Definition der einzelnen
neolithischen Stichproben. Besonders die geringe Stichprobenzahl der Krs-Kultur, sofern

195

Diskussion
sie getrennt behandelt wird, kann mit Sicherheit nur mit Einschrnkung als reprsentativ fr
das frhe Neolithikum im Karpatenbecken gesehen werden kann. Generell ist der Umstand
der geringen Datengrundlage, zum einen durch natrliche Fund- bzw.
Dokumentationslcken bedingt, ein Problem, das in jeder Wissenschaft, die (pr-)historische
Fragestellungen verfolgt, durchaus bekannt ist. Dass auch rein logistische, technische,
zeitliche Probleme bei der Probenakquisition bzw. Bereitschaft zur Bereitstellung eine groe
Rolle spielen, sei dahingestellt. Im Falle dieser Arbeit kommen zustzliche Limitierungen
seitens der Erhaltung der zu untersuchenden DNA hinzu. Trotz der noch sprlichen
Datengrundlage lassen sich aber bereits entscheidende Strukturen feststellen, die sowohl die
Gesamtheit der neolithischen Stichprobe als auch die einzelnen neolithischen Kulturen
deutlich von heutigen mitteleuropischen Populationen unterscheiden lassen.
Als weiteren Kritikpunkt lassen sich Zuordnungsprobleme anfhren, die die kulturelle
Identitt bzw. die Datierung einzelner Funde betrifft. Sicherheit bezglich der Zuordnung
von Individuen zu einem gemeinsamen kulturellen Hintergrund kann nur innerhalb
geschlossener Fundsituationen, wie z.B. greren Grberfeldern, angenommen werden.
Hierbei sollten auch trotz mglicher lngerer Belegdauern eines Friedhofes die zeitlichen
Diskrepanzen gering sein. Allerdings muss bei der Einbeziehung von mehreren Individuen
eines Fundplatzes beachtet werden, dass z.B. identische Haplotypen nur einmal gewertet
werden, da grundstzlich verwandtschaftliche Beziehungen innerhalb einer Gemeinschaft
mglich sind, die unter Umstnden die Frequenzen der Haplogruppen verzerren wrden.
Somit muss konstatiert werden, dass die verwendeten Kategorien der LBK/AVK-Stichprobe,
der Krs-Kultur sowie die der Sammelgruppe Nordosteuropas deutlich als knstliche
Einheiten verstanden werden mssen, die intern zeitliche Divergenzen von mehreren
Jahrzehnten bis hin zu wenigen Jahrhunderten aufweisen knnen. Die Zuordnung zur
archologischen Kultur ist jedoch in allen Fllen gesichert, womit von einer zwar zeitlich
inkongruenten, aber kulturell sinnvollen Einteilung zum Vergleich der neolithischen Proben
ausgegangen werden kann. Auch hier kann angefgt werden, dass die Untersuchung
weiterer Proben und die gleichzeitige Ausdehnung sowohl in geographischer als auch
zeitlicher Hinsicht die hier getroffenen Aussagen klarer erscheinen werden lassen.

7.4.1 Die Bedeutung der Ergebnisse fr die Rezentgenetik


Die aDNA-Analysen liefern mit der hohen Frequenz an N1a Haplotypen, mit Einschrnkung
der HV Haplotypen und auch der zwei asiatischen Linien innerhalb der Stichprobe der
Krs-Kultur interessante und bemerkenswerte Ergebnisse. Die Besonderheit dieser
Ergebnisse ist, dass sie als solches aus der Sicht der rezenten populationsgenetischen Studien
nicht erwartet worden wren. Im Umkehrschluss bedeutet dies, dass die Ergebnisse der
aDNA-Analyse einen Beleg dafr liefern, dass es anhand der Datenlage, die rezente Studien
liefern, nicht mglich ist, endgltige Aussagen ber die populationsgenetische Situation in
vor- und frhgeschichtlichen Epochen zu machen (vgl. Kap. 3.4, Abbildung 8).
Die groe Problematik der rezenten Populationsgenetik Europas liegt in der Tatsache
begrndet, dass die moderne gesamteuropische Bevlkerung durch eine Vielzahl
historischer Ereignisse geprgt ist, die sich zwar in archologischen sowie spter in

196

Diskussion
schriftlichen Quellen wiederfinden, deren Auswirkungen auf das Gesamtbild des
europischen Genpools, und hier besonders des mtDNA Genpools, aber weitgehend
unbekannt sind. Das vielmals geuerte Bild des genetischen Palimpsests (vgl. Kap. 3.1.4)
charakterisiert die rezente Datenlage sehr treffend. Diese wiederholte genetische
berschreibung erschwert die Rekonstruktion von historischen Geschehnissen enorm. Ein
urschlicher Faktor ist nach Meinung von Bandelt et al. (2002) rein methodologischer Art
und betrifft die grundstzliche Definition von (rezenten) Populationen, die in der Literatur
nicht konform gehandhabt wird. So werden einerseits Staatsgrenzen und andererseits
Sprachgrenzen als Unterscheidungskriterium herangezogen. Bandelt fhrt an, dass sich
Sprachen und Ernhrungsgewohnheiten bzw. Subsistenzstrategien ndern knnen, whrend
Genotypen auch unter verschiedensten Bevlkerungsstrukturen erhalten bleiben. Was die
Kritik an der Definition von Populationen betrifft, so versteht er diese auch nicht als absolut
und sieht deren Notwendigkeit im Sinne von Arbeitshypothesen durchaus gerechtfertigt
und fordert gleichzeitig, bestehende Konzepte nicht zugunsten von mystischen
Verbindungen zu mtDNA Urmttern zu verwerfen (Sykes 2003).
Ein weiteres Problem stellt die Datierung von populationsgenetischen Ereignissen dar.
Oftmals wird der Zeitpunkt einer Trennung von genetischen Linien mit der Trennung von
Populationen gleichgesetzt. Bereits Cavalli-Sforza (1998) macht deutlich, it is the date of
population splits, not the birth of individuals carrying the first mutation, that is of interest for
comparison with archaeological dates, which usually refer to the early settlement of new areas und
macht damit deutlich, dass eine Koaleszenzzeitberechung zwar das Alter der Hg berechnen,
jedoch nicht dem Alter der jeweiligen (fraglichen) Population entspricht, die Trger
derselben sind.
Die Tatsache, dass die meisten Hgs lter sind als die Populationen, die wir heute
ungeachtet der genauen Definition - kennen bzw. zu rekonstruieren versuchen, hat bereits
Sykes (1999) deutlich gemacht. Daher ist und bleibt es schwierig Populationen genetisch zu
charakterisieren, insbesondere wenn ohnehin eine hohe historische Dynamik der
betreffenden Bevlkerungen vorliegt. Des Weiteren ist der Umgang mit Koaleszenzzeiten
einzelner Hgs fr die Datierung bestimmter Epochen weiterhin kritisch zu sehen, solange
diese nicht durch weitere Daten anderer Hgs gesttzt werden.
Durch die Ergebnisse der vorliegenden Arbeit kann gezeigt werden, dass die Analyse alter
DNA im Stande ist, die beiden dargestellten Probleme der Rezentgenetik zu umgehen. Zum
einen ist es mglich, ungeachtet der bevlkerungsdynamischen Prozesse, die genetische
Variabilitt einer (kulturell oder chronologisch definierten) Bevlkerung direkt zu
definieren. Zum anderen knnen hierdurch bestehende Koaleszenzzeitberechnungen der
einzelnen Hgs gesttzt werden, da somit indirekt Besttigungen in fraglichen Epochen im
Sinne von termini ante quem bestimmt werden.

197

Diskussion

7.4.2 Die Bedeutung der Ergebnisse fr die Archologie und Anthropologie


Die Ergebnisse der ersten umfangreichen aDNA-Analysen zum mitteleuropischen
Neolithikum zeigen fr den Bereich der LBK und der Krs-Kultur ein komplexes Bild. Auf
der einen Seite offenbaren die Linearbandkeramiker durch die Hg N1a eine charakteristische
genetische Signatur und auf der anderen Seite finden sich in der kleineren Krs-Stichprobe
unerwartet ostasiatische mtDNA-Linien, wobei die verbleibenden Linien in beiden Gruppen
wiederum hnlich (hufig) sind und zudem eine vergleichsweise hohe Diversitt aufweisen.
Insgesamt deutet sich fr die Verbreitung der archologischen Sachkultur, die unter der
Epoche LBK zusammengefasst wird, ein vielschichtiger Prozess an, der abhngig vom
einzelnen Fundplatz ein variierendes Bild von neuen Einflssen als auch unter diesen
autochthon weiterentwickelten Elementen aufzeigt (Gronenborn 1999; 2003; 2005).
Dagegen weist die angrenzende Stichprobe des nrdlichen Osteuropa - aufgrund der kleinen
Probenanzahl unter Vorbehalt betrachtet - eine eher eingeschrnkte Diversitt der Hgs auf.
Hierin zeigen sich Parallelen zu den Forschungsergebnissen der Archologie der letzten
Jahrzehnte. Die Situation im nrdlichen Osteuropa, welche durch eine zeitlich stark
verzgerte und langsame Annahme der buerlichen Lebensweise geprgt war, spiegelt sich
in der geringen Haplogruppendiversitt dieser Arbeit wider. Auf Basis der vorlufigen
Ergebnisse kann daher fr diese Region im betreffenden Zeitraum angenommen werden,
dass keine tiefgreifenden Umwlzungen stattgefunden haben, die sich genetisch feststellen
lassen.
Grundstzlich lsst sich anmerken, dass in Verknpfung mit den Ergebnissen der aDNAAnalysen fr den geographischen Raum der LBK sich das Modell der leapfrog colonization
(Kap. 2.2) am ehesten als plausible Erklrungsmodell fr die Neolithisierung Mitteleuropas
anbietet (Zvelebil & Lillie 2000, Zvelebil 2000), wenngleich nicht fr alle feinchronologischen
Phasen und alle kologischen Kleinrume in gleichem Umfang.
Gleichzeitig werfen die Ergebnisse der vorliegenden Arbeit weitere Fragen auf, die sich fr
zuknftige Aufgaben empfehlen. So stellt sich nicht nur fr die Archologen die Frage,
welche Verbindung sich hinter den mglichen asiatischen Linien verbirgt und welcher
bevlkerungsdynamische Prozess als Erklrung fr die starke Verdnnung der
(linearbandkeramischen?) N1a-Linien herangezogen werden kann. Dennoch kann postuliert
werden, dass nur eine verstrkte multidisziplinre Herangehensweise ein detailliertes Bild
dieser komplexen Transition erbringen kann. In der mitteleuropischen, archologischen
Forschung der letzten Jahrzehnte ist grundstzlich eine Abwendung von reduktionistischen
Modellen sprbar (Gronenborn 2006), welche sich gleichermaen in der detaillierten
regionalen und berregionalen Aufarbeitung der Funde als auch in der zunehmenden, sowie
nachhaltigen Rezeption von naturwissenschaftlichen Methoden, wie z.B. der Isotopen- , der
DNA, sowie der Klimaforschung widerspiegelt (Price et al. 2001, Bentley et al. 2002,
Gronenborn 2003; 2005). Auch kritische Aufarbeitungen wie z.B. die aktuelle Arbeit von
Prien (2005), welche vor soziologischem Hintergrund die Nachweisbarkeit von
unterschiedlichen Formen von Wanderungsbewegungen beleuchtet, an ausgewhlten
Fallbeispielen prft und darber hinaus allgemeine Interpretationsrichtlinien liefert, bieten
einen lngst berflligen theoretischen Neuansatz. Im Sinne von Prien liefern auch meines
Erachtens gerade die oft unzureichenden Begriffsdefinitionen der einzelnen

198

Diskussion
Wanderungsbewegungen, die oft vereinfachend unter dem Oberbegriff Migration
zusammengefasst werden, die Grundlage fr eine berinterpretationen der tatschlichen
Wanderungsdynamik. Dass die Ausbreitungsrichtungen der neolithischen Lebensweise den
bekannten mesolithischen Handelsrouten folgten, ist allgemein akzeptiert (Gronenborn
1999). Weiterhin konnte aktuell in der, diese Arbeit begleitenden, Dissertation von
Bollongino (2005; Bollongino et al. 2005) gezeigt werden, dass die neolithischen Hausrinder
Mitteleuropas genetisch identisch mit den Hausrindern des Nahen Ostens sind und keine
autochthone Domestikation in Europa stattgefunden hat, was wiederum bedeutet, dass diese
Tiere wie auch Schaf und Ziege verhandelt wurden. Hieraus lsst sich veranschaulichen,
dass das neolithische Mitteleuropa mit Vorderasien direkt oder indirekt in Kontakt stand
und die kulturellen Einflsse vorrangig auf ideellem Wege ber mehrere Jahrhunderte
hinweg verbreitet wurden. Dass bei diesem Prozess - auf bekannten Wegen - auch Menschen
ber weite Distanzen mobil waren, wird hierbei vorausgesetzt, jedoch ist dies nur
eingeschrnkt fr gewisse Bevlkerungsteile berzeugend und mit groer
Wahrscheinlichkeit nicht fr diejenigen, welche in vollem Umfang Ackerbau und Viehzucht
betrieben haben. In gewisser Hinsicht stellt diese Meinung gleichsam ein Desiderat an die
knftige Neolithikumsforschung dar, worin nun in detaillierter Aufarbeitung von einzelnen
Fundpltzen
unter Einbezug
aller
aktuell
mglichen
archologischen
wie
naturwissenschaftlichen Methoden vergleichende Binnenanalysen durchgefhrt werden
mssten. Von besonderem Interesse wre hierbei, ob sich bspw. bestimmte genetische Linien
zustzlich durch abweichende Isotopenprofile, Beisetzungsformen und charakteristische
Beigabenensembles oder umgekehrt besttigen und bestimmten Traditionen bzw. und
letztlich archologischen Kulturen zuordnen lassen. Eindeutige Hinweise auf multitraditionelle Gemeinschaften finden sich nicht nur in den Isotopen-Arbeiten von Bentley und
Kollegen (2002, 2003), sondern grundstzlich im westlichen Verbreitungsgebiet der LBK, wie
z.B. im hessischen Bruchenbrcken und im sddeutschen Vaihingen a.d. Enz (Gronenborn
2003, 2006). Die groe Diversitt der Haplogruppen der vorliegenden Arbeit, sowie deren
phylogeographische Affinitten passen gut in dieses frhneolithische Gesellschaftsbild.
Gronenborn fhrt aus, ...what previously appeared as culturally - and by implication ethnically
homogenous LBK villages were in reality focal points of varying cultural traditions with differing
regional origins across Central Europe (2006), wobei nach den Ergebnissen dieser
Dissertationen, die Einzugsgebiete auch geographisch weiter gefasst werden knnen oder
gar mssen.
Somit bleibt festzuhalten, dass die genaue Aufschlsselung dieser multi-traditionellen
frhneolithischen Gemeinschaften die Aufgabe der kommenden interdisziplinren Anstze
sein muss.

199

Zusammenfassung

8. Zusammenfassung
Die vorliegende Dissertation ist eine molekulargenetische Studie an humanem neolithischem
Skelettmaterial.
Im zentralen Blickpunkt stand die Bestimmung der Variabilitt der mitochondrialen
Haplogruppen einer frhneolithischen Stichprobe aus drei unterschiedlichen Kulturkreisen,
welche die Linearbandkeramik (LBK und AVK), die Krs-Kultur und eine
Sammelkategorie osteuropischer sptmeso- und frhneolithischer Kulturen umfasste. Im
Vergleich dieser Gruppen untereinander sowie mit Rezentdaten moderner Populationen aus
vergleichbaren Gebieten Mittel- und Osteuropas sowie dem Nahen Osten sollten bestehende
Modelle und Hypothesen zur Neolithisierung Mitteleuropas geprft werden.
Insgesamt konnte fr 43 neolithische Individuen aus 16 Fundorten der reproduzierbare
Nachweis endogener DNA erbracht werden. Eine eindeutige Haplogruppenbestimmung
konnte durch die Sequenzierung vier berlappender Fragmente der mitochondrialen
Hypervariablen Region I sowie durch RFLP-Analyse zustzlicher charakteristischer
Nukleotidpositionen fr alle 43 Individuen durchgefhrt werden.
Die neolithischen Individuen der Linearbandkeramik sowie der Krs-Kultur zeigten eine
hohe Diversitt an bekannten europischen Haplogruppen, wohingegen die kleinere
Stichprobe aus dem Gebiet Osteuropas eine auffllige Homogenitt aufwies.
Neben einigen Frequenzunterschieden zur modernen mitteleuropischen Bevlkerung war
innerhalb der LBK/AVK-Stichprobe eine bemerkenswert hohe Frequenz der Haplogruppe
N1a festzustellen, welche nicht in den beiden anderen neolithischen Stichproben zu finden
war und auch in der heutigen Rezentbevlkerung Eurasiens und Nordafrikas nur mit einer
durchschnittlichen Frequenz von 0,2% vertreten ist. Innerhalb der Individuen der KrsKultur fanden sich zwei Haplotypen, welche heute nicht in Europa bekannt sind, dagegen
jedoch in Sd- bzw. Nordostasien gehuft vorkommen.
Die Ergebnisse der aDNA-Analysen besttigten im Wesentlichen das komplexe Bild der
Neolithischen Transition in Mitteleuropa und konnten die, fr diesen Raum postulierte,
Hypothese der leap frog colonization weitestgehend untersttzen. Auch fr den
geographischen Vergleichsraum des nrdlichen Osteuropa konnten Parallelen zur
etablierten Sichtweise der archologischen Forschung zu diesem Gebiet und den
vorliegenden Ergebnissen der aDNA-Analysen aufgezeigt werden. Die zeitlich verzgerte
Annahme der neolithischen Lebensweise im waldreichen nrdlichen Osteuropa spiegelt sich
in der reduzierten Diversitt an mtDNA-Haplogruppen wider.
Die vorliegende Dissertation konnte nicht nur durch die z.T. unerwarteten Ergebnisse der
Haplogruppen-Bestimmung, sondern vor allem durch die umfangreichen und elaborierten
Reproduktions- und Authentifizierungprotokolle deutlich machen, dass der Nachweis von
humaner
alter
DNA
trotz
der
allgegenwrtigen,
methodenimmanenten
Kontaminationsgefahr unter streng kontrollierten Bedingungen mglich ist.

200

Zusammenfassung
Gleichermaen konnte veranschaulicht werden, dass die aDNA-Analyse wertvolle Hinweise
auf das genetische status quo einer Population liefern kann, welche nicht bzw. nur in sehr
eingeschrnkten Mae von rezenten DNA-Daten abgeleitet werden knnen.
Als sekundres Ergebnis erlaubte der bislang grte vorliegende Datensatz von ~2500
Klonsequenzen zudem einen detaillierten Einblick in Hufigkeiten und Verteilungsmuster
von post mortem Sequenzvernderungen. Es konnten fr den mitochondrialen Bereich der
Nukleotidpositionen 15997-16409 so genannte hot bzw. cold spots definiert werden, welche
fr die Auswertung und Interpretation von zuknftigen Sequenzierungen der
Hypervariablen Region I des mt-Genoms von entscheidender Bedeutung sein werden.

201

Literatur

9. Literatur
Abbott A (2003) Anthropologists cast doubt on human DNA evidence. Nature 423:468
Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, Scozzari R, Cruciani F, Zeviani M, Briem E,
Carelli V, Moral P, Dugoujon JM, Roostalu U, Loogvali EL, Kivisild T, Bandelt HJ, Richards M,
Villems R, Santachiara-Benerecetti AS, Semino O, Torroni A (2004) The molecular dissection of
mtDNA haplogroup H confirms that the Franco-Cantabrian glacial refuge was a major source for the
European gene pool. Am J Hum Genet 75:910-918
Adcock GJ, Dennis ES, Easteal S, Huttley GA, Jermiin LS, Peacock WJ, Thorne A (2001) Mitochondrial
DNA sequences in ancient Australians: Implications for modern human origins. PNAS 98:537-542
Al-Zahery N, Semino O, Benuzzi G, Magri C, Passarino G, Torroni A, Santachiara-Benerecetti AS
(2003) Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal
and of post-Neolithic migrations. Mol Phylogenet Evol 28:458-472
Alves-Silva J, da Silva SM, Guimaraes PE, Ferreira AC, Bandelt HJ, Pena SD, Prado VF (2000) The
ancestry of Brazilian mtDNA lineages. Am J Hum Genet 67:444-461
Ammerman AJ, Cavalli-Sforza LL (1984) The Neolithic Transition and the genetics of populations in
Europe. Princeton University Press, Princeton
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP,
Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981) Sequence and organization of the
human mitochondrial genome. Nature 290:457-465
Andrews LB, Buenger N, Bridge J, Rosenow L, Stoney D, Gaensslen RE, Karamanski T, Lewis R,
Paradise J, Inlander A, Gonen D (2004) Ethics. Constructing ethical guidelines for biohistory. Science
304:215-216
Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (1999) Reanalysis
and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet 23:147
Antanaitis I (1999) Concerning the transition to farming in the East Baltic. Documenta Praehistorica
26:89-100
Anthony DW (1990a) Migration in Archaeology: The baby and the bathwater. American
Anthropologist 92:895-914
Anthony DW (1990b) Migration in Archaeology: the baby and the bathwater. American
Anthropologist 92:895-914
Anthony DW, Brown DR (1991) The origins of horseback riding. Antiquity 65:22-38
Austin JJ, Ross AJ, Smith AB, Fortey RA, Thomas RH (1997) Problems of reproducibility--does
geologically ancient DNA survive in amber-preserved insects? Proc R Soc Lond B Biol Sci 264:467-474
Autze T (2005) Ausgrabungen auf dem Sonntagsfeld in Halberstadt. Archologie in Sachsen-Anhalt
3:in press
Avise JC (2000) Phylogeography. Harvard University Press, Cambridge MA
Awadalla P, Eyre-Walker A, Smith JM (1999) Linkage disequilibrium and recombination in hominid
mitochondrial DNA. Science 286:2524-2525

202

Literatur
Babalini C, Martinez-Labarga C, Tolk HV, Kivisild T, Giampaolo R, Tarsi T, Contini I, Barac L,
Janicijevic B, Martinovic K, I, Pericic M, Sujoldzic A, Villems R, Biondi G, Rudan P, Rickards O (2005)
The population history of the Croatian linguistic minority of Molise (southern Italy): a maternal view.
Eur J Hum Genet 13:902-912
Bach A (1978) Neolithische Populationen im Mittelelbe-Saale-Gebiet. Weimar,
Bach H, Bach A (1989) Paloanthropologie im Mittelelbe-Saale-Werra-Gebiet. Weimar,
Baig MM, Khan AA, Kulkarni KM (2004) Mitochondrial DNA diversity in tribal and caste groups of
Maharashtra (India) and its implication on their genetic origins. Ann Hum Genet 68:453-460
Bailey JF, Richards MB, Macaulay VA, Colson IB, James IT, Bradley DG, Hedges RE, Sykes BC (1996)
Ancient DNA suggests a recent expansion of European cattle from a diverse wild progenitor species.
Proc R Soc Lond B Biol Sci 263:1467-1473
Balogh MK, Burger J, Bender K, Schneider PM, Alt KW (2003) STR genotyping and mtDNA
sequencing of latent fingerprint on paper. Forensic Sci Int 137:188-195
Bandelt HJ, Forster P, Rhl A (1999) Median-joining networks for inferring intraspecific phylogenies.
Mol Biol Evol 16:37-48
Bandelt HJ, Quintana-Murci L, Salas A, Macaulay V (2002) The fingerprint of phantom mutations in
mitochondrial DNA data. Am J Hum Genet 71:1150-1160
Bandelt HJ, Macaulay V, Richards M (2003) What molecules can't tell us about the spread of languages
and the Neolithic. In: Bellwood P, Renfrew C (eds) Examining the Farming/Language Dispersal
Hypothesis. McDonald Institute for Archaeological Research, pp 99-111
Bar-Gal GK, Khalaily H, Mader O, Ducos P, Horwitz LK (2002) Ancient DNA Evidence for the
Transition from Wild to Domestic Status in Neolithic Goats: A case study from the site of Abu Gosh,
Israel. Ancient Biomolecules 4:9-17
Barbujani G, Bertorelle G, Chikhi L (1998) Evidence for Paleolithic and Neolithic gene flow in Europe.
Am J Hum Genet 62:488-492
Barbujani G, Bertorelle G (2003) Were Cro-Magnons too like us for DNA to tell? Nature 424:127
Barbujani G, Goldstein DB (2004) Africans and Asians abroad: genetic diversity in Europe. Annu Rev
Genomics Hum Genet 5:119-150
Barker G (1985) Prehistoric Farming in Europe. Cambridge University Press, Cambridge
Barnes I, Matheus P, Shapiro B, Jensen D, Cooper A (2002) Dynamics of Pleistocene population
extinctions in Beringian brown bears. Science 295:2267-2270
Barnett WK (2000) Cardial pottery and the agricultural transition in Mediterranean Europe. In: Price
TD (ed) Europe's First Farmers. Cambridge University Press, Cambridge, pp 144-182
Behar DM, Hammer MF, Garrigan D, Villems R, Bonne-Tamir B, Richards M, Gurwitz D, Rosengarten
D, Kaplan M, Della PS, Quintana-Murci L, Skorecki K (2004) MtDNA evidence for a genetic bottleneck
in the early history of the Ashkenazi Jewish population. Eur J Hum Genet 12:355-364
Behrens RH (1989) Ein Grberfeld der Bandkeramik von Schwetzingen, Rhein-Neckar-Kreis.
Archologische Ausgrabungen in Baden-Wrttemberg 1990:45-48
Bentley RA, Price TD, Lning J, Gronenborn D, Wahl J, Fullagar PD (2002) Prehistoric Migration in
Europe: Strontium Isotope Analysis of Early Neolithic Skeletons. Current Anthropology 43:799-804

203

Literatur
Bentley RA, Chikhi L, Price TD (2003) The Neolithic transition in Europe: comparing broad scale
genetic and local scale isotope evidence. Antiquity 77:63-66
Benz M (1998) Why should we plant...? Theorien, Daten und einethnologisches Modell zur
Neolithisierung im Vorderen Orient. Albert-Ludwigs-Universitt, Freiburg i. Br.
Bermisheva M, Tambets K, Villems R, Khusnutdinova E (2002) [Diversity of mitochondrial DNA
haplotypes in ethnic populations of the Volga-Ural region of Russia]. Mol Biol (Mosk) 36:990-1001
Bernhard W (1978) Anthropologie der Bandkeramik. In: Schwabedissen H (ed) Die Anfnge des
Neolithikums vom Orient bis Nordeuropa. Teil VIIIb Kln, pp 128-163
Binford SR (1968) Post-Pleistocene adaptions. In: Binford SR, Binford LR (eds) New perspectives in
archaeology. Aldine Publishing Company, Chicago, pp 131-341
Bocquet-Appel JP (2002) Paleoanthropological Traces of a Neolithic Demographic Transition. Current
Anthropology 43:637-650
Bogenhagen DF (1999) Repair of mtDNA in vertebrates. Am J Hum Genet 64:1276-1281
Bogucki P (1988) Forest farmers and stockherders. Early agriculture and its consequences in NorthCentral Europe. Cambridge University Press, Cambridge
Bogucki P (2000) How agriculture came to North-Central Europe. In: Price TD (ed) Europes First
Farmers. Cambridge University Press, Cambridge,
Bknyi S (1989) Definitions of animal domestication. In: Clutton-Brock J (ed) Unwin Hyman Ltd.,
London, pp 22-27
Bollongino R (2000) Speziesidentifikation an Spuren-DNA. Bestimmung humankologisch relevanter
Tierarten aus historischen, musealen und forensischen Materialien durch Sequenzierung
mitochondrialer Genorte. Institut fr Zoologie und Anthropologie, Abteilung Historische
Anthropologie und Humankologie, Georg-August-Universitt Gttingen
Bollongino R (2005) Die Herkunft der Hausrinder in Europa. Eine aDNA-Studie an neolithischen
Knochenfunden. Johannes Gutenberg Universitt Mainz
Bollongino R, Edwards CJ, Alt KW, Burger J, Bradley D (2005) Early history of European domestic
cattle as revealed by ancient DNA. Biol. Lett. Published online December 2005
Bowcock AM, Ruiz-Linares A, Tomfohrde J, Minch E, Kidd JR, Cavalli-Sforza LL (1994) High
resolution of human evolutionary trees with polymorphic microsatellites. Nature 368:455-457
Brace CL, Segucki N, Quintyn CB, Fox SC, Nelson AR, Manolis SK, Qifeng P (2006) The questionable
contribution of the Neolithic and the Bronze Age to European craniofacial form. PNAS 103:242-247
Bramanti B, Hummel S, Chiarelli B, Herrmann B (2003) Ancient DNA analysis of the delta F508
mutation. Hum Biol 75:105-115
Brandt G (2005) Die Haplotypenverteilung neolithischer Siedlungsgebiete der Krs-Kultur. aDNAAnalytik an anthropologischem Fundmaterial. Diplomarbeit, Johannes Gutenberg Universitt Mainz
Brehm A, Pereira L, Kivisild T, Amorim A (2003) Mitochondrial portraits of the Madeira and Acores
archipelagos witness different genetic pools of its settlers. Hum Genet 114:77-86
Brown MD, Hosseini SH, Torroni A, Bandelt HJ, Allen JC, Schurr TG, Scozzari R, Cruciani F, Wallace
DC (1998) mtDNA haplogroup X: An ancient link between Europe/Western Asia and North America?
Am J Hum Genet 63:1852-1861

204

Literatur
Brown WM, George M, Jr., Wilson AC (1979) Rapid evolution of animal mitochondrial DNA. Proc
Natl Acad Sci U S A 76:1967-1971
Bunce M, Szulkin M, Lerner HR, Barnes I, Shapiro B, Cooper A, Holdaway RN (2005) Ancient DNA
provides new insights into the evolutionary history of New Zealand's extinct giant eagle. PLoS Biol 3:9
Bunce M, Worthy TH, Ford T, Hoppitt W, Willerslev E, Drummond A, Cooper A (2003) Extreme
reversed sexual size dimorphism in the extinct New Zealand moa Dinornis. Nature
:172-175
Burger J, Hummel S, Herrmann B (1997) Nachweis von DNA-Einzelkopiesequenzen aus
prhistorischen Zhnen. Liegemilieu als Faktor fr den Erhalt von DNA. Anthropol Anz 55:193-198
Burger J, Hummel S, Herrmann B, Henke W (1999) DNA preservation: A microsatellite-DNA study on
ancient skeletal remains. Electrophoresis 20:1722-1728
Burger J, Hummel S, Herrmann B (2000a) Palaeogenetics and cultural heritage. Species determination
and STR-genotyping from ancient DNA in art and artefacts. Thermochimica Acta 365:141-146
Burger J (2000b) Sequenzierung, RFLP-Analyse und STR-Genotypisierung alter DNA aus
archologischen Funden und historischen Werkstoffen. Universitt Gttingen
Burger J, Pfeiffer I, Hummel S, Fuchs R, Brenig B, Herrmann B (2001) Mitochondrial and nuclear DNA
from (pre)historic hide-derived material. Ancient Biomolecules 3:227-238
Burger J, Rosendahl W, Loreille o, Hemmer H, Eriksson T, Gotherstrom A, Hiller J, Collins MJ, Wess
T, Alt KW (2004) Molecular phylogeny of the extinct cave lion Panthera leo spelaea. Mol Phylogenet
Evol 30:841-849
Buttler W (1938) Der donaulndische und der westische Kulturkreis der jngeren Steinzeit. Handbuch
der Urgeschichte Deutschlands 2. Walter deGruyter, Berlin
Calafell F, Underhill P, Tolun A, Angelicheva D, Kalaydjieva L (1996) From Asia to Europe:
mitochondrial DNA sequence variability in Bulgarians and Turks. Ann Hum Genet 60 ( Pt 1):35-49
Cann RL, Stoneking M, Wilson AC (1987) Mitochondrial DNA and human evolution. Nature 325:31-36
Cano RJ, Poinar HN, Poinar JrGO (1992) Isolation and partial characterization of the DNA from the
bee Proplebeia dominicana in 25-40 milion year old amber. Med Sci Res 20:249-251
Caramelli D, Lalueza-Fox C, Vernesi C, Lari M, Casoli A, Mallegni F, Chiarelli B, Dupanloup I,
Bertranpetit J, Barbujani G, Bertorelle G (2003) Evidence for a genetic discontinuity between
Neandertals and 24,000-year-old anatomically modern Europeans. PNAS
:-7
Cavalli-Sforza LL (1996) The spread of agriculture and nomadic pastoralism. In: Harris DR (ed) The
Origins and Spread of Agriculture and Pastoralism in Eurasia. UCL Press, London, pp 51-69
Cavalli-Sforza LL (1998) The DNA revolution in population genetics. Trends in Genetics 14:60-65
Cavalli-Sforza LL (2003) Returning to the Neolithic transition in Europe. In: Ammerman AJ, Paolo B
(eds) The widening harvest. The Neolithic transition in Europe: Looking back, looking forward.
Archaeological Institute of America, Boston, pp 297-314
Cavalli-Sforza LL, Menozzi P, Piazza A (1994) The History and Geography of Human Genes.
Princeton University Press, Princeton
Cavalli-Sforza LL, Minch E (1997) Paleolithic and Neolithic lineages in the European mitochondrial
gene pool. Am J Hum Genet 61:247-254

205

Literatur
Chapman J (1994) The origins of farming in Southeast Europe. pp 133-156
Chikhi L, Destro-Bisol G, Bertorelle G, Pascali V, Barbujani G (1998) Clines of nuclear DNA markers
suggest a largely neolithic ancestry of the European gene pool. Proc Natl Acad Sci U S A 95:9053-9058
Chikhi L, Nichols RA, Barbujani G, Beaumont MA (2002) Y genetic data support the Neolithic demic
diffusion model. Proc Natl Acad Sci U S A 99:11008-11013
Childe VG (1957) The Dawn of European Civilisation, 6th edn. Routledge & Kegan Paul, London
Clark JGD (1965) Radiocarbon dating and the expansion of farming culture from the Near East over
Europe. Proc Prehist Soc 31:57-73
Collins MJ, Waite ER, van Duin AC (1999) Predicting protein decomposition: the case of aspartic-acid
racemization kinetics. Philos Trans R Soc Lond B Biol Sci 354:51-64
Colson IB, Bailey JF, Vercauteren M, Sykes BC (1997) The Preservation of Ancient DNA and Bone
Diagenesis. Ancient Biomolecules 1:109-117
Comas D, Plaza S, Wells RS, Yuldaseva N, Lao O, Calafell F, Bertranpetit J (2004) Admixture,
migrations, and dispersals in Central Asia: evidence from maternal DNA lineages. Eur J Hum Genet
12:495-504
Cone RW, Fairfax MR (1993) Protocol for ultraviolet irradiation of surfaces to reduce PCR
contamination. PCR Methods Appl 3:S15-S17
Constable JJ, Packer C, Collins DA, Pusey AE (1995) Nuclear DNA from primate dung. Nature 373:393
Cooper A, Mourer-Chauvire C, Chambers GK, von Haeseler A, Wilson AC, Paabo S (1992)
Independent origins of New Zealand moas and kiwis 75. Proc Natl Acad Sci U S A 89:8741-8744
Cooper A (1997) Reply to Stoneking: ancient DNA--how do you really know when you have it? Am J
Hum Genet 60:1001-1003
Cooper A, Lalueza-Fox C, Anderson S, Rambaut A, Austin J, Ward R (2001a) Complete mitochondrial
genome sequences of two extinct moas clarify ratite evolution. Nature 409:704-707
Cooper A, Rambaut A, Macaulay V, Willerslev E, Hansen AJ, Stringer C (2001b) Human origins and
ancient human DNA. Science 292:1655-1656
Cooper A, Poinar HN (2001) Ancient DNA: do it right or not at all. Science 289:1139
Cooper A, Drummond AJ, Willerslev E (2004) Ancient DNA: would the real Neandertal please stand
up? Curr Biol 14:R431-R433
Cordaux R, Saha N, Bentley GR, Aunger R, Sirajuddin SM, Stoneking M (2003) Mitochondrial DNA
analysis reveals diverse histories of tribal populations from India. Eur J Hum Genet 11:253-264
Crespillo M, Luque JA, Paredes M, Fernandez R, Ramirez E, Valverde JL (2000) Mitochondrial DNA
sequences for 118 individuals from northeastern Spain. Int J Legal Med 114:130-132
Crests AA (1996) The new craniological material of Neolithic time from the Territory of forest-Steppe
Volga Region in connection with the problem of the origin of Ural race. The herald of anthropology
1:121-141
Currat M, Excoffier L (2004) Modern Humans Did Not Admix with Neanderthals during Their Range
Expansion into Europe. PLOS Biology 2:e421

206

Literatur
Currat M, Excoffier L (2005) The effect of the Neolithic expansion on European molecular diversity.
Proc Biol Sci 272:679-688
Deffner A (1999) Von der Linearbandkeramik bis ins Frhmittelalter: die Ausgrabungen in der
Kiesgrube von Unseburg, Ldkr. Aschersleben-Stafurt, ein Zwischenbericht. Archologische Berichte
aus Sachsen-Anhalt 1999/1:73-81
Dennell R (1983) European Economic Prehistory: a New Approach. Academic Press, London
Dennell R (1992) The origins of crop agriculture in Europe. In: Cowan CW, Watson PJ (eds) The
Origins of agriculture: an International Perspective. Smithsonian Institution Press, Washington (DC),
Derbeneva OA, Starikovskaya EB, Wallace DC, Sukernik RI (2002) Traces of early Eurasians in the
Mansi of northwest Siberia revealed by mitochondrial DNA analysis. Am J Hum Genet 70:1009-1014
Derenko MV, Grzybowski T, Malyarchuk BA, Czarny J, Miscicka-Sliwka D, Zakharov IA (2001) The
presence of mitochondrial haplogroup x in Altaians from South Siberia. Am J Hum Genet 69:237-241
Derenko MV, Grzybowski T, Malyarchuk BA, Dambueva IK, Denisova GA, Czarny J, Dorzhu CM,
Kakpakov VT, Miscicka-Sliwka D, Wozniak M, Zakharov IA (2003) Diversity of mitochondrial DNA
lineages in South Siberia. Ann Hum Genet 67:391-411
DeSalle R, Gatesy J, Wheeler W, Grimaldi D (1992) DNA sequences from a fossil termite in OligoMiocene amber and their phylogenetic implications. Science 257:1933-1936
Di Benedetto G, Nasidze IS, Stenico M, Nigro L, Krings M, Lanzinger M, Vigilant L, Stoneking M,
Paabo S, Barbujani G (2000) Mitochondrial DNA sequences in prehistoric human remains from the
Alps. Eur J Hum Genet 8:669-677
Di Giacomo F, Luca F, Popa LO, Akar N, Anagnou N, Banyko J, Brdicka R, Barbujani G, Papola F,
Ciavarella G, Cucci F, Di SL, Gavrila L, Kerimova MG, Kovatchev D, Kozlov AI, Loutradis A,
Mandarino V, Mammi' C, Michalodimitrakis EN, Paoli G, Pappa KI, Pedicini G, Terrenato L, Tofanelli
S, Malaspina P, Novelletto A (2004) Y chromosomal haplogroup J as a signature of the post-neolithic
colonization of Europe. Hum Genet 115:357-371
Donoghue HD, Spigelman M, Zias J, Gernaey-Child AM, Minnikin DE (1998) Mycobacterium
tuberculosis complex DNA in calcified pleura from remains 1400 years old. Lett Appl Microbiol
27:265-269
Donoghue HD, Holton J, Spigelman M (2001) PCR primers that can detect low levels of
Mycobacterium leprae DNA. J Med Microbiol 50:177-182
Doran GH, Dickel DN, Ballinger WE, Jr., Agee OF, Laipis PJ, Hauswirth WW (1986) Anatomical,
cellular and molecular analysis of 8,000-yr-old human brain tissue from the Windover archaeological
site. Nature 323:803-806
Drancourt M, Aboudharam G, Signoli M, Dutour O, Raoult D (1998) Detection of 400-year-old
Yersinia pestis DNA in human dental pulp: an approach to the diagnosis of ancient septicemia. Proc
Natl Acad Sci U S A 95:12637-12640
Drancourt M, Raoult D (2002) Molecular insights into the history of plague. Microbes Infect 4:105-109
Drancourt M, Roux V, Dang LV, Tran-Hung L, Castex D, Chenal-Francisque V, Ogata H, Fournier PE,
Crubezy E, Raoult D (2004) Genotyping, Orientalis-like Yersinia pestis, and plague pandemics. Emerg
Infect Dis 10:1585-1592
Dupanloup I, Bertorelle G, Chikhi L, Barbujani G (2004) Estimating the impact of prehistoric
admixture on the genome of europeans. Mol Biol Evol 21:1361-1372

207

Literatur
Elson JL, Andrews RM, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (2001) Analysis of
European mtDNAs for recombination. Am J Hum Genet 68:145-153
Endicott P, Gilbert MT, Stringer C, Lalueza-Fox C, Willerslev E, Hansen AJ, Cooper A (2003) The
genetic origins of the Andaman Islanders. Am J Hum Genet 72:178-184
Engelke DR, Hoener PA, Collins FS (1988) Direct sequencing of enzymatically amplified human
genomic DNA. Proc Natl Acad Sci U S A 85:544-548
Excoffier L, Yang Z (1999) Substitution rate variation among sites in mitochondrial hypervariable
region I of humans and chimpanzees. Mol Biol Evol 16:1357-1368
Eyre-Walker A, Smith NH, Smith JM (1999) How clonal are human mitochondria? Proc Biol Sci
266:477-483
Fedorova SA, Bermisheva MA, Villems R, Maksimova NR, Khusnutdinova EK (2003) [Analysis of
mitochondrial DNA haplotypes in yakut population]. Mol Biol (Mosk) 37:643-653
Finnila S, Lehtonen MS, Majamaa K (2001) Phylogenetic network for European mtDNA. Am J Hum
Genet 68:1475-1484
Fix AG (1996) Gene frequency clines in Europe: demic diffusion or natural selection? J Roy Anthropol
Inst (NS) 2:625-643
Fix AG (1999) Migration and Colonization in Human Microevolution. Cambridge University Press,
Cambridge
Fletcher HA, Donoghue HD, Holton J, Pap I, Spigelman M (2003) Widespread occurrence of
Mycobacterium tuberculosis DNA from 18th-19th century Hungarians. Am J Phys Anthropol 120:144152
Fliss MS, Usadel H, Caballero OL, Wu L, Buta MR, Eleff SM, Jen J, Sidransky D (2000) Facile detection
of mitochondrial DNA mutations in tumors and bodily fluids. Science 287:2017-2019
Forster L, Forster P, Lutz-Bonengel S, Willkomm H, Brinkmann B (2002) Natural radioactivity and
human mitochondrial DNA mutations. Proc Natl Acad Sci U S A 99:13950-13954
Forster P (1996) Dispersal and differentiation of modern Homo sapiens analysed with mitochondrial
DNA. University of Hamburg
Forster P, Harding R, Torroni A, Bandelt HJ (1996) Origin and evolution of Native American mtDNA
variation: a reappraisal. Am J Hum Genet 59:935-945
Forster P, Cali F, Rhl A, Metspalu E, Rickards O, D`Anna R, Mirisola M, De Leo G, De Stefano G,
Flugy A, Salerno A, Ayala G, Kouvatsi A, Villems R, Romano V (2001) Continental and subcontinental
distributions of mtDNA control region types.
Forster P (2004) Ice Ages and the mitochondrial DNA chronology of human dispersals: a review.
Trans R Soc Lond B 359:255-264
Forster P, Matsumura S (2005) Evolution. Did early humans go north or south? Science 308:965-966
Fucharoen G, Fucharoen S, Horai S (2001) Mitochondrial DNA polymorphisms in Thailand. J Hum
Genet 46:115-125
Gamble C (1986) The Palaeolithic settlement of Europe. Cambridge University Press, Cambridge
Gamble C (1999) The Paleolithic Societies of Europe. Cambridge University Press, Cambridge

208

Literatur
Gassen HG, Sachse GE, Schulte E (1994) PCR-Grundlagen und Anwendungen. Gustav Fischer Verlag,
Stuttgart, Jena, Lbeck, Ulm
Gerstenberger J, Hummel S, Schultes T, Hack B, Herrmann B (1999) Reconstruction of a historical
genealogy by means of STR analysis and Y- haplotyping of ancient DNA. Eur J Hum Genet 7:469-477
Gilbert MT, Hansen AJ, Willerslev E, Rudbeck L, Barnes I, Lynnerup N, Cooper A (2003a)
Characterization of genetic miscoding lesions caused by postmortem damage. Am J Hum Genet 72:4861
Gilbert MT, Willerslev E, Hansen AJ, Barnes I, Rudbeck L, Lynnerup N, Cooper A (2003b) Distribution
patterns of postmortem damage in human mitochondrial DNA. Am J Hum Genet 72:32-47
Gilbert MT, Cuccui J, White W, Lynnerup N, Titball RW, Cooper A, Prentice MB (2004a) Absence of
Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague
victims. Microbiology 150:341-354
Gilbert MT, Wilson AS, Bunce M, Hansen AJ, Willerslev E, Shapiro B, Higham TF, Richards MP,
O'Connell TC, Tobin DJ, Janaway RC, Cooper A (2004b) Ancient mitochondrial DNA from hair. Curr
Biol 14:R463-R464
Gilbert MTP, Bandelt H-J, Hofreiter M, Barnes I (2005a) Assessing ancient DNA studies. Trends in
Ecology & Evolution. In press
Gilbert MTP, Rudbeck L, Willerslev E, Hansen AJ, Smith C, Penkman KEH, Prangenberg K, NielsenMarsh CM, Jans ME, Arthur P, Lynnerup N, Turner-Walker G, Biddle M, Kjolbye-Biddle B, Collins MJ
(2005b) Biochemical and physical correlates of DNA contamination in archaeological human bones
and teeth excavated at Matera, Italy. J Arch Sci 32: 785-793.
Gimbutas M (1965) Bronze Age Cultures in Central and Eastern Europe. Mouton & Co., The Hague
Giuffra E, Kijas JM, Amarger V, Carlborg O, Jeon JT, Andersson L (2000) The origin of the domestic
pig: independent domestication and subsequent introgression. Genetics 154:1785-1791
Gkiasta M, Russel T, Shennan S, Steele J (2003) Neolithic transition in Europe: the radiocarbon record
revisited. Antiquity 77:45-62
Gtherstrm A, Angerbjrn A, Collins MJ, Lidn K (2002) Bone preservation and DNA amplification.
Archaeometry 44:395-404
Greenwood AD, Capelli C, Possnert G, Paabo S (1999) Nuclear DNA sequences from late Pleistocene
megafauna. Mol Biol Evol 16:1466-1473
Grimm H (1964) Kraniologische Beschreibung der bandkeramischen Menschenreste von Seehausen in
Thringen. Ausgrabungen und Funde 9:233-237
Gronenborn D (1999) A variation on a basic theme: the transition to farming in southern central
Europe. J World Prehistory 13:123-210
Gronenborn D (2003) Migration, acculturation, and culture change in western temperate Eurasia,
6500-5000 cal BC. In: Budja M (ed) Documenta Praehistorica, XXX edn. Univerzav Ljubljani, Filozofzka
Fakulteta, Oddelek za Arheologijo, Ljubljana, pp 79-91
Gronenborn D (2004) Comparing Contact Period Archaeologies: The Expansion of Farming and
Pastoralist Societies to Europe and to Southern Africa. Before Farming, 226-260
Gronenborn D (2005a) Bauern - Priester - Huptlinge. Die Anfnge der Landwirtschaft und die frhe
Gesellschaftsentwicklung zwischen Orient und Europa. In: Daim F, Neubauer W (eds) Zeitreise

209

Literatur
Heldenberg.Geheimnisvolle Kreisgrben. Katalog zur Niedersterreichischen Landesausstellung.
Verlag Berger, Horn - Wien
Gronenborn D (2005b) Freundliche bernahme. Spektrum der Wissenschaft 2, 56-61
Gronenborn D (2006) Beyond the Models: Neolithization in Central Europe. In: Whittle A,
Cummings V (eds) Going Over: the Mesolithic-Neolithic Transition in North-West Europe. British
Academy, London, in press
Guitrrez G, Sanchez D, Marin A (2002) A reanalysis of the ancient mitochondrial DNA sequences
recovered from Neandertal bones. Mol Biol Evol 19:1359-1366
Haak W, Burger J, Alt KW (2004) ABO genotyping by PCR-RFLP and cloning and sequencing.
Anthropol Anz 62:397-410
Haak W, Gruber P, Rhli FJ, Bni T, Ulrich-Bochsler S, Frauendorf E, Burger J, Alt KW (2005a)
Molecular evidence of HLA-B27 in a historical case of ankylosing spondylitis. Arthritis Rheum
52:3318-3319
Haak W, Forster P, Bramanti B, Matsumura S, Brandt G, Tnzer M, Villems R, Renfrew C, Gronenborn
D, Alt KW, Burger J (2005b) Ancient DNA from the first European farmers in 7500-year-old Neolithic
Sites. Science 310:1016-1018
Haas CJ, Zink A, Molnar E, Szeimies U, Reischl U, Marcsik A, Ardagna Y, Dutour O, Palfi G, Nerlich
AG (2000a) Molecular evidence for different stages of tuberculosis in ancient bone samples from
Hungary. Am J Phys Anthropol 113:293-304
Haas CJ, Zink A, Palfi G, Szeimies U, Nerlich AG (2000b) Detection of leprosy in ancient human
skeletal remains by molecular identification of Mycobacterium leprae. Am J Clin Pathol 114:428-436
Hagelberg E, Sykes B, Hedges R (1989) Ancient bone DNA amplified. Nature 342:485
Hagelberg E, Thomas MG, Cook CE, Jr., Sher AV, Baryshnikov GF, Lister AM (1994) DNA from
ancient mammoth bones [letter; comment]. Nature 370:333-334
Hagelberg E, Goldman N, Lio P, Whelan S, Schiefenhovel W, Clegg JB, Bowden DK (1999) Evidence
for mitochondrial DNA recombination in a human population of island Melanesia. Proc R Soc Lond B
Biol Sci 266:485-492
Hagelberg E, Goldman N, Lio P, Whelan S, Schiefenhovel W, Clegg JB, Bowden DK (2000) Evidence
for mitochondrial DNA recombination in a human population of island Melanesia. Erratum. Proc R
Soc Lond B Biol Sci 267:1595-1596
Handt O, Hss M, Krings M, Paabo S (1994a) Ancient DNA: methodological challenges. Experientia
50:524-529
Handt O, Richards M, Trommsdorff M, Kilger C, Simanainen J, Georgiev O, Bauer K, Stone A, Hedges
R, Schaffner W, . (1994b) Molecular genetic analyses of the Tyrolean Ice Man. Science 264:1775-1778
Handt O, Krings M, Ward RH, Paabo S (1996) The retrieval of ancient human DNA sequences. Am J
Hum Genet 59:368-376
Hanni C, Laudet V, Stehelin D, Taberlet P (1994) Tracking the origins of the cave bear (Ursus spelaeus)
by mitochondrial DNA sequencing. Proc Natl Acad Sci U S A 91:12336-12340
Hanni C, Brousseau T, Laudet V, Stehelin D (1995) Isopropanol precipitation removes PCR inhibitors
from ancient bone extracts. Nucleic Acids Res 23:881-882

210

Literatur
Hansen AJ, Willerslev E, Wiuf C, Mourier T, Arctander P (2001) Statistical Evidence for Miscoding
Lesions in Ancient DNA Templates. Mol Biol Evol 18:262-265
Hardy C, Callou C, Vigne JD, Casane D, Dennebouy N, Mounolou JC, Monnerot M (1995) Rabbit
mitochondrial DNA diversity from prehistoric to modern times. J Mol Evol 40:227-237
Harpending HC, Sherry ST, Rogers AR, Stoneking M (1993a) The genetic structure of ancient human
populations. Current Anthropology 34:483-496
Harpending HC, Sherry ST, Rogers AR, Stoneking M (1993b) Structure of ancient human populations.
Current Anthropology 34:483-496
Hasegawa M, Di RA, Kocher TD, Wilson AC (1993) Toward a more accurate time scale for the human
mitochondrial DNA tree. J Mol Evol 37:347-354
Hebsgaard MB, Phillips MJ, Willerslev E (2005) Geologically ancient DNA: fact or artefact? Trends
Microbiol 13:212-220
Helgason A, Sigurdardottir S, Gulcher JR, Stefansson K, Ward R (2000) Sampling Saturation and the
European MtDNA Pool: Implications for Detecting Genetic Relationships among Populations. In:
Renfrew C, Boyle K (eds) Archaeogenetics: DNA and the population prehistory of Europe. McDonald
Institute for Archaeological Research, Cambridge, pp 285-294
Helgason A, Hickey E, Goodacre S, Bosnes V, Stefansson K, Ward R, Sykes B (2001) mtDNA and the
Islands of the North Atlantic: Estimating the Proportions of Norse and Gaelic Ancestry. Am J Hum
Genet 68:723-737
Herrnstadt C, Elson JL, Fahy E, Preston G, Turnbull DM, Anderson C, Ghosh SS, Olefsky JM, Beal MF,
Davis RE, Howell N (2002) Reduced-median-network analysis of complete mitochondrial DNA
coding-region sequences for the major African, Asian, and European haplogroups. Am J Hum Genet
70:1152-1171
Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC (1984) DNA sequences from the quagga,
an extinct member of the horse family. Nature 312:282-284
Hiller JC, Thompson TJ, Evison MP, Chamberlain AT, Wess TJ (2003) Bone mineral change during
experimental heating: an X-ray scattering investigation. Biomaterials 24:5091-5097
Hiller JC, Collins MJ, Chamberlain AT, Wess T (2004) Small angle X-ray scattering: a high-throughput
technique for investigating archaeological bone preservation. J Arch Sci 31:1349-1359
Hofmann S, Jaksch M, Bezold R, Mertens S, Aholt S, Paprotta A, Gerbitz KD (1997) Population
genetics and disease susceptibility: characterization of central European haplogroups by mtDNA gene
mutations, correlation with D loop variants and association with disease. Hum Mol Genet 6:1835-1846
Hofreiter M, Poinar HN, Spaulding WG, Bauer K, Martin PS, Possnert G, Paabo S (2000) A molecular
analysis of ground sloth diet through the last glaciation. Mol Ecol 9:1975-1984
Hofreiter M, Jaenicke V, Serre D, Haeseler AA, Paabo S (2001a) DNA sequences from multiple
amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucleic Acids Res
29:4793-4799
Hofreiter M, Serre D, Poinar HN, Kuch M, Paabo S (2001b) Ancient DNA. Nat Rev Genet 2:353-359
Hofreiter M, Capelli C, Krings M, Waits L, Conard N, Munzel S, Rabeder G, Nagel D, Paunovic M,
Jambresic G, Meyer S, Weiss G, Paabo S (2002a) Ancient DNA analyses reveal high mitochondrial
DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears. Mol Biol
Evol 19:1244-1250

211

Literatur
Hofreiter M, Capelli C, Krings M, Waits L, Conard N, Munzel S, Rabeder G, Nagel D, Paunovic M,
Jambresic G, Meyer S, Weiss G, Paabo S (2002b) Ancient DNA analyses reveal high mitochondrial
DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears. Mol Biol
Evol 19:1244-1250
Hofreiter M, Mead JI, Martin P, Poinar HN (2003) Molecular caving. Curr Biol 13:R693-R695
Horai S, Hayasaka K, Murayama K, ate M, oike H, akai N (1989) DNA amplification from skeletal
remains and their sequence analysis. Proc Jpn Acad 65:229-233
Horai S, Murayama K, Hayasaka K, Matsubayashi S, Hattori Y, Fucharoen G, Harihara S, Park KS,
Omoto K, Pan IH (1996) mtDNA polymorphism in East Asian Populations, with special reference to
the peopling of Japan. Am J Hum Genet 59:579-590
Hss M, Kohn M, Pbo S, Knauer F, Schroder W (1992) Excrement analysis by PCR [letter] [see
comments] 74. Nature 359:199
Hss M, Pbo S, Vereshchagin NK (1994) Mammoth DNA sequences. Nature 370:333
Hss M, Dilling A, Currant A, Paabo S (1996a) Molecular phylogeny of the extinct ground sloth
Mylodon darwinii 50. Proc Natl Acad Sci U S A 93:181-185
Hss M, Jaruga P, Zastawny TH, Dizdaroglu M, Paabo S (1996b) DNA damage and DNA sequence
retrieval from ancient tissues 47. Nucleic Acids Res 24:1304-1307
Hummel S, Herrmann B (1991) Y-chromosome-specific DNA amplified in ancient human bone.
Naturwissenschaften 78:266-267
Hummel S, Schultes T, Bramanti B, Herrmann B (1999) Ancient DNA profiling by megaplex
amplications. Electrophoresis 20:1717-1721
Hummel S, Bramanti B, Schultes T, Kahle M, Haffner S, Herrmann B (2000) Megaplex DNA typing can
provide a strong indication of the authenticity of ancient DNA amplifications by clearly recognizing
any possible type of modern contamination. Anthropol Anz 58:15-21
Hummel S, Schmidt D, Kahle M, Herrmann B (2002) AB0 blood group genotyping of ancient DNA by
PCR-RFLP. Int J Legal Med 116:327-333
Hummel S (2003) Ancient DNA Typing. Methods, Strategies and Applications. Springer, Berlin,
Heidelberg, New York
Hunan Medical College (1980) Study of an ancient cadaver in Mawangtui Tomb No.1 of the HanDynasty in Changsha. Ancient Memorial Press, pp 184-187
Huynen L, Millar CD, Scofield RP, Lambert DM (2003) Nuclear DNA sequences detect species limits
in ancient moa. Nature 425:175-178
Ingman M, Kaessmann H, Paabo S, Gyllensten U (2000) Mitochondrial genome variation and the
origin of modern humans. Nature 408:708-713
Ingman M, Gyllensten U (2001) Analysis of the complete human mtDNA genome: methodology and
inferences for human evolution. J Hered 92:454-461
Izagirre N, de la Rua C (1999) An mtDNA analysis in ancient Basque populations: implications for
haplogroup V as a marker for a major paleolithic expansion from southwestern europe. Am J Hum
Genet 65:199-207

212

Literatur
Jaenicke-Despres V, Buckler ES, Smith BD, Gilbert MT, Cooper A, Doebley J, Pbo S (2003) Early
allelic selection in maize as revealed by ancient DNA. Science 302:1206-1208
Jansen T, Forster P, Levine MA, Oelke H, Hurles M, Renfrew C, Weber J, Olek K (2002) Mitochondrial
DNA and the origins of the domestic horse. Proc Natl Acad Sci U S A 99:10905-10910
Jobling MA (1994) A survey of long-range DNA polymorphisms on the human Y chromosome. Hum
Mol Genet 3:107-114
Jobling MA, Tyler-Smith C (2000) New uses for new haplotypes the human Y chromosome, disease
and selection 1. Trends Genet 16:356-362
Jobling MA, Hurles MA, Tyler-Smith C (2004) Human Evolutionary Genetics. Origins, Peoples &
Disease. Garland Publishing, New York
Johnson LA, Ferris JA (2002) Analysis of postmortem DNA degradation by single-cell gel
electrophoresis. Forensic Sci Int 126:43-47
Johnson PE, Olson CB, Goodman M (1985) Isolation and characterization of deoxyribonucleic acid
from skeletal remains and their sequence analysis. Comp Biochem Physiol 81B:1045-1051
Jorde LB, Bamshad M (2000) Questioning evidence for recombination in human mitochondrial DNA.
Science 288:1931
Kaczanowska M, Kozlowski JK (2003) Origins of the Linear Pottery complex and the Neolithic
transition in Central Europe. In: Ammerman AJ, Paolo B (eds) The widening harvest. The Neolithic
transition in Europe: Looking back, looking forward. Archaeological Institute of America, Boston, pp
227-248
Kaessmann H, Heissig F, von Haeseler A, Paabo S (1999) DNA sequence variation in a non-coding
region of low recombination on the human X chromosome. Nat Genet 22:78-81
Kahlke HD (1957) Grber mit Bandkeramik von Seehausen bei Bad Frankenhausen. Alt-Thringen
2:63-69
Kahlke HD (1958) Ein Grberfeld mit Bandkeramik im Stadtgebiet von Sondershausen. Ausgrabungen
und Funde 3:180-182
Kahlke HD (1959) Ein Grberfeld mit Linienbandkeramik von Bruchstedt, Kr. Langensalza.
Ausgrabungen und Funde 4:229-233
Kalicz N, Makkay J (1977) Die Linienbandkeramik in der Grossen Ungarischen Tiefebene. Akadmiai
Kiad, Budapest
Kalicz N (1990) Frhneolithische Siedlungsfunde aus Sdwestungarn. Quellenananalyse zur
Geschichte der Starcevo-Kultur. Magyar Nemzeti Mzeum, Budapest,
Kasperaviciute D, Kucinskas V, Stoneking M (2004) Y chromosome and mitochondrial DNA variation
in Lithuanians. Ann Hum Genet 68:438-452
Keyser-Tracqui C, Crubezy E, Ludes B (2003) Nuclear and mitochondrial DNA analysis of a 2,000year-old necropolis in the Egyin Gol Valley of Mongolia. Am J Hum Genet 73:247-260
Kijas JM, Andersson L (2001) A phylogenetic study of the origin of the domestic pig estimated from
the near-complete mtDNA genome. J Mol Evol 52:302-308
Kind CJ (1998) Komplexe Wildbeuter und frhe Ackerbauern. Bemerkungen zur Ausbreitung der
Linearbandkeramik im sdlichen Mitteleuropa. Germania 76:1-24

213

Literatur
King R, Underhill PA (2002) Congruent distribution of Neolithic painted pottery and ceramic figurines
with Y-chromosome lineages. Antiquity 76:707-714
Kiszely I (1979) Rassengeschichte von Ungarn. In: Schwidetzky I (ed) Rassengeschichte der
Menschheit. Bd. VI. Oldenburg Verlag, Mnchen-Wien, pp. 1-49
Kivisild T, Bamshad MJ, Kaldma K, Metspalu M, Metspalu E, Reidla M, Laos S, Parik J, Watkins WS,
Dixon ME, Papiha SS, Mastana SS, Mir MR, Ferak V, Villems R (1999) Deep common ancestry of
indian and western-Eurasian mitochondrial DNA lineages. Curr Biol 9:1331-1334
Kivisild T, Villems R (2000) Questioning evidence for recombination in human mitochondrial DNA.
Science 288:1931
Kivisild T, Tolk HV, Parik J, Wang Y, Papiha SS, Bandelt HJ, Villems R (2002) The emerging limbs and
twigs of the East Asian mtDNA tree. Mol Biol Evol 19:1737-1751
Kivisild T, Reidla M, Metspalu E, Rosa A, Brehm A, Pennarun E, Parik J, Geberhiwot T, Usanga E,
Villems R (2004) Ethiopian mitochondrial DNA heritage: tracking gene flow across and around the
gate of tears. Am J Hum Genet 75:752-770
Klopffleisch F (1884) Charakteristik und Zeitfolge der Keramik Mitteldeutschlands. In: Klopffleisch F
(ed) Die Grabhgel von Leubingen, Smmerda und Nienstedt. Heft II. Otto Hendel, Halle a. d. Saale,
Knight A (2003) The phylogenetic relationship of Neandertal and modern human mitochondrial
DNAs based on informative nucleotide sites. J Hum Evol 44:627-632
Knight A, Underhill PA, Mortensen HM, Zhivotovsky LA, Lin AA, Henn BM, Louis D, Ruhlen M,
Mountain JL (2003) African Y chromosome and mtDNA divergence provides insight into the history
of click languages. Curr Biol 13:464-473
Knight A, Zhivotovsky LA, Kass DH, Litwin DE, Green LD, White PS, Mountain JL (2004) Molecular,
forensic and haplotypic inconsistencies regarding the identity of the Ekaterinburg remains. Ann Hum
Biol 31:129-138
Koehl C (1903) Die Bandkeramik der steinzeitlichen Grberfelder und Wohnpltze in der Umgebung
von Worms: Festschr. zur 34. allg. Versammlung der Deutschen Anthropologischen Gesellschaft,
Worms
Kohn M, Knauer F, Stoffella A, Schroder W, Paabo S (1995) Conservation genetics of the European
brown bear--a study using excremental PCR of nuclear and mitochondrial sequences
60. Mol Ecol 4:95-103
Koledov Z (2005) Tracing the maternal genetic roots of Slovaks - phylogenetic and phylogeographic
analysis of mitochondrial DNA variability in Slovak population. Comenius University, Bratislava
Kong QP, Yao YG, Liu M, Shen SP, Chen C, Zhu CL, Palanichamy MG, Zhang YP (2003)
Mitochondrial DNA sequence polymorphisms of five ethnic populations from northern China. Hum
Genet 113:391-405
Koot H, van der Have B (2001) Graven in Rijswijk. De Steentijmensen van Ypenburg. Koninklijke De
Swart, Den Haag
Krajewski C, Buckley L, Westerman M (1997) DNA phylogeny of the marsupial wolf resolved. Proc
Biol Sci 264:911-917
Krajewski C, Driskell AC, Baverstock PR, Braun MJ (1992) Phylogenetic relationships of the thylacine
(Mammalia: Thylacinidae) among dasyuroid marsupials: evidence from cytochrome b DNA
sequences. Proc Biol Sci 250:19-27

214

Literatur
Krause R (2001) Die bandkeramischen Siedlungsgrabungen von Vaihingen an der Enz, Kreis
Ludwigsburg. Archologische Ausgrabungen in Baden-Wrttemberg 2001:33-36
Krause R (2002) Zum Abschluss der Grabungen1994-2002 in der bandkeramischen Siedlung bei
Vaihingen an der Enz, Kreis Ludwigsburg. Archologische Ausgrabungen in Baden-Wrttemberg
2002:34-39
Krings M, Stone A, Schmitz RW, Krainitzki H, Stoneking M, Paabo S (1997a) Neandertal DNA
sequences and the origin of modern humans. Cell 90:19-30
Krings M, Stone A, Schmitz RW, Krainitzki H, Stoneking M, Paabo S (1997b) Neandertal DNA
sequences and the origin of modern humans [see comments]. Cell 90:19-30
Krings M, Geisert H, Schmitz RW, Krainitzki H, Paabo S (1999) DNA sequence of the mitochondrial
hypervariable region II from the neandertal type specimen. Proc Natl Acad Sci U S A 96:5581-5585
Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, von HA, Grossschmidt K, Possnert G,
Paunovic M, Paabo S (2000a) A view of Neandertal genetic diversity. Nat Genet 26:144-146
Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, von HA, Grossschmidt K, Possnert G,
Paunovic M, Paabo S (2000b) A view of Neandertal genetic diversity. Nat Genet 26:144-146
Kuehn R, Ludt CJ, Schroeder W, Rottmann O (2005) Molecular Phylogeny of Megaloceros giganteus the Giant Deer or Just a Giant Red Deer? Zoolog Sci 22:1031-1044
Kumar S, Hedrick P, Dowling T, Stoneking M (2000) Questioning evidence for recombination in
human mitochondrial DNA. Science 288:1931
Lahermo P, Laitinen V, Sistonen P, Beres J, Karcagi V, Savontaus ML (2000) MtDNA polymorphism in
the Hungarians: comparison to three other Finno-Ugric-speaking populations. Hereditas 132:35-42
Lalueza-Fox C, Sampietro ML, Gilbert MT, Castri L, Facchini F, Pettener D, Bertranpetit J (2004)
Unravelling migrations in the steppe: mitochondrial DNA sequences from ancient central Asians. Proc
R Soc Lond B Biol Sci 271:941-947
Lalueza-Fox C, Sampietro ML, Caramelli D, Puder Y, Lari M, Calafell F, Martinez-Maza C, Bastir M,
Fortea J, de la RM, Bertranpetit J, Rosas A (2005) Neandertal evolutionary genetics: mitochondrial
DNA data from the iberian peninsula. Mol Biol Evol 22:1077-1081
Landsteiner K (1900) Zur Kenntnis der antifermentativen, lytischen und agglutinierenden Wirkungen
des Blutserums und der Lymphe. Zbl. Bakteriol. 27:375-362.
Larson G, Dobney K, Albarella U, Fang M, Matisoo-Smith E, Robins J, Lowden S, Finlayson H, Brand
T, Willerslev E, Rowley-Conwy P, Andersson L, Cooper A (2005) Worldwide phylogeography of wild
boar reveals multiple centers of pig domestication. Science 307:1618-1621
Larson S, Jameson R, Etnier M, Fleming M, Bentzen P (2002) Loss of genetic diversity in sea otters
(Enhydra lutris) associated with the fur trade of the 18th and 19th centuries. Mol Ecol 11:1899-1903
Laval G, Excoffier L (2004) SIMCOAL 2.0: a program to simulate genomic diversity over large
recombining regions in a subdivided population with a complex history. Bioinformatics 20:2485-2487
Leonard JA, Wayne RK, Cooper A (2000) Population genetics of ice age brown bears. Proc Natl Acad
Sci U S A 97:1651-1654
Leonard JA, Wayne RK, Wheeler J, Valadez R, Guillen S, Vila C (2002) Ancient DNA evidence for Old
World origin of New World dogs. Science 298:1613-1616

215

Literatur
Li R, El-Mallakh RS (1997) Triplet repeat gene sequences in neuropsychiatric diseases. Harv Rev
Psychiatry 5:66-74
Lindahl T (1993) Instability and decay of the primary structure of DNA. Nature 362:709-715
Lister AM, Kadwell M, Kaagan LM, Jordan WC, Richards M, Stanley HF (1998) Ancient and Modern
DNA in a Study of Horse Domestication. Ancient Biomolecules 2:267-280
Lister AM, Edwards CJ, Nock DA, Bunce M, van P, I, Bradley DG, Thomas MG, Barnes I (2005) The
phylogenetic position of the 'giant deer' Megaloceros giganteus. Nature 438:850-853
Loogvali EL, Roostalu U, Malyarchuk BA, Derenko MV, Kivisild T, Metspalu E, Tambets K, Reidla M,
Tolk HV, Parik J, Pennarun E, Laos S, Lunkina A, Golubenko M, Barac L, Pericic M, Balanovsky OP,
Gusar V, Khusnutdinova EK, Stepanov V, Puzyrev V, Rudan P, Balanovska EV, Grechanina E,
Richard C, Moisan JP, Chaventre A, Anagnou NP, Pappa KI, Michalodimitrakis EN, Claustres M,
Golge M, Mikerezi I, Usanga E, Villems R (2004) Disuniting uniformity: a pied cladistic canvas of
mtDNA haplogroup H in Eurasia. Mol Biol Evol 21:2012-2021
Loreille O, Vigne J-D, Hardy C, Callou C, Treinen-Claustre F, Dennebouy N, Monnerot M (1997) First
Distinction of Sheep and Goat Archaeological Bones by the Means of their Fossil mtDNA. Journal of
Archaeological Science 24:33-37
Loreille O, Orlando L, Patou-Mathis M, Philippe M, Taberlet P, Hanni C (2001) Ancient DNA analysis
reveals divergence of the cave bear, Ursus spelaeus, and brown bear, Ursus arctos, lineages. Curr Biol
11:200-203
Lubbock J (1865) Prehistoric Times, as illustrated by Ancient Remains, and the Manners and Cusotms
of Modern savages London
Luikart G, Gielly L, Excoffier L, Vigne JD, Bouvet J, Taberlet P (2001) Multiple maternal origins and
weak phylogeographic structure in domestic goats. Proc Natl Acad Sci U S A 98:5927-5932
Lum JK, Cann RL (1998) mtDNA and language support a common origin of Micronesians and
Polynesians in Island Southeast Asia. Am J Phys Anthropol 105:109-119
Lum JK, Cann RL, Martinson JJ, Jorde LB (1998) Mitochondrial and nuclear genetic relationships
among Pacific Island and Asian populations. Am J Hum Genet 63:613-624
Lning J (2000) Steinzeitliche Bauern in Deutschland - die Landwirtschaft im Neolithikum. Rudolf
Habelt GmbH, Bonn
Lutz S, Weisser HJ, Heizmann J, Pollak S (1998) Location and frequency of polymorphic positions in
the mtDNA control region of individuals from Germany. Int J Legal Med 111:67-77
Maca-Meyer N, Gonzalez AM, Larruga JM, Flores C, Cabrera VM (2001) Major genomic mitochondrial
lineages delineate early human expansions. BMC Genetics 2:
Macaulay VA, Richards MB, Forster P, Bendall KE, Watson E, Sykes B, Bandelt HJ (1997) mtDNA
mutation rates--no need to panic. Am J Hum Genet 61:983-990
Macaulay V, Richards M, Hickey E, Vega E, Cruciani F, Guida V, Scozzari R, Bonne-Tamir B, Sykes B,
Torroni A (1999a) The emerging tree of West Eurasian mtDNAs: a synthesis of control-region
sequences and RFLPs. Am J Hum Genet 64:232-249
Macaulay V, Richards M, Sykes B (1999b) Mitochondrial DNA recombination-no need to panic. Proc R
Soc Lond B Biol Sci 266:2037-2039

216

Literatur
Macaulay V, Hill C, Achilli A, Rengo C, Clarke D, Meehan W, Blackburn J, Semino O, Scozzari R,
Cruciani F, Taha A, Shaari NK, Raja JM, Ismail P, Zainuddin Z, Goodwin W, Bulbeck D, Bandelt HJ,
Oppenheimer S, Torroni A, Richards M (2005) Single, rapid coastal settlement of Asia revealed by
analysis of complete mitochondrial genomes. Science 308:1034-1036
Makkay J (1989) Archaeological sites of Hungary. In: Makkay J (ed) Archaeological sites of Hungary
Budapest
Malyarchuk BA, Grzybowski T, Derenko MV, Czarny J, Wozniak M, Miscicka-Sliwka D (2002)
Mitochondrial DNA variability in Poles and Russians. Ann Hum Genet 66:261-283
Malyarchuk BA, Rogozin IB (2004) Mutagenesis by transient misalignment in the human
mitochondrial DNA control region. Ann Hum Genet 68:324-339
Mamonov AE (1995) The Yelkshankskaya complex of stand Chekalin IV. Ancient cultures of foreststeppe Volga Region Samara
Manfredi G, Thyagarajan D, Papadopoulou LC, Pallotti F, Schon EA (1997) The fate of human spermderived mtDNA in somatic cells. Am J Hum Genet 61:953-960
Meinila M, Finnila S, Majamaa K (2001) Evidence for mtDNA admixture between the Finns and the
Saami. Hum Hered 52:160-170
Melton T, Clifford S, Martinson J, Batzer M, Stoneking M (1998) Genetic evidence for the protoAustronesian homeland in Asia: mtDNA and nuclear DNA variation in Taiwanese aboriginal tribes.
Am J Hum Genet 63:1807-1823
Menozzi P, Piazza A, Cavalli-Sforza LL (1978) Synthetic maps of human gene frequencies in
Europeans. Science 210:786-792
Metspalu, Kivisild T, Kaldma K, Parik J, Reidla M, Tambets K, Villems R (1999) The Trans-Caucasus
and the expansion of the Caucasoid-specific human mtDNA lineages. In: Papiha SS, Deka R (eds)
Genome Diversity: Applications in human population genetics. Kluwer Academic/Plenum
Publishers, New York, pp 121-134
Metspalu M, Kivisild T, Metspalu E, Parik J, Hudjashov G, Kaldma K, Serk P, Karmin M, Behar DM,
Gilbert MT, Endicott P, Mastana S, Papiha SS, Skorecki K, Torroni A, Villems R (2004) Most of the
extant mtDNA boundaries in south and southwest Asia were likely shaped during the initial
settlement of Eurasia by anatomically modern humans. BMC Genet 5:26
Meyer C (2004) Vergleichend osteometrische Studie zur Frage der Kontinuitt frh- und
mittelneolithischer Populationen. Magisterarbeit, Johannes Gutenberg Universitt Mainz
Meyer C, Krbis O, Alt KW (2004) Das Massengrab von Wiederstedt, Ldkr. Mansfelder Land.
Auswertung und Gedanken zur Deutung im Kontext der Linienbandkeramik. Jahresschrift fr
mitteldeutsche Vorgeschichte 88:31-66
Meyer C, Alt KW (2005) Kultur- und Bevlkerungswandel am Oberrhein? Ein osteometrischer
Vergleich frh- und mittelneolithischer Populationen, eingereicht.
Meyer S, Weiss G, von HA (1999) Pattern of nucleotide substitution and rate heterogeneity in the
hypervariable regions I and II of human mtDNA. Genetics 152:1103-1110
Millard AR (2001) Deterioration of bone. In: Brothwell D, Pollard M (eds) Handbook of Archaeological
Sciences. Wiley, pp 633-643

217

Literatur
Miller CR, Waits LP (2003) The history of effective population size and genetic diversity in the
Yellowstone grizzly (Ursus arctos): implications for conservation. Proc Natl Acad Sci U S A 100:43344339
Mishmar D, Ruiz-Pesini E, Golik P, Macaulay V, Clark AG, Hosseini S, Brandon M, Easley K, Chen E,
Brown MD, Sukernik RI, Olckers A, Wallace DC (2003) Natural selection shaped regional mtDNA
variation in humans. Proc Natl Acad Sci U S A 100:171-176
Mitchell D, Willerslev E, Hansen A (2005) Damage and repair of ancient DNA. Mutat Res 571:265-276
Mountain JL, Hebert JM, Bhattacharyya S, Underhill PA, Ottolenghi C, Gadgil M, Cavalli-Sforza LL
(1995) Demographic history of India and mtDNA-sequence diversity. Am J Hum Genet 56:979-992
Mourant AE (1954) The Distribution of the Human Blood Groups. Blackwell, Oxford
Mller U (2002) Vorlufige Ergebnisse der Untersuchungen in Derenburg, Meerenstieg II, Ldkr.
Wernigerode. Jahresschrift fr mitteldeutsche Vorgeschichte 85:
Mullis KB, Faloona FA (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain
reaction. Methods Enzymol 155:335-350
Nasir J, Goldberg YP, Hayden MR (1996) Huntington disease: new insights into the relationship
between CAG expansion and disease. Hum Mol Genet 5 Spec No:1431-1435
Neustupny E (1982) Prehistoric migration by infiltration. Archeologick Rozhledy 34:278-293
Nielsen-Marsch CM (2000a) Patterns of Diagenesis in Bone I: The Effects of Site Environments. Journal
of Archaeological Science 27:1139-1150
Nielsen-Marsch CM (2000b) Patterns of Diagenesis in Bone II: Effects of Acetic Acid Treatment and the
Removal of Diagenetic CO2- 3. Journal of Archaeological Science 27:1151-1159
Nieszery N (1995) Linienbandkeramische Grberfelder in Bayern. Verlag Marie Leidorf, Espelkamp,
Nordborg M (1998) On the probability of Neanderthal ancestry. Am J Hum Genet 63:1237-1240
Noro M, Masuda R, Dubrovo IA, Yoshida MC, Kato M (1998) Molecular phylogenetic inference of the
woolly mammoth Mammuthus primigenius, based on complete sequences of mitochondrial
cytochrome b and 12S ribosomal RNA genes. J Mol Evol 46:314-326
Ohno K, Tanaka M, Suzuki H, Ohbayashi T, Ikebe S, Ino H, Kumar S, Takahashi A, Ozawa T (1991)
Identification of a possible control element, Mt5, in the major noncoding region of mitochondrial DNA
by intraspecific nucleotide conservation. Biochem Int 24:263-272
Opdal SH, Rognum TO, Vege A, Stave AK, Dupuy BM, Egeland T (1998) Increased number of
substitutions in the D-loop of mitochondrial DNA in the sudden infant death syndrome. Acta Paediatr
87:1039-1044
Orlando L, Bonjean D, Bocherens H, Thenot A, Argant A, Otte M, Hanni C (2002) Ancient DNA and
the population genetics of cave bears (Ursus spelaeus) through space and time. Mol Biol Evol 19:19201933
Ovchinnikov IV, Gotherstrom A, Romanova GP, Kharitonov VM, Liden K, Goodwin W (2000)
Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404:490-493
Pbo S (1984) ber den Nachweis von DNA in altgyptischen Mumien. Das Altertum 30:213-218
Pbo S (1985) Molecular cloning of Ancient Egyptian mummy DNA. Nature 314:644-645

218

Literatur
Pbo S (1989) Ancient DNA: extraction, characterization, molecular cloning, and enzymatic
amplification. Proc Natl Acad Sci U S A 86:1939-1943
Pbo S, Wilson AC (1991) Miocene DNA sequences - a dream come true? Curr Biol 1:45-46
Pbo S, Poinar H, Serre D, Jaenicke-Despres V, Hebler J, Rohland N, Kuch M, Krause J, Vigilant L,
Hofreiter M (2004) Genetic analyses from ancient DNA. Annu Rev Genet 38:645-679
Pakendorf B, Wiebe V, Tarskaia LA, Spitsyn VA, Soodyall H, Rodewald A, Stoneking M (2003)
Mitochondrial DNA evidence for admixed origins of central Siberian populations. Am J Phys
Anthropol 120:211-224
Palanichamy MG, Sun C, Agrawal S, Bandelt HJ, Kong QP, Khan F, Wang CY, Chaudhuri TK, Palla V,
Zhang YP (2004) Phylogeny of mitochondrial DNA macrohaplogroup N in India, based on complete
sequencing: implications for the peopling of South Asia. Am J Hum Genet 75:966-978
Parsons TJ, Muniec DS, Sullivan K, Woodyatt N, liston-Greiner R, Wilson MR, Berry DL, Holland KA,
Weedn VW, Gill P, Holland MM (1997) A high observed substitution rate in the human mitochondrial
DNA control region. Nat Genet 15:363-368
Passarge E (2004) Taschenatlas der Genetik, 2.Auflage. Georg Thieme Verlag, Stuttgart
Passarino G, Cavalleri GL, Lin AA, Cavalli-Sforza LL, Borresen-Dale AL, Underhill PA (2002)
Different genetic components in the Norwegian population revealed by the analysis of mtDNA and Y
chromosome polymorphisms. Eur J Hum Genet 10:521-529
Pavk J (1994) Zur relativen Chronologie der lteren Linearkeramik. Jsa Andrs Mzeum Evknyi
36:135-149
Paxinos EE, James HF, Olson SL, Ballou JD, Leonard JA, Fleischer RC (2002a) Prehistoric decline of
genetic diversity in the nene. Science 296:1827
Paxinos EE, James HF, Olson SL, Sorenson MD, Jackson J, Fleischer RC (2002b) mtDNA from fossils
reveals a radiation of Hawaiian geese recently derived from the Canada goose (Brantacanadensis).
Proc Natl Acad Sci U S A 99:1399-1404
Pereira L, Prata MJ, Amorim A (2000) Diversity of mtDNA lineages in Portugal: not a genetic edge of
European variation. Ann Hum Genet 64:491-506
Pereira L, Richards M, Goios A, Alonso A, Albarran C, Garcia O, Behar DM, Golge M, Hatina J, AlGazali L, Bradley DG, Macaulay V, Amorim A (2005) High-resolution mtDNA evidence for the lateglacial resettlement of Europe from an Iberian refugium. Genome Res 15:19-24
Petrusewsky M (2000) Metric analysis of skeletal remains: methods and applications. In: Katzenberg
MA, Saunders SR (eds) Biological Anthropology of the Human Skeleton New York
Pfeiffer H, Brinkmann B, Huhne J, Rolf B, Morris AA, Steighner R, Holland MM, Forster P (1999)
Expanding the forensic German mitochondrial DNA control region database: genetic diversity as a
function of sample size and microgeography. Int J Legal Med 112:291-298
Pfeiffer H, Forster P, Ortmann C, Brinkmann B (2001) The results of an mtDNA study of 1,200
inhabitants of a German village in comparison to other Caucasian databases and its relevance for
forensic casework. Int J Legal Med 114:169-172
Piganeau G, Eyre-Walker A (2004) A reanalysis of the indirect evidence for recombination in human
mitochondrial DNA. Heredity 92:282-288

219

Literatur
Piggott S (1965) Ancient Europe from the beginnings of agriculture to classical antiquity. University
Press, Edinburgh
Pinhasi R, Foley RA, Lahr MM (2000) Spatial and Temproal Patterns in the Mesolithic-Neolithic
Archaeological Record of Europe. In: Renfrew C, Boyle K (eds) Archaeogenetics: DNA and the
population history of Europe. McDonald Institute for Archaeological Research, Cambridge, pp 45-56
Pinhasi R, Pluciennik M (2005) A Regional Biological Approach to the Spread of Farming in Europe.
Current Anthropology 45:S59-S82
Poetsch M, Wittig H, Krause D, Lignitz E (2003) Mitochondrial diversity of a northeast German
population sample. Forensic Sci Int 137:125-132
Poinar H, Cano RJ, Poinar GO, Jr. (1993) DNA from an extinct plant. Nature 363:677
Poinar HN, Hoss M, Bada JL, Paabo S (1996) Amino acid racemization and the preservation of ancient
DNA. Science 272:864-866
Poinar HN, Hofreiter M, Spaulding WG, Martin PS, Stankiewicz BA, Bland H, Evershed RP, Possnert
G, Paabo S (1998a) Molecular coproscopy: dung and diet of the extinct ground sloth Nothrotheriops
shastensis [see comments]. Science 281:402-406
Poinar HN, Kuch M, Sobolik KD, Barnes I, Stankiewicz AB, Kuder T, Spaulding WG, Bryant VM,
Cooper A, Paabo S (2001) A molecular analysis of dietary diversity for three archaic Native
Americans. Proc Natl Acad Sci U S A 98:4317-4322
Price TD (2000) Europes First Farmers. Campridge University Press, Cambridge
Price TD, Bentley RA, Lning J, Gronenborn D, Wahl J (2001) Prehistoric human migration in the
Linearbandkeramik of Central Europe. Antiquity 75:593-603
Prien R (2005) Archologie und Migration. Vergleichende Studien zur archologischen
Nachweisbarkeit von Wanderungsbewegungen. Universittsforschungen zur prhistorischen
Archologie 120, Rudolph Habelt GmbH, Bonn
Pusch CM, Bachmann L (2004) Spiking of contemporary human template DNA with ancient DNA
extracts induces mutations under PCR and generates nonauthentic mitochondrial sequences. Mol Biol
Evol 21:957-964
Quintana-Murci L, Semino O, Bandelt HJ, Passarino G, McElreavey K, Santachiara-Benerecetti AS
(1999) Genetic evidence of an early exit of Homo sapiens sapiens from Africa through eastern Africa.
Nat Genet 23:437-441
Quintana-Murci L, Chaix R, Wells RS, Behar DM, Sayar H, Scozzari R, Rengo C, Al-Zahery N, Semino
O, Santachiara-Benerecetti AS, Coppa A, Ayub Q, Mohyuddin A, Tyler-Smith C, Qasim MS, Torroni
A, McElreavey K (2004) Where west meets east: the complex mtDNA landscape of the southwest and
Central Asian corridor. Am J Hum Genet 74:827-845
Quintans B, Varez-Iglesias V, Salas A, Phillips C, Lareu MV, Carracedo A (2004) Typing of
mitochondrial DNA coding region SNPs of forensic and anthropological interest using SNaPshot
minisequencing. Forensic Sci Int 140:251-257
Quitta H (1960) Zur Frage der ltesten Bandkeramik in Mitteleuropa. Prhistorische Zeitschrift 38:1-38
Quitta H (1964) Zur Herkunft des Neolithikums in Mitteleuropa. In: Grimm P (ed) Varia
Archaeologica. Wilhelm Unverzagt zum 70. Geburtstag dargebracht. Deutsche Akademie der
Wissenschaften zu Berlin. Akademie Verlag, Berlin, pp 14-24

220

Literatur
Rando JC, Pinto F, Gonzalez AM, Hernandez M, Larruga JM, Cabrera VM, Bandelt HJ (1998)
Mitochondrial DNA analysis of northwest African populations reveals genetic exchanges with
European, near-eastern, and sub-Saharan populations. Ann Hum Genet 62 ( Pt 6):531-550
Raoult D, Aboudharam G, Crubezy E, Larrouy G, Ludes B, Drancourt M (2000) Molecular
identification by "suicide PCR" of Yersinia pestis as the agent of medieval black death. Proc Natl Acad
Sci U S A 97:12800-12803
Reid AH, Fanning TG, Hultin JV, Taubenberger JK (1999) Origin and evolution of the 1918 "Spanish"
influenza virus hemagglutinin gene. Proc Natl Acad Sci U S A 96:1651-1656
Relethford JH (2001) Ancient DNA and the origin of modern humans. Proc Natl Acad Sci U S A
98:390-391
Renfrew C (1987) Archaeology and language: The puzzle of Indo-European origins. Cape, London
Renfrew C (1998) Comments on Cavalli-Sforza and Otte. J Anthropol Res 54:417-419
Ricaut FX, Fedoseeva A, Keyser-Tracqui C, Crubezy E, Ludes B (2004a) Ancient DNA analysis of
human Neolithic remains found in northeastern Siberia. Am J Phys Anthropol
Ricaut FX, Keyser-Tracqui C, Bourgeois J, Crubezy E, Ludes B (2004b) Genetic analysis of a ScythoSiberian skeleton and its implications for ancient Central Asian migrations. Hum Biol 76:109-125
Ricaut FX, Keyser-Tracqui C, Cammaert L, Crubezy E, Ludes B (2004c) Genetic analysis and ethnic
affinities from two Scytho-Siberian skeletons. Am J Phys Anthropol 123:351-360
Ricaut FX, Kolodesnikov S, Keyser-Tracqui C, Alekseev AN, Crubezy E, Ludes B (2004d) Genetic
analysis of human remains found in two eighteenth century Yakut graves at At-Dabaan. Int J Legal
Med 118:24-31
Richards M, Corte-Real H, Forster P, Macaulay V, Wilkinson-Herbots H, Demaine A, Papiha S,
Hedges R, Bandelt HJ, Sykes B (1996) Paleolithic and neolithic lineages in the European mitochondrial
gene pool. Am J Hum Genet 59:185-203
Richards M, Macaulay V, Sykes B, Pettitt P, Hedges R, Forster P, Bandelt H-J (1997) Reply to CavalliSforza and Minch. Am J Hum Genet 61:251-254
Richards M, Sykes B (1998) Reply to Barbujani et al. Am J Hum Genet 62:491-492
Richards MB, Macaulay VA, Bandelt HJ, Sykes BC (1998) Phylogeography of mitochondrial DNA in
western Europe. Ann Hum Genet 62 ( Pt 3):241-260
Richards M, Macaulay V (2000) Genetic Data and the Colonization of Europe: Genealogies and
Founders. In: Renfrew C, Boyle K (eds) Archaeogenetics: DNA and the population prehistory of
Europe. McDonald Institute of Archaeological Research, Cambridge, pp 139-152
Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C, Sellitto D, Cruciani F, Kivisild
T, Villems R, Thomas M, Rychkov S, Rychkov O, Rychkov Y, Golge M, Dimitrov D, Hill E, Bradley D,
Romano V, Cali F, Vona G, Demaine A, Papiha S, Triantaphyllidis C, Stefanescu G (2000) Tracing
european founder lineages in the near eastern mtDNA pool. Am J Hum Genet 67:1251-1276
Richards M, Macaulay V (2001) The mitochondrial gene tree comes of age. Am J Hum Genet 68:13151320
Richards M (2003) The neolithic invasion of Europe. Annu Rev Anthropol 32:135-162

221

Literatur
Richter I (1968) Die bandkeramischen Grber von Flomborn, Kr. Alzey. Mainzer Zeitschrift 63/64:158179
Ritchie PA, Millar CD, Gibb GC, Baroni C, Lambert DM (2004) Ancient DNA enables timing of the
pleistocene origin and holocene expansion of two adelie penguin lineages in antarctica. Mol Biol Evol
21:240-248
Roewer L, Croucher PJ, Willuweit S, Lu TT, Kayser M, Lessig R, de KP, Jobling MA, Tyler-Smith C,
Krawczak M (2005) Signature of recent historical events in the European Y-chromosomal STR
haplotype distribution. Hum Genet 116:279-291
Rhl A, Brinkmann B, Forster L, Forster P (2001) An annotated mtDNA database. Int J Legal Med
115:29-39
Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, Amorim A, Amos W, Armenteros M,
Arroyo E, Barbujani G, Beckman G, Beckman L, Bertranpetit J, Bosch E, Bradley DG, Brede G, Cooper
G, Corte-Real HB, de KP, Decorte R, Dubrova YE, Evgrafov O, Gilissen A, Glisic S, Golge M, Hill EW,
Jeziorowska A, Kalaydjieva L, Kayser M, Kivisild T, Kravchenko SA, Krumina A, Kucinskas V,
Lavinha J, Livshits LA, Malaspina P, Maria S, McElreavey K, Meitinger TA, Mikelsaar AV, Mitchell RJ,
Nafa K, Nicholson J, Norby S, Pandya A, Parik J, Patsalis PC, Pereira L, Peterlin B, Pielberg G, Prata
MJ, Previdere C, Roewer L, Rootsi S, Rubinsztein DC, Saillard J, Santos FR, Stefanescu G, Sykes BC,
Tolun A, Villems R, Tyler-Smith C, Jobling MA (2000) Y-chromosomal diversity in Europe is clinal
and influenced primarily by geography, rather than by language. Am J Hum Genet 67:1526-1543
Rychlik W (1995a) Priming efficiency in PCR. Biotechniques 18:84-90
Rychlik W (1995b) Selection of primers for polymerase chain reaction. Mol Biotechnol 3:129-134
Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (1985) Enzymatic
amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell
anemia. Science 230:1350-1354
Saillard J, Forster P, Lynnerup N, Bandelt HJ, Norby S (2000) mtDNA variation among Greenland
Eskimos: the edge of the Beringian expansion. Am J Hum Genet 67:718-726
Sajantila A, Lahermo P, Anttinen T, Lukka M, Sistonen P, Savontaus ML, Aula P, Beckman L,
Tranebjaerg L, Gedde-Dahl T, Issel-Tarver L, DiRienzo A, Paabo S (1995) Genes and languages in
Europe:
an
analysis
of
mitochondrial
lineages
30. Genome Res 5:42-52
Salo WL, Aufderheide AC, Buikstra J, Holcomb TA (1994) Identification of Mycobacterium
tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc Natl Acad Sci U S A 91:2091-2094
Sambrook J, Fritsch E, Maniatis T (1989) Molecular cloning. A laboratory manual, 2 edn. Cold Spring
Harbor University Press, Cold Spring Harbor, New York
Sampietro ML, Caramelli D, Lao O, Calafell F, Comas D, Lari M, Agusti B, Bertranpetit J, Lalueza-Fox
C (2005) The genetics of the pre-Roman Iberian Peninsula: a mtDNA study of ancient Iberians. Ann
Hum Genet 69:535-548
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl
Acad Sci U S A 74:5463-5467
Sangmeister E (1983) Die ersten Bauern. In: Mller-Beck H (ed) Urgeschichte in Baden-Wrttemberg
pp 429-479

222

Literatur
Savolainen P, Zhang YP, Luo J, Lundeberg J, Leitner T (2002) Genetic evidence for an East Asian
origin of domestic dogs. Science 298:1610-1613
Schfer J, Haswell K, Bauer U, Schulz R (2004) Heier gegessen als gekocht? Eine kritische
Betrachtung palogenetischer Forschungen zur Abstammung des Menschen. EAZ 1/2004:1-34
Scharl S (2004) Die Neolithisierung Europas; Ausgewhlte Modelle und Hypothesen. Leidorf,
Rahden/Westf.
Schewe C, Goldmann T, Grosser M, Zink A, Schluns K, Pahl S, Ulrichs T, Kaufmann SH, Nerlich A,
Baretton GB, Dietel M, Vollmer E, Petersen I (2005) Inter-laboratory validation of PCR-based detection
of Mycobacterium tuberculosis in formalin-fixed, paraffin-embedded tissues. Virchows Arch 447:573585
Schmitz RW, Serre D, Bonani G, Feine S, Hillgruber F, Krainitzki H, Paabo S, Smith FH (2002) The
Neandertal type site revisited: interdisciplinary investigations of skeletal remains from the Neander
Valley, Germany. Proc Natl Acad Sci U S A 99:13342-13347
Schultes T, Hummel S, Herrmann B (2000) Ancient DNA-typing approaches for the determination of
kinship in a disturbed collective burial site. Anthropol Anz 58:37-44
Schurr TG, Ballinger SW, Gan YY, Hodge JA, Merriwether DA, Lawrence DN, Knowler WC, Weiss
KM, Wallace DC (1990) Amerindian mitochondrial DNAs have rare Asian mutations at high
frequencies, suggesting they derived from four primary maternal lineages. Am J Hum Genet 46:613623
Schurr TG, Sukernik RI, Starikovskaya YB, Wallace DC (1999) Mitochondrial DNA variation in
Koryaks and Itel'men: population replacement in the Okhotsk Sea-Bering Sea region during the
Neolithic. Am J Phys Anthropol 108:1-39
Semino O, Passarino G, Brega A, Fellous M, Santachiara-Benerecetti AS (1996) A view of the neolithic
demic diffusion in Europe through two Y chromosome-specific markers. Am J Hum Genet 59:964-968
Semino O, Passarino G, Oefner PJ, Lin AA, Arbuzova S, Beckman LE, De BG, Francalacci P, Kouvatsi
A, Limborska S, Marcikiae M, Mika A, Mika B, Primorac D, Santachiara-Benerecetti AS, Cavalli-Sforza
LL, Underhill PA (2000a) The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans:
a Y chromosome perspective. Science 290:1155-1159
Semino O, Passarino G, Quintana-Murci L, Liu A, Beres J, Czeizel A, Santachiara-Benerecetti AS
(2000b) MtDNA and Y chromosome polymorphisms in Hungary: inferences from the palaeolithic,
neolithic and Uralic influences on the modern Hungarian gene pool. Eur J Hum Genet 8:339-346
Serre D, Hofreiter M, Paabo S (2004a) Mutations Induced by Ancient DNA Extracts? Letter. Mol Biol
Evol
Serre D, Langaney A, Chech M, Teschler-Nicola M, Paunovic M, Mennecier P, Hofreiter M, Possnert
G, Paabo S (2004b) No evidence of Neandertal mtDNA contribution to early modern humans. PLoS
Biol 2:313-317
Shadel GS, Clayton DA (1997) Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem
66:409-435
Shapiro B, Drummond AJ, Rambaut A, Wilson MC, Matheus PE, Sher AV, Pybus OG, Gilbert MT,
Barnes I, Binladen J, Willerslev E, Hansen AJ, Baryshnikov GF, Burns JA, Davydov S, Driver JC, Froese
DG, Harington CR, Keddie G, Kosintsev P, Kunz ML, Martin LD, Stephenson RO, Storer J, Tedford R,
Zimov S, Cooper A (2004) Rise and fall of the Beringian steppe bison. Science 306:1561-1565

223

Literatur
Sielmann B (1972) Die frhneolithische Besiedlung Mitteleuropas. Die Anfnge des Neolithikums vom
Orient bis Nordeuropa Bhlau, Kln, pp 1-65
Sigurdardottir S, Helgason A, Gulcher JR, Stefansson K, Donnelly P (2000) The mutation rate in the
human mtDNA control region. Am J Hum Genet 66:1599-1609
Simoni L, Calafell F, Pettener D, Bertranpetit J, Barbujani G (2000a) mtDNA Haplogroups and
Frequency Patterns in Europe. Am J Hum Genet 66:1173-1177
Simoni L, Calafell F, Pettener D, Bertranpetit J, Barbujani G (2000b) Geographic patterns of mtDNA
diversity in Europe. Am J Hum Genet 66:262-278
Simoni L, Calafell F, Pettener D, Bertranpetit J, Barbujani G (2000c) Reconstruction of prehistory on the
basis of genetic data. Am J Hum Genet 66:1177-1179
Smith CI, Chamberlain AT, Riley MS, Cooper A, Stringer CB, Collins MJ (2001) Neanderthal DNA.
Not just old but old and cold? Nature 410:771-772
Smith CI, Chamberlain AT, Riley MS, Stringer C, Collins MJ (2003) The thermal history of human
fossils and the likelihood of successful DNA amplification. J Hum Evol 45:203-217
Smith CI, Craig OE, Prigodich RV, Nielsen-Narsh CM, Jans MME, Vermeer C, Collins MJ (2005)
Diagenesis and survival of osteocalcin in archaeological bone. J Arch Sci 32:105-113
Sokal RR, Harding RM, Oden NL (1989) Spatial patterns of human gene frequencies in Europe. Am J
Phys Anthropol 80:267-294
Sokal RR, Oden NL, Wilson C (1991) Genetic evidence for the spread of agriculture in Europe by
demic diffusion. Nature 351:143-145
St John JC, Lloyd RE, Bowles EJ, Thomas EC, El SS (2004) The consequences of nuclear transfer for
mammalian foetal development and offspring survival. A mitochondrial DNA perspective.
Reproduction 127:631-641
Stokstad E (2003) Paleontology. Ancient DNA pulled from soil. Science 300:407
Stone AC, Starrs JE, Stoneking M (2001) Mitochondrial DNA analysis of the presumptive remains of
Jesse James. J Forensic Sci 46:173-176
Stone AC, Stoneking M (1998) mtDNA analysis of a prehistoric Oneota population: implications for
the peopling of the New World 20. Am J Hum Genet 62:1153-1170
Stoneking M, Jorde LB, Bhatia K, Wilson AC (1990) Geographic variation in human mitochondrial
DNA from Papua New Guinea. Genetics 124:717-733
Stoneking M (2000) Hypervariable sites in the mtDNA control region are mutational hotspots. Am J
Hum Genet 67:1029-1032
Storch HP (1984) Frhneolithische Bestatttungssitten. Ein Beitrag zur Urgeschichte des sdlichen
Oberrheins. Acta praehistorica et archaeologica 16/17:23-54
Stringer CB, Andrews P (1988) Genetic and fossil evidence for the origin of modern humans. Science
239:1263-1268
Sutovsky P, Van LK, McCauley T, Day BN, Sutovsky M (2004) Degradation of paternal mitochondria
after fertilization: implications for heteroplasmy, assisted reproductive technologies and mtDNA
inheritance. Reprod Biomed Online 8:24-33

224

Literatur
Sykes B, Leiboff A, Low-Beer J, Tetzner S, Richards M (1995) The origins of the Polynesians: an
interpretation from mitochondrial lineage analysis. Am J Hum Genet 57:1463-1475
Sykes B (1997) Really ancient DNA. Lights turning red on amber. Nature 386:764-765
Sykes B (1999) The molecular genetics of European ancestry. Philos Trans R Soc Lond B Biol Sci
354:131-138
Sykes B (2000) Human Diversity in Europe and Beyond: From Blood Groups to Genes. In: Renfrew C,
Boyle K (eds) Archaeogenetics: DNA and the population prehistory of Europe. McDonald Institute for
Archaeological Research, Cambridge, pp 23-30
Sykes B (2003) Die sieben Tchter Evas. Bastei Lbbe, Bergisch Gladbach
Tambets K, Kivisild T, Metspalu E, Parik J, Kaldma K, Laos S, Tolk HV, Golge M, Demirtas H,
Geberhiwot T, Papiha S, DeStefano GF, Villems R (2000) The Topology of the Maternal Lineages of the
Anatolian and Trans-Caucasus Populations and the Peopling of Europe: Some Preliminary
Considerations. In: Renfrew C, Boyle K (eds) Archeogenetics: DNA and the population prehistory of
Europe. McDonald Institute for Archaeological Research, Cambridge, pp 219-236
Tambets K, Tolk HV, Kivisild T, Metspalu E, Parik J, Reidla M, Voevoda M, Damba L, Bermisheva M,
Khusnutdinova E, Golubenko M, Stepanov V, Puzyrev V, Usanga E, Rudan I, Beckman L, Villems R
(2002) Complex signals for Population Expansions in Europe and Beyond. In: Bellwood P, Renfrew C
(eds) Examining the farming/language dispersal hypothesis. McDonald Institute for Archaeological
Research, Cambridge, pp 449-457
Tambets K, Rootsi S, Kivisild T, Help H, Serk P, Loogvali EL, Tolk HV, Reidla M, Metspalu E, Pliss L,
Balanovsky O, Pshenichnov A, Balanovska E, Gubina M, Zhadanov S, Osipova L, Damba L, Voevoda
M, Kutuev I, Bermisheva M, Khusnutdinova E, Gusar V, Grechanina E, Parik J, Pennarun E, Richard
C, Chaventre A, Moisan JP, Barac L, Pericic M, Rudan P, Terzic R, Mikerezi I, Krumina A, Baumanis
V, Koziel S, Rickards O, De Stefano GF, Anagnou N, Pappa KI, Michalodimitrakis E, Ferak V, Furedi
S, Komel R, Beckman L, Villems R (2004) The western and eastern roots of the Saami--the story of
genetic "outliers" told by mitochondrial DNA and Y chromosomes. Am J Hum Genet 74:661-682
Tambets K (2004) Towards the understanding of post-glacial spread of human mitochondrial DNA
haplogroups in Europe and beyond: a phylogeographic approach. Dissertationes biologicae
Universitatis Tartuensis
Tanaka M, Cabrera VM, Gonzalez AM, Larruga JM, Takeyasu T, Fuku N, Guo LJ, Hirose R, Fujita Y,
Kurata M, Shinoda K, Umetsu K, Yamada Y, Oshida Y, Sato Y, Hattori N, Mizuno Y, Arai Y, Hirose N,
Ohta S, Ogawa O, Tanaka Y, Kawamori R, Shamoto-Nagai M, Maruyama W, Shimokata H, Suzuki R,
Shimodaira H (2004) Mitochondrial genome variation in eastern Asia and the peopling of Japan.
Genome Res 14:1832-1850
Tnzer M (2005) Populationsgenetische Analysen alter DNA humaner Individuen von fnf
neolithischen Fundpltzen - Unterwiederstedt, Eilsleben, Erbenheim, Flomborn, Bruchenbrcken.
Magisterarbeit, Johannes Gutenberg Universitt Mainz,
Tautz D (1993) DNA Fingerprinting: State of Science. Birkenhuser, Basel
Taylor GM, Widdison S, Brown IN, Young D, Molleson T (2000) A Medieval Case of Lepromatous
Leprosy from 13-14th Century Orkney, Scotland. J Arch Sci 27:1133-1138
Teschler-Nicola M, Gerold F, Bujatti-Narbeshuber M, Prohaska T, Latkoczy C, Stingeder G, Watkins M
(1999) Evidence of Genocide 7000 BP. Neolithic Paradigm and Geo-climatic Realitiy. Coll Antropol
23:437-450

225

Literatur
Teschler-Nicola M, Gerold F, Kanz F, Lindenbauer K, Spannagl M (1996) Anthropologische
Spurensicherung.
Die
traumatischen
und
postmortalen
Vernderungen
an
den
linienbandkeramischen Skelettresten von Asparn/Schletz. Archologie sterreichs 7:4-12
Thangaraj K, Chaubey G, Kivisild T, Reddy AG, Singh VK, Rasalkar AA, Singh L (2005)
Reconstructing the origin of Andaman Islanders. Science 308:996
Thomas J (1996) The cultural context of the first use of domesticates in continental Central and
Northwest Europe. In: Harris DR (ed) The Origins and Spread of Agriculture and Pastoralism in
Eurasia. UCL Press, London, pp 310-322
Thomas RH, Schaffner W, Wilson AC, Paabo S (1989) DNA phylogeny of the extinct marsupial wolf
83. Nature 340:465-467
Thomas WK, Paabo S, Villablanca FX, Wilson AC (1990) Spatial and temporal continuity of kangaroo
rat populations shown by sequencing mitochondrial DNA from museum specimens
81. J Mol Evol 31:101-112
Thompson WE, Ramalho-Santos J, Sutovsky P (2003) Ubiquitination of prohibitin in mammalian
sperm mitochondria: possible roles in the regulation of mitochondrial inheritance and sperm quality
control. Biol Reprod 69:254-260
Thorburn DR, Dahl HH (2001) Mitochondrial disorders: genetics, counseling, prenatal diagnosis and
reproductive options. Am J Med Genet 106:102-114
Thorpe I (1996) The Origins of Agriculture in Europe. Routledge, London
Tishkoff SA, Dietzsch E, Speed W, Pakstis AJ, Kidd JR, Cheung K, Bonne-Tamir B, SantachiaraBenerecetti AS, Moral P, Krings M (1996) Global patterns of linkage disequilibrium at the CD4 locus
and modern human origins. Science 271:1380-1387
Tolk HV, Barac L, Pericic M, Klaric IM, Janicijevic B, Campbell H, Rudan I, Kivisild T, Villems R,
Rudan P (2001) The evidence of mtDNA haplogroup F in a European population and its ethnohistoric
implications. Eur J Hum Genet 9:717-723
Torroni A, Chen YS, Semino O, Santachiara-Beneceretti AS, Scott CR, Lott MT, Winter M, Wallace DC
(1994a) mtDNA and Y-chromosome polymorphisms in four Native American populations from
southern Mexico. Am J Hum Genet 54:303-318
Torroni A, Neel JV, Barrantes R, Schurr TG, Wallace DC (1994b) Mitochondrial DNA "clock" for the
Amerinds and its implications for timing their entry into North America. Proc Natl Acad Sci U S A
91:1158-1162
Torroni A, Huoponen K, Francalacci P, Petrozzi M, Morelli L, Scozzari R, Obinu D, Savontaus ML,
Wallace DC (1996) Classification of European mtDNAs from an analysis of three European
populations. Genetics 144:1835-1850
Torroni A, Bandelt HJ, D'Urbano L, Lahermo P, Moral P, Sellitto D, Rengo C, Forster P, Savontaus ML,
Bonne-Tamir B, Scozzari R (1998) mtDNA analysis reveals a major late Paleolithic population
expansion from southwestern to northeastern Europe. Am J Hum Genet 62:1137-1152
Torroni A, Bandelt HJ, Macaulay V, Richards M, Cruciani F, Rengo C, Martinez-Cabrera V, Villems R,
Kivisild T, Metspalu E, Parik J, Tolk HV, Tambets K, Forster P, Karger B, Francalacci P, Rudan P,
Janicijevic B, Rickards O, Savontaus ML, Huoponen K, Laitinen V, Koivumaki S, Sykes B, Hickey E,
Novelletto A, Moral P, Sellitto D, Coppa A, Al-Zaheri N, Santachiara-Benerecetti AS, Semino O,
Scozzari R (2001) A signal, from human mtDNA, of postglacial recolonization in Europe. Am J Hum
Genet 69:844-852

226

Literatur
Troy CS, MacHugh DE, Bailey JF, Magee DA, Loftus RT, Cunningham P, Chamberlain AT, Sykes BC,
Bradley DG (2001) Genetic evidence for Near-Eastern origins of European cattle. Nature 410:1088-1091
Tully LA, Parsons TJ, Steighner RJ, Holland MM, Marino MA, Prenger VL (2000) A sensitive
denaturing gradient-Gel electrophoresis assay reveals a high frequency of heteroplasmy in
hypervariable region 1 of the human mtDNA control region. Am J Hum Genet 67:432-443
van Andel TH, Runnels CN (1995) The earliest farmers in Europe. Antiquity 69:481-500
Vasan S, Zhang X, Zhang X, Kapurniotu A, Bernhagen J, Teichberg S, Basgen J, Wagle D, Shih D,
Terlecky I, Bucala R, Cerami A, Egan J, Ulrich P (1996) An agent cleaving glucose-derived protein
crosslinks in vitro and in vivo. Nature 382:275-278
Vernesi C, Di BG, Caramelli D, Secchieri E, Simoni L, Katti E, Malaspina P, Novelletto A, Marin VT,
Barbujani G (2001) Genetic characterization of the body attributed to the evangelist Luke. Proc Natl
Acad Sci U S A 98:13460-13463
Vigilant L, Stoneking M, Harpending H, Hawkes K, Wilson AC (1991) African populations and the
evolution of human mitochondrial DNA. Science 253:1503-1507
Vila C, Maldonado JE, Wayne RK (1999) Phylogenetic relationships, evolution, and genetic diversity
of the domestic dog. J Hered 90:71-77
Vila C, Leonard JA, Gotherstrom A, Marklund S, Sandberg K, Liden K, Wayne RK, Ellegren H (2001)
Widespread Origins of Domestic Horse Lineages. Science 291:474-477
Wahl J (1989) Zum Stand der Neolithikum-Forschung in Sdwestdeutschland. Homo 40:99-105
Wakeley J (1993) Substitution rate variation among sites in hypervariable region 1 of human
mitochondrial DNA. J Mol Evol 37:613-623
Walden KK, Robertson HM (1997) Ancient DNA from amber fossil bees? Mol Biol Evol 14:1075-1077
Wallace DC, Brown MD, Lott MT (1999) Mitochondrial DNA variation in human evolution and
disease. Gene 238:211-230
Ward R, Stringer C (1997) A molecular handle on the Neanderthals. Nature 388:225-226
Watson E, Forster P, Richards M, Bandelt HJ (1997) Mitochondrial footprints of human expansions in
Africa. Am J Hum Genet 61:691-704
Wen B, Li H, Gao S, Mao X, Gao Y, Li F, Zhang F, He Y, Dong Y, Zhang Y, Huang W, Jin J, Xiao C, Lu
D, Chakraborty R, Su B, Deka R, Jin L (2005) Genetic Structure of Hmong-Mien Speaking Populations
in East Asia as Revealed by mtDNA Lineages. Mol Biol Evol 22:725-734
Werle E, Schneider C, Renner M, Volker M, Fiehn W (1994) Convenient single-step, one tube
purification of PCR products for direct sequencing. Nucleic Acids Res 22:4354-4355
Whittle A (1996) Europe in the Neolithic. The Creation of New Worlds. Cambridge University Press,
Cambridge
Whittle A, Bartosiewicz L, Boric D, Pettitt P, Richards M (2002) In the beginning: New Radiocarbon
Dates for the Early Neolithic in Northern Serbia and South-East Hungary. Anteus 25:63-117
Willerslev E, Hansen AJ, Christensen B, Steffensen JP, Arctander P (1999) Diversity of Holocene life
forms in fossil glacier ice 11. Proc Natl Acad Sci U S A 96:8017-8021

227

Literatur
Willerslev E, Hansen AJ, Binladen J, Brand TB, Gilbert MT, Shapiro B, Bunce M, Wiuf C, Gilichinsky
DA, Cooper A (2003) Diverse plant and animal genetic records from Holocene and Pleistocene
sediments. Science 300:791-795
Willerslev E, Hansen AJ, Ronn R, Brand TB, Barnes I, Wiuf C, Gilichinsky D, Mitchell D, Cooper A
(2004) Long-term persistence of bacterial DNA. Curr Biol 14:R9-10
Willerslev E, Cooper A (2005) Ancient DNA. Proc Biol Sci 272:3-16
Willms C (1985) Neolithischer Spondylusschmuck.Hundert Jahre Forschung. Germania 63:331-343
Windl H (1996) Rtsel um Gewalt und Tod vor 7000 Jahren, eine Spurensicherung. Katalog des N
Landesmuseums, N.F. 393 Asparn a.d. Zaya
Yao YG, Watkins WS, Zhang YP (2000) Evolutionary history of the mtDNA 9-bp deletion in Chinese
populations and its relevance to the peopling of East and Southeast Asia. Hum Genet 107:504-512
Yao YG, Zhang YP (2002) Phylogeographic analysis of mtDNA variation in four ethnic populations
from Yunnan Province: new data and a reappraisal. J Hum Genet 47:311-318
Yao YG, Kong QP, Bandelt HJ, Kivisild T, Zhang YP (2002a) Phylogeographic differentiation of
mitochondrial DNA in Han Chinese. Am J Hum Genet 70:635-651
Yao YG, Nie L, Harpending H, Fu YX, Yuan ZG, Zhang YP (2002b) Genetic relationship of Chinese
ethnic populations revealed by mtDNA sequence diversity. Am J Phys Anthropol 118:63-76
Yao YG, Kong QP, Wang CY, Zhu CL, Zhang YP (2004) Different matrilineal contributions to genetic
structure of ethnic groups in the silk road region in china. Mol Biol Evol 21:2265-2280
Zilhao J (1997) Maritime pioneer colonization in the Early Neolithic of the west Mediterranean.
Testing the model against the evidence. Porocilo 24:19-42
Zilhao J (2000) From the Meoslithic to the Neolithic in the Iberian Peninsula. In: Price TD (ed) Europe's
First Farmers. Cambridge University Press, Cambridge, pp 144-182
Zilhao J (2001) Radiocarbon evidence for maritime pioneer colonization at the origins of farming in
west Mediterranean Europe. Proc Natl Acad Sci U S A 98:14180-14185
Zimmermann A (2002a) Der Beginn der Landwirtschaft in Mitteleuropa. Evolution oder Revolution?
In: Menghin W, Planck D (eds) Menschen, Zeiten, Rume - Archologie in Deutschland. Theiss,
Stuttgart, pp 133-134
Zimmermann A (2002b) Die ersten Bauern. Bandkeramik. In: Menghin W, Planck D (eds) Menschen,
Zeiten, Rume - Archologie in Deutschland. Theiss, Stuttgart, pp 135-138
Zink A, Haas CJ, Reischl U, Szeimies U, Nerlich AG (2001) Molecular analysis of skeletal tuberculosis
in an ancient Egyptian population. J Med Microbiol 50:355-366
Zink AR, Grabner W, Reischl U, Wolf H, Nerlich AG (2003a) Molecular study on human tuberculosis
in three geographically distinct and time delineated populations from ancient Egypt. Epidemiol Infect
130:239-249
Zink AR, Sola C, Reischl U, Grabner W, Rastogi N, Wolf H, Nerlich AG (2003b) Characterization of
Mycobacterium Tuberculosis Complex DNAs from Egyptian Mummies by Spoligotyping. J Clin
Microbiol 41:5350-5351
Zischler H, Hss M, Handt O, von Haeseler A (1995) Detecting Dinosaur DNA. Science 268:1192-1193

228

Literatur
Zuckerkandl E, Pauling L (1962) Molecular disease, evolution, and genetic heterogeneity. In: Kasha M,
Bullman B (eds) Horizons in biochemistry. Academic Press, New York, pp 189-225
Zvelebil (1986) Mesolithic Prelude and Neolithic revolution. In: Zvelebil M (ed) Hunters in transition.
Mesolithic Societies of Temperate Eurasia and their Transition to Farming. Cambridge University
Press, Cambridge, pp 5-15
Zvelebil M (1989) On the transition to farming in Europe, or what was spreading with the Neolithic: a
reply to Ammerman. Antiquity 63:379-383
Zvelebil M (1995) Neolithisation in eastern Europe: a review from the frontier. Porocilo 22:107-150
Zvelebil M (1996) The agricultural frontier and the transition to agriculture in the circum-Baltic region.
In: Harris D (ed) The origin and spread of Agriculture and Pastoralism in Eurasia. University of
London Press, London, pp 323-335
Zvelebil M (1998) Whats in a name: The Mesolithic, the Neolithic and social change at the MesolithicNeolithic Societies of Temperate Eurasia and their Transition to Farming. In: Edmonds M, Richards C
(eds) Understanding the Neolithic of North Western Europe. Routledge, London, pp 1-36
Zvelebil M (2000) The social context of the agricultural transition in Europe. In: Renfrew C, Boyle K
(eds) Archaeogenetics: DNA and the Population Prehistory of Europe. McDonald Institute for
Archaeological Research, Cambridge, pp 57-79
Zvelebil M, Lillie M (2000) Transition to agriculture in Eastern Europe. In: Price TD (ed) Europes First
Farmers. Cambridge University Press, Cambridge, pp 57-92
Zvelebil M (2002) Demography and Dispersal of Early Farming Populations at the MesolithicNeolithic Transition: Linguistic and Genetic Implications. In: Bellwood P, Renfrew C (eds) Examining
the farming/language dispersal hypothesis. McDonald Institute for Archaeological Research,
Cambridge, pp 379-394

229

Anhang

10. Anhang
10.1 Zustzliche Tabellen
Tabelle 10.1. HVR I Sequenz und Haplogruppenbestimmung
Labormitarbeiter, Diplomanden, Magistranden und Praktikanten.
Individuum #
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26

HVR I Sequenz
16189C 16217C
CRS
16051G 16162G 16259T
16189C
16189C 16263C
16189C 16311C
16263C
16304C
16304C
16304C 16311C
16354T
16069T 16126C
16069T 16126C
16069T 16126C 16222T
16069C 16092C 16126C 16261T 16284G 16290T
16093C 16224C 16311C
16224C 16311C
16224C 16245T 16311C
16126C 16294T 16304C
16136C 16356C
16223T 16356C
16223T 16356C
16192T 16270T
16189C 16192T 16270T
16298C
16216G 16261T 16298C

aller

anonymisierter

Haplogruppe
B
H*
H*
H*/U*
H*
H*
H*
H*
H*
H*
H*
J*
J*
J*
J*
K
K
K
T
U4
U4
U4
U5
U5
V
V

230

Anhang
Tabelle 10.2. HVR I Sequenzen und Haplogruppenbestimmung der Probengeber.

Individuum #
1
2
3
4
5
6
7
8
9
10
11
12

HVR I Sequenz
CRS
16257T
16304C
16291T 16390A
16235G 16261T
16166G 16311C
16129A 16172C
16069T 16126C
16069T 16126C
16224C 16311C
16224C 16258G
16078G 16126C

Haplogruppe
H*
H*
H*
H*
16291T 16293G
H/J1 ?
H?
16223T 16311C 16391A I
16265G 16291T 16319A J*
16145A 16172C 16261T J1
K
16311C
K
16294T 16296T
T*

231

Anhang
Tabelle 10.3. Ergebnisse aller einzelnen STR-Typisierungen.

Probe

Extrakt PCR

Amel

D3S1358

D8S1179

D5S818

vWA

D21S11

D13S317

AJD15

NC9

N13.10

15/(17)

12/14

11

(18)/19

29/(31.2)

11/12

AJD15

NC9

N26.3

15/17

12/14

11

19

29.2/32

AJD15

NF10

N12.10

15

12/14

11

(18)/19

(29)

AJD15

NF10

N26.2

15/17

12/14

11

19

29.2/32

ASP2

NH

N16.13

15/15

ASP2

NK12

N47.12

17

9/15

ASP2

NK12

N46.12

XY

16

13

BRU3

NJ4

N19.4

BRU5

NC

N13.8

15

(10)/(13)/14

BRU5

NF

N12.8

X?
X
14/15

10

FGA

D7S820 D18S51
(9)

(20)

11/12

16/17

CH4a

NL2

N64_2

DBK1a

NN13

N203.12 X/Y

13

DBK1a

NN13

N218.11

DBK1b

NO13

N204.13 X/Y

DBK1b

NO13

N219.12

DEB1

NG8

N16.18

17

DEB1

NG8

N17.1

(14)/15/(17)/18

DEB1

NG8

N20.15

DEB1

NH

N16.1

DEB1

NM5

N79.2

16/17

DEB1

NM5

N80.2

18

DEB2a

NG

N17.2

DEB2b

NK3

N47.3

DEB2b

NK3

N46.3

(X)

DEB3a

NG10

N17.3

DEB3a

NG10

N20.17

DEB3a

NG10

N26.5

DEB3a

NH3

N16.3

DEB3a

NH3

N26.4

17/18

DEB3b

NK4

N47.4

(17)/18

DEB3b

NK4

N46.4

DEB4a

NC

N11.13

XY

DEB4a

NC

N13.3

DEB4a

NF

DEB4a

23

13

11

16/17

13
artefakte

13/14
14

13
14

13

11/13

(11)/12

(14)/(17)/18

(17)/18

11/13

12

11

12

12
14

31.2/32.2

11/12/13

7-2
23

(16)/17

11/13

12

11/13

12

18

(10)/11

12

18/19

13/14

11/13

16/17

(30)

XY

18/19

13/14

11/13

16/17

(29/30

9/(12)

(24)

(10)

N12.3

XY

18/19

13/14

13

16/17

(30)

(23)

(10)

NF3

N26.10

XY

18/19

13/14

11/13

16/17

DEB4b

NK5

N47.5

XY

18/19

13

16/17

DEB4b

NK5

N46.5

XY

18/19

DEB5a

NI

N18.10

DEB5a

NI

N18.18

DKF1a

NN14

N218.12

DKF1b

NO14

N204.14

DON1a

NK10

N47.10

11

DON1b

NJ11

N19.11

16

DON1b

NJ11

N20.2

DON2a

NJ12

N19.12

DON2a

NJ12

N20.3

DON2a

NM4

N79.1

DON2a

NM4

N80.1

DON2b

NK9

N47.9

(31)

(10)

DON2b

NK9

N46.9

X(Y)

13/14

(16)/17

9/(12)

13

(11)/12

12/(15)16

(9)h

7/13
8/13

12/13

232

Anhang
Tabelle 10.3. Ergebnisse aller einzelnen STR-Typisierungen. Fortsetzung.

Probe

Extrakt PCR

DUD1b

NG

N14.2

Amel

D3S1358

D8S1179

D5S818

vWA

DUD2a

NJ10

N19.10

16

13/14

DUD2a

NJ10

N20.1

16

13

12

16/17

DUD2a

NJ10

N26.8

DUD2b

NK13

N47.13

Artefakte

14/16

(9)/(13)/14

12

15/16

ECS 1a

NN12

N203.11

(14)15

9+1/(13)14

ECS 1a

NN12

N218.10

(11)h

D21S11

D13S317

FGA

D7S820 D18S51

(13)/14
16
31.2/32.2

21/22

14-1/15-1
(14-1)h/18

EIL1a

NS10

N203.14

10/11

(15-1)h

EIL1a

NS10

N218.13 Y

EIL1b

NR8

N204.16 Y

EIL1b

NR8

N219.15 X

END119 1a

NN4

N203.3

END119 1a

NN4

N218.2

END119 1b

NO4

N219.3

END119 2b

NO5

N204.5

15

13/14

11/12/13

END119 2b

NO5

N219.4

15

14

11/13

(15)16/(17)18

END6 1a

NN6

N203.5

16

(8)9

12

11+1/(16)/17

END6 1a

NN6

N218.4

X/Y

18

9/13

13

END6 1b

NO6

N204.6

18

END6 1b

NO6

N219.5

12/16

END6 2a

NN7

N203.6

(13)14/15

END6 2a

NN7

N218.5

17/18

END6 3a

NN8

N203.7

18

(12)13

12

17

30

END6 3a

NN8

N218.6

16/(17)18

(12)/13/14

10/11/12

17-2

29,2

FLO1re

NL10

N64_10

FLO4a

NI

N18.5

ad/Y

FLO4a

NI5

N20.7

XY

FLO4a

NK1

N46.1

ad/Y

HAL1a

NF

N12.4

HAL1b

NI11

N20.12

XY

HAL1b

ND

N13.4

(15)/16

HAL1b

NI

N18.11

ad/Y

18

8/15

HAL2a

NK7

N47.7

XY

16/18

HAL2a

NK7

N46.7

XY

HAL2b

NL9

N64_19

HAL2b

NL9

N64_9

HAL3a

NI

N18.12

HAL3a

NI12

N20.13

HAL3b

NK8

N47.8

Artefakte

17/18

9+1/(13)14

(16-2)17-2
16
16/18
31.2

8
26

14
18
32+1

(10)11

19+1

(14)/15

(14)/15

12

(14)

(10)/11

13/14

(10)/11

15/17

8/13

12

(15)/16/18

(28)/30

(11)

(24)

16/18

8/13

12

16/18

28/30

(9)

(21)/24

XY

16/18

8/13

12

16/18

28/30

10/(12)

XY

16/18

8/13

12

16/18

28/30

31.2/32.2

10/11

29
(10)

21

12/13

HRX1

NG

N14.5

KRE1a

NJ13

N19.13

16/17

11/15

(7)/10/11
11/12

15/16

KRE1a

NJ13

N20.4

(15/16/17)

11/15

12

15/16

29

21

KRE1a

NJ13

N26.9

Y?

16/17

11/15

12

(15)/16

(28)

(14)

(21)

KRE1are

NM12

N79.4

16/17

11/15

(12)

16

28/29

KRE1are

NM12

N80.4

16/17

11/(15)

(12)

16

28/29

(13)

21

KRE1b

ND4

N15.3

KRE1b

ND4

N26.7

(10)/(14)/16

13

12

KRE1b

NG3

N14.3

KRE1b

NG3

N26.6

21

(20)

28/29
X

11/12

24

233

Anhang
Tabelle 10.3. Ergebnisse aller einzelnen STR-Typisierungen. Fortsetzung.
Probe

Extrakt PCR

Amel

D3S1358

D8S1179

D5S818

vWA

KRE2a

NJ14

N19.14

XY

15/17

(13)/14/(15)

11/12

15/16

KRE2a

NJ14

N20.5

XY

15/17

9/14

11/12

KRE2a

NJ14

N26.10

XY

15/17

9/14

11/12

16/18

KRE2are

NM11

N79.3

X/Y

15/17

(14)

16

28

KRE2are

NM11

N80.3

X/Y

15/17

(14)

(11)

16/18

28

KRE2b

NK14

N47.14

KRE2b

NK14

N46.14

LEB1a

NL1

N64_1

SCHWE1a

NI

N18.7

SCHWE2a

NL12

N64_12

SCHWE2b

NI8

N18.8

SCHWE2b

NI8

N20.9

SCHWE4a

NL13

N64_13

SCHWE4b

NI

N18.9

SCHWE4b

NI9

N20.10

SON6

ND

N13.6

SZA23 1a

NN1

N79.6

X/Y

14

13/14

11

14/16

26/29.2/30

11/13

22/23

7/8

SZA23 1a

NN1

N80.6

X/Y

14

13/(14)

(11)

14/16

26/(29.2-30)

11+2/13+2

22/23

(7/8)

SZA23 1b

NO1

N81.1

X/Y

14/19

13/14

11

14/16

26/30

11+2/13+2

22/23

7/8

SZA23 1b

NO1

N82.1

X/Y

14

13/14

11

14/16

26/29.2+

11+/13+

22/23

(7/8)

(12/15)

SZA23 1b

NO1

N204.1

X/Y

14

13/14

(10)11

14/16

26/30

12/14

SZA23 1b

NO1

N219.1

X/Y

14

13/14

11

14/16

26

SZA23 2a

NN2

N79.7

15

12

11/13

SZA23 2a

NN2

N80.7

15/17

12

11

SZA23 2a

NN2

N203.1

15/17

18/19

(30)h

SZA23 2a

NN2

N218.1

SZA23 2b

NO2

N81.2

17

8/(10)/13

SZA23 2b

NO2

N82.2

15/17

12

SZA23 2b

NO2

N204.2

(14)15

SZA23 2b

NO2

N219.2

XY

14

13/14

(10)/11

12/14/16

26/30

SZA23 3a

NN3

N79.8

X/Y

15/17

13/(14)

12/13

14/17

28

SZA23 3a

NN3

N80.8

X/Y

15/17

13/14

12/(13)

14/17

28/29

11/(12)

(21)

SZA23 3a

NN3

N203.2

X/Y

15/17

13/14

12/13

(13)14/17

28/29

(12)h

(21)h

SZA23 3b

NO3

N81.3

X/Y

15

13/14

12/13

14/17

28/28.2-29

11

20

(16)

SZA23 3b

NO3

N82.3

15/17

13/14

14/17

28

(9)/10+2

20+

(9)

SZA23 3b

NO3

N204.3

X/Y

15

13/14

13

14/17

21

SZA8 1a

NN9

N203.8

15

(7)8

(14)/15

D21S11

D13S317

FGA

28

10/14

20

D7S820 D18S51

(28)

(19)/20

19

Artefakte

9/(13)/14
(7)+1
X

(8)/11/12
(8)/13

(9)/(12)/13/14
(14/15)
11/12

11
(11)/12

SZA8 2b

NO10

N219.9

TRE1

NH

N16.14

UNS3a

ND

N15.1

UWS1

NE

N11.1

UWS10

NC

N13.11

UWS10

NE

N11.10

UWS2

NE

N11.2

UWS2b

NH

N16.5

UWS4

NE

N11.4

UWS5

NE

N11.5

UWS5b

NH

N16.8

8/11/12/13

UWS6

NH

N16.9

UWS8b

NH

N16.11

(13)/14

UWS9

NH

N16.12

VAI3

NK11

N46.11

VIE1

ND

N15.7

ad/Y

VIE1

NG

N14.7

(12/15)

18/19
(19)
11

19
15/16

20+2/\21-2

10/11
(8.2?)

(6?)

(7)/(9)

11/12

(24)/25
(32.2)/33.2

(35.3?)

(16?)

31.2

9/12

X
16
16/17

18/19
14/(15)/(16)

(10)/11

(15)/16

(6?)

(19)

(17)/18

234

Anhang
Tabelle 10.4. Substitutionsrate der einzelnen Amplifikationen aller neolithischer Individuen.

Individuum

Fragment Ik
1599616055

Fragment I
1599616142

ASP2

9,85

SEE1
HAL3

11,49
18,39

HAL2
HAL1

Fragment IIk
1611716218

DEB5

8,00

DEB1

Fragment III
1620916348

Fragment IV
1628716410

21,74
21,74

43,72

22,64

8,20
9,37
26,93
9,56
8,20
31,15
10,93
16,39
32,79
17,56
28,32
13,11
4,10
10,54

6,92
14,98

0,00
10,63
13,04
13,04
13,04
10,43
25,12
23,38
11,59
8,70
38,26
12,09
9,94
19,13

10,14
16,34
10,14
31,70
19,93
13,04
21,74
10,29
16,91
14,49
13,04
21,74
15,40

24,00

17,39
17,39
41,30
6,52

8,06

14,49
33,82
3,62
2,51

21,43

0,00

16,73

0,00

16,00

5,80

32,26

7,25

12,93
4,60
0,00

FLO4

Fragment IIIk
1620916303

16,15

9,85
16,09
7,76
6,96

DEB3
DEB4

Fragment II
1611716233

SCHWE1

12,07
10,34
18,10

SCHWE2
DON1

24,83
18,39

KRE1
KRE2

3,45
5,17
10,34

CHE4
LEB1
VAI3
FLO5

8,70
17,39
8,70

0,00

6,90
5,17
13,79
3,45

FLO2

17,44

FLO6

3,45
10,34
16,09

6,96
13,04
27,54

SCHWE4

5,17

16,15

0,00
7,25
25,36
7,25
0,00
5,43
7,25
27,54
5,43
7,25
23,55

36,89
24,93
20,49
22,25
40,98
28,69
16,39
5,46
5,46
6,15
4,92
28,69
0,00
8,20
6,15
0,00
11,27

10,92
17,55
14,21
17,59
17,72
10,57
13,50
23,29
22,56
17,53
11,48
11,80
5,43
8,68
19,13
3,15
7,78
17,57
17,57

235

Anhang
Tabelle 10.4. Substitutionsrate der einzelnen Amplifikationen aller neolithischer Individuen.
Fortsetzung.

Individuum

Fragment Ik Fragment I Fragment IIk Fragment II Fragment IIIk Fragment III Fragment IV
1599615996161171611716209162091628716055
16142
16218
16233
16303
16348
16410

UWS5

3,45

8,70

11,39

9,84

6,90

8,70

7,25

6,15

5,80
UWS2

5,17

7,84

10,25

17,39

6,04

12,30

17,39

7,25

13,66

13,37

23,26

19,57

17,60

8,20

20,50

34,88

24,84

13,29

34,15

12,64
FLO1
EIL1

10,06

6,83

15,17

8,70
FLO3

19,70

10,14

3,45

26,88

11,59

17,56

30,43

41,67

8,20

4,35

3,62

10,25

0,00

0,00

6,15

0,00

4,35

10,87

0,00

6,90

5,95

9,66

0,00

17,39

25,36

12,89

16,96

0,00
SZA8 1

3,45

SZA8 2

3,97
4,19

0,00
END119 1

16,55

END6 1
END6 2
ESC1

DBK1
DKF1
SZA23 1
SZA23 2

12,26

19,57

3,62

8,22

6,90

20,87

7,92

11,71

10,34

0,00

5,43

8,20

11,82

8,70

15,53

14,75

3,45

8,70

15,94

0,00

0,00

25,11

9,66

32,79

0,00

0,00

9,66

13,66

3,45

30,43

10,87

10,93

9,85

27,17

16,56

19,13

20,69

15,65

9,06

9,37

8,62

10,43

11,59

8,20

13,79

23,19

10,87

8,20

5,75

8,70

18,84

11,71

6,90

11,59

10,30

10,93

13,79

27,17

14,49

23,22

6,90

13,04

4,12

4,10

14,48
8,92
9,86
12,21

15,94
11,86
10,59
13,02

10,34
SZA23 3

Durchschnittliche
Substitutionsrate

18,90

9,20

18,10

3,33

8,20

2,43

5,80

24,64

13,66

12,70

14,02

8,88

17,36

14,59

16,79

10,67

13,08

236

Anhang
Tabelle 10.5 Aufschlsselung der einzelnen Substitutionen.

Fragment
Austausch

Ik

IIk

II

IIIk

III

IV

Summe

C>T

22

220

31

397

38

447

460

1615

75,68

C>G

0,19

C>A

0,42

T>C

33

14

18

18

85

3,98

T>G

0,42

T>A

0,14

G>T

0,09

G>C

G>A

109

75

44

62

300

14,06

A>T

15

0,70

A>G

16

21

23

23

86

4,03

A>C

0,28

Summe

25

390

39

522

44

544

570

2134

100

237

Anhang
Tabelle 40.6. Prozentualer Anteil der Haplogruppen in den unterschiedlichen frhneolithischen
Kulturen bzw. Gebieten sowie in Referenzgebiet A (LBK/Krs-Gebiet heute). Exakte Werte zu
Abbildungen 33 und 34.

Referenzgebiet A

Haplogruppe

LBK/AVK

Krs

Nordost

U3

3,85

0,00

0,00

1,14

3,85

0,00

0,00

4,04

N9a

0,00

10,00

0,00

0,00

D4a

0,00

10,00

0,00

0,00

0,00

10,00

0,00

2,55

3,85

10,00

0,00

9,04

H*

15,38

30,00

0,00

42,93

HV

7,69

10,00

0,00

1,93

15,38

10,00

0,00

5,00

19,23

10,00

0,00

8,87

3,85

0,00

0,00

1,90

N1a

23,08

0,00

0,00

0,35

U5

3,85

0,00

100,00

10,27

LBK/Krs heute

238

Anhang
Tabelle 10.7. Prozentuale Anteile der Haplogruppen in der gesamten neolithischen Stichprobe
sowie in zwei modernen Referenzgebieten. Ergnzende exakte Werte zu Abbildung 35.

Haplogruppe

Referenzgebiet A Referenzgebiet B
LBK/Krs heute Nahost+Kaukasus

Neolithikum

0,26%

0,23%

0,00%

0,09%

0,31%

0,00%

0,00%

1,16%

0,00%

0,70%

1,16%

2,38%

0,00%

0,08%

0,00%

0,00%

0,15%

0,00%

42,93%

23,61%

16,67%

HV

1,93%

8,95%

7,14%

2,55%

1,62%

2,38%

9,04%

9,49%

4,76%

5,00%

5,17%

11,90%

0,61%

8,02%

0,00%

0,26%

1,85%

0,00%

N*

0,26%

2,70%

2,38%

N1a

0,35%

0,46%

14,29%

0,18%

1,77%

0,00%

T*

5,62%

6,33%

14,29%

T1

3,25%

4,01%

0,00%

U*

6,76%

9,72%

0,00%

U3

1,14%

4,09%

2,38%

U5

10,27%

2,78%

16,67%

4,04%

0,77%

2,38%

2,81%

1,85%

2,38%

1,76%

3,47%

0,00%

div

0,18%

0,23%

0,00%

239

Anhang

10.2 Verwendete Puffer und Lsungen


LB-Medium (1 Liter):

Trypton
10 g
Hefeextrakt
5g
NaCl
5g
in Aqua bidest lsen und auf einen Liter auffllen

LB-Platten:

Trypton
10 g
Hefeextrakt
5g
NaCl
5g
Agar-Agar
15 g
Ampicillin (10 mg/ml)
10 ml
IPTG
47,6 mg
X-Gal
100 mg
in Aqua bidest lsen und auf einen Liter auffllen

20 x TBE-Puffer (2 Liter):

Na2 EDTA
18,6 g
Tris
432 g
Borsure
222,4 g
in Aqua bidest lsen und auf zwei Liter auffllen

6 x Agarose-Ladepuffer:

40% w/v Sucrose


0,25% Bromphenolblau
in 50ml H2O lsen

20 g
0,125 g

10.3 Verwendete Gerte, Chemikalien und Kits


10.3.1 Gerte
ABI PRISM 310 Genetic Analyzer, Applied Biosystems, Weiterstadt
Brutschrank, Heraeus, Art.-Bez. Typ B 5042
Certomat H und Certomat U, B. Braun
Digitales Geldokumentationssystem, INTAS Science Imaging Instruments GmbH, Gttingen
Dremel Multi, Dremel, Utrecht, Niederlande
Elektrophorese Gelkammer Midi; Carl Roth GmbH, Karlsruhe
Elektroporationskvetten, peQLab Biotechnologie GmbH,
Eppendorf Biophotometer, Eppendorf, Hamburg
Eppendorf Centrifuge 5415R, 5415C und 5402, Eppendorf, Hamburg
Eppendorf Mastercycler gradient 5331, Eppendorf, Hamburg
Eppendorf Mastercycler, Eppendorf, Hamburg
Eppendorf Thermomixer comfort 5355, Eppendorf, Hamburg

240

Anhang
EQUIBIO Easyject Prisma Elektroporator, peQLab Biotechnologie GmbH
Gelkammern, Carl Roth Chemikalien/Laborbedarf, Art.-Bez. HU10
IKA-Combimag RCT Magnetrhrer, IKA-Werk, Janke & Kunkel GmbH & Co.KG, Art.-Bez.
159815
KaVO EWL K11 Typ 4980, KaVo Elektrotechnisches Werk; Leutkirch i.A.
Labor-Schwingmhle MM200, Retsch; Haan
membraPure Aufbereitungsmodul, membraPure, Art.-Bez. 19021 R1
MILIPORE Milli-Qplus Filteranlage, MILLIPORE
Mischrotator (Eigenbau)
P1000, P100, P20, P10 PIPETMAN, Gilson Medical Electronics S.A.; Frankreich
pH-Meter CG 838, Schott
Polaroid -Kamera, Land Camera MP-4 mit Rotfilter, Polaroid
Polaroid-Filme, Typ 667
Powersupply, Consort E 143, Carl Roth GmbH, Karlsruhe
Rotator, GFL 3025, Gesellschaft fr Labortechnik GmbH; Burgwedel
Sge KaVO EWL, Typ 4990 (Handstck)
UV-Lichtanlage, Benda, Art.-Bez. Typ N-90M
UV-Transilluminator [Spectroline Transilluminator TR-302]
Vortexer Heidolph Typ REAX 1R, Labotec; Wiesbaden
Zentrifuge Jouan GR 412, Jouan GmbH, Unterhaching

10.3.2 Chemikalien
10 x EDTA-Puffer, ABI PRISM Applied Biosystems
2-Propanol, Rotipuran, Carl Roth GmbH; Karlsruhe
Agar-Agar, Carl Roth GmbH, Karlsruhe
Agarose MEEO, GENterprise, Mainz
Agarose ultraPURE, GIBCO BRL, Life technologies GmbH; Karlsruhe
Ampicillin Natriumsalz, Carl Roth GmbH, Karlsruhe
Borsure, Merck; Darmstadt
Bovines Serum Albumin (BSA), Roche Diagnostics, Mannheim, Art.-Nr. 85989824
Bromphenolblau Na-Salz, Carl Roth GmbH, Karlsruhe
dNTP-Mix, MBI fermentas GmbH, St. Leon-Rot
EDTA, Acros Organics; Geel, Belgien
EtBr-Stammlsung, Carl Roth GmbH, Karlsruhe
Ethanol, Rotipuran, Carl Roth GmbH; Karlsruhe
GeneRulerTM 50 bp DNA Ladder, MBI fermentas GmbH, St. Leon-Rot
Hi-Di-Formamide, Applied Biosystems, Weiterstadt
HPLC-Wasser, Acros Organics, Geel, Belgien
IPTG, BioTech Trade & Service GmbH, St. Leon-Rot
Loading Dye Solution, MBI fermentas GmbH, St. Leon-Rot
Natriumacetat, Merck; Darmstadt
Natriumhypochlorid DanKlorix, Palmolive-Colgate GmbH, Hamburg

241

Anhang
N-Laurylsarkosin, Fluka, Riedel-deHaen, Buchs SG, Schweiz
Nujol Mineral Oil, Applied Biosystems; Weiterstadt
POP-6 TM, Performance Optimized Polymer 6, Applied Biosystems Weiterstadt
Primer , Biosprings, Frankfurt
Roti-Phenol/Chloroform, Carl Roth GmbH; Karlsruhe
Rotiphenol 500, Carl Roth GmbH, Karlsruhe
Sucrose, Sigma-Aldrich Chemie GmbH; Steinheim
T4-gene 32 protein, Roche Diagnostics; Mannheim
Trichlormethan/Chloroform ROTISOLVHPLC, Carl Roth GmbH, Karlsruhe
Trichlormethan/Chloroform, RotisolvHPLC, Carl Roth GmbH; Karlsruhe
Tris-Puffer (Tris-(hydroxymethyl)-aminomethan), Carl Roth GmbH; Karlsruhe
TTP-Mix, peQLab Biotechnologie GmbH
UltraPURE Ethidiumbromide solution, GIBCO BRL, Life technologies GmbH; Karlsruhe
Vektor-DNA pUC18, eigene Herstellung
X-Gal, Carl Roth GmbH, Karlsruhe, Art.-Nr. 2315.3

10.3.3 Enzyme
Abgene DNA Polymerase, Abgene Germany, Hamburg
Alu I, New England Biolabs GmbH, Frankfurt
AluI, MBI fermentas GmbH, St. Leon-Rot
AmpliTaq Gold DNA Polymerase, Applied Biosystems, Weiterstadt
Dde I, New England Biolabs GmbH, Frankfurt
Eco RI, MBI fermentas GmbH, St. Leon-Rot
Exonuclease I (EXO I), MBI fermentas GmbH, St. Leon-Rot
Hind III, MBI fermentas GmbH, St. Leon-Rot
Hinf I, MBI fermentas GmbH, St. Leon-Rot
Proteinase K in Tris-HCl, Roche Diagnostics, Mannheim
Proteinase K, PCR Grade, Roche Diagnostics, Mannheim
Shrimp Alkaline Phosphatase (SAP), MBI fermentas GmbH, St. Leon-Rot
Sma I, MBI fermentas GmbH, St. Leon-Rot
T4-Ligase, MBI fermentas GmbH, St. Leon-Rot, Art.-Nr. EL0015
Uracil-N-Glykosylase,Sigma-Aldrich Chemie GmbH, Mnchen

10.3.4 Kits
BigDyeTM Terminator Cycle Sequencing 3.1, Applied Biosystems, Weiterstadt
CONCERT
Rapid PCR Purification System, GIBCO BRL , Life Technologies GmbH;
Karlsruhe
Invisorb Spin PCRapid Kit, Invitek GmbH, Berlin-Buch
NucleoSpin Plasmid Quick Pure Kit, Macherey-Nagel, Dren, Art.-Nr. 740 615.250

242

Anhang
10.3.5 Gefe, Einwegartikel und Schutzkleidung
0,5 ml Safe-Lock PCR-Tubes, eppendorf, Hamburg
0,5 ml Sample Tubes, Applied Biosystems, Weiterstadt
0,5ml PCR Tubes, flat cap, Molecular Bio Products inc.; San Diego, USA
1,5 ml eppendorf Tubes, Sarstedt, Art.-Bez. REF/ 72.690
1,5ml Micro Tubes Reagiergefe, Sarstedt AG; Nmbrecht
10il Gilson Long Tips DL 10, Gilson Medical Electronics S.A., Frankreich
100 kDa Centricon Filter Unit, Millipore GmbH, Schwalbach
15ml, 50ml Sarstedt-Rhre, Sarstedt AG, Nmbrecht
2ml Safe-seal Reagiergefe, Sarstedt AG, Nmbrecht
ART 1000E, 100E, 20P, 10 REACH Einwegpipettenspitzen, Molecular Bio Products , San
Diego, USA
Kimwipes Lite und Lite 100, Kimberley-Clark
Overall Schutzkleidung sowie berschuhe, Tyvek Pro-Tech, Du Pont Tyvek
Rotiprotect Stretch Vinylhandschuhe, Carl Roth GmbH, Karlsruhe
Schutzvisier Pulsafe, Clearways visor, CV83PEU und Clearways CB14 Browguard, dalloz
safety, UK
Septa for 0,5 ml Sample Tubes, Applied Biosystems, Weiterstadt
ZORRO Chirurgische Gesichtsmaske, EURONDA, Italien

243

Anhang

10.4 Abkrzungsverzeichnis

C
il
aDNA
bp
bzw.
cm
ddNTPs
d.h.
DNA; DNS
dNTPs
EDTA
et al.
EtBr
g
xg
h
Hg
Ht
Kap.
M
mM
min
ml
np(s)
PCR
pH
pmol
RFLP
rpm
RT
TBE
s.a.
s
s.o.
STR
s.u.
u.a.
U/min
UV
V
vgl.
x
z.B.

Promille
Prozent
Eingetragene Marke
Marke
Grad Celsius
Microliter
ancient DNA; alte DNA
base pair(s); Basenpaar(e)
beziehungsweise
Zentimeter
Didesoxinukleotidtriphosphate
das heit
desoxiribonucleic acid; Desoxiribonukleinsure
Desoxinukleotidtriphosphate
Ethylendiamintetraacetat
et alii
Ethidiumbromid
Gramm
Zentrifugalbeschleunigung
Stunde(n)
Haplogruppe
Haplotyp
Kapitel
molar
millimolar
Minute(n)
Milliliter
Nucleotide position(s); Nukleotidposition(en)
polymerase chain reaction; Polymerase Kettenreaktion
Pondus Hydrogeni, Protonenaktivittsexponent
Picomol
restriction fragment length polymorphism;
Restriktions-Fragment-Lngen-Polymorphismus
rounds per minute; U/min
Raumtemperatur
Tris-Borat-EDTA-Puffer
siehe auch
Sekunde(n)
siehe oben
short tandem repeat
siehe unten
unter anderem, unter anderen
Umdrehungen pro Minute
Ultraviolett
Volt
vergleiche
mal
zum Beispiel

244

Anhang

10.5 Alignments der Sequenzen der neolithischen Individuen


Nachfolgend sind die Alignments der Sequenzen der neolithischen Individuen in
alphabetischer Reihenfolge aufgefhrt.
Jedes Alignment wird von der Cambridge Reference Sequence (CRS; Anderson et al. 1981;
Genbank accession number J01415) angefhrt. Darber befindet sich die Angabe zur
Nukleotidposition. Die jeweiligen Sequenzen der Klone bzw. Direktsequenzierungen sind in
berlappenden Fragmenten geordnet unter der CRS angegeben, wobei nur abweichende
Positionen ausgeschrieben, bereinstimmende Positionen dagegen mit einem Punkt
gekennzeichnet werden.
Die Bezeichnung der Klonsequenzen entspricht folgendem Prinzip:
z.B. ASP2_A_I/1_1
Probenkrzel_Extraktion A_HVR I Fragment I /PCR-Nummer(mit UNG)_Klonnummer
Die Bezeichnung der Direktsequenzierungen entspricht folgendem Prinzip:
z.B. SCHWE5_B_III/1rev
Probenkrzel_Extraktion B_ HVR I Fragment III /PCR-Nummer_verwendeter Primer

Die Bezeichnung der abweichenden Nukleotide erfolgt nach dem IUB-code:


IUB

Bedeutung

a oder c

a oder g

a oder t

c oder g

c oder t

g oder t

a oder c oder g

a oder c oder t

a oder g oder t

c oder g oder t

a oder c oder g oder t

245

J01415
ASP2_A_I/1_1
ASP2_A_I/1_2
ASP2_A_I/1_3
ASP2_A_I/1_4
ASP2_A_I/1_5
ASP2_A_I/1_6
ASP2_A_I/1_7
ASP2_A_I/1_8
ASP2_A_I/1_9
ASP2_A_I/1_10
ASP2_A_I/1_11
ASP2_B_I/1UNG_1
ASP2_B_I/1UNG_2
ASP2_B_I/1UNG_3
ASP2_B_I/1UNG_4
ASP2_B_I/1UNG_5
ASP2_B_I/1UNG_6
ASP2_B_I/1UNG_7
ASP2_B_I/1UNG_8
ASP2_B_I/1UNG_9
ASP2_A_II/1UNG_1
ASP2_A_II/1UNG_2
ASP2_A_II/1UNG_3
ASP2_A_II/1UNG_4
ASP2_A_II/1UNG_5
ASP2_A_II/1UNG_6
ASP2_A_II/1UNG_7
ASP2_A_II/1UNG_8
ASP2_B_II/1_1
ASP2_B_II/1_2
ASP2_B_II/1_3
ASP2_B_II/1_4
ASP2_B_II/1_5
ASP2_B_II/1_6
ASP2_B_II/1_7
ASP2_B_II/1_8
ASP2_B_II/1_9
ASP2_A_III/1UNG_1
ASP2_A_III/1UNG_2
ASP2_A_III/1UNG_3
ASP2_A_III/1UNG_4
ASP2_A_III/1UNG_5
ASP2_A_III/1UNG_6
ASP2_A_III/1UNG_7
ASP2_A_III/1UNG_8
ASP2_A_III/1UNG_9
ASP2_A_III/1UNG_10
ASP2_B_III/1_1
ASP2_B_III/1_2
ASP2_B_III/1_3
ASP2_B_III/1_4
ASP2_B_III/1_5
ASP2_B_III/1_6
ASP2_B_III/1_7
ASP2_B_III/1_8
ASP2_B_III/1_9
ASP2_B_III/1_10
ASP2_B_III/1_11
ASP2_B_III/1_12
ASP2_A_IV/1UNG_1
ASP2_A_IV/1UNG_2
ASP2_A_IV/1UNG_3
ASP2_A_IV/1UNG_4
ASP2_A_IV/1UNG_5
ASP2_A_IV/1UNG_6
ASP2_A_IV/1UNG_7
ASP2_A_IV/1UNG_8
ASP2_A_IV/1UNG_9
ASP2_A_IV/1UNG_10
ASP2_A_IV/1UNG_11
ASP2_B_IV/1_1
ASP2_B_IV/1_2
ASP2_B_IV/1_3
ASP2_B_IV/1_4
ASP2_B_IV/1_5
ASP2_B_IV/1_6
ASP2_B_IV/1_7
ASP2_B_IV/1_8
ASP2_B_IV/1_9

16000

16010

16020

16030

16040

16050

16060

16070

16080

16090

16100

16110

16120

16130

16140

16150

16160

16170

16180

16190

16200

T A AGA T T CT A A T T T A A A CT AT T CT CT GT T CT T T CA T GGGGA A GCA GA T T T GGGT A CCA CCCA AGT A T T GA CT CA CCCA T CA A CA A CCGCT A T GT A T T T CGT A CA T T A CT GCCA GCCA CCA T GA A T A T T GT ACGGT A CCA T A A A T A CT T GA CCA CCT GT A GT A CA T A A A A A CCCAA T CCA CA T CA A A A CCCCCT CCCCA T GCT T A CA A
. . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . T. . T. . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . Y. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anhang

246

J01415
ASP2_A_I/1_1
ASP2_A_I/1_2
ASP2_A_I/1_3
ASP2_A_I/1_4
ASP2_A_I/1_5
ASP2_A_I/1_6
ASP2_A_I/1_7
ASP2_A_I/1_8
ASP2_A_I/1_9
ASP2_A_I/1_10
ASP2_A_I/1_11
ASP2_B_I/1UNG_1
ASP2_B_I/1UNG_2
ASP2_B_I/1UNG_3
ASP2_B_I/1UNG_4
ASP2_B_I/1UNG_5
ASP2_B_I/1UNG_6
ASP2_B_I/1UNG_7
ASP2_B_I/1UNG_8
ASP2_B_I/1UNG_9
ASP2_A_II/1UNG_1
ASP2_A_II/1UNG_2
ASP2_A_II/1UNG_3
ASP2_A_II/1UNG_4
ASP2_A_II/1UNG_5
ASP2_A_II/1UNG_6
ASP2_A_II/1UNG_7
ASP2_A_II/1UNG_8
ASP2_B_II/1_1
ASP2_B_II/1_2
ASP2_B_II/1_3
ASP2_B_II/1_4
ASP2_B_II/1_5
ASP2_B_II/1_6
ASP2_B_II/1_7
ASP2_B_II/1_8
ASP2_B_II/1_9
ASP2_A_III/1UNG_1
ASP2_A_III/1UNG_2
ASP2_A_III/1UNG_3
ASP2_A_III/1UNG_4
ASP2_A_III/1UNG_5
ASP2_A_III/1UNG_6
ASP2_A_III/1UNG_7
ASP2_A_III/1UNG_8
ASP2_A_III/1UNG_9
ASP2_A_III/1UNG_10
ASP2_B_III/1_1
ASP2_B_III/1_2
ASP2_B_III/1_3
ASP2_B_III/1_4
ASP2_B_III/1_5
ASP2_B_III/1_6
ASP2_B_III/1_7
ASP2_B_III/1_8
ASP2_B_III/1_9
ASP2_B_III/1_10
ASP2_B_III/1_11
ASP2_B_III/1_12
ASP2_A_IV/1UNG_1
ASP2_A_IV/1UNG_2
ASP2_A_IV/1UNG_3
ASP2_A_IV/1UNG_4
ASP2_A_IV/1UNG_5
ASP2_A_IV/1UNG_6
ASP2_A_IV/1UNG_7
ASP2_A_IV/1UNG_8
ASP2_A_IV/1UNG_9
ASP2_A_IV/1UNG_10
ASP2_A_IV/1UNG_11
ASP2_B_IV/1_1
ASP2_B_IV/1_2
ASP2_B_IV/1_3
ASP2_B_IV/1_4
ASP2_B_IV/1_5
ASP2_B_IV/1_6
ASP2_B_IV/1_7
ASP2_B_IV/1_8
ASP2_B_IV/1_9

16210

16220

16230

16240

16250

16260

16270

16280

16290

16300

16310

16320

16330

16340

16350

16360

16370

16380

16390

16400

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. T. .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . T.
. . . .
. . . .
. T. .
. T. .
. . . .
. . . .
. . . .
. . . .
. . . .
T TT.
T TT.
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
CT .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. T. .
. . . .
. . . .
. . . .
. . . .
T. . .
T. . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
T. . .
. . . .
. . . .
. . T.
. . . .
. . . .

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . T.
. TT.
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
T. . .
. . T.
. . T.
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. G.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
T. .
T. .
T. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
T. .
T. .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .
. . .
. . .
. . .
. . .
T. .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . . .
TTT.
T. T.
T. T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
T.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
AA.
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. T.
TT.
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
A. .
. . .
. . .
. . .
. . .
. A.
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
. . .
. . .
. . .
. . .
. . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
A.
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
TT.
TT.

GCAA GT A CA GCAA T CA A CCCT CA A CT A T CA CA CA T CAA CT GCA A CT CCA A A GCCA CCCCT CA CCCA CT A GGA T A CCA A CAA A CCT A CCCA CCCT T A ACA GT A CA T A GT A CA T A AA GCCA T T T A CCGT A CA T A GCA CA T T ACA GT CA A AT CCCT T CT CGT CCCCA T GGA T GA CCCCCCT CA GA T A GGGGT CCCT T GA CCACCA T CCT

Anhang

247

J01415
BRU4_A_I/1_1
BRU4_A_I/1_2
BRU4_A_I/1_3
BRU4_A_I/1_4
BRU4_A_I/1_5
BRU4_A_I/1_6
BRU4_A_I/1_7
BRU4_A_I/1_8
BRU4_A_I/1_9
BRU4_A_I/1_10
BRU4_A_I/1_11
BRU4_A_I/1_12
BRU4_B_I/1_1
BRU4_B_I/1_2
BRU4_B_I/1_3
BRU4_B_I/1_4
BRU4_B_I/1_5
BRU4_B_I/1_6
BRU4_B_I/1_7
BRU4_B_I/1_8
BRU4_B_I/1_9
BRU4_B_I/1_10
BRU4_A_II/1_1
BRU4_A_II/1_2
BRU4_A_II/1_3
BRU4_A_II/1_4
BRU4_A_II/1_5
BRU4_A_II/1_6
BRU4_A_II/1_7
BRU4_A_II/1_8
BRU4_A_II/1_9
BRU4_A_II/1_10
BRU4_A_II/1_11
BRU4_A_II/1_12
BRU4_B_II/1_1
BRU4_B_II/1_2
BRU4_B_II/1_3
BRU4_B_II/1_4
BRU4_B_II/1_5
BRU4_B_II/1_6
BRU4_B_II/1_7
BRU4_B_II/1_8
BRU4_B_II/1_9
BRU4_A_III/1_1
BRU4_A_III/1_2
BRU4_A_III/1_3
BRU4_A_III/1_4
BRU4_A_III/1_5
BRU4_A_III/1_6
BRU4_A_III/1_7
BRU4_A_III/1_8
BRU4_A_III/1_9
BRU4_A_III/1_10
BRU4_A_III/1_11
BRU4_B_III/1_1
BRU4_B_III/1_2
BRU4_B_III/1_3
BRU4_B_III/1_4
BRU4_B_III/1_5
BRU4_B_III/1_6
BRU4_B_III/1_7
BRU4_B_III/1_8
BRU4_B_III/1_9
BRU4_B_III/1_10
BRU4_B_III/1_11
BRU4_B_III/1_12
BRU4_A_IV/1_1
BRU4_A_IV/1_2
BRU4_A_IV/1_3
BRU4_A_IV/1_4
BRU4_A_IV/1_5
BRU4_A_IV/1_6
BRU4_A_IV/1_7
BRU4_A_IV/1_8
BRU4_A_IV/1_9
BRU4_A_IV/1_10
BRU4_A_IV/1_11
BRU4_A_IV/1_12
BRU4_B_IV/1_1
BRU4_B_IV/1_2
BRU4_B_IV/1_3
BRU4_B_IV/1_4
BRU4_B_IV/1_5
BRU4_B_IV/1_6
BRU4_B_IV/1_7
BRU4_B_IV/1_8

16000

16010

16020

16030

16040

16050

16060

16070

16080

16090

16100

16110

16120

16130

16140

16150

16160

16170

16180

16190

16200

T A A GA T T CT AA T T T A A ACT AT T CT CT GT T CT T T CA T GGGGAA GCAGA T T T GGGT A CCA CCCAA GT AT T GACT CA CCCA T CA A CAA CCGCT A T GT A T T T CGT A CAT T A CT GCCA GCCA CCA T GA A T AT T GT A CGGT ACCA T A A AT A CT T GACCA CCT GT A GT A CAT A A AA A CCCA AT CCA CA T CA A AA CCCCCT CCCC- - - A T GCT T A C
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TTTT - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . CC- . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . CCC. . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . C. . . . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . T . - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T. - - - . . . . . . . .
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anhang

248

J01415
BRU4_A_I/1_1
BRU4_A_I/1_2
BRU4_A_I/1_3
BRU4_A_I/1_4
BRU4_A_I/1_5
BRU4_A_I/1_6
BRU4_A_I/1_7
BRU4_A_I/1_8
BRU4_A_I/1_9
BRU4_A_I/1_10
BRU4_A_I/1_11
BRU4_A_I/1_12
BRU4_B_I/1_1
BRU4_B_I/1_2
BRU4_B_I/1_3
BRU4_B_I/1_4
BRU4_B_I/1_5
BRU4_B_I/1_6
BRU4_B_I/1_7
BRU4_B_I/1_8
BRU4_B_I/1_9
BRU4_B_I/1_10
BRU4_A_II/1_1
BRU4_A_II/1_2
BRU4_A_II/1_3
BRU4_A_II/1_4
BRU4_A_II/1_5
BRU4_A_II/1_6
BRU4_A_II/1_7
BRU4_A_II/1_8
BRU4_A_II/1_9
BRU4_A_II/1_10
BRU4_A_II/1_11
BRU4_A_II/1_12
BRU4_B_II/1_1
BRU4_B_II/1_2
BRU4_B_II/1_3
BRU4_B_II/1_4
BRU4_B_II/1_5
BRU4_B_II/1_6
BRU4_B_II/1_7
BRU4_B_II/1_8
BRU4_B_II/1_9
BRU4_A_III/1_1
BRU4_A_III/1_2
BRU4_A_III/1_3
BRU4_A_III/1_4
BRU4_A_III/1_5
BRU4_A_III/1_6
BRU4_A_III/1_7
BRU4_A_III/1_8
BRU4_A_III/1_9
BRU4_A_III/1_10
BRU4_A_III/1_11
BRU4_B_III/1_1
BRU4_B_III/1_2
BRU4_B_III/1_3
BRU4_B_III/1_4
BRU4_B_III/1_5
BRU4_B_III/1_6
BRU4_B_III/1_7
BRU4_B_III/1_8
BRU4_B_III/1_9
BRU4_B_III/1_10
BRU4_B_III/1_11
BRU4_B_III/1_12
BRU4_A_IV/1_1
BRU4_A_IV/1_2
BRU4_A_IV/1_3
BRU4_A_IV/1_4
BRU4_A_IV/1_5
BRU4_A_IV/1_6
BRU4_A_IV/1_7
BRU4_A_IV/1_8
BRU4_A_IV/1_9
BRU4_A_IV/1_10
BRU4_A_IV/1_11
BRU4_A_IV/1_12
BRU4_B_IV/1_1
BRU4_B_IV/1_2
BRU4_B_IV/1_3
BRU4_B_IV/1_4
BRU4_B_IV/1_5
BRU4_B_IV/1_6
BRU4_B_IV/1_7
BRU4_B_IV/1_8

16210

16220

16230

16240

16250

16260

16270

16280

16290

16300

16310

16320

16330

16340

16350

16360

16370

16380

16390

16400

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
T.
T.
T.
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
G.
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

T.
T.
T.
T.
T.
T.
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

T.
T.
T.
T.
T.
T.
. .
. .
. .
. .
. .
T.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
G.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
- - - - - - - - - - - - - - - - - - - - -

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
-

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

. . .
. . .
TT.
TT.
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .
. . .

. .
C.
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.