Identification of renal transporters involved in sulfate excretion in marine teleost fish

Akira Kato, Min-Hwang Chang, Yukihiro Kurita, Tsutomu Nakada, Maho Ogoshi, Takeru Nakazato, Hiroyuki Doi, Shigehisa Hirose and Michael F. Romero
Am J Physiol Regul Integr Comp Physiol 297:R1647-R1659, 2009. First published 7 October 2009; doi: 10.1152/ajpregu.00228.2009 You might find this additional info useful... Supplementary material for this article can be found at: http://ajpregu.physiology.org/http://ajpregu.physiology.org/content/suppl/2009/10/07/00228.2009. DC1.html This article cites 56 articles, 35 of which you can access for free at: http://ajpregu.physiology.org/content/297/6/R1647.full#ref-list-1 This article has been cited by 6 other HighWire-hosted articles: http://ajpregu.physiology.org/content/297/6/R1647#cited-by Updated information and services including high resolution figures, can be found at: http://ajpregu.physiology.org/content/297/6/R1647.full Additional material and information about American Journal of Physiology - Regulatory, Integrative and Comparative Physiology can be found at: http://www.the-aps.org/publications/ajpregu This information is current as of April 13, 2013.
Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

American Journal of Physiology - Regulatory, Integrative and Comparative Physiology publishes original investigations that illuminate normal or abnormal regulation and integration of physiological mechanisms at all levels of biological organization, ranging from molecules to humans, including clinical investigations. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2009 the American Physiological Society. ISSN: 0363-6119, ESSN: 1522-1490. Visit our website at http://www.the-aps.org/.

Am J Physiol Regul Integr Comp Physiol 297: R1647R1659, 2009. First published October 7, 2009; doi:10.1152/ajpregu.00228.2009.

Identication of renal transporters involved in sulfate excretion in marine teleost sh

Akira Kato,1,2 Min-Hwang Chang,2 Yukihiro Kurita,1 Tsutomu Nakada,1 Maho Ogoshi,1 Takeru Nakazato,1 Hiroyuki Doi,3 Shigehisa Hirose,1* and Michael F. Romero2*
Department of Biological Sciences, Tokyo Institute of Technology, Yokohama, Japan; 2Physiology and Biomedical Engineering, Mayo Clinic College of Medicine, Rochester, Minnesota; and 3Shimonoseki Marine Science Museum Kaikyokan, Shimonoseki Academy of Marine Science, Shimonoseki, Japan
Submitted 27 April 2009; accepted in nal form 3 October 2009
1

Kato A, Chang MH, Kurita Y, Nakada T, Ogoshi M, Nakazato T, Doi H, Hirose S, Romero MF. Identication of renal transporters involved in sulfate excretion in marine teleost sh. Am J Physiol Regul Integr Comp Physiol 297: R1647R1659, 2009. First published October 7, 2009; doi:10.1152/ajpregu.00228.2009.Sulfate (SO2 4 ) is the second most abundant anion in seawater (SW), and excretion of excess SO2 4 from ingested SW is essential for marine sh to survive. Marine teleosts excrete SO2 via the urine produced in the kidney. 4 2 The SO4 transporter that secretes and concentrates SO2 4 in the urine has not previously been identied. Here, we have identied and characterized candidates for the long-sought transporters. Using sequences from the fugu database, we have cloned cDNA fragments of all transporters belonging to the Slc13 and Slc26 families from mefugu (Takifugu obscurus). We compared Slc13 and Slc26 mRNA expression in the kidney between freshwater (FW) and SW mefugu. Among 14 clones examined, the expression of a Slc26a6 paralog (mfSlc26a6A) was the most upregulated (30-fold) in the kidney of SW mefugu. Electrophysiological analyses of Xenopus oocytes expressing mfSlc26a6A, mfSlc26a6B, and mouse Slc26a6 (mSlc26a6) demonstrated that all transporters mediate electrogenic Cl/SO2 4 , 2 Cl /oxalate , and Cl /nHCO3 exchanges and electroneutral Cl / formate exchange. Two-electrode voltage-clamp experiments dem onstrated that the SO2 4 -elicited currents of mfSlc26a6A is quite large (35 A at 60 mV) and 50- to 200-fold higher than those of mfSlc26a6B and mSlc26a6. Conversely, the currents elicited by oxalate and HCO are almost identical among mfSlc26a6A, 3 mfSlc26a6B, and mSlc26a6. Kinetic analysis revealed that mfSlc26a6A has the highest SO2 afnity as well as capacity. 4 Immunohistochemical analyses demonstrated that mfSlc26a6A localizes to the apical (brush-border) region of the proximal tubules. Together, these ndings suggest that mfSlc26a6A is the most likely candidate for the major apical SO2 transporter that mediates SO2 4 4 secretion in the kidney of marine teleosts. mefugu; proximal tubule; Slc13; Slc26; sulfate homeostasis; oxalate

for many biological processes. Almost all vertebrate animals maintain plasma SO2 4 concentration at 0.21 mM, except the special case of the freshwater eel, which uses SO2 4 as a plasma osmolyte (35). In mammals, 2 is plasma [SO4 ] is maintained by the kidney, where SO2 4 freely ltered from the blood and then reabsorbed (29, 30). The proximal tubule is the major site of active SO2 4 reabsorption, 2 and the remaining SO4 (10 30%) is excreted in urine. SO2 4 uptake across the apical membrane is coupled to Na absorp tion. This coupled transport is mediated by the Na-SO2 4
SULFATE (SO4 ) IS ESSENTIAL

* S. Hirose and M. F. Romero contributed equally to this work. Address for reprint requests and other correspondence: S. Hirose, Biological Sciences, Tokyo Institute of Technology, 4259-B-19 Nagatsuta-cho, Midoriku, Yokohama 226-8501, Japan (e-mail: shirose@bio.titech.ac.jp). http://www.ajpregu.org

cotransporter (NaSi-1, Slc13a1) (8) The basolateral membrane of the proximal tubule exchanges SO2 for anions, such as 4 OH and HCO3 (25), and this exchange seems to be mediated by SO2 anion transporter 1 (Sat1, Slc26a1) (30). In teleosts 4 (modern bony shes), plasma [SO2 4 ] is maintained at levels similar to those in mammals. In contrast to most mammals, however, marine teleosts concentrate and excrete SO2 in 4 urine (37, 41). The plasma of marine teleosts has ionic composition and osmolarity similar to that found in mammals and freshwater (FW) sh, i.e., hypotonic to seawater (SW). To balance passive water loss from the gills and skin, marine teleosts drink SW, absorb water, and eliminate salts. SW contains 53 mM 2 Mg2, 27 mM SO2 , and 10 mM K as well as 4 , 10 mM Ca 450 mM NaCl. Therefore, marine teleosts must excrete the excess ions from the ingested SW: from the gill, Na, Cl, and K; from the intestine, Ca2 and Mg2; and from the kidney, Mg2 and SO2 4 (33). Urine of marine teleosts is isotonic to the plasma but rich in Mg2 and SO2 4 , which are not secreted by the gill. Consequently, renal SO2 excretion is essential for 4 2 SO4 homeostasis in marine teleosts. SW ingestion has also been reported in a number of marine mammals (36), indicating that they may have similar SO2 4 handling as marine teleosts. It has also been shown that the site of marine teleost SO2 4 secretion is the renal proximal tubule (7, 9, 44). However, the molecular mechanisms by which SO2 4 is secreted and concentrated in urine are not known. To identify the transporters involved in SO2 4 secretion, we took a similar approach as used to identify intestinal bicarbonate transporters essential for SW adaptation (27). Specically, we cloned all candidate SO2 4 transporters from the Slc13 and Slc26 families from a euryhaline puffersh, mefugu (Takifugu obscurus) (20), with a help of database mining. We then narrowed the potential candidates by determining whether their mRNA was induced in the kidney with SW conditions. Mefugu is a species closely related to tiger puffer (T. rubripes) (57), whose whole genome was sequenced in 2002 (1). Through this systematic approach, we identied an Slc26a6 (CFEX/PAT-1) paralog (mfSlc26a6A), which exhibited the highest induction in SW. The results of our functional characterization (electrophysiology) and protein localization (immunohistochemistry) lead us to propose that mfSlc26a6A, an electrogenic Cl/SO2 4 exchanger, plays a central role in the excretion of excess SO2 4 at the apical side of the renal proximal tubule cells of marine teleosts. This highly-efcient secretion mechanism allows ma rine teleosts to maintain extremely low plasma [SO2 4 ] relative to the surrounding SW.
R1647

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

0363-6119/09 $8.00 Copyright 2009 the American Physiological Society

R1648
MATERIALS AND METHODS

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

Animals. Mefugu T. obscurus (200 380 g) were purchased from a local dealer and reared in tanks containing 150 liters brackish water (314% diluted SW) until use. For FW samples, mefugu were transferred to 150-liter FW tanks and held for 8 9 days before sample collection. For SW samples, mefugu in FW tanks were transferred to 150-liter SW tanks and acclimated for 8 9 days. The water temperature was maintained at 18 22C. All fugu were anesthetized by immersion in 0.1% ethyl m-aminobenzoate (MS-222, tricaine) before being killed by decapitation. The tissues required for RNA extraction were dissected, snap-frozen in liquid nitrogen, and stored at 80C until use. Articial SW (Rohto-Marine) was obtained from Rei-Sea (Tokyo, Japan). The animal protocols and procedures were approved by the Institutional Animal Care and Use Committee of Tokyo Institute of Technology (mefugu) or Mayo Clinic (Xenopus) and conform to the American Physiological Societys guiding principles in the care and use of laboratory animals (1a). RNA isolation. Total RNA was isolated from intestine by acidic guanidinium thiocyanate-phenol-chloroform extraction with Isogen (Nippon Gene, Tokyo, Japan). Briey, tissues were homogenized in Isogen (1 g of tissue per 10 ml of Isogen) by using a Polytron tissue homogenizer, followed by guanidinium thiocyanate-phenol-chloroform extraction, isopropanol precipitation, and 75% (vol/vol) ethanol washing of precipitated RNA. The RNA was dissolved in diethyl pyrocarbonate-treated water, and its concentration calculated from absorbance at 260 nm. Molecular cloning. Complementary DNA was reverse-transcribed using random hexamers and the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Fragments of mefugu Slc26a6A and Slc26a6B were isolated by RT-PCR from fugu intestine RNA with primers (Table 1 and S1) that were designed based on the fugu genomic database (http://genome.jgi-psf.org/fugu6/fugu6.home.html). The PCR products were subcloned into pBluescript II SK() (Stratagene, La Jolla, CA) and sequenced. These clones were used as probes for Northern blot analysis.

Table 1. List of primers used for PCR amplication

Gene Sequence Remarks

mfSlc26a6A GGGCTGCCAAGCATGTG GCGTCGTGTACTGTGACAAACA mfSlc26a6B CACCGTTCATGACGCAGTTC ACGTTTCTGTGTTCTCCTGTTCAG mfSlc26a6C TCCCAGCTTCCGCACACTCA

mfSlc26a1

mfSlc13a1 GAPDH

qPCR (S) qPCR (AS) qPCR (S) qPCR (AS) Initial cloning (S) AGCTCCTGGTTACTGTCCACCTT Initial cloning (AS) CACACTCCCCACCATGATACTGAGC 5 RACE outer AGCCACCTGTATCCTGTATGAGTCT 5 RACE inner TCACTGGGGAAATGGACCTGGGACA 3 RACE outer AAAGGAAAAGGTCTGTCGTTCTCTA 3 RACE inner AAACTGAGAAAGACATAGAATTCTACCAGA ORF cloning (S) TATTTAATTTCAGCCACTGAACACAACAAG ORF cloning (AS) GAGGACACACTGAGTCACGA qPCR (S) GGGCTTGACAACCAGCTATG qPCR (AS) GAGCCTCATGGTGGGACAGG Initial cloning (S) ACACACTGGAGCTGTAGCGG Initial cloning (AS) CAGATCAGCAGCGTTAACACAG qPCR (S) GCGTTTAACTTTCCTCTGATTGTCC qPCR (AS) AGTCGGCGGAGGATTCGCACTT qPCR (S) GCATGCGACAGTGATGGTGGCTAAC qPCR (AS) GGCCCAATGAAAGGCATTCT qPCR (S) TGGGTGTCGCCGTTGAA qPCR (AS)

S, sense primer; AS, antisense primer. AJP-Regul Integr Comp Physiol VOL

Northern blot analysis. Total RNA (20 g/lane) from a pool of various tissues of FW and SW mefugu was electrophoresed on formaldehyde-agarose (1%) denaturing gels in 10 MOPS running buffer (20 mM MOPS, pH 7.0, 8 mM acetate, 1 mM EDTA) and then transferred onto Hybond-N nylon membranes (GE Healthcare, Piscataway, NJ) by capillary blotting. After transfer, membranes were baked for 2 h at 80C and prehybridized for 2 h at 65C in PerfectHyb hybridization solution (Toyobo, Osaka, Japan). The probes were labeled with [-32P]dCTP (3,000 Ci/mmol) with the use of a ReadyTo-Go DNA labeling kit (GE Healthcare), and the unincorporated nucleotides were removed by passing the reaction mixture through a Sephadex G-50 column (GE Healthcare). The membranes were then hybridized separately with each 32P-labeled probe in the same buffer at 68C for 16 h. The blots were subsequently washed under increasingly stringent conditions (nal wash: 1 SSC and 0.1% SDS for 30 min at 60C). Membranes were exposed to an imaging plate (Fujilm, Tokyo, Japan) in a cassette overnight. The results were analyzed using a Fuji BAS2000 Bio-Image Analyzer (Fujilm). A probe for mefugu -actin was used as a control to verify loading and RNA integrity. Real-time PCR. Expression of mfSlc26a6A, mfSlc26a6B, mfSlc26a6C, mfSlc26a1, and mfSlc13a1 was quantied by real-time PCR. Total RNAs were extracted from the kidney of mefugu acclimated to SW and FW (n 5 for each group) and reverse-transcribed into cDNA using oligo(dT) primer and the SuperScript III First-Strand Synthesis System (Invitrogen). Multiplex real-time PCR was performed for quantitation of mfSlc26a6A, mfSlc26a6B, mfSlc26a6C, mfSlc26a1, and mfSlc13a1 mRNA expression, with amplication of GAPDH as an endogenous control. Reactions were performed with the SYBR Green method using SYBR Premix Ex Taq II Kit (Takara Bio, Otsu, Japan) on a Thermal Cycler Dice Real-Time System (Takara Bio) and calculated using the Relative Standard Curve method. mRNA concentrations of mfSlc26a6A, mfSlc26a6B, and mfSlc26a1 were normalized to GAPDH levels. Experiments were performed in duplicate. Data were expressed as the means SE. Signicant differences at P 0.01 were determined by two-sample Students t-test, assuming unequal variance. Immunohistochemistry. Kidneys from SW mefugu were xed in 0.1 M phosphate buffer, pH 7.4, containing 4% (wt/vol) paraformaldehyde for 1 h at 4C. After incubation in 0.1 M phosphate buffer, pH 7.4, containing 20% (wt/vol) sucrose for 16 h at 4C, specimens were frozen in Tissue Tek OCT compound on a cryostat holder. Sections (6 m) were prepared in a 20C cryostat, mounted on (3-aminopropyl)triethoxysilane-coated glass slides, and air-dried for 1 h. After being washed with PBS, sections were incubated for 2 h at room temperature with 2.5% (vol/vol) normal goat serum and then overnight at 4C with antisera and preimmune sera at a 1:1,000 (immunouorescence method) dilution. After being incubated with antisera and preimmune sera, sections were washed with PBS and then incubated for 1 h at room temperature with a cocktail of Alexa Fluor 488-conjugated anti-rabbit IgG (1:2,000; Invitrogen), Alexa Fluor 546-conjugated anti-rat IgG (1:2,000; Invitrogen), and Hoechst 33342 (100 ng/ml; Molecular Probes). Fluorescence was detected using a uorescence microscope equipped with a high-resolution digital charge-coupled device camera (Carl Zeiss, Oberkochen, Germany). Expression of mfSlc26a6A, mfSlc26a6B, and mSlc26a6 in Xenopus oocytes and electrophysiology. The entire coding regions of mfSlc26a6A, mfSlc26a6B, and mSlc26a6 cDNAs were inserted to the pGEMHE Xenopus laevis expression vector as described previously (27, 56). The plasmids were linearized with NotI or NheI, and cRNAs were transcribed in vitro using the T7 mMESSAGE mMACHINE kit (Ambion, Austin, TX). X. laevis oocytes were dissociated with collagenase as previously described (45) and injected with 25 nl of water or a solution containing cRNA at 0.4 1 g/l (10 25 ng/oocyte), using a Nanoject-II injector (Drummond Scientic, Broomall, PA). Oocytes were incubated at 16C in OR3 media (45), and studied 3 6 days after injection.
297 DECEMBER 2009

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

R1649

Ion-selective microelectrode analysis. To measure the intracellular chloride concentration ([Cl]i,) of Xenopus oocytes, a Cl ionselective microelectrode was prepared with Cl-ionophore I, cocktail A (cat. no. 24902; Fluka Chemicals, Buchs, Switzerland) and used as previously described (6, 46). [Cl]i was measured as the difference between the Cl electrode and a KCl voltage electrode impaled into the oocyte, and membrane potential (Vm) was measured as the difference between the KCl microelectrode and an extracellular calomel. [Cl]i electrodes were calibrated using 10 and 100 mM NaCl, followed by a test of the specicity by using 100 mM NaHCO3 and a point calibration in ND96 (pH 7.5). ND96 contained 96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, and 5 mM HEPES (pH 7.5). In solutions with 0 mM Cl (0Cl-ND96), Cl was replaced with gluconate. For solutions containing SO2 4 , 10 mM NaCl or sodium gluconate was replaced with 5 mM disodium sulfate (Na2SO4) and 2.5 mM choline chloride or choline gluconate. For solutions containing oxalate, 0.75 ml of 133 mM disodium oxalate (Na2C2O4) were mixed with 99.25 ml ND96 or 0Cl-ND96 just before use, because ND96-containing oxalate formed precipitates of calcium oxalate after storage of several days. For solutions containing formate, 5 mM NaCl or sodium gluconate was replaced with 5 mM sodium formate (NaHCOO). For CO2/HCO 3 -equilibrated solutions, 33 mM NaHCO3 was replaced with 33 mM NaCl or sodium gluconate and the solutions were bubbled with 5% CO2/95% O2 during the experiments. All solutions were titrated to pH 7.5 at room temperature using NaOH and had an osmolality of 195200 mosmol/kg H2O. Two-electrode voltage clamp analyses. Current-voltage (I-V) relationships of cRNA or water-injected oocytes in the presence of test anions were analyzed as previously described (50). In brief, an oocyte was perfused with ND96, clamped at a holding potential (Vh) of 60 mV and then perfused with ND96 containing 70 mM Cl (70ClND96). After that, the oocyte was perfused with 70Cl-ND96 contain 2 ing 0.2 mM SO2 4 , 70Cl-ND96 containing 1 mM SO4 , 70Cl-ND96 containing 5 mM SO2 , and 70Cl-ND96 containing 15 mM SO2 4 4 . At each change of solution, oocyte was perfused in solution until the current (I) was stabilized, and the I-V relation was then recorded. In this way, sulfate-elicited currents were measured by addition of 0.2, 1, 5, and 15 mM SO2 4 in 70Cl-ND96 or addition of 0.2, 1, 5, 15, and 48 2 mM SO4 in ND96 containing 20 mM Cl (20Cl-ND96), and were calculated as I(sulfate) I(no sulfate). Oxalate currents were measured by addition of 0.2 and 1 mM oxalate in 70Cl-ND96 or 20Cl-ND96 and calculated as I(oxalate) I(no oxalate). Formate currents were measured by addition of 1 and 5 mM formate in 70Cl-ND96 or 20Cl-ND96 and calculated as I(formate) I(no formate). HCO 3 currents were measured by addition of 33 mM HCO 3 /5% CO2 in ND96 containing 67.8 mM Cl or 20Cl-ND96 and calculated as I(bicarbonate) I(no bicarbonate). To prepare 70Cl-ND96 containing 15 mM SO2 4 , 33.6 mM NaCl was replaced with 15 mM Na2SO4, 3.6 mM sodium gluconate, and 7.5 mM choline gluconate or N-methyl-D-glucamine gluconate. To pre pare 20Cl-ND96 containing 48 mM SO2 4 , 96 mM NaCl was replaced with 48 mM Na2SO4, 12.4 mM choline chloride, and 11.6 mM choline gluconate or N-methyl-D-glucamine gluconate. 0Cl-ND96 was prepared by replacing Cl with gluconate, and 70Cl-ND96 and 20Cl-ND96 were prepared by mixing 0Cl-ND96 with ND96 contain ing 103.6 mM Cl. The test solutions with differing SO2 concen4 trations were prepared by mixing 70Cl-ND96 with 70Cl-ND96 con taining 15 mM SO2 or 20Cl-ND96 with 20Cl-ND96 containing 48 4 mM SO2 . Other solutions containing oxalate, formate, and HCO 4 3 were prepared as described above. All solutions were titrated to pH 7.5 at room temperature using NaOH and had an osmolality of 195200 mosmol/kg H2O. The oocyte currents were recorded with an OC-720C voltage clamp (Warner Instruments, Hamden, CT), ltered at 25 kHz, digitized at 10 kHz, and recorded using Pulse software (HEKA, Lambrecht, Germany) as previously described (10). Experiments involving low or no Cl used 3 M KCl-agar bridges. The data were analyzed using the PulseFit program (HEKA). For periods when I-V protocols were not
AJP-Regul Integr Comp Physiol VOL

Table 2. Tiger puffer (Takifugu rubripes) cDNA clones that are homologous to SLC13 and SLC26 family members
Family Scaffold Number Name Protein ID

Slc13

Slc26

3041 (Slc13a1) 102 238 154 1026 1951 (Slc26a6A) 216 (Slc26a6B) 1034 (Slc26a6C) 3467 1679 4271 281 (Slc26a1) 1062 591

FRUP00000136782 FRUP00000148450 FRUP00000134070 FRUP00000162965 FRUP00000141271 FRUP00000158198 FRUP00000149917 FRUP00000131543 FRUP00000144973 FRUP00000133437 FRUP00000153559 FRUP00000138439 FRUP00000161459 FRUP00000137551

17015 526 13061 6429 641 9980 11617 761 19264 7629 22971 15611 1119 29167

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

The result of a BLAST search at the web site http://genome.jgi-psf.org/ fugu6/fugu6.home.html showed that there are 5 Slc13 clones and 9 Slc26 clones.

being run, oocytes were clamped at a Vh of 60 mV, and current was constantly monitored and recorded at 1 Hz. I-V protocols consisted of 200-ms steps from Vh in 20 mV steps between 140 and 60 mV. Data were expressed as means SE. Signicant differences at P 0.01 or P 0.05 were determined by two-sample Students t-test assuming unequal variance.
RESULTS

Identication of candidate sulfate transporters by database mining. The database of The Human Genome Organisation Nomenclature Committee provides a list of 46 solute transporter families and 360 transporter genes (http://www.genenames.org/ and http://www.bioparadigms.org/slc/menu.asp) (14). Members of the solute carrier families SLC13 (31) and SLC26 (34) have sulfate transport activities. We therefore searched the T. rubripes genome sequence for homologs of the human SLC13 and SLC26 family members and identied 14 candidate sequences in the fugu genome (Table 2). Since the members of the Slc26 family can also act as HCO 3 transporters, they had already been characterized in our previous study that identied intestinal HCO 3 transporters upregulated in SW mefugu (27). Thus, the present study extends this analysis to the kidney and SO2 4 transport kinetics of these Slc26 family members. Selection of candidate clones by Northern blot analysis. Partial cDNA clones for the 14 candidate transporters predicted by database mining (5 Slc13 family members and 9 Slc26 family members, Table 2 and Fig. 1A) were obtained by RT-PCR by using RNA preparations from kidney of SW mefugu, sequenced, and used as probes for Northern blot analysis. Among the candidates, eight clones were expressed in the mefugu kidney: mfSlc13a1 (scaffold 3041), mfSlc13a5 (scaffold 1026), mfSlc26a1 (scaffold 281), mfSlc26a5 (scaffold 3467), mfSlc26a6A (scaffold 1951), mfSlc26a6B (scaffold 216), mfSlc26a6C (scaffold 1034), and mfSlc26a11 (scaffold 591). Notably, only the mRNA level of mfSlc26a6A was strongly induced by SW (Fig. 1, B
297 DECEMBER 2009

www.ajpregu.org

R1650

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Fig. 1. Phylogenetic tree of SO2 4 transporters (Slc13 and Slc26) and their mRNA expression levels. A: scaffold numbers of sulfate transporters (Slc13 and Slc26) identied in the fugu genome sequences. Results of the Fugu BLAST search revealed that there are 5 Slc13 clones and 9 Slc26 clones. Neighbor-joining trees (47) were constructed based on the deduced amino acid sequences of Slc13 and Slc26 from mammals. The bootstrap values from a 5,000-replicate analysis are given as % at the nodes. Accession numbers (h, human) are as follows: hSLCA1, AF260824; hSLCA2, U26209; hSLCA3, AF154121; hSLCA4, AF169301; hSLCA5, AY151833; hSLC26A1 (Sat-1), AF297659; hSLC26A2 (DTDST), NM_000112; hSLC26A3 (DRA), NM_000111; hSLC26A4, NM_000441; hSLC26A5, AF523354; hSLC26A6, NM_022911; hSLC26A7, AF331521; hSLC26A8, AF331522; hSLC26A9, AF331525; hSLC26A11, AF345195. Phylogenetic trees were constructed using the Clustal W computer program. The scale bar represents a genetic distance of 0.1 amino acid substitutions per site. B: the mRNA expression levels of candidate transporters for SO2 secretion were examined by Northern blot analysis. Total RNA (20 g) was blotted for Northern 4 analysis. C: real-time PCR quantication of mRNA paralogs: mfSlc26a6A, mfSlc26a6B, mfSlc26a6C, mfSlc26a1, mfSlc13a1; and glutaraldehyde phosphate dehydrogenase (GAPDH). Values are means SE of relative expression compared with values of seawater (S) mefugu. Values in gray bars represent expression levels relative to that of GAPDH. F, freshwater. *P 0.01.

and C), making it the most likely candidate for renal SO2 4 excretion. This result was conrmed by quantitative realtime PCR, which demonstrated that the expression of mfSlc26a6A in the kidney of SW mefugu is 30 2.9 times higher than those of FW mefugu (Fig. 1C, P 0.01, n 5). mfSlc26a6A and mfSlc26a6B are electrogenic Cl/SO2 4 exchangers with distinct activities. Oocytes were injected with mfSlc26a6A, mfSlc26a6B, and mouse Slc26a6 (mSlc26a6) cRNAs, and their cytosolic chloride concentration ([Cl]i) was monitored in response to exposure to Cl-free medium (Fig. 2A). Mouse Slc26a6 (mSlc26a6) was used as a positive control. Exposure to 5 mM SO2 4 elicited a hyperpolarization ( 23.2 2.6 mV, n 3, for mfSlc26a6A; 4.5 1.1 mV, n 3, for mfSlc26a6B; and 5.3 1.4 mV, n 3, for mSlc26a6) but not in control (water-injected) oocytes. In oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6, Cl removal caused marked reduction of [Cl]i (29.6 5.1 M/s, n 3, for mfSlc26a6A; 10.6 3.3 M/s, n 3, for mfSlc26a6B; and 10.3 4.1 M/s, n 3, for mSlc26a6) and a marked hyperpolarization (91.9 10.6 mV, n 3, for

mfSlc26a6A; 68.5 12.3 mV, n 3, for mfSlc26a6B; and 81.2 9.0 mV, n 3, for mSlc26a6). Readdition of Cl elicited depolarization and recovery of [Cl]i. Control oocytes did not show these responses with sequential removal and readdition of Cl. These results indicate that both Slc26a6A and Slc26a6B mediate electrogenic Cl/SO2 exchange. The 4 electrophysiological parameters determined here for the positive control, mSlc26a6, are within ranges equivalent to those reported previously (56). To determine whether the activities of mfSlc26a6A, mfSlc26a6B and mSlc26a6 differed, we analyzed I-V rela tionships using two-electrode voltage-clamp. SO2 (0.2, 1, 4 5, 15, and 48 mM) elicited outwardly rectifying currents in oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 (Fig. 2B and Fig. 3), and these data also support the electrogenic nature of Cl/SO2 exchange. Low Cl 4 concentration (20 mM) reduced the rectication of mfSlc26a6A and yielded nearly linear I-V curves. Remark ably, the SO2 current of mfSlc26a6A oocytes were much 4 greater than those of mfSlc26a6B and mSlc26a6 oocytes (Fig. 2 B and Fig. 4). For example, the currents of
297 DECEMBER 2009

AJP-Regul Integr Comp Physiol VOL

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

R1651

2 Fig. 2. SO 4 transport mediated by mfSlc26a6A, mfSlc26a6B, and mouse Slc26a6 (mSlc26a6). A: representative traces of intracellular Cl concentration ([Cl]i) and membrane potential (Vm) of oocytes injected with mfSlc26a6A (blue), mfSlc26a6B (red), mSlc26a6 (black), or water (gray) are shown. In the continuous presence of 5 mM 2 2 SO4 , the Cl/SO4 exchange activities were monitored as changes in [Cl]i and Vm when extracellular Cl was removed (grey shading) and readded. Results for solution changes from 70 mM Cl ND96 (70ClND96) with 70Cl-ND96 containing 5 mM SO2 are indicated by white boxes; results 4 for solution changes to Cl-free solution (0 Cl) are indicated by gray boxes. Numbers below [Cl]i traces are the initial rates of changes in [Cl]i (M/s). B: current-voltage (I-V) relationships of oocytes expressing mfSlc26a6A (blue), mfSlc26a6B (red), and mSlc26a6 (black), and control oocytes (gray) in the presence of 5 mM SO2 and 70 mM 4 Cl (solid line) or 5 mM SO2 and 20 mM 4 Cl (dotted line) (holding potential, 60 mV). Right: modied version of the left axis in which the vertical axis has been expanded to show weak activities of mfSlc26a6B and mouse Slc26a6. Values are means SE, n 3 6. Sulfate-elicited currents were calculated as I(sulfate) I(no sulfate).

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

mfSlc26a6A oocytes were approximately 35 A at 60 mV (50 to 200 times larger than those of mfSlc26a6B and mSlc26a6 oocytes; P 0.01, n 3 6 for each condition). 2 SO 4 steady-state kinetics were calculated from the Michaelis-Menten equation (Fig. 5). The Imax value of mfSlc26a6A for SO2 4 (63.8 4.0 A) was 86 to 100 times higher than those of mfSlc26a6B and mSlc26a6 (0.63 0.18 A for mfSlc26a6B and 0.74 0.19 A for mSlc26a6) when [Cl]out is 70 mM (P 0.01, n 4 for each condition) and is 10 to 15 times greater than those of the others when [Cl]out is 20 mM (47.6 5.0 A for mfSlc26a6A; 4.9 0.37 A for mSlc26a6; and 3.2 0.71 A for mSlc26a6; P 0.01, n 3 6 for each condition). mfSlc26a6A also showed approximately twofold higher 2 SO 4 afnity than mfSlc26a6B and mSlc26a6 when [Cl ]out was 70 mM (Km 5.3 0.9 mM for mfSlc26a6A; 11.7 6.6 mM for mSlc26a6; and 12.7 5.9 mM for mSlc26a6). The SO2 4 afnity was 15-fold greater afnity than mfSlc26a6B and mSlc26a6 when [Cl]out was 20 mM (Km 1.7 0.8 mM for mfSlc26a6A; 29.5 9.2 mM for mSlc26a6; and 19.4 10.2 mM for mSlc26a6). However, reduction of [Cl]out from 70 mM to 20 mM did not change
AJP-Regul Integr Comp Physiol VOL

Imax (mfSlc26a6A), did reduce Km (mfSlc26a6A) threefold, but increased both I max and K m of mfSlc26a6B and mSlc26a6. Other transport activities of mfSlc26a6A and mfSlc26a6B. Mammalian Slc26a6 transports several anions such as 2 HCO 3 , SO 4 , formate, and oxalate (18, 23, 56). We have shown that mfSlc26a6A and mfSlc26a6B are electrogenic 2 Cl/nHCO 3 exchangers (27) and electrogenic Cl /SO 4 exchangers (above). Therefore, we next tested whether mfSlc26a6A and mfSlc26a6B transported oxalate and formate and compared their activities to those of mSlc26a6. [Cl]i was monitored in response to Cl-removal in the presence of formate or oxalate. Exposure of the oocytes to 1 mM oxalate in the presence of normal-bath Cl (104 mM) did not affect the [Cl]i; it did elicit a small hyperpolarization (6.1 1.2 mV, n 3, for mfSlc26a6A; 4.5 1.4 mV, n 3, for mfSlc26a6B; and 1.4 0.2 mV, n 3, for mSlc26a6) but not in control oocytes (Fig. 6A). In oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6, Cl removal in the presence of 1 mM oxalate caused marked reduction of [Cl]i (18.2 6.0 M/s, n 3, for mfSlc26a6A; 9.9 2.8 M/s, n 3, for
297 DECEMBER 2009

www.ajpregu.org

R1652

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Fig. 3. SO2 4 dose response: I-V relationships. I-V curves from oocytes expressing mfSlc26a6A (A), mfSlc26a6B (B), and mouse Slc26a6 (C) and water-injected oocytes (D) in the presence of various SO2 4 concentrations (holding potential, 60 mV) are shown. Results in the presence of 70 and 20 mM Cl are shown top and bottom, respectively. Values are means SE, n 3 6. Sulfate-elicited currents were calculated as I(sulfate) I(no sulfate).

mfSlc26a6B; and 27.5 7.6 M/s, n 3, for mSlc26a6) and a marked hyperpolarization (61.5 8.4 mV, n 3, for mfSlc26a6A; 65.2 3.4 mV, n 3, for mfSlc26a6B; and 59.9 6.1 mV, n 3, for mSlc26a6). Cl readdition elicited a depolarization and recovery of [Cl]i. Control oocytes did not show any of these responses with Cl removal and readdition.

These results indicate that the mefugu and mouse Slc26a6 paralogs mediate electrogenic Cl/oxalate2 exchange. Likewise, exposure to 5 mM formate (normal-bath Cl) did not affect either [Cl]i or Vm of oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 (Fig. 6B). Cl removal (with bath formate) caused marked reduction of [Cl]i (121 14 M/s,

Fig. 4. Comparison of currents elicited by 2 HCO in oocytes ex3 , oxalate, and SO4 pressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6. The relative currents at 60 mV compared with the mean SE of the currents of mfSlc26a6A oocytes at the same conditions were calculated and are shown, n 3 6. The solution conditions are indicated at the bottom. *P 0.01; **P 0.05.

AJP-Regul Integr Comp Physiol VOL

297 DECEMBER 2009

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

R1653

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Fig. 5. Steady-state kinetics of SO2 trans4 port. A: the Michaelis-Menten equation tted to sulfate-elicited currents of oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 at 60 mV. Sulfate-elicited currents were measured by addition of 0.2, 1, 5, and 15 mM SO2 in the presence of 70 mM Cl or addi4 tion of 0.2, 1, 5, 15, and 48 mM SO2 in the 4 presence of 20 mM Cl and were calculated as I(sulfate) I(no sulfate). Maximum current (Imax) and Michaelis-Menten constant (Km) are shown. Values are means SE, n 3 6. Imax and Km values as a function of Vm are shown in B and C, respectively.

n 3, for mfSlc26a6A; 105 6.1 M/s, n 3, for mfSlc26a6B; and 89.1 8.8 M/s, n 3, for mSlc26a6) but did not show a corresponding hyperpolarization. Cl readdition resulted in recovery of [Cl]i. Again, control oocytes did not show these responses with the same experimental manipulation. These
AJP-Regul Integr Comp Physiol VOL

results indicate that mfSlc26a6A, mfSlc26a6B, and mSlc26a6 mediate electroneutral Cl/formate exchange. To compare the transport activities of mfSlc26a6A, mfSlc26a6B, and mSlc26a6 in more detail, we analyzed I-V relationships in the presence of formate or oxalate. In the
297 DECEMBER 2009

www.ajpregu.org

R1654

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Fig. 6. Formate and oxalate transport mediated by mfSlc26a6A, mfSlc26a6B, and mSlc26a6. A and B: representative traces of intracellular Cl concentration ([Cl]i) and Vm of oocytes injected with mfSlc26a6A (blue), mfslc26a6B (red), mSlc26a6 (black), and water (gray) are shown. In the continuous presence of 1 mM oxalate (A) and 5 mM formate (B), the Cl/oxalate and Cl/formate exchange activities were monitored as changes in [Cl]i and Vm when extracellular Cl was removed (grey shading) and readded. Results for solution changes from 70 mM-Cl ND96 (70Cl-ND96) to 70Cl-ND96 containing 1 mM oxalate or 5 mM formate are indicated by white boxes, and results for solution changes to Cl-free solution are indicated by gray boxes. C F: I-V relationships of oocytes in the presence of 1 mM oxalate (C), 0.2 mM oxalate (D), 5 mM formate (E), or 33 mM HCO 3 /5% CO2 (F) (holding potential, 60 mV). Values are means SE, n 3 4. Currents elicited with oxalate, formate, or HCO 3 were measured in the presence of 70 and 20 mM Cl (solid and dotted lines, respectively) and calculated as I(oxalate) I(no oxalate), I(formate) I(no formate), and I(bicarbonate) I(no bicarbonate).

AJP-Regul Integr Comp Physiol VOL

297 DECEMBER 2009

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

R1655

presence of 1 mM (data not shown) or 5 mM (Fig. 6E) formate, oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 did not display currents different than water-injected oocytes. Moreover, these same Slc26a6 oocytes did have obvious I-V responses when tested for SO2 4 transport. These data further support the electroneutral nature of Cl/formate exchange by these Slc26a6-transporters. In contrast, oxalate (0.2 or 1 mM) elicited outwardly rectifying currents in oocytes expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 (Fig. 6, C and D). Likewise, these data indicate the electrogenic nature of Cl/ oxalate exchange of these Slc26a6-transporters. In all cases, the currents were enhanced at lower Cl concentration (20 mM) and higher oxalate concentration (1 mM). The I-V curves of oocyte expressing mfSlc26a6A, mfSlc26a6B, and mSlc26a6 were almost the same, except for one exception. Only for the case of 20 mM Cl and 1 mM oxalate at 60 mV did oocytes expressing mfSlc26a6A show 1.4 to 2.0 times larger current than oocytes expressing mfSlc26a6B and mSlc26a6 (Fig. 4, P 0.05, n 3). I-V relationships in the presence of 5% CO2/33 mM HCO 3 were also analyzed; these are shown in Fig. 6F. Functional analyses of mfSlc26a6C. Oocytes were injected with mfSlc26a6C cRNA, and their cytosolic chloride concentrations and pH were monitored in response to exposure to 2 Cl-free medium in the presence of HCO 3 , SO4 , formate, and oxalate. However, oocytes expressing mfSlc26a6C showed no changes in [Cl]i, pHi, or Vm (data not shown). These results suggest that mfSlc26a6C is not an anion exchanger, and further analyses are necessary to determine the function of this protein.

Immunohistochemical localization of mfSlc26a6A in the SW mefugu kidney. Sections of the kidney of SW mefugu were analyzed by immunouorescence. Three types of tubules (proximal tubule, distal tubule, and collecting duct) are present in mefugu kidney (20), and each type of tubule is distinguished by anti-Na-K-ATPase staining (20, 28). Costaining of mfSlc26a6A and Na-K-ATPase showed that mfSlc26a6A exists in the apical membrane of proximal tubule epithelial cells (Fig. 7, C and F), through which SO2 4 is thought to be secreted (40, 44). Additionally, mfSlc26a6A also localizes to the brush-border region of the proximal tubules, which are stained with phalloidin (Fig. 7, G and H). Phalloidin binds to actin laments, and strongly stains a well-developed apical brush border of proximal tubules (20). No such signals were observed when the tissues were stained with preimmune serum as a negative control. The specicity of these antibodies was established by specic staining of mammalian culture cells (COS7) exogenously expressing the antigens (27).
DISCUSSION

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Marine teleosts maintain body uid homeostasis by drinking SW and eliminating excess ions. Sulfate (SO2 4 ) is the second most abundant anion in SW, present at an average of 27 mM. It is estimated that the rate of SO2 ingestion through SW 4 drinking in marine sh is 30 150 mol kg1 h1 (33). This ingestion rate is much greater than the catabolic generation of SO2 4 from the sulfur-containing amino acids (estimated to be 4 to 13 mol kg1 h1 under fasting conditions) (22, 55). Marine teleosts must therefore continually eliminate this ex-

Fig. 7. Immunohistochemistry of mfSlc26a6A in the kidney of SW-acclimated mefugu. AF: sections of mefugu kidney were stained with anti-mfSlc26a6A (green), anti-rat Na-K-ATPase (red), and Hoechst 33258 (nucleus, blue). Scale bars: 50 m. P, proximal tubule; D, distal tubule. G and H: sections of kidney were stained with anti-mfSlc26a6A (green), phalloidin (red), and Hoechst (blue). Bars: 50 m. AJP-Regul Integr Comp Physiol VOL
297 DECEMBER 2009

www.ajpregu.org

R1656

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

2 cess SO2 4 through the kidney to keep the plasma [SO4 ] at a normal physiological concentration (2 mM). Similar handling of sulfate may occur in other marine vertebrates that drink SW, including certain species of marine mammals (36). It is known that the bladder urine [SO2 4 ] is 40 80 mM in marine teleosts, which is created by SO2 secretion from 4 epithelial cells of the renal proximal tubules (33). However, the transporter(s) involved in the epithelial secretion of SO2 4 have not been determined. In this study, by using genome resources of Takifugu and its related euryhaline species mefugu, we identied candidate transporters for SO2 in the kidney of 4 marine teleosts. Database mining demonstrated that sh have three paralogs for Slc26a6: mfSlc26a6A, mfSlc26a6B, and mfSlc26a6C. The commonly studied mammals have a single gene for Slc6a6 that generates two splice variants named Slc26a6a and Slac6a6b, and they are expressed in various tissues including the intestine and kidney. In vitro, Slc26a6 mediates exchange of various anions such as sulfate (SO2 4 ), chloride (Cl ), iodide (I ), formate (HCOO ), oxalate ([COO ]2), hydroxyl ion (OH ), and bicarbonate (HCO 3 ). Comparative analyses between wildtype and Slc26a6/ mice have demonstrated that Slc26a6 mediates oxalate-stimulated NaCl absorption and contributes to apical membrane Cl/base exchange in the kidney proximal tubule (53), to HCO 3 secretion in the duodenum (53) and pancreatic duct (52), and to intestinal secretion of oxalate that reduces the plasma [oxalate] and frequency of urinary stones

(17). In SW-acclimated mefugu, we found that the expression of mfSlc26a6A is dramatically increased in the kidney (Fig. 1), as well as in the intestine (27). HCO 3 secretion in the intestine is stimulated in marine teleosts; this facilitates the precipitation of Ca2 and Mg2 for rectal excretion (12, 13, 54). We have proposed that mfSlc26a6A and mfSlc26a6B are the strongest candidates for the transporters responsible for HCO 3 secretion by the intestine (27). In this study, we also propose that mfSlc26a6A is the strongest candidate for SO2 4 secretion by the marine teleost kidney. Both results suggest that mfSlc26a6A is one of the key molecules involved in SW acclimation of sh. The mfSlc26a6A clone displayed extremely large SO2 4 2 currents when expressed in Xenopus oocytes, i.e., the SO4 elicited current is 50 100 times larger than those measured from mfSlc26a6B or mSlc26a6. Immunohistochemical analyses demonstrated that the mfSlc26a6A protein localizes to the apical membrane of proximal tubules, where marine teleosts 2 secrete SO2 transporters be4 . Furthermore, among all SO4 longing to the Slc13 and Slc26 families in the Takifugu genome, mfSlc26a6A exhibited the largest induction in the SW mefugu kidney. The mRNA expression level in the kidney of SW mefugu is 2.3- and 140-fold greater than the other apical SO2 4 transporters (mfSlc26a6B and mfSlc13a1), respectively. These ndings strongly suggest that mfSlc26a6A mainly con ducts SO2 4 at the apical proximal tubule membrane of marine teleosts and is the most likely candidate for the long-sought renal SO2 4 secretor of the marine teleost kidney (Fig. 8A).

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

Fig. 8. Hypothetical model for the epithelial secre tion system for SO2 in SW sh kidney. A: in SW 4 proximal tubular cells, Slc26a6A is localized to the apical membrane (Fig. 5). mfSlc26a6A acts as an electrogenic Cl/SO2 exchanger, and the negative 4 Vm may be the driving force for SO2 secretion. 4 Brush-border membrane vesicles isolated from the kidney of SW sh have SO2 4 /anion exchange activities (37, 43, 44). The basolateral localization of Slc26a1 in the proximal tubule of SW sh has not been directly demonstrated, but has been demonstrated in the kidney of FW sh (35) and mammals (19). The mode of action of Slc26a1 has also not yet been directly revealed, but studies of basolateral membranes isolated from SW sh (43) and mammals (26, 39) have proposed the electroneutral 2 2 exchange of 2HCO 3 /SO4 or 2OH /SO4 . B: hypo thetical model of the SO2 reabsorption system in 4 FW sh kidney based on the study of FW-acclimated eel. In proximal tubular cells, Slc13a1 and Slc26a1 are located in the apical and basolateral membranes, respectively (35). The model indicates that SO2 4 reabsorption is driven by Na-K-ATPase. Stoichiometry of the ions transported by Slc13a1 is assumed to be the same as for mammalian orthologs (4). Na gradient dependent SO2 4 uptake has only been demonstrated by renal brush-border membrane (BBM) vesicles from avian and mammalian species (42, 49, 51) but not by that of marine teleost (43), and the expression of Slc13a1 disappeared in the kidney of SW-acclimated eel (35). Therefore, the Na dependent SO2 uptake is abolished in the proximal 4 tubule of SW sh. TJ, tight junction.

AJP-Regul Integr Comp Physiol VOL

297 DECEMBER 2009

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST

For the secretion of SO2 into the primary urine, which 4 contains high concentrations of SO2 (up to 80 mM), a 4 powerful driving force is necessary. Since the exchange of Cl/SO2 causes a decrease in the intracellular negative 4 charge, the intracellular negative charge maintained by the sodium pump (Na-K-ATPase) will drive the electrogenic 2 Cl /SO 4 exchange. Namely, as shown in Fig. 8 A , mfSlc26a6A is an electrogenic Cl/SO2 4 exchanger, indirectly driven by Na -K -ATPase. Because of the difculty of mea suring [SO2 4 ]in in oocytes, we were unable to determine the stoichiometry of Cl/SO2 4 exchange in the present study; if we assume a 1:1 stoichiometry, we can theoretically calculate the mfSlc26a6A currents based on the following equation (Table 3).

R1657

Slc26a6 ClSO4 Cl SO4 RT ln([Cl]in/[Cl]out) (1) FVm 2 {RT ln([SO2 4 ]in/[SO4 ]out) (2) FVm} where R is the gas constant, T is the absolute temperature, F is the Faraday constant, ln is the natural log, Vm is the membrane potential, and ion is the electrochemical potential difference (Joules/mole). When we use this equation for the model of the proximal tubule of SW sh, we can estimate the ratio of [SO2 4 ] in the primary urine and the cytoplasm of the proximal 2 tubule as [SO2 4 ]out/[SO4 ]in values. At the condition of equi 2 libria, the calculated [SO2 4 ]out/[SO4 ]in values are 167, 112, and 75 when Vm is 80, 70, and 60 mV, respectively, under the following assumptions: 1) [Cl]out is 140 mM, which is similar to plasma [Cl] of SW-acclimated mefugu (20); 2) [Cl]in is 20 mM, which is similar to cytosolic [Cl] of mammalian proximal tubular cells (5, 16, 24); and 3) the temperature is 293 K (20C). These thermodynamic calcula tions suggest that mfSlc26a6A can concentrate SO2 4 in urine 2 up to 40 mM when the [SO4 ]in is 0.24 to 0.53 mM. These results of thermodynamic calculations t well with the hypo thetical model for the secretion of SO2 4 by the proximal tubule 2 (Fig. 8A). In this calculation, the value of [SO2 4 ]out/[SO4 ]in increases with higher values of [Cl ]out/[Cl ]in and lower values of Vm. Therefore 1) high Vm (negative inside) produced by Na-K-ATPase; 2) low cytoplasmic [Cl], which is possibly secreted by chloride channel(s); and 3) high cytoplas mic [SO2 4 ] of 1 mM, which is possibly supplied by baso lateral Slc26a1 are sufcient for the apical secretion of SO2 4 by mfSlc26a6A. To denitively establish its physiological role
Table 3. Calculations of [SO2 ]out/[SO2 ]in and [SO2 ]in 4 4 4 2 under various conditions of [Cl ]in, [Cl ]out, [SO4 ]out, and Vm at the equilibria (slc26a6A 0) when the stoichiometry of Cl/SO2 exchange by mfSlc26a6a is supposed to be a 1:1 4

Vm, mV

[Cl]out, mM

[Cl]in, mM

[SO2 4 ]out, mM

[SO2 4 ]in, mM

2 [SO2 4 ]out/[SO4 ]in

50 60 70 80 90 70 70 70 70

140 140 140 140 140 140 140 140 140

20 20 20 20 20 5 10 20 30

40 40 40 40 40 40 40 40 40

0.79 0.53 0.36 0.24 0.16 0.09 0.18 0.36 0.54

51 75 112 167 247 448 224 112 75

in the renal sulfate secretion of marine teleosts, it will be necessary to demonstrate that the mfSlc26a6A can fulll the necessary function in vivo. It is worth mentioning, however, that our electrophysiological data obtained using the Xenopus oocyte expression system clearly demonstrate that mfSlc26a6A has the ability to excrete sulfate under conditions relevant to uids in the renal tubules of teleost sh (sulfate being the dominant anion with Cl present). In FW sh, SO2 4 is absorbed by the renal proximal tubule 2 for SO4 homeostasis. Not all SO2 4 is secreted, as low levels of SO2 are necessary for biosyntheses of sulfated extracellu4 lar matrix proteins such as chondroitin sulfate and keratan sulfate. Recently, Nakada et al. (35) have demonstrated that the apical Na-SO2 4 cotransporter Slc13a1 (NaSi-1) and basolat eral Cl/SO2 exchanger Slc26a1 (Sat-1) are upregulated in 4 the eel kidney during FW acclimation, and they proposed a model of SO2 4 absorption by the FW teleosts kidney (35) (Fig. 8B). However, this model has not been conrmed in mefugu because the expression of mfSlc13a1 was relatively low and was not induced in the kidney of FW-acclimated mefugu (Fig. 1, B and C). In SW sh, we have proposed that mfSlc26a6A is the apical Cl/SO2 exchanger for SO2 secretion by the 4 4 kidney. Future studies should seek to identify the molecular entity that encodes the basolateral transporter mediating SO2 4 entry to proximal tubule cells from blood vessels. The strongest candidate for this is Slc26a1; we base this claim on the following observations. The expression of renal Slc26a1 is 1) upregulated in FW eel but is detectable in SW eel at signicant levels (35); 2) upregulated in rainbow trout when Na2SO4 is injected (21); and 3) abundantly expressed in both FW and SW mefugu (Fig. 1, B and C). These ndings indicate that Slc26a1 may have a role in basolateral, renal SO2 4 transport in both FW and SW sh. Thus, it is likely that lower intracellular SO2 concentrations are achieved by Slc26a6A 4 function in SW (Fig. 8A), and higher intracellular SO2 4 concentrations are achieved by Slc13a1 function in FW (Fig. 8B). The regulated action of these transporters creates a SO2 4 concentration gradient across basolateral membranes, which in turn allows SO2 to move in opposite directions in SW and 4 FW conditions, yet still using the same basolateral Slc26a1 protein. The striking SO2 activity differences between mfSlc26a6A 4 and mfSlc26a6B or mSlc26a6 are noteworthy, i.e., mfSlc26a6A SO2 currents are 10-fold higher than the other Slc26a6 trans4 porters. In general, oocytes expressing ion transporters exhibit currents between several hundred nA to several A, and those expressing ion channels exhibit currents between several dozen to 100 A (6). Therefore, SO2 4 -elicited current of mfSlc26a6A is as high as that of ion channels or a transporter with a very high turnover number such as ClC-4 or ClC-5 (38, 48). Interestingly, this high activity is specic for SO2 4 as the mfSlc26a6A currents elicited by other anions (HCO and oxalate) are much lower, i.e., 3 comparable to those of mfSlc26a6B and mSlc26a6. Further analyses on chimeric transporters of mfSlc26a6A, mfSlc26a6B, and mSlc26a6 could reveal a domain or motif that bears the SO2 4 specic activity of mfSlc26a6A. Perspectives and Signicance Marine teleosts avoid dehydration by continuously drinking SW, which contains high concentrations of Ca2 and SO2 4 .
297 DECEMBER 2009

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

The temperature is supposed to be 293 K (20C). Vm, membrane potential. AJP-Regul Integr Comp Physiol VOL

www.ajpregu.org

R1658

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST 4. Busch AE, Waldegger S, Herzer T, Biber J, Markovich D, Murer H, Lang F. Electrogenic cotransport of Na and sulfate in Xenopus oocytes expressing the cloned Na SO2 transport protein NaSi-1. J Biol Chem 4 269: 1240712409, 1994. 5. Cassola AC, Mollenhauer M, Fromter E. The intracellular chloride activity of rat kidney proximal tubular cells. Pu gers Arch 399: 259 265, 1983. 6. Chang MH, Plata C, Zandi-Nejad K, Sindic A, Sussman CR, Mercado A, Broumand V, Raghuram V, Mount DB, Romero MF. Slc26a9-anion exchanger, channel and Na transporter. J Membr Biol 228: 125140, 2009. 7. Cliff WH, Beyenbach KW. Secretory renal proximal tubules in seawaterand freshwater-adapted killish. Am J Physiol Renal Fluid Electrolyte Physiol 262: F108 F116, 1992. 8. Dawson PA, Beck L, Markovich D. Hyposulfatemia, growth retardation, reduced fertility, and seizures in mice lacking a functional NaSi-1 gene. Proc Natl Acad Sci USA 100: 13704 13709, 2003. 9. Dickman KG, Renfro JL. Primary culture of ounder renal tubule cells: transepithelial transport. Am J Physiol Renal Fluid Electrolyte Physiol 251: F424 F432, 1986. 10. Dinour D, Chang MH, Satoh J, Smith BL, Angle N, Knecht A, Serban I, Holtzman EJ, Romero MF. A novel missense mutation in the sodium bicarbonate cotransporter (NBCe1/SLC4A4) causes proximal tubular acidosis and glaucoma through ion transport defects. J Biol Chem 279: 52238 52246, 2004. 11. Evans DH, Piermarini PM, Choe KP. The multifunctional sh gill: dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiol Rev 85: 97177, 2005. 12. Grosell M. Intestinal anion exchange in marine sh osmoregulation. J Exp Biol 209: 28132827, 2006. 13. Grosell M, Taylor JR. Intestinal anion exchange in teleost water balance. Comp Biochem Physiol A Mol Integr Physiol 148: 14 22, 2007. 14. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, Bruford EA. The ABCs of solute carriers: physiological, pathological and therapeutic implications of human membrane transport proteins introduction. Pu gers Arch 447: 465 468, 2004. 15. Hirose S, Kaneko T, Naito N, Takei Y. Molecular biology of major components of chloride cells. Comp Biochem Physiol B Biochem Mol Biol 136: 593 620, 2003. 16. Ishibashi K, Sasaki S, Yoshiyama N. Intracellular chloride activity of rabbit proximal straight tubule perfused in vitro. Am J Physiol Renal Fluid Electrolyte Physiol 255: F49 F56, 1988. 17. Jiang Z, Asplin JR, Evan AP, Rajendran VM, Velazquez H, Nottoli TP, Binder HJ, Aronson PS. Calcium oxalate urolithiasis in mice lacking anion transporter Slc26a6. Nat Genet 38: 474 478, 2006. 18. Jiang Z, Grichtchenko II, Boron WF, Aronson PS. Specicity of anion exchange mediated by mouse Slc26a6. J Biol Chem 277: 3396333967, 2002. 19. Karniski LP, Lotscher M, Fucentese M, Hilker H, Biber J, Murer H. Immunolocalization of sat-1 sulfate/oxalate/bicarbonate anion exchanger in the rat kidney. Am J Physiol Renal Physiol 275: F79 F87, 1998. 20. Kato A, Doi H, Nakada T, Sakai H, Hirose S. Takifugu obscurus is a euryhaline fugu species very close to Takifugu rubripes and suitable for studying osmoregulation. BMC Physiol 5: 18, 2005. 21. Katoh F, Tresguerres M, Lee KM, Kaneko T, Aida K, Goss GG. Cloning of rainbow trout SLC26A1: involvement in renal sulfate secretion. Am J Physiol Regul Integr Comp Physiol 290: R1468 R1478, 2006. 22. Kaushik SJ. Whole body amino acid composition of European seabass (Dicentrarchus labrax), gilthead seabream (Sparus aurata) and turbot (Psetta maxima) with an estimation of their IAA requirement proles. Aquat Living Resour 11: 355358, 1998. 23. Knauf F, Yang CL, Thomson RB, Mentone SA, Giebisch G, Aronson PS. Identication of a chloride-formate exchanger expressed on the brush border membrane of renal proximal tubule cells. Proc Natl Acad Sci USA 98: 94259430, 2001. 24. Krapf R, Berry CA, Verkman AS. Estimation of intracellular chloride activity in isolated perfused rabbit proximal convoluted tubules using a uorescent indicator. Biophys J 53: 955962, 1988. 25. Krick W, Schnedler N, Burckhardt G, Burckhardt BC. Ability of sat-1 to transport sulfate, bicarbonate, or oxalate under physiological conditions. Am J Physiol Renal Physiol 297: F145F154, 2009. 26. Kuo SM, Aronson PS. Oxalate transport via the sulfate/HCO3 exchanger in rabbit renal basolateral membrane vesicles. J Biol Chem 263: 9710 9717, 1988.
297 DECEMBER 2009

The major portions of the Ca2 and SO2 burdens acquired 4 from drinking SW are eliminated by intestinal precipitation of Ca2 with bicarbonate and by renal excretion of sulfate, respectively, both of which involve Slc26a6A transport (27). Consistent with its broad ion specicity, Slc26a6A acts as a bicarbonate transporter in the intestine, as demonstrated in our previous work (27), and a sulfate (SO2 4 ) transporter in the kidney (present study) depending on the surrounding ionic conditions. It therefore seems that the substrate promiscuity of a single gene product, Slc26a6A, is an effective strategy for marine teleosts to perform different tasks in different tissues. In this context, determination of the mechanism by which the Slc26a6A gene expression is regulated in the intestine and kidney is an important issue to be addressed in future studies. The molecular mechanisms for the elimination of ionic burdens acquired by drinking SW, have been claried at the molecular level for the following major ions: Na, Cl (for reviews, see Refs. 11, 15, 32), Ca2 (27), SO2 4 (present study). The major unresolved issues in euryhaline adaptation are the molecular identication of Mg2 and borate transporters. SW contains 53 mM Mg2, and therefore marine sh are exposed to continuous Mg2 inux. The kidney plays a major role in Mg2 excretion (130 mM in the urine of SW sh) (2, 3, 33), and the identication of Mg2 transporters involved in this process is essential. SW also contains 0.4 mM borate, which would exert deleterious effects on marine teleosts without an efcient eliminating system.

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

ACKNOWLEDGMENTS We thank Heather L. Holmes and Elyse M. Scileppi for technical support; Dr. Taku Hirata, Dr. Kentaro Miyamoto, and Manami Matsuura-Nakada for their contribution in the early stage of this work; and Setsuko Sato and Tomoko Okada for secretarial assistance. Present address of T. Nakada: Molecular Pharmacology, Shinshu University School of Medicine, Nagano, Japan. GRANTS This work was supported by the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT) Grants-in-Aid for Scientic Research 14104002, 17570003, 18059010, and 19770057 and the 21st Century and Global Center of Excellence Program of MEXT. Work in the Romero lab was supported by National Eye Institute Grant EY-017732 and Cystic Fibrosis Foundation Grant 06G0 (to M. F. Romero). DISCLOSURES No conicts of interest are declared by the author(s). REFERENCES 1. Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P, Christoffels A, Rash S, Hoon S, Smit A, Gelpke MD, Roach J, Oh T, Ho IY, Wong M, Detter C, Verhoef F, Predki P, Tay A, Lucas S, Richardson P, Smith SF, Clark MS, Edwards YJ, Doggett N, Zharkikh A, Tavtigian SV, Pruss D, Barnstead M, Evans C, Baden H, Powell J, Glusman G, Rowen L, Hood L, Tan YH, Elgar G, Hawkins T, Venkatesh B, Rokhsar D, Brenner S. Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes. Science 297: 13011310, 2002. 1a.American Physiological Society. Guiding principles for research involving animals and human beings. Am J Physiol Regul Integr Comp Physiol 283: R281R283, 2002. 2. Beyenbach KW. Renal handling of magnesium in sh: from whole animal to brush border membrane vesicles. Front Biosci 5: D712D719, 2000. 3. Beyenbach KW, Freire CA, Kinne RK, Kinne-Saffran E. Epithelial transport of magnesium in the kidney of sh. Miner Electrolyte Metab 19: 241249, 1993. AJP-Regul Integr Comp Physiol VOL

www.ajpregu.org

SULFATE EXCRETION TRANSPORTERS IN MARINE TELEOST 27. Kurita Y, Nakada T, Kato A, Doi H, Mistry AC, Chang MH, Romero MF, Hirose S. Identication of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost sh. Am J Physiol Regul Integr Comp Physiol 294: R1402R1412, 2008. 28. Lin CH, Tsai RS, Lee TH. Expression and distribution of Na, K-ATPase in gill and kidney of the spotted green puffersh, Tetraodon nigroviridis, in response to salinity challenge. Comp Biochem Physiol A Mol Integr Physiol 138: 287295, 2004. 29. Markovich D. Physiological roles and regulation of mammalian sulfate transporters. Physiol Rev 81: 1499 1533, 2001. 30. Markovich D, Aronson PS. Specicity and regulation of renal sulfate transporters. Annu Rev Physiol 69: 361375, 2007. 31. Markovich D, Murer H. The SLC13 gene family of sodium sulphate/ carboxylate cotransporters. Pu gers Arch 447: 594 602, 2004. 32. Marshall WS. Na, Cl, Ca2 and Zn2 transport by sh gills: retrospective review and prospective synthesis. J Exp Zool 293: 264 283, 2002. 33. Marshall WS, Grosell M. Ion transport, osmoregulation, and acid-base balance. In: The Physiology of Fishes (3rd ed.), edited by Evans DH and Claiborne JB. Boca Raton, FL: CRC, 2006, p. 177230. 34. Mount DB, Romero MF. The SLC26 gene family of multifunctional anion exchangers. Pu gers Arch 447: 710 721, 2004. 35. Nakada T, Zandi-Nejad K, Kurita Y, Kudo H, Broumand V, Kwon CY, Mercado A, Mount DB, Hirose S. Roles of Slc13a1 and Slc26a1 sulfate transporters of eel kidney in sulfate homeostasis and osmoregulation in freshwater. Am J Physiol Regul Integr Comp Physiol 289: R575 R585, 2005. 36. Ortiz RM. Osmoregulation in marine mammals. J Exp Biol 204: 1831 1844, 2001. 37. Pelis RM, Renfro JL. Role of tubular secretion and carbonic anhydrase in vertebrate renal sulfate excretion. Am J Physiol Regul Integr Comp Physiol 287: R491R501, 2004. 38. Picollo A, Pusch M. Chloride/proton antiporter activity of mammalian CLC proteins ClC-4 and ClC-5. Nature 436: 420 423, 2005. 39. Pritchard JB, Renfro JL. Renal sulfate transport at the basolateral membrane is mediated by anion exchange. Proc Natl Acad Sci USA 80: 26032607, 1983. 40. Renfro JL. Adaptability of marine teleost renal inorganic sulfate excretion: evidence for glucocorticoid involvement. Am J Physiol Regul Integr Comp Physiol 257: R511R516, 1989. 41. Renfro JL. Recent developments in teleost renal transport. J Exp Zool 283: 653 661, 1999. 42. Renfro JL, Clark NB, Metts RE, Lynch MA. Glucocorticoid inhibition of Na-SO4 transport by chick renal brush-border membranes. Am J Physiol Regul Integr Comp Physiol 256: R1176 R1183, 1989.

R1659

43. Renfro JL, Pritchard JB. H-dependent sulfate secretion in the marine teleost renal tubule. Am J Physiol Renal Fluid Electrolyte Physiol 243: F150 F159, 1982. 44. Renfro JL, Pritchard JB. Sulfate transport by ounder renal tubule brush border: presence of anion exchange. Am J Physiol Renal Fluid Electrolyte Physiol 244: F488 F496, 1983. 45. Romero MF, Fong P, Berger UV, Hediger MA, Boron WF. Cloning and functional expression of rNBC, an electrogenic Na-HCO 3 cotransporter from rat kidney. Am J Physiol Renal Physiol 274: F425F432, 1998. 46. Romero MF, Henry D, Nelson S, Harte PJ, Dillon AK, Sciortino CM. Cloning and characterization of a Na-driven anion exchanger (NDAE1). A new bicarbonate transporter. J Biol Chem 275: 2455224559, 2000. 47. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406 425, 1987. 48. Scheel O, Zdebik AA, Lourdel S, Jentsch TJ. Voltage-dependent electrogenic chloride/proton exchange by endosomal CLC proteins. Nature 436: 424 427, 2005. 49. Schneider EG, Durham JC, Sacktor B. Sodium-dependent transport of inorganic sulfate by rabbit renal brush-border membrane vesicles. Effects of other ions. J Biol Chem 259: 1459114599, 1984. 50. Sciortino CM, Romero MF. Cation and voltage dependence of rat kidney electrogenic Na-HCO 3 cotransporter, rkNBC, expressed in oocytes. Am J Physiol Renal Physiol 277: F611F623, 1999. 51. Turner RJ. Sodium-dependent sulfate transport in renal outer cortical brush border membrane vesicles. Am J Physiol Renal Fluid Electrolyte Physiol 247: F793F798, 1984. 52. Wang Y, Soyombo AA, Shcheynikov N, Zeng W, Dorwart M, Marino CR, Thomas PJ, Muallem S. Slc26a6 regulates CFTR activity in vivo to determine pancreatic duct HCO 3 secretion: relevance to cystic brosis. EMBO J 25: 5049 5057, 2006. 53. Wang Z, Wang T, Petrovic S, Tuo B, Riederer B, Barone S, Lorenz JN, Seidler U, Aronson PS, Soleimani M. Renal and intestinal transport defects in Slc26a6-null mice. Am J Physiol Cell Physiol 288: C957C965, 2005. 54. Wilson RW, Wilson JM, Grosell M. Intestinal bicarbonate secretion by marine teleost shwhy and how? Biochim Biophys Acta 1566: 182193, 2002. 55. Wood CM. Ammonia and urea metabolism and excretion. In: The Physiology of Fishes, edited by Evans DH. Boca Raton, FL: CRC, 1993, p. 379 426. 56. Xie Q, Welch R, Mercado A, Romero MF, Mount DB. Molecular characterization of the murine Slc26a6 anion exchanger: functional comparison with Slc26a1. Am J Physiol Renal Physiol 283: F826 F838, 2002. 57. Yamanoue Y, Miya M, Matsuura K, Miyazawa S, Tsukamoto N, Doi H, Takahashi H, Mabuchi K, Nishida M, Sakai H. Explosive speciation of Takifugu: another use of fugu as a model system for evolutionary biology. Mol Biol Evol 26: 623 629, 2009.

Downloaded from http://ajpregu.physiology.org/ by guest on April 13, 2013

AJP-Regul Integr Comp Physiol VOL

297 DECEMBER 2009

www.ajpregu.org