Parasitol Res (2004) 92: 2229 DOI 10.

1007/s00436-003-0995-2

O R I GI N A L P A P E R

Hisao Yoshikawa Zhiliang Wu Isao Kimata Motohiro Iseki Ibne Karim M. D. Ali Momammad B. Hossain Viqar Zaman Rashidul Haque Yuzo Takahashi

Polymerase chain reaction-based genotype classication among human Blastocystis hominis populations isolated from different countries
Received: 20 July 2003 / Accepted: 20 August 2003 / Published online: 4 November 2003 Springer-Verlag is a part of Springer Science+Business Media 2003

Abstract Since the genotype of human Blastocystis hominis isolates is highly polymorphic, PCR-based genotype classication using known sequenced-tagged site (STS) primers would allow the identication or classication of dierent genotypes. Five populations of human B. hominis isolates obtained from Japan, Pakistan,
H. Yoshikawa (&) Department of Biological Science, Faculty of Science, Nara Womens University, Kitauoya-Nishimachi, Nara 6308506, Japan E-mail: sb56013@cc.nara-wu.ac.jp Tel.: +81-742-203423 Fax: +81-742-203423 Z. Wu Y. Takahashi Department of Parasitology, Gifu University School of Medicine, Tsukasa 40, Gifu 5008705, Japan I. Kimata Department of Medical Zoology, Osaka City University Graduate School of Medicine, Asahimachi, Abeno, Osaka 5458585, Japan M. Iseki Department of Parasitology, Graduate School of Medical Science, Kanazawa University, Takaramachi, Kanazawa 9208640, Japan I. K. M. D. Ali M. B. Hossain R. Haque International Centre for Diarrhoeal Diseases Research, G.P.O. Box 128, 1000 Dhaka, Bangladesh V. Zaman Department of Microbiology, Aga Khan University, Stadium Road, P.O. Box 3500, 74800 Karachi, Pakistan Present address: I. K. M. D. Ali Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London, WC1E 7HT, UK

Bangladesh, Germany, and Thailand were subjected to genotype analysis by using seven kinds of STS primers. Ninety-nine out of 102 isolates were identied as one of the known genotypes, while one isolate from Thailand showed two distinct genotypes and two isolates from Japan were negative with all the STS primers. The most dominant genotype among four populations, except for all four isolates from Thailand, was subtype 3 and it varied from 41.7% to 92.3%. The second most common genotype among four populations was either subtype 1 (7.725.0%) or subtype 4 (10.022.9%). Subtype 2, subtype 5, and/or subtype 7 were only rarely detected among the isolates from Japan and Germany, while subtype 6 was not detected. The phylogenetic position of the two isolates which were negative with all STS primers, was inferred from the small subunit rRNA (SSU rRNA) genes with the known sequence data of 20 Blastocystis isolates. Since the two isolates were positioned in an additional clade in the phylogenetic tree, this suggested they were a new genotype. These results demonstrated that PCRbased genotype classication is a powerful tool with which to analyse genotypes of Blastocystis isolates obtained from clinical samples. In addition, two groups of the isolates from 15 symptomatic and 11 asymptomatic patients in Bangladesh were compared with the PCRbased subtype classication. Since both groups were only classied into two distinct genotypes of subtype 1 or subtype 3 and no statistically signicant dierence was observed between the two groups, in this study it could not be shown that the specic genotype correlated with the pathogenic potential of B. hominis.

Introduction
Blastocystis hominis is one of the most common protozoan parasites of the human intestinal tract (Windsor et al. 2002). Although many symptomatic cases without any other detective agent have been reported in many countries, Blastocystis infections are very common in

23

many healthy people without any symptoms (Stenzel and Boreham 1996). Therefore, the pathogenic potential of this parasite is still controversial. On the basis of our molecular epidemiological study and the results of traditional epidemiology among family members and small communities, the faecal-oral route is considered to be the transmitting mode among humans (Nimri et al. 1993; Galantowicz et al. 1993; Stenzel and Boreham 1996; Yoshikawa et al. 2000). Circumstantial evidence of many zoonotic strains identied from a wide range of mammals and birds suggests that there is another infectious route between animal and humans (Yoshikawa et al. 1996, 2003; Clark 1997; Abe et al. 2003a, 2003b, 2003c; Noel et al. 2003). This transmission route is likely, because animal handlers showed a signicantly higher rate of infection with B. hominis (Salim et al. 1999). Since extensive genetic and karyotypic heterogeneity have been demonstrated among Blastocystis isolates from humans and animals (Upcroft et al. 1989; Yoshikawa et al. 1996, 1998, 2000, 2003; Clark 1997; Bo hm-Gloning et al. 1997; Carbajal et al. 1997; Chen et al. 1997; Hoevers et al. 2000; Ho et al. 2001; Abe et al. 2003a, 2003b, 2003c; Arisue et al. 2003; Noel et al. 2003), it has been postulated that certain demes or genetically distinct genotypes of B. hominis may exhibit pathogenicity. Since there is no suitable animal model available for B. hominis infection at present, the pathogenic potential of B. hominis cannot be demonstrated experimentally (Tan et al. 2002). Therefore, comparative studies of human B. hominis populations from geographically separate countries or of isolates from clinically symptomatic and asymptomatic patients may reveal a possible correlation between certain genotypes and the pathogenic potential of this parasite. Although there have been a few trials which have examined genotypes correlating with the pathogenic potential of this parasite, using the restriction fragment length polymorphism (RFLP) analysis of a small subunit rRNA gene (SSU rDNA), so-called riboprinting, there was only a possible relationship or no distinct dierences in genotypes (ribodemes) between isolates from symptomatic and asymptomatic groups (Bo hm-Gloning et al. 1997; Kaneda et al. 2001). Moreover, a recent sequence study of the SSU rDNAs of a wide range of Blastocystis isolates from humans and animals revealed that it could not be guaranteed that the same RFLP prole would always show the same sequence (Arisue et al. 2003). Therefore, RFLP analysis of SSU rDNA is not a suitable tool for the identication or classication of the genotypes of B. hominis. In this study, therefore, genotypic classication was performed by using sequenced-tagged site (STS) primers (Yoshikawa et al. 1998, 2000, 2003). The STS primers developed from random amplied polymorphic DNA (RAPD) analysis of known strains of B. hominis only amplied the distinct subtypes which correspond to the phylogenetically dierent clades inferred from the SSU rDNA sequences (Arisue et al. 2003; Yoshikawa et al. 2003). Moreover,

this PCR-based technique has recently been reported as a practical tool for typing B. hominis isolates from humans and animals and for the detection of zoonotic genotypes from animals (Yoshikawa et al. 1998, 2000, 2003; Abe et al. 2003a, 2003b, 2003c). Therefore, negative PCR results using the STS primers may lead to the identication of new genotype(s), which will promote further classication of unknown Blastocystis genotypes. Finally, a new genotype of human B. hominis isolates was detected in this study.

Materials and methods

Sources and isolation of B. hominis The faecal specimens of patients were obtained from the routine faecal examination unit of the hospital or parasitology laboratory at Osaka City University Medical School, Japan, Khon Kaen University, Thailand, and Bonn University, Germany, respectively. In Pakistan, the faecal samples were obtained from symptomatic patients with gastrointestinal symptoms admitted to a hospital at the Aga Khan University. The history and background of the samples could not be obtained from each university. The faecal samples collected from patients of the outpatient department at the International Centre for Diarrhoeal Disease Research in Bangladesh were classied into symptomatic and asymptomatic groups based on the following criteria. Asymptomatic patients were healthy without any gastrointestinal symptoms. Symptomatic patients had diarrhoea or dysentery, but were negative for parasitic tests for Entamoeba histolytica, Giardia lamblia , and helminth eggs etc. and bacteriological tests for Salmonella sp., Shigella sp. and Vibrio sp. However, patients could not be examined for the presence of Cryptosporidium sp. and enteric viruses due to technical reasons. The faecal specimens were cultured in Ringers solution containing 10% horse serum and 0.05% asparagine or in Jones medium (Jones 1946) containing 10% horse serum at 37C. The screening of Blastocystis organisms in 3- to 4-day-old cultures was done with standard light microscopy. When the typical vacuolar or granular forms of Blastocystis organisms were observed, they were subcultured in a new medium. After one or two subcultures, B. hominis suspensions were centrifuged at 12,000 g for 1 min and packed organisms were frozen at )20C until the DNA was extracted. In this study, 10, 18, 9, and 13 isolates of B. hominis were obtained from 498, 515, 673, and 351 faecal samples from 1999 to 2002, respectively, in Japan, 12 isolates were obtained from 67 stool samples in 2000 in Germany, and four isolates were obtained from 30 stool samples in 2000 in Thailand.

Genomic DNA preparation Genomic DNA of B. hominis was extracted by using DNAzol (Gibco BRL/Life Technologies, Grand Island, N.Y.) according to the manufacturers protocol.

Typing by PCR with the STS primers The specic STS primers developed from the RAPD products have been developed for typing the subtypes among Blastocystis isolates from humans and animals, and also have identied many zoonotic isolates from a wide range of animals (Yoshikawa et al. 1998, 2000, 2003; Abe et al. 2003a, 2003b, 2003c). In this study, therefore, typing from subtype 1 to subtype 7 was achieved by using PCR amplication on the basis of the presence or absence

24 Table 1 Subtype classication with the sequence-tagged site (STS) primer sets used in this study.SSU rRNA Small subunit rRNA Subtypes STS primer sets SB83 SB155 SB227 SB332 SB340 SB336 SB337 Product size (bp) 351 650 526 338 704 317 487 Sequences of forward (F) and reverse (R) primers (5 3) F R F R F R F R F R F R F R GAAGGACTCTCTGACGATGA GTCCAAATGAAAGGCAGC ATCAGCCTACAATCTCCTC ATCGCCACTTCTCCAAT TAGGATTTGGTGTTTGGAGA TTAGAAGTGAAGGAGATGGAAG GCATCCAGACTACTATCAACATT CCATTTTCAGACAACCACTTA TGTTCTTGTGTCTTCTCAGCTC TTCTTTCACACTCCCGTCAT GTGGGTAGAGGAAGGAAAACA AGAACAAGTCGATGAAGTGAGAT GTCTTTCCCTGTCTATTCTGCA AATTCGGTCTGCTTCTTCTG Source of primer Nand II B HV9313 HJ96AS-1 HJ961 SY943 RN949 GenBank accession no. AF166086 AF166087 AF166088 AF166091 AY048752 AY048751 AY048750 Yoshikawa et al. (2003) Yoshikawa et al. (2000) Reference Clade in the SSU rRNA phylogenya I VII III VI II V IV

1 2 3 4 5 6 7
a

Yoshikawa et al. (1998)

Each clade determined by SSU rRNA genes (Arisue et al. 2003) corresponds to a distinct subtype (Yoshikawa et al. 2003)

of the products within a parallel with a control PCR amplication (Table 1). Control subtypes of B. hominis from which the primers were developed were used in this study. Namely, strains Nand II, B, HV9313, HJ96AS-1, HJ961, SY943, and RN949 were used for subtypes 17, respectively (Yoshikawa et al. 1998, 2000, 2003). The PCR conditions when using the specic primers and electrophoresis of PCR products were the same as described previously (Yoshikawa et al. 2000). The PCR amplication for each primer pair was repeated at least thrice. When the PCR product showed a weak band or no band, the isolates were subjected to sequencing of the full-length SSU rRNA gene to conrm the genotype(s).

Results
It is generally considered that developing counties show a higher prevalence of B. hominis than developed countries (Stenzel and Boreham 1996). Although a sufcient number of stool samples could not obtained in Germany and Thailand during the short duration of the study, the prevalence of B. hominis in Japan (1.33.5% during 3 years) was quite low compared with 17.9% (12/ 67) and 13.3% (4/30) prevalence in Germany and Thailand, respectively. Moreover, it is evident that the mean prevalence of 2.45% (50/2,037) in Japan during the past 3 years was quite low compared with the prevalence of 6.9% (96/1,390) in Wales shown by examination of samples by the Trichrome staining method (Windsor et al. 2002). Even when we employed the culture examination, which is known to be sensitive for the detection of B. hominis compared with the routine examination of stool samples (Zaman and Khan 1994; Leelayoova et al. 2002), the prevalence of 2.45% in Japan was very low among those reported for developed countries (Stenzel and Boreham 1996). In contrast, the prevalence in developing countries such as Pakistan and Bangladesh is relatively high (Zaman and Khan 1994), but it is dicult to exclude the potential eects of other microbes causing gastrointestinal symptoms. In this study, therefore, the symptomatic patients in Bangladesh were checked for the following microbes; Entamoeba histolytica, Giardia lamblia , helminth eggs, Salmonella sp., Shigella sp., and Vibrio sp. and only negative samples were used in this study. Since each STS primer specically amplied distinct B. hominis genotypes, elimination of concomitant bacteria or other common intestinal Protozoa in cultures was not necessary before the extraction of genomic DNA (Yoshikawa et al. 1998, 2000, 2003). Therefore, when Blastocystis organisms were found in the cultures by standard light microscopy, DNA was extracted

Sequencing of the SSU rRNA genes The SSU rRNA genes were amplied using a pair of sense (SR1F) and anti-sense (SR1R) primers (Yoshikawa et al. 2000). These primer pairs produced an approximately 1,800-bp product. The PCR amplication was performed with 35 cycles of 94C for 40 s, 57C for 60 s, and 72C for 2 min, after an initial denaturation at 94C for 3 min. The PCR products were puried with a Geneclean II kit (Bio 101, Buena Vista, Calif.) and DNA fragments were ligated into a pT7Blue T-Vector (Novagen, EMD Biosciences, Wis.). The recombinant plasmids were introduced into competent cells of Escherichia coli JM 109. The plasmid DNA was isolated from E. coli using a FlexiPrep kit (Amersham Biosciences, N.J.). The DNA sequence was determined by using a Thermo Sequenase cycle sequencing kit (USB, Ohio) and an automatic sequencer (model LIC-4200; Aloka, Tokyo). Since the sequence variations of dierent clones of ligated DNA fragments have been placed within an independent clade without exception (Arisue et al. 2003), only one clone of each isolate was sequenced in this study. The sequence data was analysed using DNASIS software (Hitachi Software Engineering, Tokyo).

Sequence alignment and phylogenetic reconstruction analysis The ve sequences of the SSU rRNA genes obtained in this study were aligned manually with the previously published data of the SSU rRNA gene of Blastocystis isolates and of Proteromonas lacertae by using the maximum likelihood method as described previously (Arisue et al. 2003). The GenBank accession numbers for the sequences used in this study are shown in the phylogenetic tree.

25

without prior washing steps. These genomic DNAs were screened with PCR amplication using the seven sets of primer pairs to identify genotypes of B. hominis. Positive PCR amplication with each primer set was identied through gel electrophoresis by running a positive control for each primer pair (Fig. 1). When 102 isolates were screened with the seven kinds of STS primers listed in Table 1, ninety-nine isolates were amplied with only one of the distinct STS primers (Table 2). On the other hand, isolate HT001 obtained from Thailand showed positive amplication with both SB83 and SB227 primers (Fig. 1A, C). Therefore, this isolate was judged to be a mixed isolate containing two distinct genotypes of subtype 1 and subtype 3 (Table 2). In contrast, the remaining two isolates, HJ004 and HJ005, obtained from Japan were not amplied with any STS primer (Table 2, Fig. 1). Based on the PCR amplication, the most dominant genotype observed in the four populations obtained
Fig. 1 Example of PCR amplication of several Blastocystis hominis isolates with the sequenced-tagged site (STS) primers SB83 (A), SB155 (B), SB227 (C), SB332 (D), SB340 (E), and SB337 (F) with a positive PCR product of the control strain (lane 1) as listed in Table 1. The isolate HT011 (lane 15) is amplied with both SB83 (A) and SB227 (C), while other isolates are amplied with only one of the STS primers except for two isolates, HJ004 (lane 4) and HJ005 (lane 5), which are negative with all primers. Although the isolates HJ017 (lane 3) and HG003 (lane 13) show a distinct amplicon with the primer SB337 (F), HG0012 (lane 14) shows a weak band with the same primer. M Molecular marker (100-bp ladder), 1 positive control, 2 HJ999, 3 HJ017, 4 HJ004, 5 HJ005, 6 HB001, 7 HB002, 8 HB008, 9 HP001, 10 HP003, 11 HP005, 12 HG004, 13 HG0010, 14 HG0012, 15 HT001, 16 HT002, 17 HT003 {the rst two letters of each isolates name indicate the origin [human (H)] and country [Japan (J), Bangladesh (B), Pakistan (P), Germany (G), Thailand (T)] from which the organism was isolated, and the numbers indicate the year [1999 (99), 2000 (00), 2001 (01)] in which the isolate was found. The number following the hyphen indicates the position of that particular isolate in that years series}

from Japan, Bangladesh, Pakistan, and Germany was subtype 3, and its prevalence ranged from 41.7% to 92.3% among the four countries (Table 2). Since only four isolates were obtained in Thailand during the short duration of the study, it is dicult to evaluate the results of these four isolates. When the data for subtype 3 were subjected to the v2-test, its prevalence was shown to be dierent among the four countries (P <0.05). The next most common genotypes among the four countries were either subtype 1 or subtype 4. The prevalence of these subtypes between the countries varied from 7.7% to 25.5% and from 10.0% to 22.0%, respectively (Table 2). However, the data for these subtypes cannot be analysed by statistical methods because the sample sizes were too small. Since the remaining subtypes, 2, 5, and 7, were only detected at rates of from 4.016.7%, these subtypes were considered rare genotypes. Subtype 6 was not detected in this study. Based on PCR amplication with the STS primers, only one isolate, HG0012, among the three isolates amplied with the primer SB337 showed a weak band of the amplicon (Fig. 1F), while there were two isolates (HJ00-4 and HJ005) negative with all STS primers (Fig. 1). Therefore, phylogenetic analysis of these ve isolates was employed to conrm their genotypes. Based on the SSU rRNA phylogeny with the known 20 Blastocystis isolates (Arisue et al. 2003), all three isolates amplied with the primer SB337, i.e. HJ017, HG0010, and HG0012, were placed into the monophyletic clade IV including RN949, NIH:12951, and a guinea pig isolate, while the unknown genotype of the two isolates HJ004 and HJ005 was clustered into an additional monophyletic clade in the phylogenetic tree with a 100% bootstrap value (Fig. 2). Therefore, all three isolates amplied with the primer SB337 were conrmed to belong to clade IV and the results were corroborated with those of subtype 7 (Table 1). In contrast, the other two

26 Table 2 Subtype classication of Blastocystis hominis populations isolated from ve geographically dierent countries determined by STS primers Countries Total no. of isolates Subtype classication (% in parentheses) 1 Japan Bangladesh Pakistan Germany Thailand Total
a b

2 5 (10.0) 0 0 0 0 5

3 26 (52.0) 24 (92.3) 7 (70.0) 5 (41.7) 2b 64 c

4 11 (22.0) 0 1 (10.0) 0 1 13

5 0 0 0 2 (16.7) 0 2

6 0 0 0 0 0 0

7 2 (4.0) 0 0 2 (16.7) 0 4

Unknown 2 (4.0) 0 0 0 0 2

50 26 a 10 12 4c 102

4 (8.0) 2 (7.7) 2 (20.0) 3 (25.0) 2b 13 c

Comprised two groups of isolates from the symptomatic and asymptomatic patients listed in Table 3 Since isolate HT001 obtained from Thailand was amplied with both STS primers SB83 and SB227, this isolate comprised two distinct genotypes: subtype 1 and subtype 3 of Blastocystis c Comprised mixed genotypes of HT001, hence the total number of subtype 1 and subtype 3 does not correspond with the total number of isolates or the total number of isolates in Thailand

isolates, HJ004 and HJ005, which were negative with all the STS primers, showed an additional new clade in the phylogenetic tree (Fig. 2). This result indicates that these two isolates represent a new genotype among the polymorphic genotypes of B. hominis populations (Arisue et al. 2003). In order to analyse the pathogenic potential of the distinct genotype(s) of B. hominis, two groups of isolates from symptomatic and asymptomatic patients in Bangladesh were compared in the subtype classication. Tentatively, the isolates recovered from 11 normal healthy individuals without any gastrointestinal symptoms were categorized as the non-pathogenic isolates of B. hominis, while the isolates from 15 patients with diarrhoea or dysentery without other pathogenic protozoans, helminths, and bacterial pathogens examined in this study were categorized as the pathogenic isolates. Based on the PCR amplication, both groups of isolates showed only two distinct genotypes, subtype 1 and subtype 3 (Table 3). Since Fishers exact probability test could not show any dierences between these groups, there was no correlation between the distinct genotype and pathogenic potential of this parasite.

Since the human B. hominis population is genetically highly polymorphic (Yoshikawa et al. 1996, 1998, 2000, 2003; Clark 1997; Bo hm-Gloning et al. 1997; Hoevers et al. 2000; Ho et al. 2001; Kaneda et al. 2001; Arisue et al. 2003; Noel et al. 2003), it is generally assumed that the specic deme or genotype of the parasite may contribute to its pathogenic potential. Therefore, it is important to show the variation of genotypes to take into account the pathogenic potential of this parasite. In this study, therefore, a PCR-based methodology was applied to classify the genotypes of ve geographically dierent human populations of B. hominis. In our previous studies, several STS primers developed from RAPD products of the distinct genotypes have been used to successfully classify and identify seven kinds of the genotypes by PCR analysis and each genotype corroborated the phylogenetic relationship (Yoshikawa et al. 1998, 2000, 2003). Moreover, the STS primers could identify many zoonotic isolates from various animals such as cattle, pigs, monkeys, and birds (Abe et al. 2003a, 2003b, 2003c). Therefore, it is evident that the STS primers can be used as a tool to type genotypes among polymorphic Blastocystis populations.

Discussion
It is still controversial whether B. hominis is a pathogenic or a commensal organism, because there are many conicting reports on the pathogenic potential of B. hominis infection. In a trial using an immunological approach, antigenic heterogeneity had been detected among B. hominis isolates from symptomatic and asymptomatic patients (Lanuza et al. 1999), while there were no signicant dierences in populations of the serotypes between the isolates from the symptomatic and asymptomatic patients (Kukoschke and Mu ller 1991). Although signicant dierences in the antibody response have been reported between symptomatic patients and asymptomatic or healthy people, there is no information available about the genotypes of B. hominis in these studies (Zierdt et al. 1995; Hussain et al. 1997).

Fig. 2 Phylogenetic tree of the small subunit rRNA (SSU rRNA) sequences of ve isolates combined with the known sequence data of 20 Blastocystis isolates with Proteromonas lacertae as the outgroup. The best tree analysed by the maximum likelihood method is shown with the bootstrap proportion (%). For the bootstrap proportions corresponding to the internal branches within clade I up to and including clade VII, only those with >70% support are shown. In total 1,381 unambiguously aligned positions were selected and used. The two isolates which were negative with all STS primers, HJ004 and HJ005, are clustered into an additional monophyletic clade ( ), while all three isolates amplied with the primer SB337, HJ017, HG0010, and HG0012, are placed into the monophyletic clade IV including RN949, NIH-12951, and a guinea pig isolate which are designated as subtype 7 (Table 1). Each monophyletic clade from I to VII corresponded to the phylogenetic clades reported previously (Arisue et al. 2003). The accession numbers in the GenBank are shown in parentheses. The length of each branch is proportional to the estimated number of substitutions

27

In the present study, the most dominant genotype was subtype 3 among the four populations of B. hominis isolated from Japan, Bangladesh, Pakistan, and Germany (Table 2). Besides the other genotypes which could not be analysed with the v2-test, subtype 2, subtype 5, and/or subtype 7 were only detected among the isolates from Japan and Germany, while these genotypes were not present in the isolates from the symptomatic patients in Bangladesh and from Pakistan. Therefore, the genotypes of the subtypes 2, 5, and 7 appeared to be non-pathogenic ones. In the previous phylogenetic study using sequences of SSU rRNA genes among 20 Blastocystis isolates, clade III corresponded to subtype 3 amplied with the primer SB227 and only comprised those of human origin (Arisue et al. 2003). Interestingly, a recent PCR-based genotype analysis among many isolates from a wide range of animals using the same STS primers identied three zoonotic isolates of subtype 3 from cattle and pigs (Abe et al. 2003a, 2003b, 2003c). Therefore, subtype 3 is not a specic genotype showing a human origin. On the other hand, other zoonotic subtypes have been frequently isolated from various animals (Abe et al. 2003a, 2003b; Arisue et al. 2003; Yoshikawa et al. 2003) indicating the diculty of identifying the transmission route be it either human-to-animal or animal-to-human. In contrast, subtype 3 is the most dominant genotype among human isolates from four counties (41.792.3%),

while it is rare in animals, suggesting that it may spread from human to animals. In this study, HJ017, HG0010, and HG0012 isolates amplied with the primer SB337 were placed within clade IV inferred from the SSU rRNA genes (Fig. 2). Interestingly two strains, NIH:12951 and RN949, isolated from a guinea pig and a laboratory rat, respectively, were placed in this same clade (Arisue et al. 2003) and both strains were also recently demonstrated to have the same genotype as subtype 7 (Table 1) (Yoshikawa et al. 2003). Since there have been no data of human isolates of genotype 7, it is evident that clade IV is the true zoonotic genotype in this study. In addition, the same STS primer had recently amplied all three isolates from rats in Singapore (Yoshikawa et al. 2003). Therefore, these results reconrmed the nding that the three isolates from rats were zoonotic B. hominis, although these three isolates were originally reported as Blastocystis ratti on the basis of electrophoretic karyotyping analysis (Chen et al. 1997). These discrepancies also indicate that karyotypic heterogeneity among Blastocystis isolates does not support species dierences. On the other hand, subtype 2, subtype 4, and subtype 5 have been demonstrated as zoonotic genotypes based on PCR amplication with the STS primers and the SSU rRNA phylogeny (Arisue et al. 2003; Yoshikawa et al. 2003). Since subtype 1 has been proposed as the rst zoonotic subtype (Yoshikawa et al.

28 Table 3 Subtype classication of two populations ofB. hominis isolates from the symptomatic and asymptomatic patients in Bangladesh Patients Total no. of isolates Subtype classication (% in parentheses) 1 Symptomatic 11 Asymptomatic 15 2 3 4 5 6 7 H. Y. (C-13670245) and by a grant from ICDDR, B Centre for Health and Population Research with the support of the University of Virginia (NIH grant, AI-43596) to A. I.

References
Abe N, Wu Z, Yoshikawa H (2003a) Molecular characterization of Blastocystis isolates from birds by PCR with diagnostic primers and restriction fragment length polymorphism analysis of the small subunit ribosomal RNA gene. Parasitol Res 89:393396 Abe N, Wu Z, Yoshikawa H (2003b) Molecular characterization of Blastocystis isolates from primates. Vet Parasitol 113:321325 Abe N, Wu Z, Yoshikawa H (2003c) Zoonotic genotypes of Blastocystis hominis detected in cattle and pigs by PCR with diagnostic primers and restriction fragment length polymorphism analysis of the small subunit ribosomal RNA gene. Parasitol Res 90:124128 Arisue N, Hashimoto T, Yoshikawa H (2003) Sequence heterogeneity of the small subunit ribosomal RNA genes among Blastocystis isolates. Parasitology 126:19 Bo hm-Gloning B, Knobloch J, Walderich B (1997) Five subgroups of Blastocystis hominis isolates from symptomatic and asymptomatic patients revealed by restriction site analysis of PCRamplied 16S-like rDNA. Trop Med Int Health 2:771778 Carbajal JA, Del Castillo L, Lanuza MD, Villar J, Borras R (1997) Karyotypic diversity among Blastocystis hominis isolates. Int J Parasitol 27:941945 Chen XQ, Singh M, Ho LC, Tan SW, Ng GC, Moe KT, Yap EH (1997) Description of a Blastocystis species from Rattus norvegicus. Parasitol Res 83:313318 Clark CG (1997) Extensive genetic diversity in Blastocystis hominis. Mol Biochem Parasitol 87:7983 Galantowicz BB, Illueca MD, Levy J, Rayburn JL, Weinstock DJ (1993) Neonatal Blastocystis hominis diarrhea. Pediatr Infect Dis 12:345347 Ho L-C, Jeyaseelan K, Singh M (2001) Use of the elongation factor1a gene in a polymerase chain reaction-based restriction-fragment-length polymorphism analysis of genetic heterogeneity among Blastocystis species. Mol Biochem Parasitol 112:287291 Hoevers J, Holman P, Logan K, Hommel M, Ashford R, Snowden K (2000) Restriction-fragment-length polymorphism analysis of small-subunit rRNA genes of Blastocystic hominis isolates from geographically diverse human hosts. Parasitol Res 86:5761 Hussain R, Jaferi W, Zuberi S, Baqai R, Abrar N, Ahmed A, Zaman V (1997) Signicantly increased IgG2 subclass antibody levels to Blastocystis hominis in patients with irritable bowel syndrome. Am J Trop Med Hyg 56:301306 Jones WR (1946) The experimental infection of rats with Entamoeba histolytica. Ann Trop Med Parasitol 40:130 Kaneda Y, Horiki N, Cheng XJ, Fujita Y, Maruyama M, Tachibana H (2001) Ribodemes of Blastocystis hominis isolated in Japan. Am J Trop Med Hyg 65:393396 Kukoschke KG, Mu ller HE (1991) SDS-PAGE and immunological analysis of dierent axenic Blastocystis hominis strains. J Med Microbiol 35:3539 Lanuza MD, Carbajal JA, Villar J, Mir A, Borras R (1999) Solubleprotein and antigenic heterogeneity in axenic Blastocystis hominis isolates: pathogenic implications. Parasitol Res 85:9397 Leelayoova S, Taamasri P, Rangsin R, Naaglor T, Thathaisong U, Mungthin M (2002) In-vitro cultivation: a sensitive method for detecting Blastocystis hominis. Ann Trop Med Parasitol 96:803 807 Nimri LF (1993) Evidence of an epidemic of Blastocystis hominis infections in preschool children in northern Jordan. J Clin Microbiol 31:27062708 Noel C, Peyronnet C, Gerbod D, Edgcomb VP, Delgado-Viscogliosi P, Sogin ML, Capron M, Viscogliosi E, Zenner L (2003) Phylogenetic analysis of Blastocystis isolates from dierent hosts based on the comparison of small-subunit rRNA gene sequences. Mol Biochem Parasitol 126:119123

1 (9.1) 0 10 (90.9) 0 0 0 0 1 (6.7) 0 14 (93.3) 0 0 0 0

1996) and it was reconrmed by a phylogenetic study (Arisue et al. 2003), all subtypes detected in this study are zoonotic genotypes. Therefore, the STS primers can be used for the identication of the zoonotic genotypes (Abe et al. 2003a, 2003b, 2003c). In our previous phylogenetic study of the SSU rRNA genes among Blastocystis isolates from humans and animals, seven dierent monophyletic clades were supported by a 100% bootstrap value (Arisue et al. 2003). In this study, two isolates, HJ004 and HJ005, were not only negative with all STS primers in the PCR analysis but also the SSU rRNA phylogeny showed an additional monophyletic clade of both isolates supported by a 100% bootstrap value (Fig. 2). Therefore, it is evident that these isolates are a new genotype. The present study indicates that the PCR analysis using the STS primers is a practical tool with which to classify and identify genotypes and also to nd unknown genotype(s) in clinical isolates of B. hominis. In addition, it is important to carry out a survey of B. hominis to nd new genotype(s), and further study will facilitate an understanding of genomic polymorphism among B. hominis populations and the zoonotic potential of those of animal origin. It is still debated whether distinct genotype(s) of human B. hominis correlate with the pathogenic potential of this parasite. In this study, therefore, two populations of B. hominis isolated from the symptomatic and asymptomatic patients in Bangladesh were compared with the genotype classication. However, no signicant dierences in distribution of the genotype between the two populations were observed when using Fishers exact probability test (Table 3). Therefore, in this study it could not be shown that specic genotype(s) correlated with the pathogenic potential of B. hominis. In a recent genetic study of clinical isolates of Leishmania aethiopica, PCR-RFLP and RAPD analyses did not show any correlation between genetic dierences and clinical variations of cutaneous leishmaniasis (Schonian et al. 2000). Therefore, it seems that it may be dicult to detect the relationship between the pathogenicity and distinct genotype of human B. hominis.
Acknowledgements We express our gratitude to Dr S. Tesana, Khon Kaen University, Thailand and Dr H. M. Seiz, Bonn University, Germany for collecting the faecal samples in Thailand and Germany, respectively, and thank Dr T. Hashimoto, University of Tsukuba for the phylogenetic analysis. This work was supported by a grant from the Japan Society for the Promotion of Science to

29 Salim HR, Kumar GS, Vellayan S, Mak JW, Anuar AK, Init I, Vennila GD, Saminathan R, Ramakrishnan K (1999) Blastocystis in animal handlers. Parasitol Res 85: 10321033 Schonian G, Akuo H, Lewin S, Maasho K, Nylen S, Pratlong F, Eisenberger CL, Schnur LF, Presber W (2000) Genetic variability within the species Leishmania aethiopica does not correlate with clinical variations of cutaneous leishmaniasis. Mol Biochem Parasitol 106:239248 Stenzel DJ, Boreham PFL (1996) Blastocystis hominis revisited. Clin Microbiol Rev 9:563584 Tan KSW, Singh M, Yap EH (2002) Recent advances in Blastocystis hominis research: hot spots in terra incognita. Int J Parasitol 32:789804 Upcroft JA, Dunn LA, Dommett LS, Healey A, Upcroft P, Boreham PFL (1989) Chromosomes of Blastocystis hominis. Int J Parasitol 19:879883 Windsor JJ, Macfarlane L, Hughes-Thapa G, Jones SKA, Whiteside TM (2002) Incidence of Blastocystis hominis in faecal samples submitted for routine microbiological analysis. Br J Biomed Sci 59:154157 Yoshikawa H, Nagano I, Yap EH, Singh M, Takahashi Y (1996) DNA polymorphism revealed by arbitrary primers polymerase chain reaction among Blastocystis strains isolated from humans, a chicken, and a reptile. J Euk Microbiol 43:127130 Yoshikawa H, Nagano I, Wu Z, Yap EH, Singh M, Takahashi Y (1998) Genomic polymorphism among Blastocystis strains and development of subtype-specic diagnostic primers. Mol Cell Probes 12:153159 Yoshikawa H, Abe N, Iwasawa M, Kitano S, Nagano I, Wu Z, Takahashi Y (2000) Genomic analysis of Blastocystis hominis strains isolated from two long-term health care facilities. J Clin Microbiol 38:13241330 Yoshikawa H, Wu Z, Nagano I, Takahashi Y (2003) Molecular comparative studies among Blastocystis isolates obtained from humans and animals. J Parasitol 89:585594 Zaman V, Khan KZ (1994) A comparison of direct microscopy with culture for the diagnosis of Blastocystis hominis. Southeast Asian J Trop Med Public Health 25:792793 Zierdt CH, Zierdt WS, Nagy B (1995) Enzyme-linked immunosorbent assay for detection of serum antibody to Blastocystis hominis in symptomatic infections. J Parasitol 81:127129