DNA Markers for Diabetes and Gender Identification in Human Teeth Remains. Hossam A. Eid1 & Manae M.

Mosleh2
1 2
Oral diagnosis, oral medicine &Periodontology Dept., , faculty of Dentistry, Suez Canal University, Egypt. Division of Periodontics, Preventive Dental Sciences (PDS), College of Dentistry, KKU, Abha city, KSA. BDS, Intern Doctor, College of Dentistry, KKU, Abha city, KSA

Background: Human teeth can be considered the black box of the human body as it can preserve a sufficient amount of human DNA for further investigations in mass disasters and in criminal scene investigations. Aim of study: was to use human teeth remains to detect genes babysit mounted on chromosome Y to identify gender and also diabetics from non diabetics. Materials & methods: Forty-five teeth (23 men and 22 females), 20 patients of the whole group were diabetics ( 11 males & 9 females) average age was 37.5y collected from the college of

dentistry , KKU. All data required for the study were collected from the patient's files. Each tooth was split into two halves, then pulp tissue was collected and subjected to DNA extraction. Genes of RBM1, sY14, sY83, Sy90, CDY were amplified using the multiplex PCR. Results: Male teeth only gave five bands with different molecular weights ranged from 72 to 800 bp. While no amplicones were observed with the women DNA. The sensitivity of identifying males was 95% with false negative results of 5%, the sensitivity of identifying females was 90%. Moreover, a 301bp of insulin gene was amplified from diabetic and non diabetic persons. A mutation point was detected at the base 81 in the amino acids 48 where one nucleotide [T] substituted by [C]. A unique restriction site was observed at the base 81 in normal person when the DNA was digested using the restriction enzyme BssT1I. This mutation was found in 35% (6 out of 17) diabetic patients. Conclusion: Human teeth provide sufficient amount of DNA so its use in forensic investigation is promising. Key words: Human teeth, DNA, PCR, Diabetes, Y chromosome, Mass disaster. Corresponding author: hossam_eid73@yahoo.com

Introduction Identification of human remains in mass disasters is a difficult task and the identification of burned bodies starts with the objects that have remained with the body.
[1],[2],[3]

Teeth are

considered to be the most indestructible components of the human body, having the highest resistance to most destructive environmental effects like fire, desiccation, and decomposition[4,5]. Teeth provide a positive, personal identification of an otherwise unrecognizable body. It was realized with the correlation of dental records to observed restorations,
[6,7]

where as the

destruction of the burned victims of the third, fourth, and fifth categories is extensive, such ash remains provide small amount of DNA and may be mixed ashes so cannot be used for accurate personal identification.[4],[8] Due to the resistant nature of dental tissues and dental restorations to the changes brought by environmental extremes such as temperature and decomposition makes them an ideal source of DNA, which will be of great help in the identification of a person.
[9]

With the advent of

Polymerase Chain Reaction (PCR) technique that allows amplification of DNA at pre-selected sites the biological material extracted even from a root filled tooth will be sufficient to make a conclusion on the identity of a person. [9]. Methods used for sex determination in animals are a pre-requisite for a number of applications in animal production and forensics. However, some of the existing methods depend only on the detection of Y-chromosome specific sequences. Thus, the detection of Y- and X-chromosome specific sequences is advantageous. Sex identification using genomic DNA extracted from meat, blood, hair or embryo biopsies is sometimes an important analytical tool in forensic science or in

routine genotyping[10,11,12] . The presence of a spermatogenesis locus located at Yq11, which is named azospermia factor (AZF) locus. Recently, 15 novel genes or gene families in the human Y chromosome have been identified, some of which located within AZF intervals. [13] . In most mammals, the male is identified by amplifying the SRY gene (sex-determining region Y) which is a Y chromosome-specific sequence
[14]

. In sex identification by PCR, primers that amplify the

SRY gene together with the mitochondrial DNA control region or the ZFX/Y region have been used
[10,15]

Diabetes is a heterogeneous group of metabolic disorders characterized by hyperglycemia and a relative or absolute deficiency of insulin. A strong genetic component is particularly evident in the more common noninsulin-dependent or maturity- onset form of the disease (type II diabetes), but the nature of the underlying genetic factor or factors responsible for the disorder remains obscure
[14,15]

. Shoelson, et al.

[16]

succeed to identify three individuals with mild diabetes

associated with increased plasma insulin levels and have shown that these patients all have abnormal circulating insulin molecules that can be distinguished from each other and from normal human insulin. These abnormal insulin exhibited both impaired biological activity and reduced rates of clearance from the circulation
[17]

. In one of these cases, insulin isolated from the

patient's pancreas consisted of roughly equal proportions of normal insulin and insulin of low biological potency, having a leucine-for-phenylalanine substitution at position 25 in the B chain(16,17) . The main aim of this study is to isolate the genomic DNA from the human teeth to establish some DNA marker that may be used in human body identification in disaster conditions. Based on the previous studies in which they succeeded to distinguish between the male and female especially in animals, where the genes are completely absent in the X chromosome in the

women. Moreover, the identification of the genes inherited mutation of diseases in the obtained DNA from the examined tooth, will help in accurate personal identification specially in the burned mixed bodies ashes in mass disaster .

Materials and methods Teeth samples Forty-five teeth (different types) (23 men and 22 women) (healthy and diabetics) were collected from the college of dentistry outpatient clinic, King Khalid University, Saudi Arabia. We recorded the medical history of the patients included in the study from their dental record files. From the twenty-three male patients, there were ninety diabetics and three non diabetics. From the twenty female patients, there were eight diabetics while others were non diabetics. These information concealed until the multiplex PCR analysis was performed and then we matched the recorded patient information with the results of the DNA analysis. DNA extraction from the collected teeth Genomic DNA was extracted according to the modified method of Lucy E. Edwards et al. (1991) [18]. The tooth was split longitudinally into two halves and the nerve was crushed from each side of the tooth root canal space (fig. 1). The nerve was then transferred into eppendorf tube containing 1 ml extraction buffer (200 mM Tris, pH 7.5, 25 mM EDTA, and 0.5% SDS) (previously heated in 60C water bath) and mixed by inverting several times. The tube was heated for 60 min at 60C in a water bath with frequent adding of five l RNAase (10 mg/ ml) and the tube was incubated at 37C for 1 hr. Proteinase-K was added to a final concentration of 50 l / ml and the tube was incubated at 37C for 3 hrs. An equal volume of phenol: chloroform: isoamyl alcohol solution (25: 24: 1) was added and mixed by inverting to form an emulsion. The

emulsion was left to stand, and inversion was repeated twice, then centrifuged for 5 min at 13000 rpm at room temperature. The upper (aqueous) phase was transferred using a wide-bore pipette into a new tube without taking any precipitate from interphase. An equal volume of chloroform: isoamyl alcohol solution (24: 1) was added, mixed by inverting several times, and centrifuged for 5 min at 13000 rpm at 4C. One tenth volume of sodium acetate was added and 1.5 volume of 100% ice-cold ethanol and mixed by inverting, the tube was then placed in a -80 for one hour. The tube was centrifuged for 30 min at 13000 rpm at room temperature; the pellet was washed with cold 70% ethanol to remove salts. The DNA precipitation was done by adding an equal volume of ice-cold isopropanol then mixing by inverting. Finally, the pellet was resuspended in 0.1x TE, mixed by flicking with finger, and then stored at -20C.

Multiplex PCR and Y genes amplifications The multiplex PCR was performed according to Edward et al., 199121 to differentiate between the male and female DNA. The reaction was carried out in a total volume 25 l containing 2.5 l 10 x buffer, 2 l 25 mM MgCl2, 2 l 2.5 mM dNTPs, 2 l 10 pmol of each primer(Table 1), 1 l 100 ng of the genomic DNA and 1 l (5 units/l) Taq DNA polymerase. The PCR program was applied as following by initial denaturation at 95 C for five min.; 40 cycles of 95C for 1 min.; annealing at 63 C for one min and extension at 72 C for one min. A final extension step at 72C for 10 min. two l of loading dye was added prior to loading of 10 l of PCR products per gel slot. Electrophoresis was performed at 90 volt with 0.5 x TBE as running buffer in 2% agarose in 0.5x TBE gels and then the gel stained in 0.5 g /ml ethedium bromide solution. Finally the gel was visualized and photographed using the gel documentation system. Table 1. Primers sequence for Y chromosome fertile genes used in the study

Primer name RBM1

Primer sequence 5`-`3

CTTTGAAAACAATTCCTT TTCC TGCACTTCAGAGATACG G

Amplified segment (bp) 800

sY14

GAATATTCCCGCTCTCCG GA GCTGGTGCTCCATTCTTG AG

472

sY83

CTTGAATCAAAGAAGGC CCT CAATTTGGTTTGGCTGAC AT

275

Sy90

CAGTGCCCCATAACACTT TC ATGGTAATACAGCAGCTC GC

176

CDY

CCTCAAAATCCACTGACG CAAGCGATATCTCACCAC C

72

Insulin gene amplification by specific PCR The extracted DNA was subjected to PCR amplification us insulin gene and about 301bp were amplified with the use of the following two primers 5'- GCGGGCTGCGTCTAGTTGCAGTAG -3' (forward) and 5'- ATGGCCCTGTGGATGCGCCTCCTG -3' (reverse). PCR was performed in a reaction volume of 25 l using 25 ng genomic DNA of each sample, 25 pmol of each primer, 10X Taq DNA polymerase buffer including MgCl2, 0.2 mM dNTPs and 5 unit/ l Taq DNA polymerase (Promega Co.). Thermal cycling (Perkin Elmer 9700) was carried out by initial denaturation at 95C for 5 min, followed by 34 cycles each at 94C for 1 min, annealing

temperature at 63C for 45s, polymerization temperature at 72C for 1 min and final extension at 72C for 10 min, then the samples were held at 4C. The amplicones were separated on 2% agarose gel and the expected band was selected and subjected for further study.

Cloning Nucleotide Sequence, Sequence Analysis and Phylogenic analysis The resultant PCR product was excised from the gel and purified using a QIA quick gel extraction kit (QIAGEN Inc., Germany). Purified DNAs were ligated into the pGEM-T assay vector (Promega, USA). Plasmids containing the gene was then directly sequenced using the automated sequencer (Macrogene Company, Korea), with forward universal primer. DNA homology searches were carried out with the NCB1 data bases, using the BLAST network service http://www.ncbi.nlm.nih.gov/
[19]

Restriction Fragment Length Polymorphism (RFLP) for the amplified insulin gene The amplified insulin bands were eluted and purified from the agarose gel as mentioned above and about 50ng of the purified DNA was transferred into a new eppendrof tube. A 4 l of the 5X enzyme buffer, bout 3 U of the restriction enzyme were added to the DNA and the volume was completed using sterile H2O up to 20 l. The reaction mixture was incubated at 37C for 3 hours and the enzyme was inactivated by heating the reaction at 75C for 5 minutes. The digested DNA was separated on 2% agrose gel and visualized using the gel documentation system.

Results DNA was extracted from the tooth pulp with a considerable amount and it was enough for all experiment done in this study (Fig.1A). The PCR results shown in (Fig.1B) revealed that the

five Y genes were observed only with the men`s DNA but the women DNA didn`t show any amplicones. The molecular sizes of the amplified genes ranged from 73 to 800 bp. On the other hand, about 300bp of the human insulin genes were amplified and digested with RE BssT1I. The results presented in (Fig.1.C) revealed that the diabetic DNA was not digested with the enzyme but two fragment with molecular sizes 220 and 81 bp was obtained with normal persons. DNA sequence was performed for the PCR amplicones for both the diabetic and non diabetic DNA and the sequence analysis revealed that a point mutation was occurred at the base 81 (T-C) in Ser amino acid 48. This point mutation occurred in the phenylalanine site of this amino acids which help to convert the normal person into diabetic ones. The sequence alignment which was performed using Clustal W1.4 revealed that the similarity between the DNA nucleotide sequence of the diabetic DNA and the non diabetic are mostly identical except the base substitution which colored in green (Fig. 2).

Fig.1. A. Genomic DNA extracted from the human teeth. Lane1M: DNA/Hind III Fragments DNA marker, lane 2M: Genomic DNA from man tooth sample. Lane 3W: Genomic DNA extracted from woman tooth. B: Mltiplex PCR for four different genes positioned on the Y chromosome. Lane M: 1KB ladder DNA marker, lane 2: PCR products obtained from male DNA and lane 3 PR products amplified from woman DNA. C: Restriction digestion of the amplified insulin gene with the RE BssT1I, 1; normal insulin gene and 2; Mutated insulin gene.

Fig.2. Sequence alignment between the amplified 301 bp of the insulin gene from the DNA of normal person and diabetic one. The alignment was performed using ClustalW 1.4. According to the results of our study the accuracy of using this method in identifying the gender from human teeth was 95% (19 out of 20) of males, with false negative results 5% (1 out of 20). 18 out of 20 (90%) with false negative results 10% (2 out of 20) of females. Differentiation between diabetics and non diabetics was 42.5% (17 out of 40) which was consistent with the medical history from patient's record files with false positive results 13% (3 out of 23). From the diabetics there was a mutation in 35% (6 out of 17). While distinguishing between fertile and infertile males was 28.5% (4 out of 14) with false positive results 16.6%.(1 out of 6), false negative results 14% (2 out of 14), non fertile 30% (6 out of 20) which was consistent with the medical history from patient's record files.

Discussion

In most mammals, the male is identified by amplifying the SRY gene (sex-determining region Y) which is a Y chromosome-specific sequence
[14]

. The multiplex-PCR succeeds to differentiate

between the male and female teeth, by amplified different amplicones with different molecular sizes from the genomic DNA of both. The five examined genes are distributed along the Y chromosome; SY13 from the long arm, SY83 and SY 90 from AZFa region, RPM1 from AZFb region, CDY from the DAZ region. Furthermore, recent reports have described the use of the mitochondrial DNA because the DNA on the teeth tissues was not enough, in this study the extracted of DNA from the tooth plp was so high and enough for all the analysis required in similar analysis (13). The discovery of Y chromosome azoospermia factors (AZFs) and its deletion in infertile men, added to the knowledge of techniques that disrupt AZF homologous genes in animal models, and this has permitted the identification of many genes related to spermatogenesis. Deletions of Y chromosome genes represent an important genetic cause of idiopathic male infertility. These deletions occur as three AZFs on the euchromatic region of Yq (Yq11), named AZFa, AZFb and AZFc
[14]

. The AZF regions include genes that encode proteins implicated in male

spermatogenesis. Moreover, among these genes, DDX3Y (DEAD-box RNA helicase Y, formerly DBY) in AZFa, RBMY1 in AZFb and DAZ in AZFc are considered strong AZF candidates because they are frequently deleted in infertile men. Then they are exclusively expressed in human testes, and their homologues in other species have a role in spermatogenesis
[15]

. Another

Y chromosome genes, likely implicated in spermatogenesis but not related to microdeletions, TSPY is a candidate oncogene that, due to its limited expression pattern in germ cells, is thought to function as a proliferation factor during spermatogenesis [20,22].

Additionally, the insulin gene was amplified from the pulp extracted DNA and the amplified DNA was subjected to restriction cutting using BssT1I enzyme. Only one restriction site was observed in the gene amplified from normal persons but the diabetic DNA showed no digestion. These results supports what was obtained by Horst-Sikorska et al.
[23]

, where they identified

three individuals with mild diabetes associated with increased plasma insulin levels and have shown that these patients all have abnormal circulating insulin molecules that can be distinguished from each other and from normal human insulin. These abnormal insulin exhibited both impaired biological activity and reduced rates of clearance from the circulation. In one of these cases, insulin isolated from the patient's pancreas consisted of roughly equal proportions of normal insulin and insulin of low biological potency, having a leucine-forphenylalanine substitution at position 25 in the B chain. A similar screening approach has already been applied to the detection of the sickle cell mutation in the /3-globin gene by using the enzyme Dde 11
[15]

. The Mbo II cleavage defect also made it easier to identify the abnormal

allele of the cloned insulin gene in this patient. Indeed, an equal number of clones of the normal and abnormal alleles were obtained. The results of RFLP were consistent with the results obtained by Owerbach et al.
[25]

They found in the 5' flanking region of the insulin gene and is
(26)

composed of a tandemly repeated 14-nucleotide G+C-rich family of sequences (Bell et al.

Two main modal size distributions have been observed in the human population that are inherited in a Mendelian fashion [24]. Horst-Sikorska et al.
[23]

found that the substitution resulted in the loss of a normal restriction

enzyme cleavage site in one allele of the patient's insulin gene in the coding region for the B chain at the phenylalanine- phenylalanine sequence at positions B24 and B25. In our study the substitution occurred in the amino acid 48, Serinen-for phenylalanine substitution at position 81.

When both of the mutated and normal insulin were sequenced, the sequence alignment showed that the T base in normal insulin was substituted by C in mutated one. Nucleotide sequence analysis revealed a point mutation within the codon for phenylalanine-B24 (TTC -- TCC) in the mutant gene. No other mutation was detected within the coding region of either allele of the insulin gene when these were compared with the previously reported nucleotide sequences for the normal gene[25,26] . This single nucleotide transition results in the substitution of serine for phenylalanine at position B24, which accounts for the less hydrophobic character of the mutant insulin
[17]

. Polymorphism of the human insulin gene and its possible relationship to diabetes

have been reported [27].

Conclusion:
Human teeth can be considered the black box of human body, it provides a sufficient amount Of DNA which can be used in recognition of the personal identity, gender, as well as diabetics or non diabetics. This is will be of great value in fire accident grade IV where there is mixed ashes of the victims, teeth will be the only source available of pure, sufficient human DNA for forensic investigations.

Acknowledgement
Great appreciation to Dr. Elsayed Hafez (Assoc. Prof. of Molecular biology) as he did the part of genetic analysis in this work, also for his remarkable notes in editing of this paper. References 1. 2. 3. Moya V, Roldan B, Snchez JA. Materiales dentales en la identificacin. In: Odontologa legaly forense. Barcelona: Editorial Masson; 1994. p. 269-76. Guerra AS. Odontoestomatologia forense. In: Jurado J, editor. Santa fe de Bogot: Ecoe; Panamericane 2002. p. 1-8. Ferreira JL, Espina AL, Barrios FA, Mavarz MG. Conversation of oral and facial Structures of burned cadaver. Ciencia Odontolgica 2005;2:58-65.

4. 5. 6.

Delattre VF. Burned beyond recognition: Systematic approach to the dental identification of charred human remains. J Forensic Sci 2000;45:589-96. Rotzscher K, Grundma C, Benthaus S. The effect of high temperatures on human teeth and dentures. Int Poster J Dent Oral Med 2004;6:1-4. Norrlander AL. Burned and incinerated remains. In: Bowers CM, editor. Manual of Forensic Odontology. Colorado Springs: American Society of Forensic Odontology; 1997. p. 16-8. Robinson FG, Rueggeberg FA, Lockwood PE. Thermal stability of direct dental esthetic restorative materials at elevated temperatures. J Forensic Sci 1998;43:1163-7. Ferreira JL, Espina AL, Barrios FA. The identification of victim of slaughter of the jail of Sabaneta in forensic odontology. Rev Esp Med Leg 1998;22:50-6. ADA Council on scientific affairs. Direct and indirect restorative materials. J Am Dent Assoc 2003;134:463-72. 10. Taberlet P, Mattock H, Dubois-Paganon C, Bouvet J: Sexing free ranging brown bears (Ursos arctos) using hair found in the field. Mol Ecol 1993, 2:399-403. 11. Dias Neto E, Santos FR, Pena SD, Simpson AJ: Sex determination by low stringency PCR (LS-PCR). Nucl Acids Res 1993, 21:763-427. 12. Aasen E, Medrano JF: Amplification of the ZFY and ZFX genes for sex identification in humans, cattle, sheep and goats. Biotech 1990, 8:1279-1281. 13. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farah S, Ramos C, et al..Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet. (1996), 5:933-943. 14. Kohn M, Knauer F, Stoffella A, Schroder W, Pbo S: Conservation genetics of European brown bear-astudy using excremental PCR of nuclear and mitochondrial sequences. Mol Ecol 1995, 4:95-103. 15. Rotter, J. I. & Rimoin, D. L. Diabetes, May (1978),vol,, (27); 599-605. 16. Shoelson, S., Haneda, M., Blix, P., Nanjo, A., Sanke, T., Inouye, K., Steiner, D., Rubenstein, A. & Tager, H. Nature (London) (1983), 302, 540-543. 17. Given, B. D., Mako, M. E., Tager, H. S., Baldwin, D., Markese, J., Rubenstein, A. H., Olefsky, J., Kobayashi, M., Kolterman, & Paucher, R. N. Engl. J. Med. (1980), 302, 129-

7. 8. 9.

135. 18. Lucy E. Edwards, Peta J. Mudie and Anne de Vernal, Pliocene paleoclimatic reconstruction using dinoflagellate cycrs. Comparison of Quaternary Science Review, 1991, 10(2-3);259-274.

19. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990 Oct 5;45(3):403-10. 20. Foresta C..Y chromosome microdeletions and alterations of spermatogenesis. Endocr Rev. (2001), 22:226-239. 21. Edwards K, Johnstone C, Thompson C A simple and rapid method for the preparation of genomic plant DNA for PCR analysis. Nucleic Acids Res (1991) 19: 1349 22. Schnieders F, Dork T, Arnemann J, Vogel T, Werner M, Schmidtke J. Testis-specific protein, Y-encoded (TSPY) expression in testicular tissues. Hum Mol Genet.( 1996), 5:1801-1807. 23. Horst-Sikorska W, Zoll B, Kwiatkowska J, Willms B, Kraszewski A, Horst A, Slomski R. Prevalence of beta allele of the insulin gene in type II diabetes mellitus. Department of Endocrinology, Medical Academy, Poznan, Poland. 1994 Mar;93(3):325-8. 24. Geever, R. F., Wilsonj L. B., Nallaseth, F. S., Milner, P. F., Bittner, M. & Wilson, J. T. Proc. Nati. Acad. Sci. USA (1981), 78, 5081-5085. 25. Owerbach, D., Poulsen, S.,- Billesbolle, P. & Nerup, J. Lancet i, (1982), 870-883. 26. Bell, G. I., Selby, M. J. & Rutter, W. J. Nature (London) (1982) , 295, 31-35. 27. Ullrich, A., Dull, T. J., Gray, A., Brosius, J. & Sures, I. Science (1980), 209, 612-615.