Aberrant Phenotype and Function of Myeloid Dendritic Cells in Systemic Lupus Erythematosus

This information is current as of April 10, 2011 Dacheng Ding, Hemal Mehta, W. Joseph McCune and Mariana J. Kaplan J Immunol 2006;177;5878-5889

References

This article cites 101 articles, 38 of which can be accessed free at: http://www.jimmunol.org/content/177/9/5878.full.html#ref-list-1
Downloaded from www.jimmunol.org on April 10, 2011

Article cited in: http://www.jimmunol.org/content/177/9/5878.full.html#related-urls Subscriptions Permissions Email Alerts Information about subscribing to The Journal of Immunology is online at http://www.jimmunol.org/subscriptions Submit copyright permission requests at http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at http://www.jimmunol.org/etoc/subscriptions.shtml/

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright 2006 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

The Journal of Immunology

Aberrant Phenotype and Function of Myeloid Dendritic Cells in Systemic Lupus Erythematosus1
Dacheng Ding, Hemal Mehta, W. Joseph McCune, and Mariana J. Kaplan2
Systemic lupus erythematosus (SLE) is characterized by a systemic autoimmune response with profound and diverse T cell changes. Dendritic cells (DCs) are important orchestrators of immune responses and have an important role in the regulation of T cell function. The objective of this study was to determine whether myeloid DCs from individuals with SLE display abnormalities in phenotype and promote abnormal T cell function. Monocyte-derived DCs and freshly isolated peripheral blood myeloid DCs from lupus patients displayed an abnormal phenotype characterized by accelerated differentiation, maturation, and secretion of proinammatory cytokines. These abnormalities were characterized by higher expression of the DC differentiation marker CD1a, the maturation markers CD86, CD80, and HLA-DR, and the proinammatory cytokine IL-8. In addition, SLE patients displayed selective down-regulation of the maturation marker CD83 and had abnormal responses to maturation stimuli. These abnormalities have functional relevance, as SLE DCs were able to signicantly increase proliferation and activation of allogeneic T cells when compared with control DCs. We conclude that myeloid DCs from SLE patients display signicant changes in phenotype which promote aberrant T cell function and could contribute to the pathogenesis of SLE and organ damage. The Journal of Immunology, 2006, 177: 5878 5889. ystemic lupus erythematosus is an autoimmune disease of unclear etiology that affects multiple organs. Individuals with systemic lupus erythematosus (SLE)3 present with numerous and diverse immune system abnormalities and display a prominent imbalance in different T cell subset functions (13). Indeed, individuals with SLE have autoreactive T cells that are specic for ubiquitous self-peptides and provide pathogenic B cell help (4, 5). A pan T cell dysfunction in SLE is characterized by exaggerated CD4 T cell responses (6, 7) and diminished CD8 T cell activities (8). Other alterations include changes in proliferative T cell responses as well as increased expression of early and late T cell activation markers (3, 7, 9 11). In addition, alterations in Th1 and/or Th2 lymphocyte function have been described (1216), resulting in production of cytokines that up-regulate autoantibody production by B cells, promote immune complex formation, and increase the apoptotic load (17, 18). The exact role that accessory cells might have in inducing abnormal T cell responses in SLE is unclear; however, different groups have proposed that T cell disturbances in SLE could be induced or promoted, at least in part, by alterations in dendritic cell (DC) phenotype and function, because these are key regulators of the immune system (19 22). DCs comDepartment of Internal Medicine, Division of Rheumatology, University of Michigan, Ann Arbor, MI 48109 Received for publication June 15, 2005. Accepted for publication August 12, 2006. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by Public Health Service Grants AR050554 and AR048235 and by the Anthony S. Gramer Fund in Inammation Research (all to M.J.K.). D.D. was supported by Training Grant T32 AR 07080. W.J.M. was supported by the Herb and Carol Amster Lupus Research Fund and the Klein Lupus Research Fund. This research was also supported (in part) by the National Institutes of Health through University of Michigans Cancer Center Support Grant (P30 CA46592) and the Rheumatic Diseases Core Center Grant (P30 AR48310).

Downloaded from www.jimmunol.org on April 10, 2011

prise several subsets with different stages of maturation (20). Immature, Ag-capturing DCs sense diverse signals that induce them to undergo a maturation process, whose hallmarks are the up-regulation of the molecule CD83, as well as of a number of costimulatory and adhesion molecules, migration into lymphoid organs (23), and acquisition of the capacity to activate quiescent, naive, and memory lymphocytes (20, 24 30). DCs can induce either T cell tolerance or strong innate and adaptive immunity to specic Ag. In general, tolerance is initiated when DCs are immature, whereas the initiation of immunity requires an effective DC maturation signal. After reaching the lymph nodes, DCs present processed Ag to T cells via both classical (class I and II MHC) and nonclassical (CD1 family) pathways (24, 31, 32). In addition to their maturation status, DCs can be subdivided into a CD11c (plasmacytoid DC) and a CD11c (myeloid DC) subset (20, 33). The CD11c subset follows a myeloid differentiation pathway in which monocytes serve as precursors. These DC subsets have different migration programs and very likely have divergent roles in the induction and regulation of the immune response (33, 34) In the past few years, signicant progress has been made in elucidating the important role that IFN--producing plasmacytoid DCs have in promoting autoimmune responses in SLE (22, 35, 36). Much less is known about the role that myeloid DCs play in contributing to the pathogenesis of SLE. Indeed, it is unclear whether myeloid DCs present phenotypic and functional changes that may promote the autoimmune features of lupus and whether such differences might potentiate aberrant cognate interactions with T cells. We now report that myeloid DCs of individuals with SLE display evidence of aberrant phenotype and function which may contribute to the T cell abnormalities described in this disease.

Materials and Methods

Patient selection
Patients with SLE and rheumatoid arthritis (RA) fullled the American College of Rheumatology criteria for these diseases (3739) and were recruited from the outpatient rheumatology clinic and inpatient services at the University of Michigan, and from the Michigan Lupus Cohort (Ann Arbor, MI). Healthy controls were obtained by advertisement. SLE activity
0022-1767/06/$02.00

Address correspondence and reprint requests to Dr. Mariana J. Kaplan, Division of Rheumatology, University of Michigan, 5520 MSRBI, 1150 West Medical Center Drive, Ann Arbor, MI 48109-0680. E-mail address: makaplan@umich.edu
3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; DC, dendritic cell; RA, rheumatoid arthritis; SLEDAI, SLE disease activity index; 6-MP, 6-mercaptopurine; MMF, mycophenolate-mofetil.

Copyright 2006 by The American Association of Immunologists, Inc.

The Journal of Immunology

was assessed by the SLE disease activity index (SLEDAI) (40). Patient and control cells were paired and studied in parallel. Overall, 146 SLE patients, 76 healthy controls and 35 RA patients were studied. Information regarding the demographics, disease activity, and use of medications is provided in Table I.

5879
For uorescent microscopy, DCs were derived from monocytes as stated above. At day 7, cells were harvested, washed, and stained with the specic mAbs mentioned above to characterize DC phenotype and morphology. Cells were then xed in 1% formalin in PBS for 30 min, and transferred to a microscope slide using ProLong Antifade kit (Molecular Probes). Slides were analyzed using a Zeiss LSM 510 META Laser Scanning Microscope (Carl Zeiss Advanced Imaging Microscopy).

Reagents
Human rIL-4, TNF-, and IL-2 were purchased from PeproTech. Human GM-CSF was a gift from Berlex. rIFN-2b was obtained from Schering. X-vivo 10 serum-free medium was from BioWhittaker. LPS and PHA were purchased from Sigma-Aldrich. The following anti-human mAbs conjugated to FITC, PE, CyChrome, and allophycocyanin were used: anti-CD1a, CD3, CD4, CD8, CD11c, CD14, CD25, CD40L, CD69, CD80, CD83, CD86, HLA-DR, and isotype controls (all obtained from BD Biosciences). The pan T cell isolation kit was obtained from Miltenyi Biotec. CFSE was obtained from Molecular Probes.

Isolation and characterization of myeloid DCs from peripheral blood

PBMCs were isolated from peripheral blood of SLE patients and controls by Ficoll gradient as described above. PBMCs were incubated with two different mixtures of Abs: 1) CD11c-FITC, CD1a-allophycocyanin, CD83PE, and CD86-PE/Cy5, and 2) CD11c-FITC, CD14-allophycocyanin/Cy5, CD86-PE/Cy5 and HLA-DR-allophycocyanin. After incubation for 30 min with these Abs at 4C, cells were washed, xed in PBS/1% paraformaldehyde, and analyzed by FACS by gating the CD11c population and excluding CD14 cells.

Generation of monocyte-derived DCs

Myeloid DCs were generated from human peripheral monocytes as previously described (41). In brief, human PBMC were separated by standard density gradient centrifugation on Ficoll-Hypaque Plus (Amersham Biosciences) and resuspended at 6 106 cells/ml in RPMI 1640 with Lglutamine and 10% FBS. The cells were transferred to tissue culture plates and allowed to adhere to the plastic surface for 1 h at 37C. Nonadherent cells were then removed by washing with PBS. Monocyte recovery rate after adherence was 89% in both healthy controls and SLE patients. The adhered monocytes were further cultured for 57 days in DC induction medium (serum-free X-vivo-10 containing 20 ng/ml GM-CSF and 510 ng/ml IL-4). In some experiments, cells were further puried using metrizamide gradient (Sigma-Aldrich). The purity of myeloid DCs obtained under our experimental conditions was 90%, as conrmed by ow cytometric analysis (data not shown). At days 57, cells were harvested for analysis or stimulated with DC maturation stimuli (41) (0.52 g/ml LPS and/or 10 100 ng/ml TNF-) for 48 h. In additional experiments, freshly isolated monocytes were cultured for 7 days with GM-CSF, with or without IL-4, in the presence or absence of 100 or 1000 U of rIFN-.

Drug treatment
Monocytes were cultured as stated above to induce DC differentiation, in the presence or absence of graded concentrations of indomethacin (0.011 g/ml), hydroxychloroquine (0.022 g/ml), hydrocortisone (0.011 M), 6-mercaptopurine (6-MP) (0.011 M) and mycophenolate-mofetil (MMF) (0.04 4 g/ml; all obtained from Sigma-Aldrich) or vehicle (42 46). A stock solution of 6-MP was prepared in dimethylformamide at a concentration of 10 mg/ml. The stock solution was diluted in assay diluent (80% culture medium/20% ethanol) to yield a 6-MP working solution of 80 g/ml or less as indicated. The working solution of 6-MP as well as the other materials prepared in assay diluent were then further diluted 1/40 into the cell cultures for the tests. The nal concentrations of ethanol (0.1%) or dimethylformamide (0.02%) do not yield signicant effects on the cell cultures (11, 47). Indomethacin was prepared in a concentration of 500 mM in absolute ethanol, then diluted to nal concentrations in the cell culture medium (11). Control cells were treated with an equal volume of the solvent. MMF was prepared as previously described (43). At day 7, DCs were washed and analyzed by ow cytometry for expression of differentiation (CD1a) and maturation (CD83, CD86, HLA-DR) markers.

Downloaded from www.jimmunol.org on April 10, 2011

Immunouorescence staining, FACS, and uorescent microscopy analysis

DCs were washed with PBS/0.2% BSA and FcRs were blocked by incubating cells for 20 min in PBS with 40% control human sera or with anti-Fc Ab (Miltenyi Biotec). Cells were then incubated for 30 min at 4C with 0.06 0.15 g/ml uorochrome-conjugated mAb following the manufacturers directions. Cells were washed three times with PBS/0.2% BSA, xed in 1% paraformaldehyde and analyzed in a FACSCalibur ow cytometer (BD Biosciences), using previously described protocols. Data analysis was performed using Lysys II software (BD Biosciences) and WinMDI 2.8 software (http://facs.scripps.edu). Stained cells were gated by side scatter and forward scatter characteristics and further identied by surface markers. The results were expressed as the percentage of cells staining positive for different markers as well as by mean channel uorescence. The cutoff point for positive staining was above the level of the control isotype Abs.

RNA extraction and quantitative real-time RT-PCR

Total RNA was isolated from myeloid DCs using the RNeasy kit with DNase I digestion (Qiagen) to remove possible genomic DNA contamination, and reverse transcribed to cDNA using the SuperScript III rst-strand synthesis system (Invitrogen Life Technologies) with Oligo(dT)30 primer. For real-time detection of target and reference gene expression, eight pair primers and probes were designed as follows: 83 forward (F): 5-CTG CTCCTGAGCTGCGCCTACA; CD83 reverse (R): 5-CACCACCCTC CAATAACTTGAC; CD83 probe: 5-ATCCGCAGGTTCCCTACACGGT CTCC; CD80 F: 5-CTTCAACTGGAATACAACCAAGCA; CD80 R: 5TGCATCTTGGGGCAAAGCAGTA; CD80 probe: 5-CTCCCATCCTG GGCCATTACCTTAATC; CD1a F: 5-GTCCTCTACTGGGAGCATC ACA; CD1a R: 5-GTCTTAACAGAAACAGCGTTTCC; CD1a probe:

Table I. Demographic and clinical characteristics of human subjects studied

Variable Lupus Control RA

Number studied Age(mean range) Females n (%) Males n (%) Lupus disease activity (mean SEM) SLEDAI 2 (%) SLEDAI 2 (%) Medications Antimalarials (%) Azathioprine (%) Cyclophosphamide (%) Methotrexate (%) Mycophenolate mofetil (%) Prednisone (0.5 mg/kg/day) (%) Prednisone (0.51 mg/kg/day) (%) Prednisone (1 mg/kg/day) (%)

146 44.5 11.5 130 (89) 16 (11) 4.5 3 77 69 68.5 5.47 1.36 1.36 24.65 34.2 9.5 4.1

76 37 13.5 55 (72.3) 21 (27.6)

35 51 14.4 18 (51.5) 17 (48.5)

40.5 0 0 51.4 0 51.4 5.7 8.5

5880
5-CTTGGCGGTGATAGTGCCTTTACTTCTT; CD86 F: 5-GACAG GCATTTGTGACAGCACTA; CD86 R: 5-TCT GCA GTC TCA TTG AAA TAA GC; CD86 probe: 5-TTCCTGCTCTCTGGTGCTGCTCCTCT; CD14 F: 5-GGTGCCGCTGTGTAGAAAGAAGC; CD14 R: 5-GGT TCTGGCGTGGTCGCAGAGAC; CD14 probe: 5-TTATCGACCATG GAGCGCGCGT; DRa F: 5-TCAAGGTGCATTGGCCAACATAG; DRa R: 5-CTCTCAGTTCCACAGGGCTGTTC; DRa probe: 5-CGATCAC CAATGTACCTCCAGAG; PBGD-F 5-GGCAATGCGGCTGCAA-3; PBGD-R 5-GGGTACCCACGCGAATCAC-3; PBGD probe 5-CTCA TCTTTGGGCTGTTTTCTTCCGCC; -actin F: 5-AGCCTTCCTTC CTGGGCATGGA; -actin R: 5-CTCAGGAGGAGCAATGATCTTGA; -actin probe: 5-ACATCCGCAAAGACCTGTACGCCAACA. Probes were labeled with 5-6-FAM/3-TAMRA (Integrated DNA Technologies). HotStar Taq polymerase (Qiagen) was used. PCR was performed using MyCycler Thermal Cycler (Bio-Rad) in a total reaction mixture of 20 l containing 50 ng of cDNA, 1 HotStar TaqPCR buffer, and 400 nM probe/primers mixture. After denaturation at 95C for 15 min, 55 cycles were performed at 95C for 15 s, followed by 60C for 1 min. Comparative cycle threshold method with PCR efciency correction, also known as Pfafs method, was used for quantication, as previously described (48). The expression levels of the target genes were adjusted to the expression levels of the housekeeping genes PBGD and -actin.

ABNORMAL PHENOTYPE AND FUNCTION OF LUPUS DCs Statistical analysis

The difference between means was analyzed using paired t test or one-way ANOVA with post hoc analysis and Bonferroni correction. Spearman and Pearsons correlation were used to assess correlation between different variables. Analyses were performed with SPSS version 11.5. A value of p 0.05 was considered to be statistically signicant.

Results
Myeloid lupus DCs display abnormal levels of differentiation and maturation markers and have abnormal responses to maturation stimuli Conrming a previous study (54), no morphologic differences in the capacity of monocytes to differentiate into DCs were found between SLE and controls, using light and uorescent microscopy (Fig. 1). After 57 days of culture, DCs from SLE patients and healthy controls were found to be increased in size and developed typical dendrites. To assess whether DCs from SLE individuals and controls differ in their differentiation and maturation potentials, monocyte-derived DCs from 31 individuals with SLE, 8 patients with RA, and 20 healthy controls obtained at day 7 were stained with anti-human Abs to CD1a (to evaluate DC differentiation) (31) and CD83 (a marker of DC maturation) (55), and expression of these markers was measured by FACS. As shown in Fig. 2, AC, SLE patients, have increased numbers of cells expressing the differentiation marker CD1a, and decreased numbers of cells expressing the maturation marker CD83 ( p 0.05). No

Cytokine determination
Cytokines were measured using two different methods. The human cytokines IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12p70, IL-13, IFN-, GM-CSF, and TNF- were simultaneously quantied in duplicate using the human cytokine multiplex kit (Linco Research). Supernatants obtained from day 7 (unstimulated DCs) or day 9 (DCs treated with maturation stimuli for 48 h) cultures were aliquoted and stored at 80C until used. Sera from the same patients were also stored. Cytokine concentrations were determined following manufacturers instructions. In brief, standards and samples were added into the appropriate wells. Mixed beads were added to each well and the plate was incubated with agitation for 1 h at room temperature. Plate was washed and a detection Ab mixture was added to each well and incubated for 30 min at room temperature. Streptavidin-PE was added to each well containing the detection Ab mixture. The plate was then incubated with agitation on a plate shaker for 30 min at room temperature, washed, and sheath uid was added for 5 min. Plate was read on Luminex 100 (Luminex) and the concentration reported as picograms per milliliter. In addition, the BD CBA Human Inammation kit (BD Biosciences) was used to quantitatively measure IL-8, IL-1, IL-6, IL-10, TNF-, and IL-12p70 protein levels in sera and supernatant samples, following manufacturers instructions. In brief, mixed capture beads were added to assay tubes. Human inammation standard dilutions and test samples were added to the assay tubes. Samples were incubated for 1.5 h at room temperature and protected from direct exposure to light. Wash buffer was added and tubes were centrifuged at 200 g for 5 min. Supernatants were discarded leaving 100 l of liquid in each assay tube. Human inammation PE detection reagent was added to the tubes and samples were incubated for 1.5 h at room temperature, washed, and analyzed by FACS using BD Cytometric Bead Array Software.

Downloaded from www.jimmunol.org on April 10, 2011

T cell proliferation and determination of T cell activation

T cells were isolated by negative selection using magnetic beads and instructions provided by the manufacturer (pan T cell isolation kit; Miltenyi Biotec). Purity was 95%, as assessed by CD3 expression. T cell proliferation was analyzed using the intracellular uorescent dye CFSE. With each cell division, the CFSE uorescence intensity of the cells is reduced by half (49 51). T cells from healthy controls were labeled with 2 M CFSE in RPMI 1640/10% FBS for 2 min at room temperature. After washing to remove unbound uorescent dye, 4 106 T cells were cocultured with allogeneic DCs from SLE or healthy controls. Conditions included unstimulated DCs or DCs stimulated with LPS and TNF- for 48 h, as described above. Cells were cocultured at a T cell:DC ratio of 5:1 to 10:1. After 1 and 5 days, cells were harvested and stained with mouse antihuman CD3-allophycocyanin/Cy7, CD11c-PE, and CD25-CyChrome, then xed with 2% formaldehyde/PBS and analyzed by FACSCalibur, using CellQuest software (BD Biosciences) and WinMDI. In additional experiments, expression of additional activation markers (CD69 and CD40L) was measured on these T cells. Expression was measured 24 h and 5 days after cocultures were started. Proliferation of T cells was analyzed by the logarithmic reduction of CFSE staining of CD3-positive cells. The percentage of T cells that had undergone specic numbers of cell divisions (G1G5) or no cell divisions (G0) was calculated (52, 53). Controls included PHAstimulated T cells and unstimulated T cells.

FIGURE 1. Monocyte-derived DCs from SLE patients display normal morphology. A, Images represent different magnications of cells from one individual with SLE, after culture in X-vivo medium with IL-4 and GMCSF for 7 days. Cells display the characteristic membrane and nuclear features of DCs. Arrows point at the cells that are displayed at higher magnication on the left panels. B, Fluorescent microscopy image of one cell from a patient with SLE that displays the classic morphology DCs, at day 7 in culture. The cell expresses both CD1a and CD83.

The Journal of Immunology

5881

Downloaded from www.jimmunol.org on April 10, 2011

FIGURE 2. Aberrant expression of differentiation and maturation markers in monocyte-derived DCs in SLE. Bar graph represents A, CD1a, and B, CD83 percent expression, in 20 healthy controls, 8 RA patients, and 31 SLE patients. , p 0.05, results represent mean SEM of independent experiments. C, A representative density plot of CD83 and CD1a expression from one control and one SLE patient. D, Bar graphs represent CD1a, CD14, and CD83 mRNA expression by real-time RT-PCR relative to housekeeping genes in day 7 DCs from 7 healthy controls, 22 SLE, and 7 RA patients. Results are reported as the fold change compared with healthy controls. , p 0.05, results represent mean SEM of independent experiments.

signicant differences were observed in mean uorescence intensity (data not shown). No signicant differences were detected between RA patients and controls in CD1a expression (Fig. 2A) or CD83 expression (Fig. 2B). The differences between SLE and controls were conrmed at the mRNA level by real-time RT-PCR (Fig. 2D). Indeed, lupus patients (but not RA patients) displayed signicantly decreased mRNA levels of the monocyte marker CD14 and higher levels of CD1a mRNA at day 7, suggesting an

acceleration of the differentiation from the monocyte stage to the myeloid DC stage (Fig. 2D). Baseline CD14 levels in monocytes did no differ between controls and lupus patients (data not shown), suggesting that the differences seen on day 7 DCs were the consequence of accelerated differentiation from the monocyte to the DC stage and not due to baseline down-regulation of CD14 on lupus monocytes. Interestingly, while CD83 protein and mRNA levels were signicantly lower in lupus DCs at day 7 (Fig. 2, BD),

5882 mRNA levels of other specic maturation and differentiation markers (CD86, CD80, and HLA-DR) were signicantly higher in SLE than in healthy controls in the absence of exogenous maturation stimuli (Fig. 3A). These ndings were conrmed at the protein level (Fig. 3, B and C), both as numbers of cells expressing these markers (data not shown) and as mean uorescent intensity in each cell. When compared with healthy controls, there were no differences in the expression of maturation markers in RA patients (Fig. 3). These results indicate that differentiation and maturation are enhanced in monocytederived DCs from SLE patients, but that the maturation marker CD83 is selectively down-regulated in lupus DCs. We considered the possibility that an in vivo serum effect could induce early responses in monocytes that would lead/promote the observed differences in maturation. However, when we treated lupus and healthy control monocytes with autologous sera, no differences were found between control and SLE sera on the induction of expression of specic maturation markers (CD80: 11.5 4.6% for untreated control DCs; 10.5 4.1% for control DCs treated with autologous sera; 32.6 11.2% for untreated lupus

ABNORMAL PHENOTYPE AND FUNCTION OF LUPUS DCs DCs and 34.2 12% for lupus DCs treated with autologous sera. CD83: 28.2 11.1% for untreated control DCs; 5.35 0.8% for control DCs treated with sera; 14.5 2% for untreated lupus DCs and 2 0.1 for lupus DCs treated with autologous serum, p NS when comparing lupus vs control sera; results represent mean SEM of three SLE patients and four healthy controls). These results suggest that the differences found on maturation markers were intrinsic to lupus monocyte derived-DCs, rather than an exogenous effect secondary to a serum factor or to serum withdrawal. Furthermore, when we cultured lupus monocytes in GM-CSF and IL-4 in the presence or absence of IFN-, there were no signicant differences in the expression of CD83 between IFN-treated or untreated cells, suggesting that adding this cytokine did not alter the phenotypic abnormalities seen in SLE DCs (CD83: 39 10% in IL-4 GM-CSF; 30 5% in IL-4 GM-CSF 100 U of IFN-; 30 4.4% in IL-4 GM-CSF 1000 U IFN-; results represent mean SEM of eight independent experiments, p 0.05). Similarly, when lupus monocytes were cultured in GM-CSF without IL-4 but in the presence of IFN-, this combination of cytokines did not result in changes in CD83 expression (10 4% in GM-CSF alone; 15 5% in GM-CSF 100 U of IFN-; 19 5% in GMCSF 1000 U of IFN-; results represent mean SEM of eight independent experiments; p 0.05 between all conditions). To exclude the possibility that medications could account for the differences in expression of differentiation and maturation markers between controls and SLE patients, monocytes were treated with graded concentrations of drugs commonly used in the management of SLE, including hydrocortisone (for steroids), indomethacin (for nonsteroidal anti-inammatory drugs), chloroquine (for antimalarials), 6-MP (for azathioprine), and MMF, while these cells were being differentiated into DCs in vitro. At doses equivalent to the ones used to treat SLE patients, we did not nd any signicant changes in the expression of differentiation and maturation markers induced by these drugs (Table II). Further, there were no signicant correlations between the use of specic immunosuppressive drugs by SLE patients and the phenotypic differences found in SLE DCs (Table III). Abnormal differentiation and maturation correlated with specic lupus clinical and serologic manifestations. Indeed, decreased CD83 expression in DCs correlated signicantly with current or previous evidence of lupus nephritis, and with levels of antidsDNA Abs. Increased CD1a expression in lupus DCs correlated with decreased levels of complement (dened as C3 levels 83 mg/dl and/or C4 levels 13 mg/dl) (Fig. 4B). These correlations were seen both at the protein (Fig. 4) and mRNA level ( p 0.05 for same variables). Increased levels of CD80 at the protein level correlated with hemologic manifestations of SLE (leucopenia and immune-mediated thrombocytopenia) (r 0.49, p 0.02) and levels of anti-dsDNA Abs (r 0.46, p 0.03), and negatively correlated with skin manifestations of SLE (r 0.59, p 0.004). Increased levels of CD86 at the protein level strongly correlated with disease activity (SLEDAI) (r 0.74, p 0.001) and with previous or current lupus nephritis (r 0.45, p 0.04). The correlations between CD80 and CD86 with these specic clinical variables were also conrmed at the mRNA level (data not shown). To establish whether DCs from individuals with SLE normally up-regulate maturation markers in response to maturation stimuli, we proceeded to treat day 7 monocyte-derived DCs with LPS and/or TNF- for 48 h. As show in Fig. 5C, lupus DCs signicantly up-regulate mRNA of the maturation markers CD86, CD80, and CD83. However, when compared with healthy controls, the degree of up-regulation for CD80 and CD86 was blunted in the lupus group both at the protein and mRNA level ( p 0.05) (Fig. 5), using either LPS and/or TNF- as maturation stimuli. These experiments suggest that lupus DCs have the capacity to respond

Downloaded from www.jimmunol.org on April 10, 2011

FIGURE 3. Increased expression of maturation markers in lupus DCs. A, Bar graphs represent mRNA expression of different maturation markers relative to housekeeping genes by real-time RT-PCR in day 7 DCs from 7 healthy controls, 22 SLE patients, and 7 RA patients. Results are reported as the fold change compared with healthy controls. , p 0.05, results represent mean SEM of independent experiments. B, Bar graphs compare CD86 mean uorescent intensity in day 7 DCs from 8 healthy controls, 5 RA patients, and 24 SLE patients. Representative histogram displays expression of CD86 on day 7 myeloid DCs from one healthy control, one RA patient, and one SLE patient. C, Bar graphs compare CD80 mean uorescent intensity in day 7 DCs from 8 healthy controls, 5 RA patients, and 24 SLE patients. Representative histogram displays expression of CD80 on day 7 myeloid DCs from 1 healthy control, 1 RA patient, and 1 SLE patient. , p 0.05, results represent mean SEM of independent experiments.

The Journal of Immunology

Table II. Expression of maturation and differentiation markers on day 7 monocyte-derived DCs, after in vitro drug treatmenta
CD1a CD83 CD86 CD80

5883

Untreated HC 0.01 M HC 0.1 M HC 1 M 6-MP 0.01 M 6-MP 0.1 M 6-MP 1 M INDO 0.01 g/ml INDO 0.1 g/ml INDO 1 g/ml MMF 0.04 g/ml MMF 0.4 g/ml MMF 4 g/ml HCQ 0.02 g/ml HCQ 0.2 g/ml HCQ 2 g/ml

18.08 6.5 19.08 1.76 24 5.01 31 9 10.25 0.2 13.3 0.25 14.8 0.9 10.6 5.6 14.6 0.52 15.5 1.4 14 8.5 10.7 5.7 18 3.5 13.5 7.1 6.9 2.85 3.44 1.4

24.86 0.27 39.9 9.6 27.1 4.2 26.06 6.7 33.5 2.7 27.2 4.2 35.4 4.9 34.4 0.08 35.2 1 35.6 6.5 30.9 8.3 32 11.5 37 18.4 28 10.5 31 8.3 28.7 11.6

34 1.67 36.7 0.07 28 10.47 26.5 3.2 46.7 3.45 36.6 0.075 47 3.5 33.5 1.7 35 16.22 32.3 16.2 51 0.5 51 11 41 2.05 51 .3 57 11.2 51 6

89.2 0.4 84 0.3 82.5 0.5 83.2 2 84.4 0.9 82.2 0.8 84.1 3 83 9 77.8 5 77 6 92 5 93 2.8 94 3 89 2 93 3 91 1.1

a HC, Hydrocortisone; 6-MP, 6-mercaptopurine; INDO, Indomethacin; MMF, mycophenolate mofetil; HCQ, hydroxychloroquine. Vehicle results did not differ from results from untreated cells. Values represent mean SEM of three independent experiments and all values are p 0.05 when compared to untreated cells.

to maturation stimuli, as shown by up-regulation of maturation markers; however, the level of up-regulation of these markers is decreased when compared with healthy controls. When compared with healthy controls, there were no statistical differences in the capacity of RA DCs to up-regulate maturation markers after exposure to exogenous maturation stimuli (Fig. 5, A and B). To exclude the possibility that abnormal differentiation and maturation observed in SLE DCs were consequences of the in vitro conditions used, the expression of maturation and differentiation markers in myeloid DCs directly obtained from peripheral blood was examined. As shown in Fig. 6A, the myeloid DC population obtained directly from lupus blood is also characterized by higher numbers of CD1a cells, lower numbers of CD83 cells and higher expression of CD86 cells when compared with healthy controls, further conrming our in vitro ndings. In addition, high levels of CD1a cells signicantly correlated with levels of antidsDNA Abs (Fig. 6B) and with hypocomplementemia ( p 0.004). Furthermore, similar to what we found in DCs generated in vitro, there were no signicant correlations between the use of specic immunosuppressive drugs and phenotypic abnormalities seen in lupus DCs isolated from peripheral blood (data not shown). Lupus DCs secrete higher levels of IL-8 To evaluate whether SLE DCs show differential secretion of cytokines, we measured the secretion of a number of cytokines using cytometric bead array and a cytokine multiplex kit array. Control, RA, and SLE DCs secrete detectable amounts of IL-6, IL-7, IL-8, IL-10, IL-13, IFN-, and TNF-. The cytokine secreted at the highest levels was the proinammatory cytokine IL-8, and lupus DCs secreted signicantly higher levels of IL-8 than control DCs both before (5459.2 813.7 vs 2137.9 759.3 pg/ml, respectively, mean SEM, p 0.05) and after TNF- stimulation

(8760.6 1048.6 vs 4817.2 689.4, respectively, mean SEM, p 0.05) (Fig. 7A). Levels of IL-8 secreted by lupus DCs correlated with expression of the maturation marker CD80 (r 0.56, p 0.01, Pearsons correlation), and patients with higher production of IL-8 had higher anti-dsDNA (Fig. 7B) and anti-cardiolipin levels in sera (r 0.53, p 0.007 and r 0.45, p 0.02, respectively, Pearsons correlation). When compared with healthy controls, there were no signicant increases in IL-8 secretion by DCs from RA patients (Fig. 7B). No signicant differences between control, SLE, and RA patients were observed when the other cytokines were measured in DC supernatants (data not shown). Of interest, IL-8 was also the most abundant cytokine detected in plasma from SLE patients and serum levels were higher than in healthy controls, although no statistical signicance was found (57.9 vs 36.3 pg/ml, P NS). Lupus DCs up-regulate T cell proliferation and activation Unstimulated and stimulated DCs from lupus patients induced a signicant increase in allogeneic T cell proliferation when compared with DCs from healthy controls. As expected, unstimulated DCs from healthy controls were poor stimulators of allogeneic T cell proliferation and, after stimulation with maturation stimuli, their capacity to induce allogeneic T cell proliferation increased signicantly. When cocultured with lupus DCs, allogeneic T cells showed a signicantly higher percentage of proliferating cells than what was observed with control allogeneic DCs, and the effect was more pronounced in DCs treated with maturation stimuli (LPS and TNF-) (Fig. 8, A and B). This increase in proliferation required cell-cell interactions, as supernatants from lupus DCs did not induce similar increases in T cell proliferation (data not shown). Similarly, there was a statistically signicant increase in the expression of the activation marker CD40L in allogeneic T cells

Downloaded from www.jimmunol.org on April 10, 2011

Table III. Correlation analysis of specic immunosuppressive/immunomodulator use and expression of differentiation and maturation markers in lupus DCsa
Corticosteroids Antimalarials Azathioprine Mycophenolate

CD1a CD83 CD86 CD80 IL-8

a

p 0.24 (0.28) p 0.77 (0.07) p 0.14 (0.31) p 0.65 (0.11) p 0.42 (0.20)

p 0.50 (0.16) p 0.12 (0.37) p 0.99 (0.0002) p 0.96 (0.009) p 0.30 (0.26)

p 0.63 (0.121) p 0.29 (0.262) p 0.71 (0.08) p 0.47 (0.18) p 0.30 (0.18)

p 0.46 (0.15) p 0.16 (0.24) p 0.47 (0.17) p 0.24 (0.27) p 0.52 (0.16)

Results represent p value (r ), using Spearman correlation. Negative numbers indicate a negative correlation. All p values were 0.05.

5884

ABNORMAL PHENOTYPE AND FUNCTION OF LUPUS DCs

FIGURE 4. Aberrant differentiation and maturation in SLE correlate with clinical and serologic features of lupus. A, Correlation of a low percent of CD83-positive day 7 DCs, with past or current lupus nephritis and with levels of anti-dsDNA Abs. B, Correlation of an increased percent of CD1a-positive day 7 DCs with serum complement levels; , p 0.05, mean SEM of independent experiments. Similar correlations were seen at the mRNA level.

Downloaded from www.jimmunol.org on April 10, 2011

when they were cocultured for 24 h with either unstimulated or stimulated lupus DCs, as compared with DCs from healthy controls (Fig. 8C). An increase in the percentage of cells that coexpress CD25 and CD40L in allogeneic T cells was also observed after these cells were cocultured with either unstimulated or stimulated lupus DCs for 5 days, as compared with unstimulated or stimulated DCs from healthy controls (percent of CD25CD40L T cells: 2.4 1% with unstimulated control DCs were added; 5.8 2.1% when unstimulated lupus DCs were added; 4.8 1.2% when stimulated control DCs were added;. 10.8 3% when stimulated lupus DCs were added; p 0.05 between control and lupus cells for both conditions; results represent mean SEM of independent experiments using ve controls and 11 SLE patients). No signicant differences were seen for the early T cell activation marker CD69 between control and lupus DCs (data not shown). As expected, DCs treated with maturation stimuli were more effective at inducing allogeneic T cell activation (Fig. 8).

Discussion
This study establishes that myeloid DCs from individuals with SLE display distinct phenotypic and functional differences characteristic of proinammatory DCs and promote abnormal T cell responses. These phenotypic changes are characterized by accelerated differentiation from the monocyte to the myeloid DC stage (as measured by increased expression of the DC differentiation marker CD1a), up-regulation of different costimulatory molecules which are involved in T cell priming, even in the absence of exogenous maturation stimuli; and increased production of the proinammatory cytokine IL-8. In addition, myeloid DCs from SLE patients display a selective downregulation of the maturation marker CD83. These abnormalities were seen not only on in vitro-derived DCs, but also in DCs obtained from peripheral blood, indicating that this phenomenon is not the consequence of added cytokines in vitro or a serum withdrawal effect but likely represent true abnormalities on the differentiation/maturation pathways of myeloid DCs in vivo.

These phenotypic differences correlate with specic clinical and serologic manifestations of the disease. Because the population studied was fairly well-controlled, with an SLEDAI of 4.5 3 (mean SEM), the results of this study suggest that the abnormalities observed in SLE DCs are not merely the result of active disease but might have pathogenic signicance. Further, these phenotypic differences in lupus DCs likely have functional relevance, as both unstimulated and stimulated myeloid DCs from lupus patients induce signicant increases in allogeneic T cell proliferation and activation, when compared with healthy controls. Immature DCs are known to have a low T cell activation potential (20) and this promotion of T cell proliferation and activation is likely the consequence of an increased mature phenotype. Accelerated differentiation from the monocyte (or potentially other myeloid precursors) to the DC stage, and up-regulation of maturation markers could promote and enhance the capabilities of lupus DCs to prime and activate T cells in the spleen and other lymphoid organs, further contributing to the T cell hyperresponsiveness and enhanced activation described in SLE. Supporting this idea, a recent study reported up-regulation of CD11bCD11c DCs in the thymus and spleen in aged BWF1 lupus-prone mice (56), suggesting accelerated migration to these organs. Studies in humans have also shown that myeloid and plasmacytoid DCs are markedly decreased in SLE blood and it has been speculated, although not proven, that this might reect an accelerated migration of these cells from the blood into tissues (22, 57). Certainly, the up-regulation of CD86 and other maturation markers in DCs would support the possibility that a mature DC phenotype would be associated to increased migration to lymphoid organs of SLE DCs and stimulation and priming of T cells in these organs. DCs can induce either T cell tolerance or strong innate and adaptive immunity to specic Ag. In general, tolerance is initiated when DCs are immature, whereas the initiation of immunity requires an effective DC maturation signal. Therefore, accelerated DC maturation in SLE in the absence of extrinsic danger signals suggests that these cells can become very

The Journal of Immunology

5885

Downloaded from www.jimmunol.org on April 10, 2011

FIGURE 6. Aberrant expression of differentiation and maturation markers in lupus myeloid DCs obtained from peripheral blood. A, Bar graphs display expression of DC differentiation and maturation markers in freshly isolated CD11c cells from peripheral blood, in 11 healthy controls and 24 SLE patients. B, Bar graphs display correlation of anti-dsDNA Abs with CD1a DCs in peripheral blood. , p 0.05, results represent the mean SEM of independent experiments.

FIGURE 5. Responses of monocyte-derived DCs to maturation stimuli are abnormal in lupus DCs. A, Bar graphs display mean uorescence intensity of CD86 in DCs from 10 healthy controls, 5 RA patients, and 20 SLE patients before and after stimulation with TNF-. B, Representative histograms of CD86 expression on DCs from 1 healthy control, 1 patient with SLE, and 1 patient with RA before and after stimulation with LPS and TNF-. C, Bar graphs display mRNA expression by real-time RT-PCR of differentiation and maturation markers normalized to housekeeping genes in DCs, after stimulation with LPS and TNF- in 6 healthy controls and 17 SLE patients. Results are reported as the fold change when compared with unstimulated day 7 DCs. , p 0.05 when compared before and after stimulation; results are presented as mean SEM.

efcient autoantigen-presenting cells and drive autoimmune responses. In addition, the role of costimulatory molecules is well documented in murine models of lupus, including the observation that treatment with a combination of blocking mAbs to CD80 and CD86, before the onset of murine lupus, signicantly improves survival and severity of the disease (58, 59). Given that mature myeloid DCs are able to break tolerance and induce lupus autoantibodies in normal hosts (60), the increase in DC maturation in SLE suggests that these abnormalities might be very relevant in the induction and perpetuation of autoimmunity in SLE. Increased secretion of IL-8 by lupus DCs could potentially contribute to tissue damage, as this cytokine has been proposed to play an important role in the development of lupus nephritis (61 64)

and has been found to be elevated in lupus patients with CNS involvement (65). IL-8 is produced by numerous cell types, including monocytes/macrophages and DCs (64, 66, 67). IL-8 is mainly active on neutrophils, promoting their recruitment and also their strong activation which triggers the leukotriene pathway, induces the release of their granular content, elastase and lactoferrin and increases their adherence to endothelial cells (68 71). In fact, migration of neutrophils is inuenced by DCs primarily by IL-8 (64). IL-8 is also a chemoattractant for other cell types including T cells (72). In addition, we found a signicant association between IL-8 secretion and serum levels of anti-dsDNA. Anti-dsDNA can enhance the release of proinammatory cytokines, including IL-8 and TNF- from mononuclear cells to augment inammatory reactions and can polarize the immune reaction toward the Th2 pathway (7274). Therefore, an increase in the production of this cytokine by DCs might enhance the ability to recruit cells in the glomerulus and enhance neutrophil adhesion to vascular endothelium which in turn may contribute to renal and vascular damage. Interestingly, a recent study has shown that the IL-8 gene and its receptor CXCR-2 are up-regulated in PBMCs from SLE patients using microarrays (75). The functional relevance of decreased levels of CD83 in SLE is unclear at this point. CD83 is a cell surface membrane glycoprotein whose surface expression is largely restricted to DCs (55). The precise functions of this molecule remain unknown (76, 77), but CD83 may serve important roles during intercellular interactions (7779), as membrane-bound CD83 increases the stimulatory capacity of DCs (79). Further, previous studies suggest that CD83 mediates adhesion to monocytes and CD8 T cells (80). CD83-Ig enhances T cell proliferation and increases the proportion of CD8 T cells (80), and engagement of CD83 delivers a signicant signal

5886

ABNORMAL PHENOTYPE AND FUNCTION OF LUPUS DCs creasing IL-8 secretion and enhancing T cell proliferative and activation responses. However, the up-regulation of some of the membranebound maturation markers was blunted when compared with the degree of up-regulation seen in healthy controls. It is possible that the preactivation status of lupus DCs, as conrmed by the overexpression of maturation markers even before maturation stimuli, makes the lupus cells more refractory to further up-regulation of cell surface maturation markers. Lupus DCs treated with maturation stimuli did become more efcient at inducing allogeneic T cell proliferation, T cell activation and cytokine secretion, than untreated lupus DCs. Although we cannot entirely exclude the possibility that immunosuppressive drugs could play a role in the phenotypic and functional differences of lupus myeloid DCs, correlation analysis did not show an association between expression of specic differentiation and maturation markers and secreted cytokines with different medications used by SLE patients. Further, when we treated monocytes with drugs commonly used to treat SLE and differentiated them into DCs, we found no differences in the maturation and differentiation patterns seen in untreated or treated cells. Also, while RA patients are also exposed to immunosuppressive medications, DCs from patients with this disease did not show any signicant differences in the expression of maturation and differentiation markers and cytokine prole when compared with healthy controls. These observations suggest that our ndings are not related to the use of medications in these patients. In addition, an effect of corticosteroid treatment on DC function can reasonably be excluded, as these agents have a short biological halflife of 1236 h (84) and therefore can only have a marginal effect on maturation of DCs after a 7-day culture. Further supporting that our results are not related to medication use, a recent report in a novel lupus-prone mouse strain, B6.Sle3 (not subject to any type of immunosuppressive treatment), indicates that its DCs are hyperstimulatory, more mature and proinammatory, overexpress CD80 and CD86 among other costimulatory molecules, and induce T cell hyperactivity (85), similar to our ndings in human lupus DCs. Our results on the differentiation and maturation status of myeloid derived DCs differ from the ones previously described by Koller et al. (54), where no signicant increases in the expression of maturation markers in lupus DCs and a decrease in T cell proliferation by lupus DCs were found. We believe that these discrepancies might be secondary to differences in methodology. The number of patients studied by Koller et al. (54) was signicantly smaller and disease activity also appeared to be lower, although a different scoring system was used. That group used positive selection to isolate monocytes, which could contribute to activation of these cells, as has been reported for other PBMCs (86). In addition, their cells were cultured for longer periods of time and under conditions that were not serum-free. It has been demonstrated that serum contains growth factors that could affect DC development, differentiation and maturation in vitro (87, 88) and that serum-free conditions like the ones used in our study lead to more optimal DC harvest that non-serum free conditions (89). Furthermore, Koller et al. (54) used irradiated DCs for their mixed-lymphocyte reaction studies, while we used nonirradiated DCs. Irradiated DCs can undergo apoptosis (90) and posttranslational modications of proteins during apoptosis can potentially modify T cell activation and proliferation (90). Our results do conrm a previous observation that CD83 expression on lupus DCs is not up-regulated after maturation stimuli (91), are supported by similar ex vivo ndings in DCs isolated from peripheral blood and, as mentioned, are reminiscent of what has been reported in lupus animal models (85). Our observations that DCs from RA patients do not display the phenotypic abnormalities seen in SLE are in consensus what has been previously been reported in the RA literature in monocytederived DCs (92, 93). Our observations may not necessarily indicate

Downloaded from www.jimmunol.org on April 10, 2011

FIGURE 7. Increased IL-8 secretion by myeloid DCs from SLE patients. A, Results represent the mean concentration in supernatants (picograms per milliliter) SEM in DC cultures from 12 healthy controls and 27 SLE patients. Concentrations were adjusted according to initial monocyte number; , p 0.05 when comparing controls vs SLE in each culture condition. B, Results represent the mean concentration in supernatants (picograms per milliliter) SEM in DC cultures from 7 healthy controls, 5 RA patients, 13 SLE patients with negative anti-dsDNA Abs, and 9 SLE patients with elevated anti-dsDNA Abs. The variability in measurements between A and B is due to different methodology (CBA for A, Luminex array for B) and different samples measured.

specically supporting the expansion, survival and function of newly primed naive CD8 T cells (81). CD8 T cells in lupusprone mice are impaired in expansion, acquisition of memory, secretion of cytokine, and suppression of autoimmunity (8, 82) and because CD83 appears to have a role in CD8 function, it is possible that down-regulation of the former could contribute to abnormal CD8 function in SLE. In addition, CD4 T cells that develop in a CD83 mutant animal fail to respond normally following allogeneic stimulation (83), at least in part due to an altered cytokine expression pattern characterized by an increased production of IL-4 and IL-10 and diminished IL-2 production, ndings typically seen in SLE. Thus, absence or decrease of CD83 in SLE DCs may result in the generation of T cells with an altered activation and cytokine prole. Future studies will address these possibilities. The factors inducing down-regulation of CD83 in lupus DCs remain to be determined. Although we detected that autologous serum down-regulates the percentage of DCs that express CD83, this phenomenon was observed for both lupus and control serum, and therefore cannot explain the differences in expression of this molecule observed between the two groups. Similarly, treatment with IFN- did not alter CD83 expression. DCs from SLE patients responded to extrinsic maturation stimuli by up-regulating the expression of maturation markers, further in-

The Journal of Immunology

5887

FIGURE 8. Lupus DCs promote increased allogeneic T cell proliferation and activation. A, Bar graph represents percentage of allogeneic T cells in phases G0-G5, after coculture for 5 days with either unstimulated or stimulated (LPS TNF-) DCs from 11 healthy controls and 19 SLE patients. Proliferation of untreated T cells and PHA-treated T cells treated is also shown. Results represent the mean SEM of independent experiments. , p 0.05 when comparing proliferation of T cells adding SLE DCs with healthy control DCs and with untreated T cells. , p 0.05 when comparing proliferation of T cells stimulated with healthy control DCs vs untreated T cells. Both control and SLE-stimulated DCs induced higher T cell proliferation rates when compared with unstimulated healthy control or lupus DCs (p 0.02 for G0 in SLE; p 0.02 for G2 in control; p 0.04 for G2 in SLE and p 0.04 for G3 in control). B, Representative dot plots display CFSE and CD25 expression in allogeneic T cells after exposure to stimulated DCs from 1 SLE patient or DCs from 1 healthy control. C, Bar graph represents percentage of CD40L allogeneic T cells after 24 h coculture with unstimulated or stimulated (LPS TNF-) DCs from 4 healthy controls and 7 SLE patients. Untreated T cells and PHA-treated T cells treated are also shown. Results represent the mean SEM of independent experiments. , p 0.01 when comparing unstimulated SLE vs unstimulated healthy control DCs and p 0.03 when comparing stimulated lupus DCs vs stimulated control DCs. There was also a statistically signicant difference (p 0.04) in up-regulation of CD40L between untreated and stimulated DCs for both control and SLE patients.

Downloaded from www.jimmunol.org on April 10, 2011

that all RA DCs have normal phenotype and function. Indeed, monocyte-derived DCs might not reect changes occurring in the inamed synovium and there is evidence that DCs in the joint of RA patients show a distinct phenotype, with differential expression of specic TLRs (94). DCs are abundant both in synovial tissue and in synovial uid of RA patients (95) and it has been proposed that RA synovitis may be a delayed-type hypersensitivity reaction generated by the interaction of synovial DCs and T cells (96). Furthermore, the cytokine prole in RA and SLE is known to be distinctly different (35, 93, 97) and there is evidence that the mechanisms leading to autoimmunity in SLE and RA are probably quite distinct (98, 99). Therefore, the lack of hyperactivated DCs in RA patients does not imply that the abnormal DC phenotype observed in SLE is not important in maintaining autoimmunity, and this statement is supported by ndings in lupus animal models (56, 85). Immune complexes consisting of DNA and anti-dsDNA Abs isolated from the sera of patients with SLE can induce plasmacytoid DCs to produce high levels of IFN- (100). Increased IFN- production in SLE causes increased monocyte differentiation into DCs (22). These cells are able to capture apoptotic cells and

present their Ags to autologous T cells and induce potent MLRs (22). We propose that, in addition to the IFN-, there are endogenous abnormalities in myeloid DC differentiation and maturation, as a serum effect and exogenous IFN- could not account for, or abrogate, the differences in phenotype and function seen in lupus monocyte-derived DCs. Puried nucleosomes directly induce in vitro DC maturation of mouse bone marrow-derived DC, human monocyte-derived DC and puried human myeloid DCs as observed by stimulation of allogenic cells in MLR, IL-8 secretion, and CD86 up-regulation (101), ndings similar to the ones we report in this study. Further, nucleosomes complexed with antinucleosome Abs can activate DCs (102). Therefore, autoantigens and immune complexes could play an important role in vivo by inducing accelerated differentiation and maturation of lupus DCs. Taken together, our data suggest that monocyte-derived DC differentiation and maturation are altered in SLE and contribute to enhanced T cell proliferation and activation and to an increase in the secretion of proinammatory cytokines. We hypothesize that these events could help to initiate and maintain the autoimmune response in lupus.

5888

ABNORMAL PHENOTYPE AND FUNCTION OF LUPUS DCs

25. Angelini, G., S. Gardella, M. Ardy, M. R. Ciriolo, G. Filomeni, G. Di Trapani, F. Clarke, R. Sitia, and A. Rubartelli. 2002. Antigen-presenting dendritic cells provide the reducing extracellular microenvironment required for T lymphocyte activation. Proc. Natl. Acad. Sci. USA 99: 14911496. 26. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, and G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184: 747752. 27. Daniel, P. T., C. Scholz, J. Westermann, B. Dorken, and A. Pezzutto. 1998. Dendritic cells prevent CD95 mediated T lymphocyte death through costimulatory signals. Adv. Exp. Med. Biol. 451: 173177. 28. Ingulli, E., D. R. Ulman, M. M. Lucido, and M. K. Jenkins. 2002. In situ analysis reveals physical interactions between CD11b dendritic cells and antigen-specic CD4 T cells after subcutaneous injection of antigen. J. Immunol. 169: 22472252. 29. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, and M. Moser. 1999. CD8 and CD8 subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189: 587592. 30. Sallusto, F., and A. Lanzavecchia. 2002. The instructive role of dendritic cells on T-cell responses. Arthritis Res. 4(Suppl. 3): S127S132. 31. Brigl, M., and M. Brenner. 2004. CD1: antigen presentation and T cell function. Annu. Rev. Immunol. 22: 817 890. 32. Langenkamp, A., G. Casorati, C. Garavaglia, P. Dellabona, A. Lanzavecchia, and F. Sallusto. 2002. T cell priming by dendritic cells: thresholds for proliferation, differentiation and death and intraclonal functional diversication. Eur. J. Immunol. 32: 2046 2054. 33. Penna, G., M. Vulcano, A. Roncari, F. Facchetti, S. Sozzani, and L. Adorini. 2002. Differential chemokine production by myeloid and plasmacytoid dendritic cells. J. Immunol. 169: 6673 6676. 34. Pulendran, B., J. L. Smith, G. Caspary, K. Brasel, D. Pettit, E. Maraskovsky, and C. R. Maliszewski. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA 96: 1036 1041. 35. Banchereau, J., V. Pascual, and A. Palucka. 2004. Autoimmunity through cytokine-induced dendritic cell activation. Immunity 20: 539 550. 36. Santiago-Raber, M. L., R. Baccala, K. Haraldsson, D. Choubey, T. Stewart, D. Kono, and A. Theolopoulos. 2003. Type-I interferon receptor deciency reduces lupus-like disease in NZB mice. J. Exp. Med. 197: 777788. 37. Tan, E. M., A. Cohen, J. Fries, A. Masi, D. McShane, N. Rotheld, J. Schaller, N. Talal, and R. Winchester. 1982. The 1982 revised criteria for the classication of systemic lupus erythematosus. Arthritis Rheum. 25: 12711277. 38. Arnett, F. C., S. Edworthy, D. Bloch, D. McShane, J. Fries, N. Cooper, L. Healey, S. Kaplan, M. Liang, H. Luthra, et al. 1988. The American Rheumatism Association 1987 revised criteria for the classication of rheumatoid arthritis. Arthritis Rheum. 31: 315324. 39. Hochberg, M. C., for the Diagnostic and Therapeutic Criteria Committee of the American College of Rheumatology. 1997. Updating the American College of Rheumatology revised criteria for the classication of systemic lupus erythematosus [letter]. Arthritis Rheum. 40: 1725. 40. Bombardier, C., D. Gladman, M. Urowitz, D. Caron, and C. Chang. 1992. Derivation of the SLEDAI: a disease activity index for lupus patients. The Committee on Prognosis Studies in SLE. Arthritis Rheum. 35: 630 640. 41. Scandella, E., Y. Men, S. Gillessen, R. Forster, and M. Groettrup. 2002. Prostaglandin E2 is a key factor for CCR7 surface expression and migration of monocyte-derived dendritic cells. Blood 100: 1354 1361. 42. Munster, T., J. P. Gibbs, D. Shen, B. A. Baethge, G. R. Botstein, J. Caldwell, F. Dietz, R. Ettlinger, H. E. Golden, H. Lindsley, et al. 2002. Hydroxychloroquine concentration-response relationships in patients with rheumatoid arthritis. Arthritis Rheum. 46: 1460 1469. 43. Ensom, M. H., N. Partovi, D. Decarie, A. P. Ignaszewski, G. J. Fradet, and R. D. Levy. 2003. Mycophenolate pharmacokinetics in early period following lung or heart transplantation. Ann. Pharmacother. 37: 17611767. 44. Doria, A., M. Cutolo, A. Ghirardello, S. Zampieri, F. Vescovi, A. Sulli, M. Giusti, A. Piccoli, P. Grella, and P. F. Gambari. 2002. Steroid hormones and disease activity during pregnancy in systemic lupus erythematosus. Arthritis Rheum. 47: 202209. 45. Iqbal, M. P., J. A. Baig, A. A. Ali, S. K. Niazi, N. Mehboobali, and M. A. Hussain. 1998. The effects of non-steroidal anti-inammatory drugs on the disposition of methotrexate in patients with rheumatoid arthritis. Biopharm. Drug Dispos. 19: 163167. 46. Mawatari, H., K. Unei, S. Nishimura, N. Sakura, and K. Ueda. 2001. Comparative pharmacokinetics of oral 6-mercaptopurine and intravenous 6-mercaptopurine riboside in children. Pediatr. Int. 43: 673 677. 47. Lieberman, M. M., G. M. Patterson, and R. E. Moore. 2001. In vitro bioassays for anticancer drug screening: effects of cell concentration and other assay parameters on growth inhibitory activity. Cancer Lett. 173: 2129. 48. Tichopad, A., M. Dilger, G. Schwarz, and M. W. Pfaf. 2003. Standardized determination of real-time PCR efciency from a single reaction set-up. Nucleic Acids Res. 31: e122. 49. Green, K. J. 2002. Improving understanding of exercise effects on in vitro Tlymphocyte functionthe role of uorescent cell division tracking. Exerc. Immunol. Rev. 8: 101115. 50. Mannering, S. I., J. Morris, K. Jensen, A. Purcell, M. Honeyman, P. van Endert, and L. Harrison. 2003. A sensitive method for detecting proliferation of rare autoantigen-specic human T cells. J. Immunol. Methods 283: 173183. 51. Thompson, B. S., and T. C. Mitchell. 2004. Measurement of daughter cell accumulation during lymphocyte proliferation in vivo. J. Immunol. Methods 295: 79 87.

Acknowledgments
We thank Drs. David Fox, Bruce Richardson, and Michael Denny for critical review of the manuscript; Joel Joshua for help in patient recruitment, and Berlex for providing human GM-CSF.

Disclosures
The authors have no nancial conict of interest.

References
1. Tsokos, G. C., H. Wong, E. Enyedi, and M. Nambiar. 2000. Immune cell signaling in lupus. Curr. Opin. Rheumatol. 12: 355363. 2. Kammer, G., A. Perl, B. Richardson, and G. Tsokos. 2002. Abnormal T cell signal transduction in systemic lupus erythematosus. Arthritis Rheum. 46: 1139 1154. 3. Tsokos, G. C., J. Mitchell, and Y. Juang. 2003. T cell abnormalities in human and mouse lupus: intrinsic and extrinsic. Curr. Opin. Rheumatol. 15: 542547. 4. Busser, B. W., B. Adair, J. Erikson, and T. Laufer. 2003. Activation of diverse repertoires of autoreactive T cells enhances the loss of anti-dsDNA B cell tolerance. J. Clin. Invest. 112: 13611371. 5. Riemekasten, G., D. Langnickel, F. Ebling, G. Karpouzas, J. Kalsi, G. Herberth, B. Tsao, P. Henklein, S. Langer, G. Burmester, et al. 2003. Identication and characterization of SmD183119-reactive T cells that provide T cell help for pathogenic anti-double-stranded DNA antibodies. Arthritis Rheum 48: 475 485. 6. Kaplan, M. J., Q. Lu, A. Wu, J. Attwood, and B. Richardson. 2004. Demethylation of promoter regulatory elements contributes to perforin overexpression in CD4 lupus T cells. J. Immunol. 172: 36523661. 7. Tsai, H. F., J. Lai, A. Chou, T. Wang, C. Wu, and P. Hsu. 2004. Induction of costimulation of human CD4 T cells by tumor necrosis factor-related apoptosisinducing ligand: possible role in T cell activation in systemic lupus erythematosus. Arthritis Rheum 50: 629 639. 8. Karpouzas, G. A., A. La Cava, F. M. Ebling, R. R. Singh, and B. H. Hahn. 2004. Differences between CD8 T cells in lupus-prone (NZB NZW)F1 mice and healthy (BALB/c NZW)F1 mice may inuence autoimmunity in the lupus model. Eur. J. Immunol. 34: 2489 2499. 9. Wenzel, J., S. Henze, S. Brahler, T. Bieber, and T. Tuting. 2005. The expression of human leukocyte antigen-DR and CD25 on circulating T cells in cutaneous lupus erythematosus and correlation with disease activity. Exp. Dermatol. 14: 454 459. 10. Zielinski, C. E., S. Jacob, F. Bouzahzah, B. Ehrlich, and J. Craft. 2005. Naive CD4 T cells from lupus-prone Fas-intact MRL mice display TCR-mediated hyperproliferation due to intrinsic threshold defects in activation. J. Immunol. 174: 5100 5109. 11. Kaplan, M. J., E. Lewis, E. Shelden, E. Somers, R. Pavlic, W. McCune, and B. Richardson. 2002. The apoptotic ligands TRAIL, TWEAK, and Fas ligand mediate monocyte death induced by autologous lupus T cells. J. Immunol. 169: 6020 6029. 12. Calvani, N., H. Richards, M. Tucci, G. Pannarale, and F. Silvestris. 2004. Upregulation of IL-18 and predominance of a Th1 immune response is a hallmark of lupus nephritis. Clin. Exp. Immunol. 138: 171178. 13. Gomez, D., P. Correa, L. Gomez, J. Cadena, J. Molina, and J. Anaya. 2004. Th1/Th2 cytokines in patients with systemic lupus erythematosus: is tumor necrosis factor protective? Semin. Arthritis Rheum. 33: 404 413. 14. Zeng, D., Y. Liu, S. Sidobre, M. Kronenberg, and S. Strober. 2003. Activation of natural killer T cells in NZB/W mice induces Th1-type immune responses exacerbating lupus. J. Clin. Invest. 112: 12111222. 15. Singh, R. 2003. IL-4 and many roads to lupus like autoimmunity. Clin. Immunol. 108: 7379. 16. Nakajima, A., S. Hirose, H. Yagita, and K. Okumura. 1997. Roles of IL-4 and IL-12 in the development of lupus in NZB/W F1 mice. J. Immunol. 158: 1466 1472. 17. Tyrrell-Price, J., P. Lydyard, and D. Isenberg. 2001. The effect of interleukin-10 and of interleukin-12 on the in vitro production of anti-double-stranded DNA antibodies from patients with systemic lupus erythematosus. Clin. Exp. Immunol. 124: 118 125. 18. Llorente, L., W. Zou, Y. Levy, Y. Richaud-Patin, J. Wijdenes, J. Alcocer-Varela, B. Morel-Fourrier, J. Brouet, D. Alarcon-Segovia, P. Galanaud, and D. Emilie. 1995. Role of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J. Exp. Med. 181: 839 844. 19. Palucka, A. K., J. Banchereau, P. Blanco, and V. Pascual. 2002. The interplay of dendritic cell subsets in systemic lupus erythematosus. 80: 484 488. 20. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245252. 21. Kono, D. H., R. Baccala, and A. Theolopoulos. 2003. Inhibition of lupus by genetic alteration of the interferon-/ receptor. Autoimmunity 36: 503510. 22. Blanco, P., A. Palucka, M. Gill, V. Pascual, and J. Banchereau. 2001. Induction of dendritic cell differentiation by IFN- in systemic lupus erythematosus. Science 294: 1540 1543. 23. Stoll, S., J. Delon, T. M. Brotz, and R. N. Germain. 2002. Dynamic imaging of T cell-dendritic cell interactions in lymph nodes. Science 296: 18731876. 24. Mailliard, R. B., S. Egawa, Q. Cai, A. Kalinska, S. N. Bykovskaya, M. T. Lotze, M. L. Kapsenberg, W. J. Storkus, and P. Kalinski. 2002. Complementary dendritic cell-activating function of CD8 and CD4 T cells: helper role of CD8 T cells in the development of T helper type 1 responses. J. Exp. Med. 195: 473 483.

Downloaded from www.jimmunol.org on April 10, 2011

The Journal of Immunology

52. Chen, J. C., M. L. Chang, and M. O. Muench. 2003. A kinetic study of the murine mixed lymphocyte reaction by 5,6-carboxyuorescein diacetate succinimidyl ester labeling. J. Immunol. Methods 279: 123133. 53. Renno, T., A. Attinger, S. Locatelli, T. Bakker, S. Vacheron, and H. R. MacDonald. 1999. Cutting edge: apoptosis of superantigen-activated T cells occurs preferentially after a discrete number of cell divisions in vivo. J. Immunol. 162: 6312 6315. 54. Koller, M., B. Zwolfer, G. Steiner, J. Smolen, and C. Scheinecker. 2004. Phenotypic and functional deciencies of monocyte-derived dendritic cells in systemic lupus erythematosus (SLE) patients. Int. Immunol. 16: 15951604. 55. Cao, W., S. Lee, and J. Lu. 2004. CD83 is preformed inside monocytes, macrophages and dendritic cells but it is only stably expressed on activated dendritic cells. Biochem. J. 385: 8593. 56. Adachi, Y., S. Taketani, J. Toki, K. Ikebukuro, K. Sugiura, H. Oyaizu, R. Yasumizu, M. Tomita, H. Kaneda, Y. Amoh, et al. 2002. Marked increase in number of dendritic cells in autoimmune-prone (NZW BXSB)F1 mice with age. Stem Cells 20: 6172. 57. Scheinecker, C., B. Zwolfer, M. Koller, G. Manner, and J. Smolen. 2001. Alterations of dendritic cells in systemic lupus erythematosus: phenotypic and functional deciencies. Arthritis Rheum. 44: 856 865. 58. Nakajima, A., M. Azuma, S. Kodera, S. Nuriya, A. Terashi, M. Abe, S. Hirose, T. Shirai, H. Yagita, and K. Okumura. 1995. Preferential dependence of autoantibody production in murine lupus on CD86 costimulatory molecule. Eur. J. Immunol. 25: 3060 3069. 59. Kinoshita, K., G. Tesch, A. Schwarting, R. Maron, A. Sharpe, and V. Kelley. 2000. Costimulation by B7-1 and B7-2 is required for autoimmune disease in MRL-Faslpr mice. J. Immunol. 164: 6046 6056. 60. Georgiev, M., L. Agle, J. Chu, K. Elkon, and D. Ashany. 2005. Mature dendritic cells readily break tolerance in normal mice but do not lead to disease expression. Arthritis Rheum. 52: 225238. 61. Holcombe, R. F., B. Baethge, R. Wolf, K. Betzing, R. Stewart, V. Hall, and M. Fukuda. 1994. Correlation of serum interleukin-8 and cell surface lysosomeassociated membrane protein expression with clinical disease activity in systemic lupus erythematosus. Lupus 3: 97102. 62. Rovin, B. H., L. Lu, and X. Zhang. 2002. A novel interleukin-8 polymorphism is associated with severe systemic lupus erythematosus nephritis. Kidney Int. 62: 261265. 63. Tsai, C. Y., T. H. Wu, C. Yu, J. Lu, and Y. Tsai. 2000. Increased excretions of 2-microglobulin, IL-6, and IL-8 and decreased excretion of Tamm-Horsfall glycoprotein in urine of patients with active lupus nephritis. Nephron 85: 207214. 64. Scimone, M. L., V. P. Lutzky, S. Zittermann, P. Mafa, C. Jancic, F. Buzzola, A. Issekutz, and H. Chuluyan. 2005. Migration of polymorphonuclear leucocytes is inuenced by dendritic cells. Immunology 114: 375385. 65. Trysberg, E., H. Carlsten, and A. Tarkowski. 2000. Intrathecal cytokines in systemic lupus erythematosus with central nervous system involvement. Lupus 9: 498 503. 66. Zhu, K., Q. Shen, M. Ulrich, and M. Zheng. 2000. Human monocyte-derived dendritic cells expressing both chemotactic cytokines IL-8, MCP-1, RANTES and their receptors, and their selective migration to these chemokines. Chin. Med. J. 113: 1124 1128. 67. Mayer, G., K. Pohlmeyer, A. Caliebe, E. Heimueller, B. Behnke, G. Steimann, C. Lange, and J. Beuth. 2000. Low molecular thymic peptides stimulate human blood dendritic cells. Anticancer Res. 20: 28732883. 68. Bickel, B. M. 1993. The role of interleukin-8 in inammation and mechanisms of regulation. J. Periodontol. 64(Suppl. 5): 456 460. 69. Huang, S., L. Mills, B. Mian, C. Tellez, M. McCarty, X. Yang, J. Gudas, and M. Bar-Eli. 2002. Fully humanized neutralizing antibodies to interleukin-8 (ABX-IL8) inhibit angiogenesis, tumor growth, and metastasis of human melanoma. Am. J. Pathol. 161: 125134. 70. Mukaida, N. 2000. Interleukin-8: an expanding universe beyond neutrophil chemotaxis and activation. Am. J. Hematol. 72: 391398. 71. Gerszten, T. E., E. Garcia-Zepeda, Y. Lim, M. Yushida, H. Ding, M. Gimbrone, A. Luster, F. Luscinskas, and A. Rosenzweig. 1999. MCP-1 and IL-8 trigger rm adhesion of monocytes to vascular endothelium under ow conditions. Nature 398: 718 723. 72. Casilli, F., A. Bianchini, I. Gloaguen, L. Biordi, E. Alesse, C. Festuccia, B. Cavalieri, R. Strippoli, M. Cervellera, R. Di Bitondo, et al. 2005. Inhibition of interleukin-8 (CXCL8/IL-8) responses by repertaxin, a new inhibitor of the chemokine receptors CXCR1 and CXCR2. Biochem. Pharmacol. 69: 385394. 73. Lai, K., J. Leung, K. Lai, and C. Lai. 1997. Effect of anti-DNA autoantibodies on the gene expression of interleukin 8, transforming growth factor-, and nitric oxide synthase in cultured endothelial cells. Scand. J. Rheumatol. 26: 461 467. 74. Sun, K. H., C. Yu, S. Tang, and G. Sun. 2000. Monoclonal anti-double-stranded DNA autoantibody stimulates the expression and release of Il-1, Il-6, IL-8 IL-10 and TNF- from normal human mononuclear cells involving in the lupus pathogenesis. Immunology 99: 352360. 75. Rus, V., S. Atamas, V. Shustova, I. Luzina, F. Selaru, L. Madger, and C. Via. 2002. Expression of cytokine- and chemokine-related genes in peripheral blood mononuclear cels from lupus patients by cDNA array. Clin. Immunol. 102: 283290. 76. Scholler, N., M. Hayden-Ledbetter, K. Hellstrom, I. Hellstrom, and J. Ledbetter. 2001. CD83 is a sialic acid-binding Ig-like lectin (Siglec) adhesion receptor that binds monocytes and a subset of activated CD8 T cells. J. Immunol. 166: 38653872 77. Kruse, M., O. Rosorius, F. Kratzer, D. Bevec, C. Kuhnt, A. Steinkasserer, G. Schuler, and J. Hauber. 2000. Inhibition of CD83 cell surface expression during dendritic cell maturation by interference with nuclear export of CD83 mRNA. J. Exp. Med. 191: 15811590.

5889
78. Lechmann, M., E. Zinser, A. Golka, and A. Steinkasserer. 2002. Role of CD83 in the immunomodulation of dendritic cells. Int. Arch. Allergy Immunol. 129: 113118. 79. Lechmann, M., E. Kremmer, H. Sticht, and A. Steinkasserer. 2002. Overexpression, purication, and biochemical characterization of the extracellular human CD83 domain and generation of monoclonal antibodies. Protein Expr. Purif. 24: 445 452. 80. Scholler, N., M. Hayden-Ledbetter, A. Dahlin, I. Hellstrom, K. Hellstrom, and J. Ledbetter. 2002. Cutting edge: CD83 regulates the development of cellular immunity. J. Immunol. 168: 2599 2602. 81. Hirano, N., M. O. Butler, Z. Xia, S. Ansen, M. S. von Bergwelt-Baildon, D. Neuberg, G. J. Freeman, and L. M. Nadler. 2005. Engagement of CD83 ligand induces prolonged expansion of CD8 T cells and preferential enrichment for antigen specicity. Blood 107: 1528 1536. 82. Filaci, G., S. Bacilieri, M. Fravega, M. Monetti, P. Contini, M. Ghio, M. Setti, F. Puppo, and F. Indiveri. 2001. Impairment of CD8 T suppressor cell function in patients with active systemic lupus erythematosus. J. Immunol. 166: 6452 6457. 83. Garcia-Martinez, L., M. Appleby, K. Staehling-Hampton, D. Andrews, Y. Chen, M. McEuen, P. Tang, R. Rhinehart, S. Proll, B. Paeper, et al. 2004. A novel mutation in CD83 results in the development of a unique population of CD4 T cells. J. Immunol. 173: 29953001. 84. Schwab, M., and U. Klotz. 2001. Pharmacokinetic considerations in the treatment of inammatory bowel disease. Clin. Pharmacokinet. 40: 723751. 85. Zhu, J., X. Liu, C. Xie, M. Yan, Y. Yu, E. S. Sobel, E. K. Wakeland, and C. Mohan. 2005. T cell hyperactivity in lupus as a consequence of hyperstimulatory antigen-presenting cells. J. Clin. Invest. 115: 1869 1878. 86. Oren, A., C. Husebo, A. C. Iversen, and R. Austgulen. 2005. A comparative study of immunomagnetic methods used for separation of human natural killer cells from peripheral blood. J. Immunol. Methods 303: 110. 87. Tobiasova-Czetoova, Z., A. Palmborg, A. Lundqvist, G. Karlsson, L. Adamson, J. Bartunkova, G. Masucci, and P. Pisa. 2005. Effects of human plasma proteins on maturation of monocyte-derived dendritic cells. Immunol. Lett. 100: 113119. 88. Tkachenko, N., K. Wojas, J. Tabarkiewicz, and J. Rolinski. 2005. Generation of dendritic cells from human peripheral blood monocytes comparison of different culture medium. Folia Histochem. Cytobiol. 43: 2530. 89. Kufner, S., H. Zitzelsberger, T. Kroell, R. Pelka-Fleischer, A. Salem, F. de Valle, C. Schweiger, V. Nuessler, C. Schmid, H. J. Kolb, and H. M. Schmetzer. 2005. Leukemia-derived dendritic cells can be generated from blood or bone marrow cells from patients with acute myeloid leukaemia: a methodological approach under serum-free culture conditions. Scand. J. Immunol. 62: 86 98. 90. Chernysheva, A. D., K. A. Kirou, and M. K. Crow. 2002. T cell proliferation induced by autologous non-T cells is a response to apoptotic cells processed by dendritic cells. J. Immunol. 169: 12411250. 91. Banki, Z., L. Kacani, B. Mullauer, D. Wilingseder, G. Obermoser, H. Niederegger, H. Schennach, G. Sprinzl, N. Sepp, A. Erdei, et al. 2003. Crosslinking of CD32 induces maturation of human monocyte-derived dendritic cells via NF-B signaling pathway. J. Immunol. 170: 39633970. 92. Radstake, T. R., K. C. Nabbe, M. H. Wenink, M. F. Roelofs, A. Oosterlaar, A. W. van Lieshout, P. Barrera, P. L. van Lent, and W. B. van den Berg. 2005. Dendritic cells from patients with rheumatoid arthritis lack the interleukin 13 mediated increase of FcRII expression, which has clear functional consequences. Ann. Rheum. Dis. 64: 17371743. 93. Radstake, T. R., A. B. Blom, A. W. Sloetjes, E. O. van Gorselen, G. J. Pesman, L. Engelen, R. Torensma, W. B. van den Berg, C. G. Figdor, P. L. van Lent, et al. 2004. Increased FcRII expression and aberrant tumour necrosis factor production by mature dendritic cells from patients with active rheumatoid arthritis. Ann. Rheum. Dis. 63: 1556 1563. 94. Roelofs, M. F., L. A. Joosten, S. Abdollahi-Roodsaz, A. W. van Lieshout, T. Sprong, F. H. van den Hoogen, W. B. van den Berg, and T. R. Radstake. 2005. The expression of Toll-like receptors 3 and 7 in rheumatoid arthritis synovium is increased and costimulation of Toll-like receptors 3, 4, and 7/8 results in synergistic cytokine production by dendritic cells. Arthritis Rheum. 52: 23132322. 95. Tran, C. N., S. K. Lundy, and D. A. Fox. 2005. Synovial biology and T cells in rheumatoid arthritis. Pathophysiology 12: 183189. 96. Klareskog, L., U. Forsum, A. Scheynius, D. Kabelitz, and H. Wigzell. 1982. Evidence in support of a self-perpetuating HLA-DR-dependent delayed-type cell reaction in rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 79: 36323636. 97. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005. Cross-regulation of TNF and IFN- in autoimmune diseases. Proc. Natl. Acad. Sci. USA 102: 33723377. 98. Kyttaris, V. C., Y. T. Juang, and G. C. Tsokos. 2005. Immune cells and cytokines in systemic lupus erythematosus: an update. Curr. Opin. Rheumatol. 17: 518 522. 99. Lorenz, H. M., M. Herrmann, and J. R. Kalden. 2001. The pathogenesis of autoimmune diseases. Scand. J. Clin. Lab. Invest. Suppl. 235: 16 26. 100. Vallin, H., A. Perers, G.V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN- inducer in systemic lupus erythematosus. J. Immunol. 163: 6306 6313. 101. Boule, M., C. Broughton, F. Mackay, S. Akira, A. Marshak-Rothstein, and I. Rifkin. 2004. Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin-immunoglobulin G complexes. J. Exp. Med. 199: 16311640. 102. Decker, P., H. Singh-Jasuja, S. Haager, I. Kotter, and H. Rammensee. 2005. Nucleosome, the main autoantigen in systemic lupus erythematosus, induces direct dendritic cell activation via a MyD88-independent pathway: consequences on inammation. J. Immunol. 174: 3326 3334.

Downloaded from www.jimmunol.org on April 10, 2011