You are on page 1of 8

www.odnavaiaescola.

org
Todos os direitos reservados DNA Goes to School, Inc. 2003

Manual da Oficina Prtica de Gentica, Genoma e Biotecnologia Quarto Mdulo


Multiplicando o nosso DNA
Uma das principais caractersticas encontradas no genoma de organismos eucariotos so as chamadas seqncias de repetio, constitudas, como o nome sugere, por seqncias de DNA repetitivo. O DNA repetitivo composto por seqncias de nucleotdeos de vrios tamanhos e composies diferentes que aparecem com muita freqncia em nosso genoma, tanto de forma consecutiva (as chamadas seqncias em tandem) ou como seqncias dispersas. Os segmentos de DNA encontrados no genoma que no esto repetidos so chamados de DNA cpia nica (single copy DNA). A proporo de DNA repetitivo no genoma varia de acordo com a taxonomia do organismo. Enquanto em leveduras o DNA repetitivo representa 20% do genoma deste organismo, em mamferos este nmero pode chegar at a 60%. Em algumas plantas, 80% do genoma formado por DNA repetitivo. A maioria das seqncias repetitivas no dispersas to uniforme que quando todo o DNA submetido separao usandose um gradiente de densidade, estas seqncias formam uma banda visvel no tubo que se distingue claramente do resto do DNA presente no organismo em questo. Esta banda foi denominada DNA satlite e formada pelas seqncias repetitivas no dispersas. Os cientistas acreditam que estas seqncias no possuem uma funo definida, sendo o resultado de um acmulo de seqncias geradas ao longo da histria evolutiva dos organismos, j que as mesmas no esto sujeitas seleo natural. Outra classe de seqncias repetitiva so as chamadas seqncias de repetio dispersas, j que elas podem ser encontradas em todo o genoma, como nos ntrons de genes, nas regies intragnicas e tambm nas regies onde no h genes propriamente ditos. Estas seqncias podem ser curtas (500 pb), sendo, neste caso, chamadas de SINES (short interspersed repeated sequences), ou longas, que so as chamadas seqncias LINES (long interspersed repeated sequences). As interspersed repeated sequences apresentam algumas caractersticas semelhantes aos genes que transcrevem os RNA-transportadores. O tipo mais conhecido de seqncia SINE o das seqncias Alu. Estas seqncias possuem este nome devido presena de um stio de restrio para a enzima Alu I. Aproximadamente 1 milho de membros da famlia Alu esto distribudos pelo genoma dos primatas. As seqncias Alu caracterizam-se tambm por seu tamanho de aproximadamente 300 pares de bases e acredita-se que tenham surgido no genoma dos primatas h 65 milhes de anos. Neste mdulo, investigaremos uma seqncia da famlia Alu encontrada no oitavo ntron do gene de ativao de tecido plasminognico (PLAT), localizado no cromossomo 8. Esta seqncia no tem qualquer associao com doenas genticas ou com nenhum tipo de susceptibilidade. Ela apenas um marcador gentico muito til para estudo de populaes, pois indivduos diferentes podem ou no apresentar esta insero em seus genomas.

Kary Mullis
A tcnica de PCR foi criada em 1985 pelo Dr. Kary Mullis, nos Estados Unidos. Esta tcnica uma das grandes responsveis por todo o avano na rea de biomedicina destes ltimos 20 anos.

Aparelho de PCR

Uma outra categoria de seqncia de repetio encontrada no genoma dos eucariotos so as chamadas seqncias de repetio, ou DNA repetitivo, ou ainda VNTRs (do ingls Variable Number of Tandem Repeat). Estas seqncias de DNA contm vrias cpias consecutivas de uma unidade de seqncia, uma atrs da outra, como vages de trem. Em uma populao, podemos encontrar alelos diferentes desta mesma seqncia entre os indivduos onde a diferena entre eles est apenas no nmero de vezes em que a unidade se repete. Assim, estas seqncias so altamente polimrficas Para facilitar a compreenso, tome como exemplo a seqncia ATCG como uma unidade de seqncia de um microssatlite. Se um alelo possuir esta unidade repetindo-se de modo consecutivo 3 vezes, teremos a seguinte seqncia ATCGATCGATCG (alelo 1) gerando um fragmento de 12 pares de bases. Agora tome como exemplo um outro alelo onde esta mesma unidade se repete por 4 vezes. Deste modo, o fragmento gerado ser ATCGATCGATCGATCG (alelo 2) com 15 pares de bases. Estes dois alelos podero ser diferenciados de acordo com seus respectivos tamanhos. So justamente estas diferenas no nmero de repeties destas seqncias que resultam na deteco de diferentes alelos, ou seja, fragmentos de tamanhos diferentes, no genoma humano de diferentes indivduos. Em genomas de eucariotos, estas seqncias esto distribudas ao acaso e constituem a classe mais polimrfica de marcadores moleculares disponvel. Estas repeties podem estar localizadas dentro de genes ou podem se localizar em regies que no contm genes. Estas regies ainda so de funo desconhecida. Estas seqncias repetitivas so utilizadas em testes de paternidade por DNA por serem altamente polimrficas, o que diminui muito a possibilidade de que dois indivduos no relacionados tenham o mesmo gentipo, isto , os mesmos alelos. Nestes casos, vrias regies diferentes do genoma so utilizadas, isto , fragmentos de DNA repetitivo espalhados pelo genoma. Para se chegar a um nmero que reflita a possibilidade de que um indivduo seja de fato o pai em questo, todos os resultados so multiplicados e avaliados .

Esquema do funcionamento da tcnica de PCR

A PCR pode ser usada para se determinar a paternidade biolgica de um indivduo.

O princpio bsico da PCR est na capacidade de, a partir de quantidades mnimas de DNA, multiplicar uma determinada seqncia, de modo que esta se torne majoritria na amostra. O material inicial para anlise atravs da tcnica de PCR pode ser obtido a partir de diferentes tecidos. Estes tecidos podem ser o sangue, que proporciona uma grande quantidade de DNA, ou at mesmo fios de cabelo ou clulas da boca. Numa reao de PCR, o fragmento de DNA que desejamos multiplicar (ou amplificar) chamado de fragmento alvo ou DNA molde (e os oligonucleotdeos que utilizamos so chamados de primers), ou iniciadores. Na realidade, os primers nada mais so do que pequenos fragmentos de DNA complementares s extremidades da regio que se pretende amplificar. Estes primers so produzidos rapidamente e vendidos por companhias de biotecnologia especficas. A tcnica de PCR tem provocado grande impacto nas principais reas da biotecnologia: mapeamento gnico, clonagem e seqenciamento de DNA, e deteco da expresso gnica. Atualmente, a PCR utilizada para o diagnstico de doenas genticas, bem como na deteco de material gentico presente em pequenas quantidades na amostra em anlise. Como exemplo, temos a deteco e identificao de material gentico de vrus como o HIV ou o vrus da hepatite, assim como a deteco de organismos geneticamente modificados em produtos alimentcios. O mtodo pelo qual a PCR funciona descrito em seguida: dois pequenos fragmentos de DNA, tipicamente de 20 pares de bases, so sintetizados em laboratrio. Esses so os primers , que so complementares a cada uma das extremidades da seqncia de DNA de interesse. Num tubo de reao so adicionados os primers, os nucleotdeos livres (adenina, guanina, timina e citosina), o DNA que se quer analisar (DNA molde) e uma enzima especial resistente ao calor chamada Taq DNA polimerase, que promove a sntese de DNA. A mistura aquecida a 95C, causando a separao das duas fitas de DNA. Em seguida, a mistura esfriada at 55C ou 65C, temperatura na qual os primers se ligam s regies complementares das fitas de DNA que esto separadas. Neste momento, dentro do tubo de reao, todo o DNA est na forma de fita simples, menos as duas pequenas regies nas quais os primers de 20 pares de bases se ligaram nos dois lados da seqncia de DNA de interesse. A temperatura ento elevada a 72C, e a Taq DNA polimerase comea a sintetizar um novo DNA, comeando nas regies em dupla fita, local onde cada um dos primers se ligou ao DNA molde. A Taq ir promover a sntese de DNA somente a partir da regio em dupla fita. A sntese ocorre em uma taxa de aproximadamente 20 nucleotdeos/segundo, e em cerca de 30 segundos a 1 minuto uma nova cpia do fragmento que se quer analisar sintetizada. A reao agora novamente aquecida a 95C, causando novamente a separao de todo DNA em fitas simples. Ao final do primeiro ciclo h duas fitas da molcula original de DNA, mais duas cpias da regio de interesse. A temperatura novamente reduzida, e agora os primers iro se ligar aos 4 stios nas novas duas cpias e tambm na molcula original de DNA. A temperatura do ciclo novamente elevada a 72C e as 4 fitas individuais so copiadas em 8. Esses ciclos so repetidos geralmente 30 vezes, num aparelho chamado termociclador. Ao final dos ciclos de amplificao existem, aproximadamente, 1 milho de cpias do segmento de DNA de interesse para cada molcula molde originria da amostra inicial. assim que podemos selecionar um fragmento especfico dentro de um genoma. Quando so usados primers especficos em uma reao em cadeia da polimerase (PCR), fragmentos especficos no genoma do organismo so amplificados. por este tipo de anlise que podemos observar diferenas entre indivduos. Estas anlises podem ser feitas utilizando-se o DNA repetitivo, ou VNTRs, j mencionados anteriormente. De acordo com o nmero de repeties da seqncia que so observadas, ou seja, das bandas de diferentes tamanhos visualizadas em gel de agarose (ou poliacrilamida), podemos identificar o grau de parentesco ou at a origem da amostra em anlise. A tcnica de PCR tem sido muito aplicada em estudos forenses devido pouca disponibilidade de material em situaes criminais. Alm disso, devido alta sensibilidade desta tcnica, torna-se possvel a amplificao de DNA a partir de at mesmo uma nica clula, e o DNA obtido no precisa necessariamente estar ntegro. No entanto, a grande sensibilidade desta tcnica apresenta tambm desvantagens, pois o risco de contaminao por uma molcula de DNA no presente na amostra de interesse se torna grande, sendo recomendado bastante cuidado em casos forenses e em todos os estudos moleculares.

Reao em Cadeia da Polimerase

Variabilidade na populao humana


Todos os seres vivos, incluindo seres humanos, apresentam grande variabilidade entre si. Podemos notar a variabilidade em uma populao (indivduos da mesma espcies) ou ainda entre espcies, gneros e, enfim, classes diferentes. Variaes tambm podem ser observadas dentro do genoma de um mesmo indivduo quando este heterozigoto para um determinado gene ou fragmento de DNA. Diferentes indivduos podem apresentar diferentes alelos de um mesmo gene. No caso da seqncia Alu que iremos trabalhar, diferentes indivduos podem apresentar ou no esta insero em seu genoma. A tcnica de estabelecimento de vnculo Nesta aula iremos realizar a PCR para amplificar os dois gentico a partir de sequncias repetidas alelos para a insero Alu conhecida como TPA25, de 300 do genoma foi desenvolvida pelo pares de bases, encontrada ou no no cromossomo 8. pesquisador ingls Alec Jaffrey em 1987. Para isso iremos trabalhar com o DNA das clulas da bochecha extrado anteriormente e cada indivduo realizar a reao de PCR com seu prprio DNA. Em seguida, iremos realizar uma eletroforese em gel de agarose para observarmos a freqncia de cada um dos dois alelos (com a insero +, sem a insero -). O PCR poder gerar fragmentos de dois tamanhos diferentes, 570 pb (quando h presena da insero) e 260 pb (quando no h presena da insero). preciso que fique claro que esta regio com a qual iremos trabalhar no tem nenhuma implicao mdica, tnica ou racial. apenas uma regio polimrfica do genoma humano.

Atividade de Laboratrio Reao de PCR Adicione _______ de primer ao tubo de PCR Adicione _______ do tubo contendo o DNA extrado de bochecha As seqncias dos primers utilizados so: #1- 5' GTGAAAAGCAAGGTCTACCAG 3' #2- 5' GACACCGAGTCCATCTTGAC 3'

Ciclo de PCR
95C inicial por 5 minutos 94C 1 min 60C 1 min 72C 1 min Este ciclo se repete por 30 vezes.

72C finais por 5 minutos 4C finais at a amostra ser utilizada na eletroforese de gel de agarose.

O Princpio de Hardy-Weinberg
O Princpio de Hardy-Weinberg um modelo matemtico simples que demonstra que as freqncias genotpicas de uma populao se mantm constante quando no h nenhuma fora evolutiva atuando sobre a mesma. Para que o princpio possa ser demonstrado, a populao em questo deve estar em equilbrio gentico, devendo ela apresentar as seguintes caractersticas: 1) No pode haver a ocorrncia de mutaes; 2) No pode haver fluxo gnico entre diferentes populaes; 3) A populao analisada deve ser grande o suficiente para que no ocorram desvios estatsticos; 4) Os cruzamentos devem ocorrer ao acaso, no havendo preferncia de acasalamento; 5) No pode haver atuao da seleo natural. Este tipo de populao chamada de populao ideal e, na realidade, poucas so as populaes que preenchem as condies descritas acima. No entanto, o principio de Hardy-Weinberg muito til para se estudarem populaes e os mecanismos evolutivos que violam o princpio. Por exemplo, se uma populao X apresenta determinadas freqncias genotpicas na gerao 1 (que corresponde ao momento em que os cientistas colhem os dados) e se na gerao 5 estas freqncias esto alteradas, ento o cientista pode concluir que uma, ou mais, das condies descritas anteriormente foi violada. Com esta informao o geneticista evolutivo pode estudar quais so as foras evolutivas que esto atuando na populao. Embora a populao humana no obedea a todas as condies exigidas pela lei de HardyWeinberg, esta pode ser aplicada a populaes humanas com uma boa dose de correo. Na realidade, a nica condio que a populao humana realmente obedece a de ser grande, j que estamos todos sujeitos ao da seleo natural (um bom exemplo o que ocorre com a incidncia do gene da anemia falciforme na frica, onde ele oferece parcial proteo malria), a incidncia de ocorrncia de mutaes est na faixa de um em 100 mil gametas, alm do fato de muitos casamentos no ocorrerem ao acaso, mas sim de acordo com critrios religiosos, culturais ou mesmo delimitados por questes geogrficas. O modelo matemtico postula que as freqncias allicas de uma populao em equilbrio gentico iro se comportar de acordo com a frmula p2 +2pq+q 2=1 Este modelo mais usado em sistemas dimrficos, ou seja, que possuam apenas dois alelos, mas pode ser expandido tambm para os casos de polialelia. Em sistemas dimrficos, cada uma das trs classes representa um dos trs gentipos possveis, representados pelos dois possveis homozigotos e o heterozigoto. Diferentes populaes podem apresentar freqncias gnicas bem diferentes. Observe, por exemplo, o artigo de Tishkoff e colaboradores. Tishkoff e colaboradores estudaram o dimorfismo da seqncia Alu do locus PLAT em 27 populaes humanas diferentes, distribudas geograficamente. Alm de estudar as populaes humanas, o grupo tambm investigou este dimorfismo em 24 chimpanzs, 5 gorilas, 5 orangotangos e 4 gibes, no encontrando a presena desta insero em nenhum destes primatas. Por outro lado, em todas as 27 populaes humanas estudadas observou-se a presena dos dois alelos, e em 25 populaes no havia uma predominncia de um ou outro alelo que apresentasse uma freqncia maior que 75%. Perguntas 1) Em relao ao surgimento desta insero Alu, que concluso voc tiraria da observao de que esta insero no pde ser encontrada em nenhum dos primatas analisados, podendo, no entanto, ser encontrada em todas as 27 populaes humanas estudadas? 2) Voc poderia indicar, atravs da anlise da tabela 2 do artigo de Tishkoff e colaboradores, quais as duas populaes humanas cujas freqncias de um dos alelos menor que 25%?

Eletroforese em gel de agarose


Utilize_________ do volume da reao de PCR para a eletroforese. O gel utilizado de 2%, para que possa possibilitar uma boa resoluo de fragmentos pequenos. Pipete____________de tampo de corrida em sua amostra. Aplique sua amostra no gel. O gel deve correr a 100 volts por aproximadamente 1 hora, ou at que o corante azul do tampo de corrida esteja a aproximadamente 2 cm do final do gel. Aps a corrida o gel deve ser corado com papelote de azul de metileno.

Anlise dos Resultados


A seqncia Alu se integrou na populao ao acaso, sendo, deste modo, um bom instrumento para se estudar a gentica de populaes e determinar se a populao est ou no em equilbrio. Esta anlise se faz aplicando-se o princpio de Hardy-Wienberg. Aps corar o gel, observe o gentipo de cada indivduo de seu grupo. Voc poder observar que alguns indivduos so homozigotos enquanto outros so heterozigotos. Em nosso exerccio, ns iremos designar por p2 os indivduos homozigotos que possuem a insero Alu TPA25 em seu genomas, e ns os chamaremos de indivduos (+/+). Os indivduos heterozigotos (+/-) correspondem classe 2pq, e a outra classe de homozigotos (-/-) corresponde classe q2. Atravs da determinao dos gentipos observados neste grupo, podemos calcular as freqncias allicas. Para tal, complete a tabela abaixo. Tabela 1 Freqncias genotpicas observadas Classes Homozigotos (+/+) Heterozigoto (+/-) Homozigoto (-/-) Quantidade de Gentipos Freqncia (gentipos/total) p2= pq= q2= Total= Tabela 2 Alelo
total p alelos total q alelos Total alelos=

Clculo das Freqncias Allicas Quantidade Freqncia Allica


p/total= q/total=

Testando o Equilbrio de Hardy-Weinberg Para saber se o nosso grupo est em Equilbrio de Hardy-Weinberg necessrio que ns apliquemos um teste estatstico, que ser capaz de nos informar se as freqncias genotpicas que observamos em nosso grupo so significativamente diferentes, ou no, daquela esperada. Neste caso, ns aplicaremos o teste qui-quadrado. Este teste utilizado para se testar uma hiptese, a hiptese nula. Neste caso, ns partimos do princpio de que o nosso grupo est em Equilbrio de Hardy-Weinberg, sendo esta a hiptese que iremos testar. De acordo com o resultado obtido no teste qui-quadrado, poderemos ento dizer se nosso grupo est (a hiptese nula confirmada) ou no (a hiptese nula rejeitada) em equilbrio para a insero TPA 25. Quando trabalhamos com apenas dois alelos temos somente 1 grau de liberdade. O valor crtico do qui-quadrado neste caso 3.84. Se o valor do qui-quadrado for igual ou maior que 3.84, ento h probabilidade de que a hiptese nula seja rejeitada ( porque as diferenas entre as freqncias observadas e as freqncias esperadas so significativas e no apenas obra do acaso). Se o valor do qui-quadrado, por outro lado, for menor que 3.84, ento dizemos que h 95% de probabilidade de que a diferena entre a freqncia observada e a freqncia esperada seja simples acaso. Neste caso, ns aceitamos a hiptese de que a populao est em equilbrio. Frmula do qui-quadrado Graus de liberdade

onde o a freqncia genotpica observada e e a freqncia genotpica esperada.

Problema
Baseado nas freqncias de p (+) e q (-) encontrada em nosso grupo, clcule as freqncias genotpicas esperadas, segundo a teoria de Hardy-Weinberg. Em seguida, aplique o teste qui-quadrado e descubra se nosso grupo est ou no em equilbrio para o locus em questo.

A estimativa de um parmetro pode estar baseada em um diferente nmero de informaes. Em clculos de distribuio, o conceito de graus de liberdade est associado ao nmero de parmetros que podem variar independentemente. Por exemplo, quando trabalhamos com dois alelos, p e q, se um dos parmetros varia o outro necessariamente tambm ir variar, porque p + q= 1. Ou seja, quando p 0,9, q 0,1. Se p varia de 0,9 para 0,7, q tambm varia na mesma proporo. Assim, quando trabalhamos com dois alelos, temos apenas um grau de liberdade, porque apenas um dos parmetros pode variar, sendo necessariamente acompanhado por uma variao no outro parmetro (alelo). J quando se trabalha com sistemas de 3 alelos, tm-se 2 graus de liberdade, j que dois dos parmetros (alelos) podem variar de qualquer forma, sendo que o terceiro ter que se ajustar de acordo com as variaes dos outros dois.

Um pouco de histria
Modelos matemticos tm sido utilizados em gentica desde o final do sculo XIX. Um dos primeiros e mais populares modelos matemticos para o estudo de gentica de populaes foi introduzido por Godfrey Harold Hardy, um matemtico de Cambridge. Em 1908, Hardy enviou uma carta ao editor da revista Science onde ele contestava a idia de que uma caracterstica gentica dominante teria a tendncia de se espalhar pela populao ao longo das geraes, enquanto uma caracterstica recessiva teria a tendncia a desaparecer. Para contestar tal idia, Hardy demonstrou que no havendo a atuao da evoluo, as freqncias genotpicas se manteriam em equilbrio ao longo da evoluo. De acordo com Hardy, somente a presena de foras evolutivas poderia alterar as freqncias genotpicas. Atravs de um simples modelo matemtico, Hardy demonstrou que a atuao apenas dos mecanismos mendelianos no poderia alterar as freqncias gnicas de uma populao. A equao apresentada no artigo intitulado Mendelian proportions in a mixed population representou o primeiro passo para a formulao do equilbrio de Hardy-Weinberg e o conseqente nascimento da gentica de populaes. No entanto, por quase 40 anos esta equao ficou conhecida apenas como Lei de Hardy. Em 1943, Curt Stern, do Departamento de Zoologia da Universidade de Rochester, enviou uma carta mesma revista Science onde informou que em 13 de janeiro de 1908, Wilhelm Weinberg havia apresentado uma palestra em que demonstrava o mesmo equilbrio proposto por Hardy, na mesma poca. Assim como os trabalhos de Mendel, a palestra de Weinberg havia sido publicada numa obscura revista cientfica e ficou desconhecida por quase 40 anos. Curt Stern ento sugeriu que seria uma questo de justia e de reconhecimento ao trabalho de Weinberg, que a equao passasse a levar o nome dos dois cientistas. Desde ento a equao tem sido conhecida como Equilbrio de Hardy-Weinberg.

Referncias G. H. Hardy, Mendelian proportions in a mixed population. Sci. New Ser. 28, 49-50 (1908). Curt Stern. The Hardy-Weinberg Law Science, New Series, Vol. 97, No. 2510: 137-138. (Feb. 5, 1943). Para saber mais sobre o Equilbrio de Hardy-Weinberg, visite os links abaixo How to Use Hardy-Weinberg to Find Gene Frequencies in a Wild Population http://www.woodrow.org/teachers/bi/1994/find.html MODELO DE HARDY-WEINBERG http://www.infobiogen.fr/services/chromcancer/IntroItems/HardySp.html