Sie sind auf Seite 1von 217

D 1331

Eine Zeitschrift der Gesellschaft Deutscher Chemiker


www.angewandte.de

2010122/33

Wirkungsweise amyloidogener Proteine


H. A. Lashuel und S. M. Buttereld

Totalsynthese von Kendomycin


J. Mulzer, H. J. Martin und T. Magauer

Highlights: Hochdruckpolymorphe von In2O3 Entwicklung ionischer Flssigkeiten


ANCEAD 122 (33) 57155938 (2010) ISSN 00448249 Vol. 122 No. 33

Titelbild
Andrew C. Stelzer, Jeremy D. Kratz, Qi Zhang und Hashim M. Al-Hashimi*
Mageschneiderte biomolekulare Strukturen mit festgelegten dynamischen Eigenschaften herzustellen ist eine noch nicht gelste Aufgabe der Strukturbiologie. In der Zuschrift auf S. 5867 ff. nutzen H. M. Al-Hashimi et al. eine einzige A-U!GC-Mutation, um die Dynamik von TAR-RNA (TAR: transactivation response element) gezielt so zu ndern, dass sie den Zustand nachahmt, den sie mit dem Ligand Argininamid einnimmt. Ein thermodynamisches topologisches Gerst fr das Entwerfen lokaler und globaler Merkmale der RNA-Dynamik auf atomarer Ebene zeichnet sich ab.

Naturstoffsynthese H. J. Martin, J. Mulzer und T. Magauer berichten im Kurzaufsatz auf S. 5746 ff. ber verschiedene Synthesestrategien fr das Polyketid Kendomycin, eine Ansaverbindung mit ungewhnlicher Struktur und biologischer Aktivitt.

Amyloid-Toxizitt In ihrem Aufsatz auf S. 5760 ff. zeigen H. A. Lashuel und S. M. Butterfield, wie Studien mit knstlichen Membranmodellen wertvolle Einblicke in die Mechanismen liefern, nach denen amyloidogene Proteine mit Membranen wechselwirken.

Wasserspaltung In der Zuschrift auf S. 5790 ff. stellen H. Jiang, J. Caro et al. einen sauerstoffpermeablen Membranreaktor vor, der die Wasserspaltung mit der Dehydrierung von Ethan koppelt. Der permeierte Sauerstoff aus der Wasserspaltung wird verwendet, um Ethan oxidativ zu Ethylen zu dehydrieren.

. Je nach Reaktionsbedingungen kann die selektive Cyclisierung von Aminocyclopropanen entweder an N1 oder an C3 des Indolrings ablaufen, wie J. Waser und Mitarbeiter in ihrer Zuschrift auf S. 5903 ff. beschreiben. Die Methode wurde zur Synthese von Apocynaceae-Alkaloiden eingesetzt: Mit einem Kupfer(I)-Katalysator wurde die Kernstruktur von Aspidospermidin erhalten, und in Gegenwart einer Brnsted-Sure gelang die Totalsynthese von Goniomitin, das signifikante Zytotoxizitt gegen Tumorzelllinien zeigte (IC50 = 150400 nm ).

Innentitelbild
Filippo De Simone, Jrg Gertsch und Jrme Waser*
Je nach Reaktionsbedingungen kann die selektive Cyclisierung von Aminocyclopropanen entweder an N1 oder an C3 des Indolrings ablaufen, wie J. Waser und Mitarbeiter in ihrer Zuschrift auf S. 5903 ff. beschreiben. Die Methode wurde zur Synthese von Apocynaceae-Alkaloiden eingesetzt: Mit einem Kupfer(I)Katalysator wurde die Kernstruktur von Aspidospermidin erhalten, und in Gegenwart einer Brnsted-Sure gelang die Totalsynthese von Goniomitin, das signifikante Zytotoxizitt gegen Tumorzelllinien zeigte (IC50 150400 nm ).

Inhalt
Die folgenden Zuschriften wurden von mindestens zwei Gutachtern als sehr wichtig (very important papers) eingestuft und sind in Krze unter www.angewandte.de verfgbar:
Z. Zhang, Z. Wang, R. Zhang, K. Ding* Extremely Efficient Titanium Catalyst for the Enantioselective Cyanation of Aldehydes Using Cooperative Catalysis Q. Wang, M. Zhang, C. Chen, W. Ma, J. Zhao* Photocatalytic Aerobic Oxidation of Alcohols on TiO2 : The Acceleration Effect of Bronsted Acids Y. Fu, Q. Dai, W. Zhang, J. Ren, T. Pan,* C. He* AlkB Domain of Mammalian ABH8 Catalyzes Hydroxylation of 5-Methoxycarbonylmethyluridine at the Wobble Position of tRNA H. Braunschweig,* K. Radacki, A. Schneider Cyclodimerisierung eines Oxoborylkomplexes durch trans-Ligandabstraktion C. Apostolidis, B. Schimmelpfennig, N. Magnani, P. Lindqvist-Reis,* O. Walter, R. Sykora, A. Morgenstern, E. Colineau, R. Caciuffo, R. Klenze, R. G. Haire, J. Rebizant, F. Bruchertseifer, T. Fanghnel [An(H2O)9](CF3SO3)3 (An=UCm, Cf ): Exploring Their Stability, Structural Chemistry, and Magnetic Behavior by Experiment and Theory S. Rizzato, J. Bergs, S. A. Mason, A. Albinati, J. Kozelka* Dispersion-Driven Hydrogen Bonding: Theoretically Predicted Hbond between H2O and Platinum(II) Identified by Neutron Diffraction D. R. Dreyer, H. Jia, C. W. Bielawski* Graphene Oxide: A Convenient Carbocatalyst for Facilitating Oxidation and Hydration Reactions

Autoren-Profile
Mit achtzehn wollte ich fr Schottland Fuball spielen. Die wichtigste wissenschaftliche Errungenschaft der letzten 50 Jahre ist die Entwicklung der Biologie hin zu einer Wissenschaft der Molekle (Chemie) ... Dies und mehr von und ber David OHagan finden Sie auf Seite 5736. David OHagan 5736

Bcher
Fluorinated Heterocyclic Compounds Viacheslav A. Petrov rezensiert von G. Weaver 5737

Nachruf
Victor S.-Y. Lin (19662010) W. Lin 5738 5739

Highlights
Ohne Wrme weichgekocht: Versuche, neue (oft funktionalisierte) ionische Flssigkeiten zu kreieren, enden hufig mit der Herstellung ionischer Feststoffe. Krzlich haben zwei Studien vielversprechende Wege aufgezeigt, um speziell solche Systeme in flssiger Form zu erhalten, die auf den in der Fachliteratur dominierenden Strukturen beruhen (siehe Bild; Tf2N = Bis(trifluormethylsulfonyl)imid). Ionische Flssigkeiten R. Giernoth* 5740 5741

Geknickte und verdrehte ionische Flssigkeiten: neue Wege zu flssigen Salzen

Angew. Chem. 2010, 122, 5719 5730

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5719

Inhalt
Nanomaterialien A. Gurlo* 5742 5744

Strukturelle Stabilitt von Hochdruckpolymorphen in In2O3Nanokristallen: Beweis fr eine spannungsinduzierte Umwandlung?

Zwei Wege zum Ziel : Hoher Druck oder nanoskalige Synthese fhren zum gleichen Indiumoxid-Polymorph, wofr die Untersuchungen von Farvid et al. eine Erklrung lieferten: Das metastabile Hochdruckpolymorph rh-In2O3 wird in

Nanopartikeln oberflchenspannungsinduziert stabilisiert, whrend es bei greren Partikeln als stabiles kubisches c-In2O3 existiert, wie die beiden schematischen Energiediagramme andeuten.

Kurzaufstze
Naturstoffsynthese H. J. Martin,* T. Magauer, J. Mulzer* Eine carbacyclische Ansaverbindung mit ungewhnlichen Strukturmerkmalen und einer uerst facettenreichen Bioaktivitt ist das Kendomycin (siehe Struktur; grau C, rot O). Dieser Kurzaufsatz bietet eine chronologische Schilderung der bisherigen Arbeit von acht Forschungsgruppen an der Synthese der Zielverbindung, die letztlich in fnf Totalsynthesen und einer Reihe fortgeschrittener Fragmentsynthesen mndete.

5746 5758

Einem kompetitiven Zielmolekl auf den Fersen: Totalsynthese des Antibiotikums Kendomycin

Aufstze
Amyloid-Toxizitt S. M. Butterfield, H. A. Lashuel*

5760 5788

Wechselwirkungen zwischen amyloidogenen Proteinen und Membranen: Modellsysteme liefern mechanistische Einblicke

Gegenseitige Strung : Modellsysteme wurden genutzt, um die Mechanismen aufzuklren, nach denen Membranoberflchen die Faltung, Oligomerisierung und Fibrillbildung von amyloidogenen Proteinen beeinflussen und wie diese oligome-

ren Proteinstrukturen im Gegenzug die Membranstruktur aufbrechen (siehe Bild). Die Studien offenbarten eine Reihe von Schlsselfaktoren, die zur Zytotoxizitt dieser Proteine beitragen.

5720

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Angewandte

Chemie

Zuschriften
Sauerstoff macht sich ntzlich : Ein sauerstoffpermeabler Perowskit-Membranreaktor (BCFZ; BaCoxFeyZr1xyO3d) koppelt die Wasserspaltung mit der Dehydrierung von Ethan. Die Bildung von Wasserstoff an der Innenseite der Membran geht einher mit der simultanen Produktion von Ethylen an der Auenseite (siehe Bild). Wasserspaltung H. Jiang,* Z. Cao, S. Schirrmeister, T. Schiestel, J. Caro* 5790 5794 Gekoppelte Herstellung von Wasserstoff und Ethylen in einem Membranreaktor

Brcken schlagen : Durch Kombination von hochauflsender Moleklspektroskopie im cm- und mm-Wellenbereich mit quantenchemischen Coupled-ClusterRechnungen auf hohem Theorieniveau wurde die Struktur von HPSi ermittelt. Seine verbrckte Struktur (siehe Bild; berechnete Werte in Klammern) unterscheidet sich in bemerkenswerter Weise von den linearen Strukturen der C- und NAnaloga wie HCN/HNC und HNSi.

Schwerer Cyanwasserstoff V. Lattanzi, S. Thorwirth, D. T. Halfen, L. A. Mck, L. M. Ziurys, P. Thaddeus, J. Gauss,* M. C. McCarthy* 5795 5798 Die Bindungsverhltnisse in schweren Analoga des Cyanwasserstoffs: der merkwrdige Fall des HPSi

Whlerische Partikel : Eine Methode fr die selektive Bildung von Kupfer-Nanopartikeln an dsDNA-Templaten wurde entwickelt. Die Gre der Nanopartikel kann ber die Lnge der dsDNA gesteuert werden, und einzelstrngige DNA wirkt nicht als Templat (siehe Schema). Einzelstrangberhnge wurden genutzt, um eine Nanostruktur bestehend aus zwei metallisierten dsDNAs und einem nichtmetallisierten starren Linker aufzubauen.

DNA-Nanofunktionseinheiten A. Rotaru, S. Dutta, E. Jentzsch, K. Gothelf, A. Mokhir* 5799 5802 Selektive dsDNA-gesteuerte Bildung von Kupfer-Nanopartikeln in Lsung

Luft wie geschmiert : Molekldynamikrechnungen ergaben, dass sich der Cluster B19 wie ein molekularer Wankel-Motor verhlt (siehe Vergleichsbild), in dem zwei konzentrische Borringe gegeneinander rotieren. Aufgrund der geringen Rotationsbarriere bleibt der Cluster whrend der Drehbewegung vollstndig eben.

Borchemie J. O. C. Jimnez-Halla, R. Islas, T. Heine,* G. Merino* 5803 5806 B19 : ein aromatischer Wankel-Motor

Angew. Chem. 2010, 122, 5719 5730

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5721

Inhalt
Kleinringsysteme F. Frbault, M. Luparia, M. T. Oliveira, R. Goddard, N. Maulide* 5807 5811 Eine vielseitige und stereoselektive Synthese funktionalisierter Cyclobutene

Quadratisch flach : Eine vielseitige atomkonomische Methode zur Synthese funktionalisierter Cyclobutene kombiniert eine elegante photochemische Isomerisierung mit einer Palladium-katalysierten

Alkylierung und kann das leicht verfgbare, flache aromatische 2-Pyron mit ausgezeichneter Stereoselektivitt in eine Vielzahl von funktionalisierten Produkten umwandeln (siehe Schema).

Polymorphie J. Evers,* W. Beck, M. Gbel, S. Jakob, P. Mayer, G. Oehlinger, M. Rotter, T. M. Klaptke 5812 5817 Die Strukturen von d-PdCl2 und g-PdCl2 : Phasen mit negativer thermischer Ausdehnung in einer Richtung

Dreimal ungewhnlich : Im tetramorphen PdCl2-System zeigen drei der vier Phasen das ungewhnliche Verhalten einer negativen thermischen Ausdehnung in einer Richtung. Die beiden Hochtemperaturphasen a-PdCl2 und d-PdCl2 (links) enthalten ebene Bnder kantenverknpfter PdCl4-Quadrate, whrend in der Tieftemperaturphase g-PdCl2 (rechts) gewellte Schichten eckenverknpfter PdCl4-Quadrate vorliegen. Normales thermisches Verhalten zeigt die b-Phase.

Heterogener Kollaps M. J. N. Junk, W. Li, A. D. Schlter, G. Wegner, H. W. Spiess, A. Zhang,* D. Hinderberger* 5818 5823 EPR-Spektroskopische Charakterisierung lokaler nanoskopischer Heterogenitten beim thermischen Kollaps thermoresponsiver dendronisierter Polymere

Der Phasenbergang von thermoresponsiven dendronisierten Polymeren wurde durch CW-EPR-Spektroskopie auf molekularer Ebene charakterisiert. Die Aggregation des Polymers wird durch dynamische, nanometergroe Strukturinhomo-

genitten eingeleitet, und die Dehydratisierung der Polymerketten zieht sich trotz des makroskopisch scharfen Phasenbergangs ber einen Temperaturbereich von mindestens 30 K hin (siehe Bild).

Seltenerdmetalle B. Davaasuren, H. Borrmann, E. Dashjav, G. Kreiner, M. Widom, W. Schnelle, F. R. Wagner, R. Kniep* 5824 5828 Planar Fe6 Cluster Units in the Crystal Structure of RE15Fe8C25 (RE = Y, Dy, Ho, Er)

Neuigkeiten von Fe-C : Die ternren Seltenerd-Titelverbindungen enthalten planare (magnetische) Fe6-Cluster, die durch Fe(C2)3-Einheiten zu polymeren Carboferrat-Komplexen verbunden sind (siehe Strukturausschnitt; rot Fe, schwarz C). Die Fe6-Cluster knnen als Fragmente von g-Fe und binren Eisencarbiden angesehen werden. Die ternren Verbindungen enthalten kovalente Fe-Fe-, polare dative Ligand(C2)!Metall(Fe)- und Fe !REWechselwirkungen.

5722

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Angewandte
Malariatherapeutika P. M. ONeill,* R. K. Amewu, G. L. Nixon, F. Bousejra ElGarah, M. Mungthin, J. Chadwick, A. E. Shone, L. Vivas, H. Lander, V. Barton, S. Muangnoicharoen, P. G. Bray, J. Davies, B. K. Park, S. Wittlin, R. Brun, M. Preschel, K. Zhang, S. A. Ward 5829 5833 Identification of a 1,2,4,5-Tetraoxane Antimalarial Drug-Development Candidate (RKA 182) with Superior Properties to the Semisynthetic Artemisinins

Chemie

Etappensieg gegen Wirkstoffresistenz : Aus einer Bibliothek von ber 150 1,2,4,5Tetraoxanen wurde ein Kandidat, RKA 182, fr die prklinische Entwicklung von Malariatherapeutika selektiert. RKA 182

zeigt herausragende In-vitro-Aktivitt gegen resistente Stmme von P. falciparum und wirkt auch gegen sdostasiatische Isolate, bei denen die Artemisininbasierte Kombinationstherapie versagt.

Zellulre Signalgebung J.-H. Lee, E. S. Kim, M. H. Cho, M. Son, S.-I. Yeon, J.-S. Shin,* J. Cheon* 5834 5838 Magnetisch angezogen : Zellaktivitten knstlich zu steuern gelingt durch nanoskalige magnetisch aktivierte zellulre Signalgebung, wofr magnetische Nanopartikel selektiv an Zelloberflchenrezeptoren geknpft und durch ein externes Magnetfeld aggregiert werden. Diese mechanozellulre Aktivierung lst die nachgeschaltete Signalgebung aus und initiiert im Prangiogenese-Stadium von Endothelzellen die Tubulogenese (siehe Bild). Artificial Control of Cell Signaling and Growth by Magnetic Nanoparticles

DNA-Entwindung H. Jang, Y.-K. Kim, H.-M. Kwon, W.-S. Yeo, D.-E. Kim, D.-H. Min* 5839 5843 A Graphene-Based Platform for the Assay of Duplex-DNA Unwinding by Helicase Mit bloen Auge zu erkennen : Mithilfe von Graphenoxid (GO) kann die Helicaseabhngige Entwindung doppelstrngiger DNA (dsDNA) quantitativ und in Echtzeit verfolgt werden. GO bindet selektiv an entwundene fluoreszenzmarkierte einzelstrngige DNA und lscht die Fluoreszenz (siehe Bild). Die Helicaseaktivitt wird ber die Fluoreszenznderung registriert.

Rotaviren auf der Spur : Die empfindliche und selektive Detektion von Rotaviren gelingt mithilfe der Photolumineszenz eines Graphenoxid(GO)-Arrays. Die Zielzelle wurde vom Rotavirus-spezifischen, auf dem GO-Array immobilisierten Antikrper eingefangen, und der Bindevorgang wurde anhand der Fluoreszenzlschung verfolgt, die aus dem resonanten Fluoreszenzenergietransfer (FRET) zwischen GO und Goldnanopartikeln an den Antikrpern resultiert (siehe Bild).
Angew. Chem. 2010, 122, 5719 5730

Biosensoren J. H. Jung, D. S. Cheon, F. Liu, K. B. Lee, T. S. Seo* 5844 5847 A Graphene Oxide Based Immunobiosensor for Pathogen Detection

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5723

Inhalt
Nanostbchen H. Kim, Y. Chae, D. H. Lee, M. Kim, J. Huh, Y. Kim, H. Kim, H. J. Kim, S. O. Kim,* H. Baik, K. Choi, J. S. Kim, G.-R. Yi, K. Lee* 5848 5852 Palladium Nanoparticle Catalyzed Conversion of Iron Nanoparticles into Diameter- and Length-Controlled Fe2P Nanorods Eine doppelte Rolle spielen Pd-Nanopartikel bei der Umwandlung von Fe-Nanopartikeln und einer P-Quelle in Fe2PNanostbchen: als Katalysatoren, die FeNanopartikel unter Bildung lslicher Vorstufen destabilisieren, und als Katalysezentren fr das Wachstum von Nanostbchen (siehe Bild). Durchmesser und Lnge der Nanostbchen lassen sich ber den Durchmesser der Pd-Nanopartikel bzw. das Fe/Pd-Verhltnis einstellen.

C-H-Aktivierung C. Geng, S. Ye, F. Neese* 5853 5856

Analysis of Reaction Channels for Alkane Hydroxylation by Nonheme Iron(IV)Oxo Complexes Neue High-Spin-Pfade : Die vier plausiblen Reaktionspfade der Alkanhydroxylierung durch Nichthm-Eisen(IV)-OxoKomplexe wurden rechnerisch untersucht. Der Triplett-s-Pfad ist energetisch zu hoch, um an einer C-H-Aktivierung beteiligt zu sein jedoch konkurriert die Reaktivitt des Quintett-p-Kanals mit dem Triplett-Pfad, was einen neuen Ansatz fr die spezifische C-H-Aktivierung durch Eisen(IV)-Oxo-Spezies bieten knnte (siehe Schema).

Kombinatorische Chemie S. V. Shelke, B. Cutting, X. Jiang, H. Koliwer-Brandl, D. S. Strasser, O. Schwardt, S. Kelm, B. Ernst* 5857 5861 A Fragment-Based In Situ Combinatorial Approach to Identify High-Affinity Ligands for Unknown Binding Sites

In leitender Position : Die im Titel genannte Methode zur Identifizierung von Liganden ist besonders ntzlich, wenn keine oder nur unvollstndige strukturelle Informationen zur Bindungsstelle verfgbar sind. In einem Fragment-basierten Verfahren wird durch NMR-Experimente

ein geeignetes Paar von Liganden ermittelt. Mit einem Rezeptor-vermittelten, kombinatorischen In-situ-Verfahren werden die Liganden anschlieend verknpft und so in eine neue hochaffine Leitstruktur berfhrt (siehe Bild).

Naturstoffe J. B. Scaglione, D. L. Akey, R. Sullivan, J. D. Kittendorf, C. M. Rath, E.-S. Kim, J. L. Smith, D. H. Sherman* 5862 5866 Biochemical and Structural Characterization of the Tautomycetin Thioesterase: Analysis of a Stereoselective Polyketide Hydrolase

Ein enger Tunnel : Struktur- und biochemische Analyse der Tautomycetin-Thioesterase (TE) lieferten die erste hoch aufgelste Struktur einer TE mit einer linearen Kette als Endstck in der Polyketidbiosynthese und zeigten, dass das Enzym stereoselektiv ist und eine engere Substratkammer aufweist als Makrolactone bildende Thioesterasen.

5724

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Angewandte
Mit einer einzigen Mutation von AU nach GC wurde die lokale und globale Dynamik der Transactivation-Response-Element(TAR)-RNA rational ber Zeitskalen bis hin zu Millisekunden verndert. Damit ist es mglich, den gebundenen Zustand von TAR mit dem Liganden Argininamid (ARG) zu imitieren. Die Mutante bindet ARG mit etwas hherer Affinitt und nimmt dabei eine Konformation an, die sich nicht von jener der Wildtypsequenz unterscheidet. RNA-Dynamik A. C. Stelzer, J. D. Kratz, Q. Zhang, H. M. Al-Hashimi* 5867 5869 RNA Dynamics by Design: Biasing Ensembles Towards the Ligand-Bound State

Chemie

Plasmonen G. Noy, A. Ophir, Y. Selzer* 5870 5872

Tunnel in die Freiheit : Durch Laserbestrahlung erzeugte Plasmonen beeinflussen die Leitfhigkeit an einem molekularen bergang mit schwebendem Draht (siehe Bild). Die Stromzunahme, die von

Wellenlnge und Laserleistung abzuhngen scheint, ist in halbquantitativer bereinstimmung mit theoretischen Modellen auf der Grundlage eines photonenvermittelten Tunnelmechanismus.

Response of Molecular Junctions to Surface Plasmon Polaritons

Nanotechnologie B. Kowalczyk, D. A. Walker, S. Soh, B. A. Grzybowski* 5873 5877 Echt stark! Kern-Schale- und Nanopartikelkristalle detektieren chemische und enzymatische Analyte mit einem verstrkten Mess-Signal. Die Kristalle werden dabei zunchst wasserunlslich gemacht, indem ihre Oberflche mit Dithiolen vernetzt wird, die analytspezifische Gruppen tragen. Bei Zugabe des Analyten werden diese Gruppen gespalten, woraufhin die Kristalle Millionen intensiv farbiger Nanopartikel freisetzen (siehe Bild). Nanoparticle Supracrystals and Layered Supracrystals as Chemical Amplifiers

Extralieferung : Ein effektiver Impfstoff gegen Gruppe-A-Streptokokken wird von einem Liefersystem gebildet, das aus genau definierten nanoskaligen dendritischen Strukturen besteht (siehe Bild). Die Strukturen prsentieren mehrere Kopien der minimalen B-Zellepitope, die auf der Oberflche der Nanopartikel die optimale Konformation haben. Die Nanopartikel knnen ohne Zusatz eines Hilfsmittel verabreicht werden.

Wirkstofftransport M. Skwarczynski, M. Zaman, C. N. Urbani, I-C. Lin, Z. Jia, M. R. Batzloff, M. F. Good, M. J. Monteiro,* I. Toth* 5878 5881 Polyacrylate Dendrimer Nanoparticles: A Self-Adjuvanting Vaccine Delivery System

Angew. Chem. 2010, 122, 5719 5730

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5725

Inhalt
Metallkatalysierte Reaktionen P. A. Evans,* J. R. Sawyer, P. A. Inglesby

5882 5885 Man hat die Wahl : In der Titelreaktion lsst sich die selektive Bildung der zwei Regioisomere durch sorgfltige Wahl der Hilfsliganden steuern (siehe Schema). Entscheidend war der Befund, dass Reste von Silbersalzen aus der Salzmetathese des neutralen Komplexes einen starken Einfluss auf die Regio- und Diastereoselektivitt haben.

Regiodivergent Ligand-Controlled Rhodium-Catalyzed [(22)2] Carbocyclization Reactions with Alkyl Substituted Methyl Propiolates

Kristall-Engineering K. Ikemoto, Y. Inokuma, M. Fujita*

5886 5888

The Reaction of Organozinc Compounds with an Aldehyde within a Crystalline Molecular Flask

Ein Organozinkreagens wurde im Zuge einer Einkristall-Einkristall-Umwandlung im Innern eines porsen Koordinationsgersts an einen Aldehyd addiert (siehe Bild). Dabei wurde die Struktur des Pro-

dukts durch Rntgenbeugung abgesichert. Eine zweistufige Reaktion im Einkristall berfhrte darber hinaus einen Aldehyd in einen Ester, ohne dass die Kristallinitt des Gersts verlorenging.

Fullerene P. Compain,* C. Decroocq, J. Iehl, M. Holler, D. Hazelard, T. Mena Barragn, C. Ortiz Mellet,* J.-F. Nierengarten* 5889 5892 Glycosidase Inhibition with Fullerene Iminosugar Balls: A Dramatic Multivalent Effect

Superball! Ein dodekavalentes Iminozucker-Derivat mit einem Fulleren-Kern (siehe Bild) zeigt in Versuchen zur Glycosidase-Inhibition eine um bis zu drei Grenordnungen bessere Bindung als der entsprechende monovalente Ligand. Dies ist der erste Beleg fr einen signifikanten Multivalenzeffekt bei der Glycosidase-Inhibition.

Arylierungen D. S. Huang, J. F. Hartwig* 5893 5897

Palladium-Catalyzed g-Arylation of a,bUnsaturated Esters from Silyl Ketene Acetals

Smarter Katalysator : Eine Methode fr die Palladium-katalysierte g-Arylierung von a,b-ungesttigten Estern wurde entwickelt, die ber Silylketenacetale verluft und ohne Fluorid-Aktivatoren auskommt.

Die Kupplung gelingt mit elektronenreichen und elektronenarmen Aryl- und Vinylbromiden in hohen Ausbeuten, und andere funktionelle Gruppen werden gut toleriert.

5726

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Angewandte
Organokatalyse K. Matoba, H. Kawai, T. Furukawa, A. Kusuda, E. Tokunaga, S. Nakamura, M. Shiro, N. Shibata* 5898 5902 Eine Sequenz von Addition, Cyclisierung und Dehydrierung liefert die biologisch wichtigen chiralen 3,5-Diaryl-5-(trifluormethyl)-2-isoxazoline 1 in hervorragenden Ausbeuten und hohen Enantioselektivitten. Der gezielte Zugang zum S- oder REnantiomer der Produkte wurde durch die Wahl eines geeigneten Phasentransferkatalysators (2) erffnet. Enantioselective Synthesis of Trifluoromethyl-Substituted 2Isoxazolines: Asymmetric Hydroxylamine/Enone Cascade Reaction

Chemie

Alkaloide F. De Simone, J. Gertsch, J. Waser*

5903 5906

Sanfte Kontrolle : Je nach Reaktionsbedingungen gelingt die Titelreaktion an der N1- oder der C3-Position eines Indolrings (siehe Schema). Das neben Aspidospermidin mithilfe dieser Strategie syntheti-

sierte Goniomitin ist gegen mehrere Tumorzelllinien cytotoxisch (IC50 = 150 400 nm). Cbz = Benzyloxycarbonyl, Ts = 4-Toluolsulfonyl.

Catalytic Selective Cyclizations of Aminocyclopropanes: Formal Synthesis of Aspidospermidine and Total Synthesis of Goniomitine

Gold? Ja! Aber in welcher Form? Die im Titel bezeichneten Katalysatoren wurden nach einem Kolloidabscheidungsverfahren erhalten. Rastertransmissionselektronenmikroskopie-Untersuchungen belegen, dass das Vorliegen von Doppelschichten aus etwa 0.5 nm groen Goldclustern nicht zwingend fr eine hohe katalytische Aktivitt erforderlich ist (siehe Bild).

Nanopartikel Y. Liu, C.-J. Jia, J. Yamasaki, O. Terasaki, F. Schth* 5907 5911 Highly Active Iron Oxide Supported Gold Catalysts for CO Oxidation: How Small Must the Gold Nanoparticles Be?

Elektrochemie J. M. Salverda, A. V. Patil, G. Mizzon, S. Kuznetsova, G. Zauner, N. Akkilic, G. W. Canters, J. J. Davis,* H. A. Heering, T. J. Aartsma* 5912 5915 Fluorescent Cyclic Voltammetry of Immobilized Azurin: Direct Observation of Thermodynamic and Kinetic Heterogeneity

Schwankungen im formalen elektrochemischen Potential (E0) und in der Elektronentransfergeschwindigkeit (k0) des blauen Kupferproteins Azurin wurden direkt beobachtet. Die Fluoreszenz-Cyclovoltammetrie wurde als ein neues Ver-

fahren angewendet, um die Eigenschaften von 1001000 Proteinen zu charakterisieren. Dabei wurden starke Schwankungen fr E0 und k0 bestimmt, und man konnte unterschiedliche Arten von Heterogenitten unterscheiden.

Angew. Chem. 2010, 122, 5719 5730

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5727

Inhalt
Asymmetrische Katalyse Z.-Q. Wang, C.-G. Feng, S.-S. Zhang, M.-H. Xu,* G.-Q. Lin* 5916 5919 Rhodium-Catalyzed Asymmetric Conjugate Addition of Organoboronic Acids to Nitroalkenes Using Chiral Bicyclo[3.3.0] Diene Ligands Nichts geht ber Diene : In der Titelreaktion mit anspruchsvollen Nitroalkenen ohne a-Substituenten als Substraten und unter ArB(OH)2/KHF2-Bedingungen waren chirale Bicyclo[3.3.0]-Diene die besten Liganden. Np = Naphthyl.

DOI: 10.1002/ange.201004246

Vor

100 Jahren in der Angewandten Chemie


Zukunft braucht Herkunft die Angewandte Chemie wird seit 1888 publiziert, und im nchsten Jahr gibt es auch die International Edition schon 50 Jahre. Ein Blick zurck kann Augen ffnen, zum Nachdenken und -lesen anregen oder ein Schmunzeln hervorlocken: Deshalb finden Sie an dieser Stelle wchentlich Kurzrckblicke, die abwechselnd auf Hefte von vor 100 und vor 50 Jahren schauen. COCl2 beides sehr unerfreuliche Stoffe im Hinblick auf eine Narkose verhindern soll. Lesen Sie mehr in Heft 33/1910. & ast siebzig Seiten umfassen die Texte ber die 23. Hauptversammlung des Vereins deutscher Chemiker in Mnchen im nchsten Heft. Bei der vom Geh. Reg.-Rat Prof. Dr. C. Duisberg als Vorsitzenden geleiteten Sitzung des Vorstandrates gab es neben den bei einer solchen Veranstaltung zu erwartenden typischen Tagesordnungspunkten auch den Dauerbrenner Verbesserung des chemisch-technologischen Unterrichts an den deutschen Universitten sowie Informationen zu den neuen Brorumen der Geschftsstelle mit einer genauen Beschreibung der Rumlichkeiten, die mit den Worten beginnt: Betreten wir den Flur des Hauses Stephanstr. 8, so fhrt uns die erste Tr links in die Geschftsrume des Vereins. Zudem findet man einen detaillierten Grundriss. Auch eine bersicht ber die Aufstze in der Angewandten Chemie (so hieen damals die Originalverffentlichungen) gab es bereits (siehe Tabelle 1). Heute erhlt die Angewandte Chemie ca. 600 Originalbeitrge (Zuschriften) im Monat! Lesen Sie mehr in Heft 34/1910.

Die effiziente Gewinnung von Bioalkohol kein neues Thema: In seinem Vortrag bei der Vorstandssitzung des Vereins der Zellstoff- und Papierchemiker 1910 in Goslar sprach Dr. Carl G. Schwalbe ber die Spritgewinnung aus den Ablaugen der Zellstoffabrikation und nannte dabei unter anderem zwei Vorteile der Verwendung von Cellulose gegenber der von Zucker und Strke: Man knne Kartoffeln und Getreide wieder vor allem als Nhrmittel nutzen, und die nordeuropischen und nordamerikanischen Sgewerke mssten nicht mehr stndig ihr Sgemehl verbrennen. Schwalbe analysiert die Versuche, Sgemehl mit schwefliger Sure unter Druck aufzuschlieen, sowohl unter verfahrenstechnischen als auch unter wirtschaftlichen Aspekten. Die Reinheitsprfung bei NarkoseChloroform war Thema des Vortrags von Dr. F. Stadlmayr bei der Hauptversammlung des Vereins deutscher Chemiker in Mnchen. Narkose-Chloroform unterscheidet sich von anderen Chloroform-Handelsformen durch den Zusatz von Ethanol, der die durch Licht ausgelste Reaktion mit Sauerstoff zu Cl2 oder

Tabelle 1: Statistische Daten zur Angewandten Chemie vor 100 Jahren. Aufstze Eingegangen Davon zurckgewiesen Ins neue Jahr hinbergenommen Also abgedruckt im gleichen Jahr Abgedruckt aus dem Vorjahre Also insgesamt abgedruckt Durchschnittslnge eines Aufsatzes 1909 252 38 32 182 21 203 3.9 1908 252 21 21 210 27 237 3.3 1907 245 39 27 179 32 211 3.5

5728

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Angewandte
Oxaplatinacyclen N. Nakata, N. Furukawa, T. Toda, A. Ishii* 5920 5923 Cleavage of CS and OH Bonds by Platinum(0) Complexes To Give FiveMembered 1,2-Oxaplatinacycles

Chemie

Spektakulres Platin(0): Die 1,2-Oxaplatinacyclen 2 entstanden berraschenderweise aus (2-Hydroxybenzyl)sulfiden 1 durch Pt0-vermittelte Bindungsspaltung (siehe Schema; nb = Norbornen). Die thermische Reaktion von 2 lieferte neu-

artige sechsgliedrige 1,2,3-Oxaphosphaplatinacyclen durch Ringerweiterung unter Insertion eines Phosphoratoms in die Pt-O-Bindung und 1,2-Verschiebung einer Phenylgruppe.

Frustrierte Lewis-Paare M. Alcarazo,* C. Gomez, S. Holle, R. Goddard 5924 5927 Exploring the Reactivity of Carbon(0)/ Borane-Based Frustrated Lewis Pairs

Doppelt frustriert : Die ungewhnliche elektronische Verteilung um das zentrale Kohlenstoff(0)-Atom in Carbodiphosphoranen macht dieses Zentrum so basisch,

dass es selbst nach einem ersten Alkylierungsschritt dazu in der Lage ist, als kationische Lewis-Base im Rahmen der Chemie frustrierter Lewis-Paare zu wirken.

C-H-Aktivierung H. F. Yu, W. W. Jin, C. L. Sun, J. P. Chen, W. M. Du, S. B. He, Z. K. Yu* 5928 5933 Palladium-Catalyzed Cross-Coupling of Internal Alkenes with Terminal Alkenes to Functionalized 1,3-Butadienes Using CH Bond Activation: Efficient Synthesis of Bicyclic Pyridones

Eine hoch regioselektive direkte Kreuzkupplung von internen Alken-a-oxoketendithioacetalen mit terminalen Alkenen gelang durch Palladium-katalysierte C-HAktivierung unter Bildung von funktiona-

lisierten 1,3-Butadienen. Kondensation der Butadiene mit Diaminen lieferte potenziell biologisch aktive bicyclische Pyridon-Derivate.

Hintergrundinformationen sind unter www.angewandte.de erhltlich (siehe Beitrag).

Eine Videodatei ist als Hintergrundinformation unter www.angewandte.de oder vom Korrespondenzautor erhltlich.

Service
Top-Beitrge der Schwesterzeitschriften der Angewandten 5732 5734 Stichwortregister Autorenregister Stellenanzeigen Vorschau 5934 5935 5731 5937

Angew. Chem. 2010, 122, 5719 5730

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5729

Inhalt

Berichtigung *
Exploring the Reactivity of Carbon(0)/ Borane-Based Frustrated Lewis Pairs M. Alcarazo,* C. Gomez, S. Holle, R. Goddard 59245927 Angew. Chem. 2010, 122 DOI 10.1002/ange.201002119
[1] a) D. J. Parks, W. E. Piers, J. Am. Chem. Soc. 1996, 118, 9440 9441; b) D. J. Parks, J. M. Blackwell, W. E. Piers, J. Org. Chem. 2000, 65, 3090 3098; c) J. M. Blackwell, D. J. Morrison, W. E. Piers, Tetrahedron 2002, 58, 8247 8254. [2] J. M. Blackwell, E. Sonmor, T. Scoccitti, W. E. Piers, Org. Lett. 2000, 2, 3921 3923. [3] J. M. Blackwell, K. L. Foster, V. H. Beck, W. E. Piers, J. Org. Chem. 1999, 64, 4887 4892.

Die Hydrosilylierung von Carbonyl-[1] und Iminfunktionen[2] sowie die Silylierung von Alkoholen[3] wurden bereits in einer Reihe von Verffentlichungen vor dieser Zuschrift ber frustrierte Lewis-Paare (FLPs) vorgestellt. Kinetische Parameter deuten stark auf eine Aktivierung der Si-H-Bindung ber einen FLP-Mechanismus in diesen Prozessen hin. Die Autoren danken Prof. W. E. Piers fr diesen Hinweis.

Weitere Informationen zu:

www.chemasianj.org

www.chemmedchem.org

www.chemsuschem.org

www.chemcatchem.org

5730

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Inhalt
Asymmetrische Katalyse Z.-Q. Wang, C.-G. Feng, S.-S. Zhang, M.-H. Xu,* G.-Q. Lin* 5916 5919 Rhodium-Catalyzed Asymmetric Conjugate Addition of Organoboronic Acids to Nitroalkenes Using Chiral Bicyclo[3.3.0] Diene Ligands Nichts geht ber Diene : In der Titelreaktion mit anspruchsvollen Nitroalkenen ohne a-Substituenten als Substraten und unter ArB(OH)2/KHF2-Bedingungen waren chirale Bicyclo[3.3.0]-Diene die besten Liganden. Np = Naphthyl.

DOI: 10.1002/ange.201004246

Vor

100 Jahren in der Angewandten Chemie


Zukunft braucht Herkunft die Angewandte Chemie wird seit 1888 publiziert, und im nchsten Jahr gibt es auch die International Edition schon 50 Jahre. Ein Blick zurck kann Augen ffnen, zum Nachdenken und -lesen anregen oder ein Schmunzeln hervorlocken: Deshalb finden Sie an dieser Stelle wchentlich Kurzrckblicke, die abwechselnd auf Hefte von vor 100 und vor 50 Jahren schauen. COCl2 beides sehr unerfreuliche Stoffe im Hinblick auf eine Narkose verhindern soll. Lesen Sie mehr in Heft 33/1910. & ast siebzig Seiten umfassen die Texte ber die 23. Hauptversammlung des Vereins deutscher Chemiker in Mnchen im nchsten Heft. Bei der vom Geh. Reg.-Rat Prof. Dr. C. Duisberg als Vorsitzenden geleiteten Sitzung des Vorstandrates gab es neben den bei einer solchen Veranstaltung zu erwartenden typischen Tagesordnungspunkten auch den Dauerbrenner Verbesserung des chemisch-technologischen Unterrichts an den deutschen Universitten sowie Informationen zu den neuen Brorumen der Geschftsstelle mit einer genauen Beschreibung der Rumlichkeiten, die mit den Worten beginnt: Betreten wir den Flur des Hauses Stephanstr. 8, so fhrt uns die erste Tr links in die Geschftsrume des Vereins. Zudem findet man einen detaillierten Grundriss. Auch eine bersicht ber die Aufstze in der Angewandten Chemie (so hieen damals die Originalverffentlichungen) gab es bereits (siehe Tabelle 1). Heute erhlt die Angewandte Chemie ca. 600 Originalbeitrge (Zuschriften) im Monat! Lesen Sie mehr in Heft 34/1910.

Die effiziente Gewinnung von Bioalkohol kein neues Thema: In seinem Vortrag bei der Vorstandssitzung des Vereins der Zellstoff- und Papierchemiker 1910 in Goslar sprach Dr. Carl G. Schwalbe ber die Spritgewinnung aus den Ablaugen der Zellstoffabrikation und nannte dabei unter anderem zwei Vorteile der Verwendung von Cellulose gegenber der von Zucker und Strke: Man knne Kartoffeln und Getreide wieder vor allem als Nhrmittel nutzen, und die nordeuropischen und nordamerikanischen Sgewerke mssten nicht mehr stndig ihr Sgemehl verbrennen. Schwalbe analysiert die Versuche, Sgemehl mit schwefliger Sure unter Druck aufzuschlieen, sowohl unter verfahrenstechnischen als auch unter wirtschaftlichen Aspekten. Die Reinheitsprfung bei NarkoseChloroform war Thema des Vortrags von Dr. F. Stadlmayr bei der Hauptversammlung des Vereins deutscher Chemiker in Mnchen. Narkose-Chloroform unterscheidet sich von anderen Chloroform-Handelsformen durch den Zusatz von Ethanol, der die durch Licht ausgelste Reaktion mit Sauerstoff zu Cl2 oder

Tabelle 1: Statistische Daten zur Angewandten Chemie vor 100 Jahren. Aufstze Eingegangen Davon zurckgewiesen Ins neue Jahr hinbergenommen Also abgedruckt im gleichen Jahr Abgedruckt aus dem Vorjahre Also insgesamt abgedruckt Durchschnittslnge eines Aufsatzes 1909 252 38 32 182 21 203 3.9 1908 252 21 21 210 27 237 3.3 1907 245 39 27 179 32 211 3.5

5728

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Inhalt

Berichtigung *
Exploring the Reactivity of Carbon(0)/ Borane-Based Frustrated Lewis Pairs M. Alcarazo,* C. Gomez, S. Holle, R. Goddard 59245927 Angew. Chem. 2010, 122 DOI 10.1002/ange.201002119
[1] a) D. J. Parks, W. E. Piers, J. Am. Chem. Soc. 1996, 118, 9440 9441; b) D. J. Parks, J. M. Blackwell, W. E. Piers, J. Org. Chem. 2000, 65, 3090 3098; c) J. M. Blackwell, D. J. Morrison, W. E. Piers, Tetrahedron 2002, 58, 8247 8254. [2] J. M. Blackwell, E. Sonmor, T. Scoccitti, W. E. Piers, Org. Lett. 2000, 2, 3921 3923. [3] J. M. Blackwell, K. L. Foster, V. H. Beck, W. E. Piers, J. Org. Chem. 1999, 64, 4887 4892.

Die Hydrosilylierung von Carbonyl-[1] und Iminfunktionen[2] sowie die Silylierung von Alkoholen[3] wurden bereits in einer Reihe von Verffentlichungen vor dieser Zuschrift ber frustrierte Lewis-Paare (FLPs) vorgestellt. Kinetische Parameter deuten stark auf eine Aktivierung der Si-H-Bindung ber einen FLP-Mechanismus in diesen Prozessen hin. Die Autoren danken Prof. W. E. Piers fr diesen Hinweis.

5730

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5719 5730

Top-Beitrge
Auf diesen drei Seiten weisen wir auf wichtige aktuelle Beitrge in unseren Schwesterzeitschriften hin. Wenn Sie die Seiten online lesen, dann knnen Sie die Artikel mit einem Klick direkt aufrufen, ansonsten sind sie durch Eingabe der DOIs ber Wiley InterScience leicht online zugnglich.

Coordination Chemistry J. M. Lynam Recent Mechanistic and Synthetic Developments in the Chemistry of Transition-Metal Vinylidene Complexes How to tautomerise alkynes! Transition-metal vinylidene complexes are important synthetic intermediates for a range of transformations involving terminal alkynes. This article reviews a number of recent developments focused on understanding the alkyne/vinylidene tautomerisation mediated by transition-metal complexes. The coupling of experimental and theoretical methods has allowed for detailed insight into this process and the factors which control it.

Chem. Eur. J. DOI: 10.1002/chem.201000695

Dendrimers G. Bergamini, A. Sottilotta, M. Maestri, P. Ceroni,* F. Vgtle* Cyclam-Cored Dendrimers Appended with Four Dendrons of Two Different Types: Intradendrimer Energy Transfer The H effect! Two cyclam-cored dendrimers appended with dendrons of two different types, by proper protection/deprotection of the cyclam unit, are synthesized. Interdendron naphthyl-to-dansyl energy transfer takes place within the same dendrimer: its efficiency can be reversibly tuned by protonation/deprotonation of the cyclam core.

Chem. Asian J. DOI: 10.1002/asia.201000170

Drug Delivery F. Marlin, P. Simon, T. Saison-Behmoaras, C. Giovannangeli* Delivery of Oligonucleotides and Analogues: The Oligonucleotide Conjugate-Based Approach Carrier conjugates : Oligonucleotide-based therapeutic strategies are moving closer to use in patients, but bench work is still needed. Although oligonucleotides are validated and powerful tools in basic research, their delivery is still the major issue impeding their use as therapeutics. Carrieroligonucleotide conjugates currently in development are reviewed here.

ChemBioChem DOI: 10.1002/cbic.201000138

5732

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5732 5734

aus unseren Schwesterzeitschriften


Nanostructures D. Bekermann, A. Gasparotto,* D. Barreca, A. Devi, R. A. Fischer, tangar, O. I. Lebedev, C. Maccato, ic S M. Kete, U. Lavrenc E. Tondello, G. Van Tendeloo ZnO Nanorod Arrays by Plasma-Enhanced CVD for Light-Activated Functional Applications Switch of the surface properties : Supported ZnO nanorod arrays with tailored roughness and aspect ratios are successfully synthesized by plasma-enhanced chemical vapor deposition. Such nanostructures exhibit significant superhydrophilic and photocatalytic properties tunable as a function of their morphological organization (see picture). This renders them promising building blocks for the fabrication of stimuli-responsive materials. Bioinformatics K. Engels, C. Beyer, M. L. Surez Fernndez, F. Bender, M. Gael, G. Unden, R. J. Marhfer, J. C. Mottram, P. M. Selzer* Inhibition of Eimeria tenella CDK-Related Kinase 2: From Target Identification to Lead Compounds Targeting coccidiosis : Cyclin-dependant kinases (CDKs) of the protozoan parasite Eimeria tenella, which causes the severe poultry disease coccidiosis, were identified from genomic sequence data. The cell cycle and most well-characterized kinase (EtCRK2) of E. tenella were chemically validated as drug targets in enzyme and cell culture assays. Promising lead compounds were identified in a combined in silico/ in vitro screening approach. Carbon Dioxide Capture W. Li, S. Choi, J. H. Drese, M. Hornbostel, G. Krishnan, P. M. Eisenberger, C. W. Jones* Steam-Stripping for Regeneration of Supported Amine-Based CO2 Adsorbents Amine-based solid CO2 adsorbents have been investigated intensively in recent years. However, the focus has routinely been on their adsorption capacity and not on their regeneration. Here, a practical desorption process for supported amine adsorbents, steam-stripping, is demonstrated for the first time. CoreShell Catalysts J. Keilitz, M. Schwarze, S. Nowag, R. Schomcker, R. Haag* Homogeneous Stabilization of Pt Nanoparticles in Dendritic CoreMultishell Architectures: Application in Catalytic Hydrogenation Reactions and Recycling Cores and effect : The synthesis and stabilization of Pt nanoparticles in dendritic coremultishell polymers and their application to hydrogenation reactions are described. The catalyst is reused 14 times (total TON = 22 000) and can be recovered by ultrafiltration or phase separation with very low metal leaching into the product.

ChemPhysChem DOI: 10.1002/cphc.201000333

ChemMedChem DOI: 10.1002/cmdc.201000157

ChemSusChem DOI: 10.1002/cssc.201000131

ChemCatChem DOI: 10.1002/cctc.201000013

Angew. Chem. 2010, 122, 5732 5734

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5733

Top-Beitrge
Modeling Actinide Compounds S. V. Krivovichev* Actinyl Compounds with Hexavalent Elements (S, Cr, Se, Mo) Structural Diversity, Nanoscale Chemistry, and Cellular Automata Modeling Basic features of the structural chemistry of actinyl compounds with TO4 tetrahedral oxyanions (T = S, Cr, Se, and Mo) are outlined with particular attention to structural topologies, nanoscale units, and algorithmic generation of structures by using cellular automata.

Eur. J. Inorg. Chem. DOI: 10.1002/ejic.201000168

Pyrrolysine T. Fekner, X. Li, M. K. Chan* Pyrrolysine Analogs for Translational Incorporation into Proteins A combination of crystallographic, biochemical, and synthetic studies related to pyrrolysine and its biochemical machinery led to the formulation of a set of principles for the design of successful analogs for site-specific modification of proteins. The journey leading to it and recent practical applications of the acquired knowledge are discussed.

Eur. J. Org. Chem. DOI: 10.1002/ejoc.201000204

5734

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5732 5734

Autoren-Profile
David OHagan
Geburtstag: Stellung: Werdegang: 29. September 1961 Professor und Leiter des Bereichs Organic Chemistry, School of Chemistry and Centre for Biomolecular Sciences der Universitt St Andrews (Grobritannien) 19781982 BSc, Universitt Glasgow (Grobritannien) 19821985 Promotion bei Prof. J. A. Robinson (Universitt Southampton) 19851986 Postdoc bei Prof. Heinz G. Floss, Ohio State University (USA) 19862000 Department of Chemistry, Universitt Durham (Grobritannien) seit 2000 School of Chemistry, Universitt St Andrews 2004 Wahl zum Fellow der Royal Society of Edinburgh (FRSE), 2005 Malcolm-CampbellGedchtnis-Preis und -Medaille der RSC, 2006 Tilden-Dozentur und -Medaille der RSC, 2009 RSC Natural Product Reports Award Synthese und Eigenschaften fluorierter Verbindungen mit dem Schwerpunkt auf dem Verstndnis und der Vorhersage der Wirkung, die der Einbau von Fluor in organische Molekle hat; die Erforschung und Biosynthese seltener fluorierter Naturstoffe und die Isolierung und Charakterisierung eines bakteriellen Enzyms (Fluorinase), das die C-F-Bindungsbildung katalysiert; die Verwendung des 18F-Isotops zur PET-Bildgebung Golfspielen, Klettern in den Munro-Bergen (Name fr alle schottischen Berge, die hher als 3000 Fu sind) und das Lesen von Biographien

Preise:

Forschung: D. OHagan

Der auf dieser Seite vorgestellte Autor verffentlichte krzlich seinen 10. Beitrag seit 2000 in der Angewandten Chemie: Halomethane biosynthesis: Structure of a SAMdependent halide methyltransferase from Arabidopsis thaliana: J. W. Schmidberger, A. B. James, R. Edwards, J. H. Naismith, D. OHagan, Angew. Chem. 2010, 49, 3728 3730; Angew. Chem. Int. Ed. 2010, 49, 3646 3648.

Hobbys:

Mit achtzehn wollte ich fr Schottland Fuball spielen.

Die wichtigste wissenschaftliche Errungenschaft der letzten 50 Jahre ist die Entwicklung der
Biologie hin zu einer Wissenschaft der Molekle (Chemie).

Die bahnbrechendste Entdeckung des vergangenen Jahrhunderts war die Aufklrung der DNAStruktur (Doppelhelix; 1953). Bei jedem Aufenthalt in Cambridge versuche ich, den Pub The Eagle zu besuchen, in den Watson und Crick damals mit dem Aufschrei gerannt kamen, dass sie das Geheimnis des Lebens entschlsselt htten.

Die drei Kennzeichen eines erfolgreichen Wissenschaftler sind intellektuelle Vielseitigkeit, begabte Mitarbeiter und das Geschick, die finanzielle Ausstattung aufrechtzuerhalten.

Drei Personen der Wissenschaftsgeschichte, mit denen ich gerne einen geselligen Abend verbringen
wrde, sind Charles Darwin, Sir Robert Robinson (britischer Organiker, der 1947 den Nobelpreis erhielt) und Henri Moissan (franzsischer Wissenschaftler, der elementares Fluor isolierte und dafr 1906 den Nobelpreis bekam).

Und ich wrde sie fragen Hatten Sie eine Vorstellung davon, wie weitreichend Ihre Erkenntnisse
sein wrden? Als Antworten erwarte ich Oh Gott!, Ja und Nein in dieser Reihenfolge.

Was mich am meisten inspiriert, sind erfolgreiche Kollegen und Studenten. Mir macht es Spa zu
beobachten, wie sie ihre Forschung vorantreiben und sich selbst motivieren, welche Leidenschaft sie ausstrahlen und wie sie ticken. Es gibt viele Wege zum Erfolg, und ich versuche stndig, von ihnen zu lernen. Sir Alex Ferguson, den Trainer von Manchester United, zu beobachten ist ebenfalls inspirierend. Meine 5 Top-Paper:
1. Biochemistry: Biosynthesis of an Organofluorine Molecule: D. OHagan, C. Schaffrath, S. L Cobb, J. T. G. Hamilton, C. D Murphy, Nature 2002, 416, 279. 2. Crystal Structure and Mechanism of a Bacterial Fluorinating Enzyme: C. Dong, F. Huang, H. Deng, C. Schaffrath, J. B. Spencer, D. OHagan, J. H. Naismith, Nature 2004, 427, 561 565. 3. Identification of a PLP-Dependent Threonine Transaldolase: A Novel Enzyme Involved in 4-Fluorothreonine Biosynthesis in Streptomyces cattleya: C. D. Murphy, D. OHagan, C. Schaffrath, Angew. Chem. 2001, 113, 4611 4613; Angew. Chem. Int. Ed. 2001, 40, 4479 4481. 4. S-Adenosyl-l -methionine: Hydroxide Adenosyltransferase: A SAM Enzyme: H. Deng, C. H. Botting, J. T. G. Hamilton, R. J. M. Russell, D. OHagan, Angew. Chem. 2008, 120, 5437 5441; Angew. Chem. Int. Ed. 2008, 47, 5357 5361. 5. Synthesis and Structure of Stereoisomeric Multivicinal Hexafluoroalkanes: L. Hunter, P. Kirsch, A. M. Z. Slawin, D. OHagan, Angew. Chem. 2009, 121, 5565 5568; Angew. Chem. Int. Ed. 2009, 48, 5457 5460.

D. OHagan war auch auf dem Titelbild der Angewandten Chemie vertreten: Cell-Free Biosynthesis of Fluoroacetate and 4-Fluorothreonine in Streptomyces cattleya: C. Schaffrath, S. L. Cobb, D. OHagan, Angew. Chem. 2002, 114, 4069 4071; Angew. Chem. Int. Ed. 2002, 41, 3913 3915.

DOI: 10.1002/ange.201002846
 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Angew. Chem. 2010, 122, 5736

5736

Bcher
Fluorinated Heterocyclic Compounds
Die Einfhrung eines oder mehrerer Fluoratome in eine organische Verbindung kann sich stark auf die physikalischen und chemischen Eigenschaften dieser Verbindung auswirken. Die Reaktivitt der fluorierten Verbindung kann beispielsweise deutlich gesteigert oder vermindert sein. Einige organische Fluorverbindungen sind extrem stabil und werden in den Materialwissenschaften verwendet. Durch die Fluorierung von Wirkstoffen knnen ihre metabolische Stabilitt und biologische Aktivitt erhht werden. Fluorsubstituenten knnen den Mechanismus vieler Reaktionen verndern, was zu unerwarteten Ergebnissen fhren kann. Seit den ersten Entwicklungen in den 1960ern ist die Organofluorchemie ein wichtiges Forschungsgebiet; in letzter Zeit sind vor allem Fortschritte bei Synthesen und Anwendungen erzielt worden. Es gibt zahlreiche gute Bcher ber die allgemeine Organofluorchemie, aber das vorliegende Buch ist die erste Monographie, die sich ausschlielich mit fluorierten Heterocyclen beschftigt. Die vielfltigen Eigenschaften und Reaktivitten von Heterocyclen werden durch die Fluorsubstitution noch reizvoller. Insgesamt 17 fhrende Wissenschaftler auf dem Gebiet fluorierter Heterocyclen haben als Autoren mitgewirkt. Im ersten Teil des Buch wird in 10 Kapiteln die Chemie kleiner, mittlerer und groer Heterocyclen abgehandelt. Die Kapitel 1113 bilden den zweiten Teil und sind Anwendungen von fluorierten Heterocyclen in Landwirtschaft, Pharmazie und Materialwissenschaften gewidmet. In den Kapiteln 1 und 2 werden drei- und viergliedrige Heterocyclen wie Oxirane, Aziridine, Oxetane, Thietane und einige ihrer ungesttigten Verwandten behandelt. Vor allem ihre Synthesen aus Fluoralkenen werden beschrieben. In Kapitel 3 stehen Synthesen, Eigenschaften und Reaktionen von fnfgliedrigen N-Heterocyclen wie Pyrrolen und Pyrrolidinen sowie von Polyazacyclen und Nanellierten Ringen im Mittelpunkt. Auf die Chemie von fluorhaltigen O-, S-, Se- und P-Heterocyclen wird in Kapitel 4 eingegangen. Kapitel 5 ist speziell fluorierten Kohlenhydraten gewidmet. Sechsgliedrige fluorierte Heterocyclen mit den wohl am besten untersuchten Pyridinderivaten bilden die wichtigste Klasse der fluorierten Heterocyclen. Drei Kapitel sind diesen Verbindungen vorbehalten. In Kapitel 6 wird die selektive Einfhrung von Fluoratomen in Pyridinderivate beschrieben, wobei unter anderem die Balz-Schiemann-Reaktion und die Arenlithiierung vorgestellt werden. Heterocyclen mit Fluoralkyl-Seitenketten rcken in Kapitel 7 in den Blickpunkt. Methoden und Reagentien fr die Einfhrung von FluoralkylAngew. Chem. 2010, 122, 5737

Angewandte
gruppen und Cyclisierungen mit Fluoralkyl-Bausteinen werden prsentiert. In Kapitel 8 werden Reaktionen von Perfluorpyridinen, einschlielich der SNAr-Reaktionen, die zur Herstellung mehrfach funktionalisierter Pyridine und anderer Azaarene dienen knnen, detailliert beschrieben. Nichtaromatische oder gesttigte Perfluorheterocyclen werden in Kapitel 9 diskutiert. Eine bersicht ber groe fluorierte Ringe wie Azepine, Diazepine, Oxazepine, anellierte Ringsysteme und Makrocyclen enthlt das Kapitel 10. Jeder Beitrag ist klar verfasst. bersichtliche Reaktionsschemata veranschaulichen die unterschiedlichen, interessanten und oft nicht vorhersehbaren Reaktionen fluorierter Verbindungen. Der Leser erhlt zahllose Einblicke in ein faszinierendes Gebiet. Kapitel 11, das erste Kapitel des zweiten Teils, liefert aktuelle Informationen ber Insektizide und Fungizide auf der Basis fluorierter Heterocyclen. ber fluorhaltige Pharmaka wird in Kapitel 12 berichtet. Die Tatsache, dass ca. 10 % aller verkauften Arzneistoffe Fluor enthalten, zeigt, dass dieses Element einen groen Einfluss auf die pharmakologischen Eigenschaften hat. Die Synthesen der wichtigsten fluorhaltigen Arzneistoffe mit antiviraler und antibakterieller Wirkung werden errtert. Auch fluorhaltige Wirkstoffe gegen Krebs, Parasiten und Nervenkrankheiten werden vorgestellt. Ein Bericht ber Anwendungen polymerer und oligomerer Materialien, die hauptschlich aus fluorierten Epoxiden hergestellt werden, schliet das Buch ab. Die letzten drei Beitrge bieten eine ausgezeichnete bersicht ber viele wichtige Anwendungen fluorhaltiger Heterocyclen. Die separate Beschreibung der Anwendungen zeigt, welche Relevanz diesem Bereich in einer Abhandlung ber fluorierte Heterocyclen zukommt. Das Buch hat ein klares Sachwortverzeichnis und eine ausfhrliche Bibliographie; Arbeiten aus den 1960er Jahren werden ebenso angefhrt wie aktuelle Arbeiten aus dem Jahr 2009. Petrovs Buch ist eine ausgezeichnete Informationsquelle ber fluorierte Heterocyclen und hervorragend fr fortgeschrittene Studierende und Diplomanden geeignet, sowie fr alle, die dieses interessante Teilgebiet der Chemie kennenlernen wollen. Es sollte in den Bibliotheken akademischer und industrieller Forschungseinrichtungen verfgbar sein. Ferner kann ich allen Wissenschaftlern, die sich mit der Synthese und den Anwendungen fluorierter organischer Verbindungen in den Lebensund Materialwissenschaften beschftigen, diese Lektre empfehlen. George Weaver Department of Chemistry, Loughborough University (England) DOI: 10.1002/ange.201003132
Fluorinated Heterocyclic Compounds Synthesis, Chemistry and Applications. Herausgegeben von Viacheslav A. Petrov. John Wiley & Sons, Hoboken 2009. 516 S., geb. 105.00 E.ISBN 9780470452110

Chemie

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5737

Nachruf
Victor S.-Y. Lin (19662010)
Victor Shang-Yi Lin, ein aufgehender Stern der anorganischen Nanochemie, ist nach kurzer Krankheit am 4. Mai 2010 im Alter von nur 43 Jahren verstorben. Victor wurde in Taiwan geboren. Er erhielt seinen BSc von der National-ChungHsing-Universitt in Taichung und promovierte 1996 unter Anleitung von M. J. Therien an der University of Pennsylvania ber die Synthese und die photophysikalischen Eigenschaften konjugierter Multiporphyrinsysteme.[1] Als Skaggs-Postdoktorand bei M. R. Ghadiri entwickelte er am Scripps Research Institute in La Jolla porse interferometrische Silicium-basierte Biosensoren.[2] 1999 wechselte Victor zur chemischem Fakultt der Iowa State University (ISU) und wurde 2002 Mitglied des zum Department of Energy gehrenden Ames Laboratory. Ab 2007 war er Direktor des Chemical and Biological Sciences Program am Ames Laboratory und wurde auch zum Leiter des ISU Institute for Physical Research and Technologys Center for Catalysis ernannt. Anfang dieses Jahres wurde ihm die John-D.-Corbett-Professur in Chemie zuerkannt. Wir kannten Victor Lin als kreativen Chemiker, inspirierenden und engagierten Mentor, gromtigen, freundlichen Kollegen und liebevollen Ehemann und Vater. Seine wegweisenden Beitrge ber die Entwicklung und Anwendungen mesoporser SiO2-Nanopartikel (mesoporous silica nanoparticles, MSNs) diesen Ausdruck prgte er fr mesoporse SiO2-Nanopartikel mit definierter und kontrollierbarer Morphologie sind international anerkannt. Er entwickelte nicht nur verlssliche Syntheseverfahren fr MSNs, sondern demonstrierte auch ihr Potenzial fr interessante Anwendungen auf den Gebieten der heterogenen Katalyse,[3] der erneuerbaren Energien,[4] der Biosensoren[5] und der Nanomedizin.[6, 7] Im Bereich der Nanomedizin ersann Victor die Verwendung von MSNs als Nanokapseln, die mit dem Zellmilieu entweder als intelligentes System fr die Wirkstofffreisetzung oder als Nanofabrik wechselwirken knnen. Er verglich dieses Verfahren gerne mit der Reise des U-Boots in dem Science-Fiction-Film Fantastic Voyage aus dem Jahr 1966, das, extrem verkleinert, mit einer Crew von Medizinern in den Krper eines sterbenden Wissenschaftlers injiziert wird. Victor demonstrierte als Erster intrazellulre Anwendungen von MSNSystemen, die als Reaktion auf uere Reize Wirkstoffe oder Gene freisetzen knnen. Auch Anwendungen von MSNs und verwandten Materialien auf dem Gebiet der erneuerbaren Energien gehrten zu Victors Forschungsinteressen. Er konzentrierte sich besonders auf die Erforschung kooperativer Katalyse in MSN-Nanokanlen. Er entwickelte difunktionelle mesoporse Calciumsilicat-Mischoxidkatalysatoren fr die kooperative, effiziente Umwandlung von stark fettsurehaltigem Biomaterial in Biodiesel. Um diese Technik auf den Markt zu bringen, grndete er die Firma Catilin. Ein weiterer Forschungsbereich war die Entwicklung von MSN-Materialien fr die Produktion von Ethanol aus Synthesegas und die Gewinnung von Biolen aus Algen. Victor konnte seine Wissbegierde und Begeisterung hervorragend auf seine Forschungsgruppe und seine Kollegen bertragen. In seinem Arbeitszimmer hing ein Plakat mit dem Ausspruch Albert Einsteins: Imagination is more important than knowledge. Phantasie und Kreativitt waren Victor enorm wichtig, und immer wieder ermutigte er seine jungen Mitarbeiter zu versuchen, ihre Visionen zu realisieren. Ein ehemaliger Student und spterer Kooperationspartner Victors sagte ber ihn: He taught us to draw our dreams, to tie dreams little by little, piece by piece, to reach so far and beyond, and find ways we could never have guessed. Auch auerhalb seines Labors war Victor sehr beliebt. Studenten und Kollegen begegnete er immer mit einem freundlichen Lcheln, sei es in seinem Bro, in den Fluren des chemischen Instituts oder in den Konferenzrumen nationaler und internationaler Veranstaltungen. Victor bildete 12 Postdoktoranden, 29 Doktoranden und 8 Diplomanden aus, zahllose andere profitierten von seinen Ratschlgen. In seiner kurzen wissenschaftlichen Karriere hat Victor viel erreicht, viele berufliche Ehrungen wurden ihm zuteil: Er wurde zum zweiten John-D.Corbett-Professor in Chemie ernannt, er erhielt den ISU College of Liberal Art & SciencesAward (LAS), ihm wurden 20032008 der National Science Foundation CAREER Award, 2004 der LAS Award for Early Achievements in Research, 2005 der Outstanding Technology Development Award des Federal Laboratory Consortiums und 2008 der ISU Award for Mid-Career Achievement in Research verliehen. Zudem war Victor im Beirat der Zeitschrift Advanced Functional Materials. Seine Forschungen schlugen sich in 58 Verffentlichungen, 3 Patenten und 10 patentierten Anwendungen whrend seiner Amtszeit an der ISU nieder. Er wurde zu mehr als 100 Vortrgen eingeladen, und seine Forschungsarbeiten wurden bereits mehr als 2500-mal zitiert. Ich hatte die Ehre, Victor sowohl beruflich als auch privat sehr gut zu kennen. Als Gastprofessoren an der Hokkaido University in Sapporo (Japan) teilten wir uns im Sommer 2008 ein Bro. Es war eine Freude, mit ihm wissenschaftliche Probleme zu diskutieren und mit ihm und seiner Familie beim Sushi-Essen zu plaudern. Noch vor zwei Monaten berichtete er mir whrend eines Essens beim ACS National Meeting in San Francisco begeistert ber
Angew. Chem. 2010, 122, 5738 5739

Victor S.-Y. Lin

5738

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
die bevorstehende Ernennung zum John-D.-Corbett-Professor. Ich konnte die tragische Nachricht von seinem Tod, kaum einen Monat spter, kaum glauben. Die Wissenschaftlergemeinde wird Victor sehr vermissen, und seine Studenten, Kollegen und Freunde werden sich seiner stets als Vorbild von beispielhafter wissenschaftlicher Exzellenz und Loyalitt erinnern. Wenbin Lin University of North Carolina at Chapel Hill (USA)
[2] V. S.-Y. Lin, K. Motesharei, K.-P. S. Dancil, M. J. Sailor, M. R. Ghadiri, Science 1997, 278, 840. [3] S. Huh, H.-T. Chen, J. W. Wiench, M. Pruski, V. S.-Y. Lin, Angew. Chem. 2005, 117, 1860; Angew. Chem. Int. Ed. 2005, 44, 1826. [4] T.-M. Hsin, S. Chen, E. Guo, C.-H. Tsai, M. Pruski, V. S.-Y. Lin, Top. Catal. 2010, 53, 746. [5] V. S.-Y. Lin, C.-Y. Lai, J. Huang, S.-A. Song, S. Xu, J. Am. Chem. Soc. 2001, 123, 11510. [6] T. Francois, B. G. Trewyn, V. S.-Y. Lin, K. Wang, Nat. Nanotechnol. 2007, 2, 295. [7] Y. Zhao, B. G. Trewyn, I. I. Slowing, V. S.-Y. Lin, J. Am. Chem. Soc. 2009, 131, 8398. DOI: 10.1002/ange.201003378

Chemie

[1] V. S.-Y. Lin, S. G. DiMagno, M. J. Therien, Science 1994, 264, 1105.

Angew. Chem. 2010, 122, 5738 5739

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5739

Highlights
Ionische Flssigkeiten
DOI: 10.1002/ange.201002393

Geknickte und verdrehte ionische Flssigkeiten: neue Wege zu flssigen Salzen**


Ralf Giernoth*
Elektronische Effekte Fettsuren Ionische Flssigkeiten Lsungsmittel Sterische Effekte Dr. John M. Brown gewidmet

In den vergangenen fnfzehn Jahren haben sich ionische


Flssigkeiten (ionic liquids, ILs) von Laborkuriositten hin zu Alltagschemikalien entwickelt.[1] Dabei haben sie nicht nur Eingang in den Lsungsmittelmarkt fr die organische Synthese, sondern auch in viele weitere Anwendungsbereiche gefunden im Besonderen als funktionalisierte (task-specific) ILs.[2] Unter den vielen, oft gepriesenen Vorteilen ionischer Flssigkeiten liegt der wichtigste in der groen Zahl verfgbarer ILs. Wenn man sich fr die Verwendung einer ionischen Flssigkeit fr eine beliebige Anwendung entscheidet, besteht die schwierigste Aufgabe darin, die richtige IL zu finden. Diese Tatsache wurde von vielen Autoren flschlicherweise als abstimmbare Eigenschaften (tunable properties) bezeichnet, obgleich ganz offensichtlich nicht die Eigenschaften einer bestimmten IL verndert werden knnen statt dessen whlt man einfach eine andere (mit anderen Eigenschaften). Heutzutage wird der IL-Markt immer noch stark vom Imidazoliumkation dominiert. Anscheinend hat Imidazolium die Rolle des Universalmotivs zur Entwicklung von bei Raumtemperatur flssigen Salzen (RTILs) bernommen. Aber es gibt hier auch ernsthafte Einschrnkungen, wenn man versucht, ein flssiges Imidazoliumsalz zu kreieren: Speziell fr RTILs sind wir auf Alkylketten moderater Lnge (je nach Anion ca. C2C12 ; siehe Tabelle 1) beschrnkt.[1, 3] Dieses Problem verstrkt sich noch, wenn funktionelle Gruppen im Kation bentigt werden. Einige wenige Gruppen haben sich bereits auf die Vorhersage von Schmelzpunkten von ILs mithilfe theoretischer Methoden konzentriert.[4] Die Schlsselfrage lautet also: Wie knnen wir neue ILs mit niedrigeren Schmelzpunkten konstruieren? In jngster Zeit haben die Gruppe um Strassner[5] sowie die Gruppen um Davis und West[6] unabhngig voneinander sehr hilfreiche Lsungen fr dieses Problem vorgestellt.

Tabelle 1: Schmelzpunkte oder Glasbergangstemperaturen von 1-Alkyl3-methylimidazoliumtetrafluoroborat-ILs [Cnmim]BF4.[3] n[a] 1 2 4 6 Schmp. [8C] 103.5 5.8[b] 71.0[b] 82.4[b] n[a] 8 10 12 Schmp. [8C] 78.5 4.2 26.4
[b]

n[a] 14 16 18

Schmp. [8C] 42.4 49.6 66.8

[a] Lnge n der Alkylkette in [Cnmim]BF4 ; [Cnmim] = 1-Alkyl-3-methylimidazolium. [b] Glasbergang.

[*] Priv.-Doz. Dr. R. Giernoth Department fr Chemie, Universitt zu Kln Greinstrae 4, 50939 Kln (Deutschland) Fax: (+ 49) 221-470-5102 E-Mail: ralf.giernoth@uni-koeln.de Homepage: http://www.ralfgiernoth.de [**] R.G. dankt der Deutschen Forschungsgemeinschaft fr finanzielle Untersttzung ber das Emmy Noether-Programm sowie die Schwerpunktprogramme 1166 und 1191.

Strassners Idee beruht auf Beobachtungen bei ionischen Flssigkristallen, deren Eigenschaften sich als einfach abstimmbar erwiesen, indem mit unterschiedlich substituierten Arylsubstituenten gearbeitet wurde.[7] Wir alle haben in unserer Studentenzeit diese Abstimmbarkeit als nichts anderes als (+ /)-I- und (+ /)-M-Effekte kennen gelernt, besonders bei aromatischen Substitutionsreaktionen oder in linearen Freie-Enthalpie-Beziehungen. Die logische Konsequenz ist also, eine Alkylkette im Imidazoliumkation durch Schema 1. Allgemeieine Arylgruppe zu ersetzen. Strassner ne Struktur der TAet al. haben diese neue Klasse von ioni- AILs von Strassner [5] schen Flssigkeiten TAAILs (tunable et al. arylalkyl ionic liquids) genannt (Schema 1). In der Tat kann die Kombination aus induktiven, mesomeren und sterischen Effekten und vermutlich auch p-pWechselwirkungen effektiv die Kristallisation verhindern und zum Vorliegen einer Schmelze bei Raumtemperatur fhren. Die Synthese ist genau so einfach und unkompliziert wie die Synthese von Standard-Imidazolium-ILs. Strassner und Mitarbeiter heben hervor, dass die Schmelzpunkte stark vom (para-)Arylsubstituenten abhngen: Elektronenschiebende Gruppen fhren durchweg zu einem niedrigeren Schmelzpunkt als elektronenziehende. Zudem ist interessant, dass Dichtefunktionalrechnungen um die 70 % der Ladung als am Imidazoliumring lokalisiert anzeigen. In reinen Alkylimidazoliumsalzen ist der Groteil der Ladung auf den Alkylgruppen lokalisiert. Davis und West haben einen anderen Ansatz zur Konstruktion niedrig schmelzender Imidazolium-ILs verfolgt. Ihre Idee beruht auf einem Modell, das sich homoviskose Adaption (HVA) nennt[8] und die nderung der Viskositt
Angew. Chem. 2010, 122, 5740 5741

5740

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
von Membranlipiden in lebenden Organismen beschreibt. Beim Studium der Schmelzpunkte natrlicher Fettsuren stellten die Autoren fest, dass niedrig schmelzende Fette (le) hufig eine cis-konfigurierte Doppelbindung in der Alkylkette enthalten. Dieser Knick, wie sie ihn nennen, fhrt zu einer verminderten Packungseffizienz und damit zu einer hheren Fluiditt hchstwahrscheinlich einfach ein Entropie-dominierter Effekt. Auf Basis dieser berlegungen haben die Forscher eine Serie von Methylimidazoliumbis(trifluormethylsulfonyl)imid-Salzen mit einer langen Fettsure-Seitenkette (C16C20) synthetisiert (Schema 2). Und wirklich: Der Trend in den stimmt insbesondere fr gezielt angefertigte task-specific ILs, die ber ihre Lsungsmittelfunktion fr eine spezielle chemische Transformation hinaus zustzliche Aufgaben bernehmen. Der wahre Vorteil beim Einsatz von ILs liegt in der Tatsache, dass so viele verschiedene ILs verfgbar sind. Angesichts der hier vorgestellten Entwicklungen ist offensichtlich, dass wir auf diesem Gebiet in der nahen Zukunft noch viel zu erwarten haben.
Eingegangen am 22. April 2010 Online verffentlicht am 2. Juli 2010

Chemie

Schema 2. Beispiel fr eine bei Raumtemperatur als ionische Flssigkeit vorliegende Substanz mit einer langen Alkylkette.[6] Tf2N = Bis(trifluormethylsulfonyl)imid.

Schmelzpunkten hnelt stark demjenigen, der fr Fettsuren beobachtet wird. Man findet einen starken Effekt bei cisDoppelbindungen an C10, C16 und C18 ; fr C11 und C12 ist der Effekt schwcher. Dem Trend der Schmelzpunkte folgend sinken auch die Viskositten. Obgleich ionische Flssigkeiten heute nicht mehr neuartige Lsungsmittel genannt werden knnen, scheint ihre Entwicklung immer noch nicht zum Stehen zu kommen. Dies

[1] P. Wasserscheid, T. Welton, Ionic Liquids in Synthesis, WileyVCH, Weinheim, 2008. [2] a) J. H. Davis, Jr., Chem. Lett. 2004, 33, 1072 1077; b) R. Giernoth, Angew. Chem. 2010, 122, 2896 2901; Angew. Chem. Int. Ed. 2010, 49, 2834 2839. [3] J. Holbrey, K. Seddon, J. Chem. Soc. Dalton Trans. 1999, 2133 2139. [4] a) I. Krossing, J. M. Slattery, Z. Phys. Chem. 2006, 220, 1343 1359; b) I. Krossing, J. M. Slattery, C. Daguenet, P. J. Dyson, A. Oleinikova, H. Weingrtner, J. Am. Chem. Soc. 2006, 128, 13427 13434; c) J. M. Slattery, C. Daguenet, P. J. Dyson, T. J. S. Schubert, I. Krossing, Angew. Chem. 2007, 119, 5480 5484; Angew. Chem. Int. Ed. 2007, 46, 5384 5388. [5] S. Ahrens, A. Peritz, T. Strassner, Angew. Chem. 2009, 121, 8048 8051; Angew. Chem. Int. Ed. 2009, 48, 7908 7910. [6] S. M. Murray, R. A. OBrien, K. M. Mattson, C. Ceccarelli, R. E. Sykora, K. N. West, J. H. Davis, Angew. Chem. 2010, 122, 2815 2818; Angew. Chem. Int. Ed. 2010, 49, 2755 2758. [7] P. H. J. Kouwer, T. M. Swager, J. Am. Chem. Soc. 2007, 129, 14042 14052. [8] M. Sinensky, Proc. Natl. Acad. Sci. USA 1974, 71, 522 525.

Angew. Chem. 2010, 122, 5740 5741

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5741

Highlights
Nanomaterialien
DOI: 10.1002/ange.201000488

Strukturelle Stabilitt von Hochdruckpolymorphen in In2O3-Nanokristallen: Beweis fr eine spannungsinduzierte Umwandlung?**


Aleksander Gurlo*
Hochdruckchemie Indiumoxid Kolloide Nanomaterialien Phasenumwandlungen

anoskalige Phasenumwandlungen haben hauptschlich wegen der Grenabhngigkeit von Materialeigenschaften und wegen ihres Einflusses auf die Funktionalitt von nanoskaligen Bauteilen besondere Aufmerksamkeit auf sich gezogen.[1] Einige Materialfunktionalitten wie Superplastizitt oder Ferromagnetismus ndern sich als Funktion der Kristallgre, in bestimmten Fllen werden sie sogar komplett unterdrckt, wenn die Kristallgre kleiner ist als ein kritischer Wert. In manchen Fllen fhrt die Verminderung der Kristallgre auerdem zu Kristallstrukturen und -morphologien, die sich von denen makroskopischer Kristalle unterscheiden.[2] Bekannte Beispiele dafr sind die Stabilisierung von kubischem BaTiO3,[2b] Anatas (TiO2),[2c] tetragonalem ZrO2[2g] und g-Al2O3[2d] in Nanomaterialien. Die unterschiedlichen Kristallstrukturen haben auch unterschiedliche Materialeigenschaften zur Folge; so ist tetragonales makroskopisches BaTiO3 piezoelektrisch, kubisches nanokristallines BaTiO3 dagegen nicht. Wie theoretisch[2c,e] vorhergesagt und durch Mikrokalorimetrie[2a,f] besttigt, knnen Phasenumwandlungen unterhalb einer kritischen Partikelgre unterdrckt sein, sofern die Oberflchenenergie grer als die Volumenenergie ist. Dementsprechend knnte die Stabilitt von Volumenpolymorphen in Nanosystemen umgekehrt werden, und ein niederenergetisches Polymorph, das in der Volumenphase metastabil ist, wird stabil, wenn die Partikelgre abnimmt. Oberflchenspannungen spielen auf der Nanoskala ebenfalls eine bedeutende Rolle. Mit abnehmender Partikelgre erzeugen sie eine effektive Spannung, die einer extern an das Material angelegten Druckspannung gleicht. In Nanopartikeln, die klein genug sind, um Oberflchenspannungen zu erzeugen, die ber dem fr die Phasenumwandlung ntigen
[*] Dr. A. Gurlo Fachbereich Material- und Geowissenschaften Technische Universitt Darmstadt Petersenstrae 23, 64287 Darmstadt (Deutschland) Fax: (+ 49) 6151-166-346 E-Mail: gurlo@materials.tu-darmstadt.de Homepage: http://www.mawi.tu-darmstadt.de [**] Diese Arbeit wurde durch die DFG (Deutsche Forschungsgemeinschaft) im Rahmen des Schwerpunktprogrammes 1236 Oxide, Carbide und Nitride bei extrem hohen Drcken und Temperaturen (SPP 1236) untersttzt.

Druck liegen, konnte ein Hochdruckpolymorph stabilisiert werden (Abbildung 1). Allerdings ist eine systematische Aussage darber, ob Hochdruckpolymorphe in oxidischen

Abbildung 1. Strukturen der beiden In2O3-Polymorphe (In: kleine graue, O: groe rote Kreise) rh-In2O3 (links) und c-In2O3 (rechts) sowie schematische Darstellung der Potentialenergiediagramme fr kleine und fr groe Partikel. Das Hochdruckpolymorph rh-In2O3, das in der Volumenphase nur metastabil ist, wird bei kleinerer Partikelgre stabil (siehe Abbildung 3).

Nanopartikeln unter Umgebungsdruckbedingungen stabilisiert werden knnen, wegen des Mangels an experimentellen Sonden nicht mglich. Weder Al2O3 noch TiO2, ZrO2 oder BaTiO3 kristallisieren als Nanopartikel in Hochdruckstrukturen.[3] Die aktuelle Arbeit von Farvid et al. zur phasenkontrollierten Synthese von kolloidalen Indiumoxid(In2O3)-Nanokristallen knnte ein aufschlussreiches Beispiel fr eine solche spannungsinduzierte Stabilisierung von metastabilen Hochdruckpolymorphen in oxidischen Nanopartikeln sein, die unter Umgebungsdruck synthetisiert wurden (Abbildung 2).[4] In2O3 ist ein transparenter n-Typ-Halbleiter mit diversen Anwendungen:[5] 1) Sn-dotiertes In2O3 bekannt als ITO (Indium-Zinn-Oxid) ist das technologische Schlsselmaterial fr die Nutzung der Solarenergie;[5a] 2) Cr3+-, Mn3+- oder Fe3+-dotierte In2O3-Materialien sind bei Raumtemperatur Ferromagnete;[5b] 3) In2O3-basierte Gassensoren zeigen schon bei niedrigen Temperaturen hohe Empfindlichkeiten gegenAngew. Chem. 2010, 122, 5742 5744

5742

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
*

Chemie

Bei einem Anstieg der Nanokristallgre auf ungefhr 5 nm ndert sich die In2O3-Struktur von rhomboedrisch zu kubisch. Dotier-Ionen wie Mn3+ (Mn:In = 0.05) unterdrcken das Kristallwachstum und stabilisieren so die metastabile rhIn2O3-Phase.

Abbildung 2. Links: XRD-Diffraktogramme, rechts: hochaufgelste TEM- (oben) und zugehrige Fourier-transformierte Bilder (unten) von 3.5 nm groen rh-In2O3- (a) und 9.5 nm groen c-In2O3-Kristallen (b) (aus Lit. [4a]).

ber giftigen und explosiven Gasen, was sie als Gasdetektoren in flexiblen elektronischen Bauteilen geeignet macht.[5c,d] Wegen der Relevanz von grenabhngigen Phnomenen in der Entwicklung von Materialien mit erweiterten funktionellen Eigenschaften ist die Synthese von wohldefiniertem nanokristallinem reinem und dotiertem In2O3 von beachtlichem Interesse sowohl fr die Grundlagenforschung als auch fr technische Anwendungen. Die Einfhrung einer Hochtemperatursynthese unter Verwendung von hochsiedenden Lsungsmitteln bei Temperaturen der Lsung oberhalb von 250 8C war ein wichtiger Schritt hin zur Fertigung von monodispersen In2O3-Nanokristallen. Wie in den klassischen Untersuchungen von LaMer und Dinegar demonstriert, bentigt die Synthese von monodispersen Kolloiden mittels homogener Keimbildung eine zeitliche Trennung der Keimbildung und der Wachstumsstadien.[6] Experimentell kann die Trennung von Keimbildung und Wachstum durch eine schnelle Injektion der Reagentien in das heie Lsungsmittel erreicht werden, wodurch die Konzentration der Vorstufe im Reaktionskolben ber den fr die Keimbildung ntigen Grenzwert erhht wird (Heiinjektionstechnik; fr Details siehe beispielsweise Lit. [7]). Alternativ kann die fr die homogene Keimbildung bentigte bersttigung durch die Insitu-Bildung der reaktiven Spezies durch Bereitstellen von Wrmeenergie erreicht werden (Aufheizmethode). Beide Methoden wurden fr die Synthese von ITO,[8] In2O3[4, 9] und TMI-In2O3[4b] sowie fr die Bildung von In2O3Superkristallen[9a] verwendet, wobei heie Lsungen von Indiumcarboxylaten oder Indiumacetylacetonat[10] zusammen mit freien Carbonsuren und primren Aminen eingesetzt wurden. Eine Kombination von nucleophilem Angriff eines elektronenarmen Carbonyl-Kohlenstoffatoms und Kondensations-Hydrolyse-Kaskadenreaktionen lieferte hoch kristalline und monodisperse oxidische Nanopartikel, allerdings scheint deren Kristallstruktur von der Reaktionszeit und den verwendeten Dotierelemente abhngig zu sein. Das Studium des zeitlichen Verlaufs des Wachstums der kolloidalen In2O3Kristalle ermglichte es Farvid et al., diese Diskrepanz zu klren (Abbildung 1). Ihre berraschenden Erkenntnisse sind:[4] * Die Kristallisation des metastabilen Hochdruckpolymorphs rh-In2O3 luft zu Beginn der kolloidalen Synthese von c-In2O3 in In2O3-Partikeln < 5 nm ab.
Angew. Chem. 2010, 122, 5742 5744

Abbildung 3. Enthalpie-Druck-Diagramm fr die bisher synthetisierten Indiumoxid-Polymorphe mit kubischem c-In2O3 (Bixbyit) als Referenzstruktur.[12] c-In2O3 (C-Typ-Struktur der Seltenerdoxide, Raumgruppe Ia" 3, Nr. 206, Z = 16) ist unter Umgebungsdruck thermodynamisch stabil. Der Korundtyp rh-In2O3 (Raumgruppe R" 3c, Nr. 167, a = 5.491 , c = 14.526 , Z = 6) ist ein metastabiles Hochdruckpolymorph. Orthorhombisches o-In2O3 (Rh2O3-II-Strukturtyp, Raumgruppe Pbna, Nr. 60, Z = 4) wurde unter Hochdruck- und Hochtemperaturbedingungen in lasergeheizten Diamantstempelzellen hergestellt.[11, 14]

Wodurch wird die Kristallisation der Hochdruckphase rhIn2O3 in Nanopartikeln < 5 nm bewirkt? In beiden In2O3Polymorphen finden sich Indium-Sauerstoff-Polyeder desselben Typs (Oktaeder) und mit hnlicher Gre; Sauerstoff ist in allen Strukturen annhernd tetraedrisch koordiniert.[11] Diese hnlichkeit der Strukturen spiegelt sich sowohl in nur kleinen Unterschieden in der Dichte als auch in nur kleinen Energieunterschieden wider: rh-In2O3 ist ungefhr um 2.5 % dichter als c-In2O3, und die Enthalpiedifferenz betrgt bei Umgebungsdruck ungefhr 15 kJ mol1 (Abbildung 3).[12] Bei einem Druck zwischen 3.8 und 13.5 GPa (abhngig von der DFT-Methode, die fr die Berechnung verwendet wurde[12, 13]) werden die Enthalpien beider Phasen gleich, was auf eine Phasenumwandlung von c-In2O3 in das dichtere rh-In2O3 hindeutet. Die Abnahme des Volumens eines Partikels ist quivalent zum angelegten berschussdruck, der Gitterverzerrungen erzeugt, was sich in leicht erhhten 2q-Werten im Rntgendiffraktogramm widerspiegelt, wie von Farvid et al. beobachtet wurde.[4] Die Gitterverzerrung, die zunimmt, wenn die Nanokristalle kleiner werden, begnstigt rh-In2O3 mit seiner hheren Dichte und seinem kleineren Abstand zwischen den Atomen. Entsprechend wird rh-In2O3, das in der Volumenphase metastabil ist, bei der Kristallisation in Partikeln, die kleiner als 5 nm sind, energetisch begnstigt. Die hier referierten Ergebnisse zu kolloidalen Synthesen von In2O3-basierten Nanokristallen sind von enormer methodischer, grundlegender und technischer Bedeutung. So sollte das Verstndnis der Wachstumsmechanismen und der Strukturumwandlungen eine rationale und gezielte Synthese von kolloidalen In2O3-Partikeln ermglichen, bei der die www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5743

Highlights
Partikelgren- und -strukturen einfach durch Anpassen von Temperatur, Vorstufen, Lsungsmittel, koordinierenden Liganden und Reaktionszeit eingestellt werden knnen. Die bisher entwickelte Synthesemethodik erlaubt die Herstellung von hochkristallinen, desagglomerierten und monodispersen oxidischen Partikeln. Solche Partikel sind wegen ihrer leichten Verarbeitbarkeit zu dnnen Filmen mit hoher Flexibilitt bezglich der Substratstruktur und -geometrie von groem Interesse fr viele Anwendungen, z. B. fr das Tintenstrahldrucken von flexiblen elektronischen Bauteilen. Die Synthese von kolloidalem Indiumoxid in Lsungsmitteln mit hohem Siedepunkt durch Aufheizen oder Heiinjektion dagegen befindet sich, verglichen mit den etablierten Synthesen von II-VI-Quantenpunkten (CdSe, CdS, CdTe etc),[7] immer noch in ihrem Anfangsstadium. Nichtsdestoweniger kann fr beide Materialklassen eine Entwicklung hin zu einer Vereinfachung der Syntheseablufe mit dem Ziel einer besseren Reproduzierbarkeit und der bertragung der Reaktion vom Labormastab auf Groanlagen beobachtet werden. Die Eintopfsynthese von II-VI-Quantenpunkten im Subkilogrammbereich wurde bereits demonstriert,[15] die von In2O3basierten Nanokristallen steht vor der Realisation. Darber hinaus ist die In2O3-Fallstudie wohl auch ein anschauliches Beispiel dafr, wie man mehr ber die energetischen Pfade von Phasenumwandlungen auf der Nanoskala erfahren kann.
Eingegangen am 27. Januar 2010, vernderte Fassung am 15. April 2010 Online verffentlicht am 2. Juli 2010 [3] Die Hochdruckpolymorphe von CdS and CdSe mit Steinsalzstruktur wurden in Nanopartikeln < 2 nm fr CdS und < 11 nm fr CdSe gefunden (siehe G. Hodes, Adv. Mater. 2007, 19, 639 655, zit. Lit.). [4] a) S. S. Farvid, N. Dave, P. V. Radovanovic, Chem. Mater. 2010, 22, 9 11; b) S. S. Farvid, N. Dave, T. Wang, P. V. Radovanovic, J. Phys. Chem. C 2009, 113, 15928 15933. [5] a) C. G. Granqvist, Sol. Energy Mater. Sol. Cells 2007, 91, 1529 1598; b) J. Philip, A. Punnoose, B. I. Kim, K. M. Reddy, S. Layne, J. O. Holmes, B. Satpati, P. R. Leclair, T. S. Santos, J. S. Moodera, Nat. Mater. 2006, 5, 298 304; c) M. Graf, A. Gurlo, N. Barsan, U. Weimar, A. Hierlemann, J. Nanopart. Res. 2006, 8, 823 839; d) T. Sahm, A. Gurlo, N. Barsan, U. Weimar, Part. Sci. Technol. 2006, 24, 441 452. [6] Die Arbeiten sind in J. P. Jolivet, M. Henry, J. Livage, Metal Oxide Chemistry and Synthesis: from Solutions to Solid State, Wiley-VCH, Weinheim, 2000 referiert. [7] Semiconductor Nanocrystal Quantum Dots. Synthesis, Assembly, Spectroscopy and Applications (Hrsg.: A. Rogach), Springer, Wien, 2008. [8] a) R. A. Gilstrap, Jr., C. J. Summers, Thin Solid Films 2009, 518, 1136 1139; b) R. A. Gilstrap, Jr., C. J. Capozzi, C. G. Carson, R. A. Gerhardt, C. J. Summers, Adv. Mater. 2008, 20, 4163 4166; c) C. J. Capozzi, I. N. Ivanov, S. Joshi, R. A. Gerhardt, Nanotechnology 2009, 20, 145701; d) S. I. Choi, K. M. Nam, B. K. Park, W. S. Seo, J. T. Park, Chem. Mater. 2008, 20, 2609 2611. [9] a) W. G. Lu, Q. S. Liu, Z. Y. Sun, J. B. He, C. D. Ezeolu, J. Y. Fang, J. Am. Chem. Soc. 2008, 130, 6983 6991; b) Q. S. Liu, W. G. Lu, A. H. Ma, J. K. Tang, J. Lin, J. Y. Fang, J. Am. Chem. Soc. 2005, 127, 5276 5277. [10] Bei der Herstellung von dotiertem In2O3 (z. B. ITO) wurden Metallcarboxylate oder -acetylacetonate in der Synthese eingesetzt. [11] A. Gurlo, D. Dzivenko, P. Kroll, R. Riedel, Phys. Status Solidi RRL 2008, 2, 269 271. [12] A. Gurlo, P. Kroll, R. Riedel, Chem. Eur. J. 2008, 14, 3306 3310. [13] a) S. Z. Karazhanov, P. Ravindran, P. Vajeeston, A. Ulyashin, T. G. Finstad, H. Fjellvag, Phys. Rev. B 2007, 76, 075129; b) A. Walsh, C. R. A. Catlow, A. A. Sokol, S. M. Woodley, Chem. Mater. 2009, 21, 4962 4969. [14] H. Yusa, T. Tsuchiya, N. Sata, Y. Ohishi, Phys. Rev. B 2008, 77, 064107. [15] a) S. Bhattacharyya, Y. Estrin, O. Moshe, D. H. Rich, L. A. Solovyov, A. Gedanken, ACS Nano 2009, 3, 1864 1876; b) J. Il Kim, J. K. Lee, Adv. Funct. Mater. 2006, 16, 2077 2082.

[1] a) D. Vollath, Nanomaterials. An Introduction to Synthesis, Properties and Applications, Wiley-VCH, Weinheim, 2008 ; b) A. Saxena, G. Aeppli, MRS Bull. 2009, 34, 804 813. [2] a) J. M. McHale, A. Auroux, A. J. Perrotta, A. Navrotsky, Science 1997, 277, 788 791; b) S. Schlag, H. F. Eicke, Solid State Commun. 1994, 91, 883 887; c) H. Z. Zhang, J. F. Banfield, J. Mater. Chem. 1998, 8, 2073 2076; d) I. Levin, D. Brandon, J. Am. Ceram. Soc. 1998, 81, 1995 2012; e) A. S. Barnard, P. Zapol, J. Phys. Chem. B 2004, 108, 18435 18440; f) A. Navrotsky, Proc. Natl. Acad. Sci. USA 2004, 101, 12096 12101; g) D. Vollath, F. D. Fischer, M. Hagelstein, D. V. Szabo, J. Nanopart. Res. 2006, 8, 1003 1016.

5744

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5742 5744

Kurzaufstze
Naturstoffsynthese

H. J. Martin, J. Mulzer und T. Magauer

DOI: 10.1002/ange.201000227

Einem kompetitiven Zielmolekl auf den Fersen: Totalsynthese des Antibiotikums Kendomycin
Harry J. Martin,* Thomas Magauer und Johann Mulzer*
Ansaverbindungen Antibiotika Makrocyclen Oxidationen Totalsynthesen Professor Rolf Huisgen zum 90. Geburtstag gewidmet

Kendomycin ist ein neuartiges Polyketid mit einer einzigartigen


Chinomethid-Ansastruktur und einem beeindruckenden biologischen Profil. In diesem Kurzaufsatz geben wir eine chronologische bersicht ber die Arbeiten zur Synthese des Zielmolekls. ber ca. acht Jahre hinweg berichteten weltweit bisher acht Gruppen ber Syntheseversuche, die in fnf Totalsynthesen und etlichen Fragmentsynthesen resultierten. Die Strategie war dabei meist in groben Zgen der Biogenese nachempfunden: Gestartet wurde mit einem aromatischen Polyphenol, an dem die Polyketid-Seitenkette angebracht wurde. Weitere Schlsselschritte umfassten eine Makrocyclisierung und den Aufbau des hochsubstituierten Tetrahydropyranrings, gefolgt von Oxidation und Lactolbildung.

1. Einleitung
Kendomycin (1), auch bekannt als ()-TAN 2162, ist aus verschiedenen Streptomyces-Stmmen isoliert worden und zeigt eine auergewhnlich facettenreiche Bioaktivitt. Die Verbindung wurde zuerst als Endothelinrezeptor-Antagonist[1] und kurze Zeit spter als antiosteoporotischer Wirkstoff[2] patentiert. Im Zuge der Reisolierung aus Streptomyces violaceoruber[3] zeigte sich, dass 1 starke antibiotische Aktivitt gegen eine Vielzahl von Bakterien aufweist und auch gegen Methicillin-resistente Staphylococcus-aureus-Stmme (MRSA-Stmme) aktiv ist. Zustzlich wirkt Kendomycin stark cytotoxisch gegen verschiedene menschliche Tumorzelllinien,[3] vermutlich durch Proteasom-[4] oder Bcl-xl-Inhibierung.[5] 1 verfgt ber eine aliphatische Ansakette, die ber einen hoch substituierten Tetrahydropyranring an einen Chinonmethid-Chromophor geknpft ist. Die relative und die absolute Konfiguration von insgesamt neun stereogenen Zentren wurden durch Einkristalldiffraktometrie und Mosher-Esteranalyse aufgeklrt.[3] Das groe Interesse an dieser Verbindung in den Bereichen der Synthesechemie und medizinischen Chemie wird durch ca. 50 Eintrge im CAS Sci-

finder Scholar belegt. So haben sich acht Forschungsgruppen um die Synthese bemht und ber einen Zeitraum von ca. acht Jahren fnf Totalsynthesen entwickelt.[6] Die Biosynthese von Kendomycin (Schema 1) wurde zuerst von Zeeck und Bode[3, 7] erforscht und spter durch Genexpressionsexperimente von Mller et al.[8] weiter ausgearbeitet. Es wird angenommen, dass zunchst das Aren 2 ber eine Typ-III-

[*] Dr. H. J. Martin, Dr. T. Magauer, Prof. Dr. J. Mulzer Universitt Wien, Institut fr Organische Chemie Whringer Strae 38, 1090 Wien (sterreich) E-Mail: harry.martin@univie.ac.at johann.mulzer@univie.ac.at Homepage: http://mulzer.univie.ac.at/

Schema 1. Biosynthese von Kendomycin (1). M-CoA = Malonyl-Coenzym A.


Angew. Chem. 2010, 122, 5746 5758

5746

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte
Harry Martin war zunchst Chemotechniker und studierte dann in Berlin, Frankfurt und Wien Chemie. 1999 promovierte er bei Johann Mulzer an der Universitt Wien. 2001 war er als Gastwissenschaftler am Scripps Research Institut (La Lolla, CA), wo er mit Benjamin List auf dem Gebiet der Organokatalyse arbeitete. Seit 2006 ist er Assistenzprofessor an der Universitt Wien. Seine Forschungsinteressen liegen in der Anwendung neuer stereoselektiver Reaktionen in der Naturstoffsynthese. Thomas Magauer wurde 1983 in Linz (sterreich) geboren. Er studierte Chemie an der Universitt Wien, wo er 2007 sein Diplom erhielt. 2009 promovierte er bei Johann Mulzer an der Universitt Wien ber die Totalsynthesen von Kendomycin sowie Echinopin A und B. 2010 wechselte er als Erwin-Schrdinger-Postdoktorand zu Andrew Myers an die Harvard University.

Chemie

Polyketidsynthase (Typ-III-PKS) gebildet wird. Oxidation und Kettenabbau fhren dann zur Benzoesure 3 oder deren chinoidem Analogon. Diese unbliche Starteinheit wird anschlieend in einen PKS-I-Komplex geladen und in Ketoester 4 berfhrt. Nachfolgender Pyranringschluss und eine bis dahin unbekannte PKS-Terminierung liefern nach Decarboxylierung den Makrocyclus 5 und schlielich 1 durch Halbketalbildung. Die chemischen Synthesen folgen im Wesentlichen dieser biogenetischen Abfolge, d. h., sie beginnen mit einer aromatischen Vorstufe (hnlich 3), an der die PolyketidAnsafragmente angebracht werden. Der Ringschluss erfolgt innerhalb der Ansakette und liefert zunchst den Makrocyclus, der schlielich in das Zielmolekl berfhrt wird. Die Schlussphase besteht entweder aus der Oxidation des Polyphenols 6 zum p-Chinonmethid 5, gefolgt von einer Lactolbildung, oder aus der Oxidation des Benzofurans 7 zum oBenzochinon 8 mit anschlieender 1,6-Addition von Wasser (Schema 2).

Johann Mulzer promovierte 1974 bei Rolf Huisgen an der Ludwig-Maximilians-Universitt Mnchen, bevor er sich als Postdoktorand der Gruppe von E. J. Corey an der Harvard University anschloss. Zwischen 1982 und 1996 hatte er Professuren an der Universitt Dsseldorf, der Freien Universitt Berlin und der Universitt Frankfurt inne. Seit 1996 ist er Ordinarius fr Organische Chemie an der Universitt Wien. Sein wissenschaftliches Hauptinteresse gilt der Synthese von strukturell und physiologisch interessanten Naturstoffen.

Schema 2. Oxidative Endphasen fr die Synthese von 1.

2. Frhe Studien von Mulzer et al. (20012004)


Die erste Publikation zur Synthese von 1 beschreibt die Verknpfung der linksseitigen Ansakette mit dem aromatischen Rumpf und den anschlieenden Ringschluss zum Tetrahydropyran durch intramolekulare Michael-Addition (Schema 3).[9] Die Synthese begann mit einer substratkontrollierten Aldolreaktion des Aldehyds 9 mit Keton 10. Eine diastereoselektive Reduktion und die nderung des Schutzgruppenmusters ergaben nach Oxidation zunchst Aldehyd 11, der ber eine Horner-Wadsworth-Emmons-Reaktion (HWE-Reaktion) mit dem Ketophosphonat 12 zum Enon 13 reagierte. Das nach Entfernung des Acetonids mithilfe wssriger HCl entstehende Diol cyclisierte ber eine OxaMichael-Addition zum Tetrahydropyran 14, dessen Ketofunktion ber das entsprechende Tosylhydrazon zu 15 reduziert wurde. Zwar gelang es an dieser Stelle nicht, eine geeignete Seitenkette an C20a anzubringen, immerhin aber zeigte die Synthese von 15 und hnlicher Verbindungen eine wichtige,
Angew. Chem. 2010, 122, 5746 5758

Schema 3. Tetrahydropyransynthese ber 1,4-Addition nach Mulzer et al.; R = TBDPS. PMB = p-Methoxybenzyl, TBDPS = tert-Butyldiphenylsilyl, Ts = Toluol-4-sulfonyl.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5747

Kurzaufstze
bis dahin unbekannte Besonderheit dieses Typs von C-Arylglycosiden, nmlich eine stark gehinderte sp2-sp3-Rotation um die C4a-C5-Bindung. Diese Beobachtung war insofern bedeutsam, als dadurch die Reaktivitt an C20a wie auch die Konformation der reaktiven Rotamere bei der spteren Makrocyclisierung steuerbar waren. So wurde beispielsweise demonstriert, dass durch eine Methoxymethyl(MOM)Schutzgruppe an C4-O die gewnschte anti-Orientierung in Bezug auf C5-O induziert werden konnte. Der zweite Ansatz von Mulzer et al.[10] (Schema 4) konzentrierte sich auf eine C13-C14-Verknpfung durch Ringschlussmetathese (RCM) des Diens 16. Die Bildung des Te-

H. J. Martin, J. Mulzer und T. Magauer

Schema 5. Synthese der aliphatischen Seitenkette (C5C13). Bn = Benzyl, OTf = Trifluormethansulfonat.

Schema 4. Zweiter Ansatz von Mulzer et al.; R = MOM.

trahydropyrans sollte durch eine SN1-Cyclisierung ber das Carbenium-Intermediat 17 erfolgen, wobei die Arylgruppe eine pr-quatoriale Position einnehmen wrde. 16 ist durch Addition des Aldehyds 18 an C4a des Benzofurans 19 zugnglich, das sich wiederum leicht aus Bromid 20 und Epoxid 21 synthetisieren lsst. Die Synthese des Aldehyds 18 (Schema 5) startete mit einer Aldoladdition des aus (S)-Citronellen leicht zugnglichen Aldehyds 22.[11] Die Reaktion mit Evans Ketoimid 23[12] fhrte zum syn-Aldolprodukt, das nach selektiver Reduktion[13] das entsprechende Diol lieferte. Die Entfernung des Auxiliars setzte Lacton 24 frei, das in den Acetonid-geschtzen Methylester 25 berfhrt wurde. Eine Sequenz aus Reduktion und Oxidation lieferte schlielich Aldehyd 18. Die Synthese der Benzofuraneinheit (Schema 6) ging vom bekannten Aldehyd 26[14] aus, der in einer HWE-Reaktion mit 27 Oppolzers N-Enoylsultam 28 lieferte.[15] Eine stereoselektive a-Methylierung,[16] gefolgt von einer reduktiven Auxiliarabspaltung, ergab Alkohol 29, der in die Epoxide 21 oder 30 berfhrt wurde. Die ffnung der beiden Epoxide mit der aus Arylbromid 20 hergestellten Grignard-Verbindung lieferte nach einigen weiteren Standardreaktionen die Benzofurane 19 bzw. 31. Diese wurden nach ortho-Lithiie-

Schema 6. Benzofuransynthese; R = TBDPS, Xc = Oppolzers Sultam. DIBAL-H = Diisobutylaluminiumhydrid, HMPA = Hexamethylphosphoramid, mCPBA = m-Chlorperbenzoesure, TBAF = Tetrabutylammoniumfluorid.

rung mit Aldehyd 18 umgesetzt (Schema 7) und fhrten so zu den Benzylalkoholen 32 und 33 jeweils als Diastereomerenmischung. Der Entfernung der Acetonidschutzgruppe folgte direkt die SN1-Cyclisierung zu den Tetrahydropyranen 34 und 35, wobei ausschlielich die Diastereomere mit quatorial orientierten Arylsubstituenten gebildet wurden. Wie sich allerdings bald herausstellte, war die RCM der Diene 32 und 34 nicht durchfhrbar. Deshalb wurde alternativ eine HWEReaktion fr die Makrocyclisierung angestrebt.[17] Zu diesem Zweck wurde 35 in das Ketophosphonat 36 berfhrt, das mit
Angew. Chem. 2010, 122, 5746 5758

5748

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte
selektive Bildung des Tetrahydropyranrings. Zustzlich wurden in einer Modellstudie die geplanten oxidativen letzten Stufen der Totalsynthese untersucht.[18] Einige der so gewonnenen Erkenntnisse wurden spter auch von anderen Gruppen genutzt.

Chemie

3. Die erste Totalsynthese von Lee et al. (2004)


Lee und Mitarbeiter verwendeten bei ihrer enantioselektiven Totalsynthese von Kendomycin eine neuartige, sehr elegante Makro-C-Glycosidierung als Schlsselschritt.[19] Das acyclische Intermediat 40, das bereits die Tetrahydropyranund Benzofuran-Struktureinheiten enthlt, wurde durch eine B-Alkyl-Suzuki-Miyaura-Kupplung aus den Fragmenten 41 und 42 aufgebaut (Schema 9).

Schema 7. Synthese der Cyclisierungsvorstufen 34 und 36. TMEDA = N,N,N,N-Tetramethylethylendiamin.

LiOH die Makrocyclisierung zu 37 einging (Schema 8). Die Entfernung des unerwnschten Carbonylsauerstoffatoms in 37 erwies sich als schwierig, gelang aber nach Luche-Reduktion und berfhrung in das Xanthogenat ber eine BartonMcCombie-Reduktion. Allerdings wurde bei dieser Reaktion, die ber das pseudosymmetrische Allylradikal 38 verluft, nur das unerwnschte Olefin 39 gebildet.

Schema 9. Konvergenter Ansatz von Lee et al.

Die Synthese des rechtsseitigen Fragments 42 (Schema 10) startete mit dem bekannten Iodid 43,[20] das mithilfe einer Myers-Alkylierung des Pseudoephedrinpropionamids 44[21] und einer anschlieenden Amidhydrolse in die Carbonsure 45 berfhrt wurde. Deren Veresterung mit der Phenol-OH-Gruppe des Wittig-Salzes 46 und die anschlieende intramolekulare Wittig-Reaktion[22] lieferten das Benzofuran 48, das in zwei weiteren Stufen in das Alkyliodid 42

Schema 8. HWE-Makrocyclisierung; R = MOM.

Die Gruppe um Mulzer konnte die Totalsynthese zu diesem Zeitpunkt zwar nicht fertig stellen, entwickelte aber bei ihren Versuchen effiziente Methoden fr die Synthese und das Anbringen der Seitenketten sowie fr eine hoch stereoAngew. Chem. 2010, 122, 5746 5758

Schema 10. Synthese der Benzofurandomne; R = TBS. DCC = N,NDicyclohexylcarbodiimid, DMAP = 4-Dimethylaminopyridin, LDA = Lithiumdiisopropylamid, TBS = tert-Butyldimethylsilyl.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5749

Kurzaufstze
berfhrt wurde. Der Aufbau des Tetrahydropyranfragments (Schema 11) begann mit einer Corey-Fuchs-Kettenverlngerung des bekannten Aldehyds 49[23] zum Alkinal 50. Dieses wurde, in Analogie zum Ansatz von Mulzer et al., in drei weiteren Stufen in das Lacton 51 berfhrt. Eine Sequenz aus Hydrostannylierung und Iodierung ergab das E-Vinyliodid 41, das mit 42 zum Kreuzkupplungsprodukt 52 umgesetzt wurde.

H. J. Martin, J. Mulzer und T. Magauer

Schema 11. Synthese der acyclischen Vorstufe 52 ber eine SuzukiMiyaura-Kupplung; R = TBS. 9-BBN = 9-Borabicyclo[3.3.1]nonan, dppf = 1,1-Bis(diphenylphosphanyl)ferrocen. Schema 12. Makrocyclisierung und Oxidation zu Kendomycin (1). IBX = o-Iodoxybenzoesure, TES = Triethylsilyl.

Fr die Makro-C-Glycosidierung wurde Lacton 52 zunchst in das Lactolacetat 40 berfhrt und nachfolgend unter Friedel-Crafts-Bedingungen cyclisiert, wobei SnCl4 als Lewis-Sure fungierte (Schema 12). Die Reaktion verlief offensichtlich ber das O-glycosidische Intermediat 53, das sich anschlieend, induziert durch SnCl4, ber das Zwitterion 54 zum Makro-C-Glycosid 55 umlagerte. Nach der Desacetylierung zu 56 und einer selektiven Silylierung der 7-OHGruppe wurde ber eine IBX-Oxidation das o-Chinon 57 erhalten. Desilylierung mit HF bei gleichzeitiger 1,6-Addition von Wasser lieferte schlielich Kendomycin (1).

4. Beitrge von Arimoto et al. (2004, 2007)


Einen anderen Zugang zum Tetrahydropyransystem beschrieben Arimoto et al.,[24] die eine intramolekulare Michael-Addition an der C5-Position des o-Chinonmethids 58 nutzten (Schema 13). Benzyliodid 59 wurde in 14 Stufen in das Zwischenprodukt 60 berfhrt, wobei eine Evans-Alkylierung, eine Roush-Crotylierung und eine Carbonyladdition als Schlsselschritte zum Einsatz kamen. Die anschlieende Oxidation von 60 lieferte das Chinonmethid 58, das sofort eine intramolekulare 1,4-Addition unter Bildung des Tetrahydropyrans 61 einging. Nach dessen berfhrung in das Bis(allyloxy)-Derivat 62 lieferte eine vierstufige Reaktionsfolge, an der auch eine Claisen-Umlagerung beteiligt war, das vollstndig substituierte Aren 63.

Schema 13. Tetrahydropyransynthese durch 1,4-Addition nach Arimoto et al.; R = TBS. NMO = 4-Methylmorpholin-N-oxid.
Angew. Chem. 2010, 122, 5746 5758

5750

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte

Chemie

In einem spteren Beitrag berichteten Arimoto et al. ber die Anknpfung der rechten Seitenkette an C19 (Schema 14).[25] Bei diesem Ansatz wurde zunchst Vinyliodid 64 ber sieben Stufen aus dem bekannten Aldehyd 65[26] hergestellt. Eine Hiyama-Nozaki-Kishi-Reaktion mit Aldehyd 63 ergab den Alkohol 66, der zum Keton 67 oxidiert wurde. Selektive Entschtzung, Oxidation und Wittig-Methylenierung fhrten zum Dien 68. Die Sequenz endete mit einer RCM-Reaktion, die allerdings ausschlielich das unerwnschte Z-Olefin 69 ergab (vgl. Synthese von Smith et al.; Schema 17).

Schema 15. Retrosynthese nach Smith et al.; R = TBS.

Schema 14. RCM-Ansatz; R = TBS. Grubbs II = Grubbs-Katalysator der 2. Generation, PPTS = Pyridinium-p-toluolsulfonat.

5. Totalsynthese von Smith III et al. (2005)


Die zweite Totalsynthese von 1 gelang Smith und Mitarbeitern.[27] Sie konzentrierten sich dabei auf die RCM-Reaktion des Diens 70, das aus Bromid 71 und Epoxid 72 erhltlich war (Schema 15). Die Tetrahydropyranvorstufe 73 wurde durch eine Acetalisierung von 74 mit 73 ber das Enolacetal 75 und die Oxoniumzwischenstufe 76 in einer Petasis-FerrierUmlagerung aufgebaut. Die Cyclisierung von 76 zu 72 verluft dabei ber einen SN1-hnlichen Mechanismus, sodass ein Pyranring mit zwei quatorial angeordneten Resten entsteht. Die Synthese der Tetrahydropyranregion begann mit der Umsetzung des bekannten Aldehyds 22 mit 77[28] in einer synselektiven Aldolreaktion und einer anschlieenden Hydrolyse zur Sure 73 (Schema 16). Diese wurde unter modifizierten Lewis-Sure-Bedingungen[29] mit dem Aldehyd 74 kondensiert und lieferte das Dioxanon 78 als einziges Diastereomer. Eine Petasis-Tebbe-Olefinierung[30] fhrte zum instabilen Enolacetal 75, das mit AlMe2Cl eine Petasis-Ferrier-Umlagerung[31] zu 72 einging. Eine diastereoselektive Reaktionssequenz bestehend aus einer Methylierung an C6,
Angew. Chem. 2010, 122, 5746 5758

Schema 16. Synthese der RCM-Vorstufe durch Smith et al.; R = TBS. Cp = Cyclopentadienyl, LHMDS = Lithiumhexamethyldisilazanid, TEA = Triethylamin, TMS = Trimethylsilyl.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5751

Kurzaufstze
einer Carbonylreduktion und einer O-Silylierung ergab letztlich das vollstndig substituierte Tetrahydropyran 71. Die rechte Alkenylseitenkette erfolgte analog zur Strategie von Mulzer et al. (siehe Schema 6) ber eine Epoxidffnung. So ergab die berfhrung des Arylbromids 71 in die entsprechende Organolithiumverbindung nach Zugabe des Epoxids 21 das Secodien 70 als 2:1-Mischung der C19-Epimere. Die nachfolgende RCM-Reaktion unter Verwendung des Grubbs-II-Katalysators lieferte das Z-Olefin 79 als reines C19-S-Epimer, was darauf schlieen lie, dass lediglich die Verbindung 19-(S)-70 reagiert hatte (Schema 17). Die uner-

H. J. Martin, J. Mulzer und T. Magauer

6. Beitrge von White und Smits (2005)


Die Synthese eines fortgeschrittenen Intermediats durch White und Smits umfasst eine Iodveretherung fr die Bildung des Pyranrings und eine Dtz-Anellierung fr den Aufbau des substituierten Benzolrings.[33] Die Synthese startete mit der vierstufigen Umsetzung des bekannten Aldehyds 84[34] zum Alkin 85, ber eine Brown-Allylierung[35] und Seyferth-Gilbert-Alkinierung[36] als Schlsselschritte (Schema 18). Die Reaktion von 85 mit dem aus 1-Methoxypropin zugnglichen Alkenylchromcarben 86 ergab das Aren 87, das in drei weiteren Stufen[37] in den Aldehyd 88 berfhrt wurde.

Schema 18. Anwendung der Dtz-Reaktion durch White und Smits. Ipc = Isopinocampheyl, NBS = N-Bromsuccinimid.

Fr die Fertigstellung des Tetrahydropyrangersts (Schema 19) wurde Aldehyd 88 mit Masamunes Propionat (90)[38] in einer anti-selektiven Aldolreaktion und zwei weiteren Stufen zum Alkohol 89 umgesetzt. Oxidation des pri-

Schema 17. Fertigstellung der Synthese; R = TBS. DMPI = Dess-MartinPeriodinan, Ms = Methansulfonyl, py = Pyridin.

wnschte Olefin-Geometrie erforderte eine kontra-thermodynamische Isomerisierung des Z-Isomers zum E-Isomer. Nach etlichen Experimenten entwickelten Smith et al. schlielich eine vierstufige Reaktionsfolge, die mit einer selektiven Dihydroxylierung startete. Anschlieende Mesylierung und Ringschluss lieferten das trans-Epoxid 80, dessen absolute Konfiguration nicht bestimmt wurde. Die Desoxygenierung mit WCl6/nBuLi verlief unter Erhaltung der relativen Konfiguration und fhrte so zum E-Olefin 81.[32] Die oxidative Endphase folgte im Wesentlichen dem von Zeeck et al. postulierten Biosyntheseweg: Selektive Desilylierung zu 82 und nachfolgende Oxidation lieferten das o-Chinon 83, das bei Umsetzung mit HF ber Desilylierung, Demethylierung und Lactolbildung schlielich Kendomycin (1) lieferte.

Schema 19. Tetrahydropyransynthese. Cy = Cyclohexyl, Mes = Mesitylen, SEM = Trimethylsilylethoxymethyl, TPAP = Tetrapropylammoniumperruthenat.
Angew. Chem. 2010, 122, 5746 5758

5752

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte

Chemie

mren Alkohols zum Aldehyd und anschlieende BrownCrotylierung[39] ergaben das entsprechende Alken, das durch Schutzgruppenmanipulation in das Zwischenprodukt 91 berfhrt wurde. ber eine Iodveretherung wurde nachfolgend der Ring zum Tetrahydropyran 92 geschlossen.

7. Beitrge von Williams und Shamim (2005)


Eine besonders effiziente Synthese der Ansakette (C5 C19) durch Williams und Shamim[40] verluft ber zwei entscheidende Auxiliar-gesteuerte 1,4-Cupratadditionen zum Aufbau der Olefindomne (Schema 20). Die Synthese wird

Schema 21. [4+2]-Anellierung nach Panek und Lowe; R = TBS.

Schema 20. Synthese der Ansakette nach Williams und Shamim.

eingeleitet duch die Bildung des Yamamoto-Cuprats aus dem bekannten Bromid 94.[41] Die 1,4-Addition an Crotylimid 93, gefolgt von reduktiver Auxiliarabspaltung und Swern-Oxidation, ergab den entsprechenden Aldehyd, der mit dem Bestmann-Ohira-Reagens 95[42] in das Alkin 96 berfhrt wurde. Carboaluminierung von 96, Cupratbildung und Addition der Organometallverbindung an ent-93 lieferten nach reduktiver Entfernung des Auxiliars den Alkohol 97. Eine Standardkettenverlngerung ergab Aldehyd 98, der in einer Paterson-Aldolreaktion mit Keton 99[43] das Zwischenprodukt 100 lieferte. Diastereoselektive Carbonylreduktion und Acetonidschutz des resultierenden Diols ergaben schlielich die vollstndig substituierte Ansakette 101.

ber eine Negishi-Kreuzkupplung aus dem Vinyliodid 103 und dem Alkyliodid 104 hergestellt. Fr die Synthese der Tetrahydropyranvorstufe 105 entwickelten Panek und Lowe die Lewis-Sure-katalysierte, formale [4+2]-Cycloaddition des chiralen Crotylsilans 106[45] mit Aldehyd 107, wobei vermutlich das Acetal 108 und das Ionenpaar 109 als Zwischenstufen auftreten. Ausgehend von 105 wurde in einer vierstufigen Sequenz aus Epoxidierung (d.r. 3:1), Epoxidffnung, Hydrierung und Silylierung das Tetrahydropyran 110 synthetisiert (Schema 22). Die Komplettierung des Arens erfolgte in vier weiteren Stufen, wobei eine Stille-Kupplung an C20a zum Einsatz kam. Nach der Reduktion des C10-Esters zum Aldehyd wurde dieser in einer Wittig-Reaktion mit dem Phosphoniumbromid 112[46] kettenverlngert und anschlieend ber eine Hydrierung/Debenzylierung mit nachfolgender Oxidation in den Aldehyd 113 berfhrt. Vier weitere Standardschritte lieferten das Vinyliodid 103. Die Fertigstellung der Ansakette (Schema 23) durch Negishi-Kupplung von 103 mit 104 lieferte das Intermediat 114, das in vier weiteren Stufen in die Secoverbindung 102 berfhrt wurde. Die Barbier-Makrocyclisierung[47] wurde durch Umsetzung des Aldehyds 102 mit Samarium(II)-iodid bewirkt und lieferte 115 als Epimerenmischung, die analog zur von Smith et al. entwickelten, oxidativen Reaktionssequenz (vgl. Schema 17) in 1 berfhrt wurde.

8. Totalsynthese von Panek und Lowe (2005, 2008)


In Paneks und Lowes Synthese von 1 wurde die Makrocyclisierung durch eine intramolekulare SmI2-Barbier-Reaktion des Aldehyds 102 erreicht (Schema 21).[44] Dieser wurde
Angew. Chem. 2010, 122, 5746 5758

9. Zwei Formalsynthesen von Rychnovsky und Bahnck (2006, 2008)


Rychnovsky und Bahnck entwickelten zwei Anstze zur Synthese von Kendomycin. Der erste endete mit der Synthese www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5753

Kurzaufstze

H. J. Martin, J. Mulzer und T. Magauer

Schema 22. Aufbau der Tetrahydropyrandomne; R = TBS. Schema 24. Synthese des Intermediats 71 durch Rychnovsky und Bahnck.

Schema 23. Totalsynthese von Kendomycin (1) ber eine Barbier-Makrocyclisierung; R = TBS. CSA = ( )-Camphersulfonsure.

des Smith-Intermediats 71,[48] der zweite mndete ber das makrocyclische Benzofuran-Intermediat 56 in der Syntheseroute von Lee et al.[49] Beide Routen nutzen zum Aufbau des Tetrahydropyranrings die Prins-Reaktion, wobei diese im ersten Zugang intermolekular eingesetzt wurde, whrend sie im zweiten Zugang gleichzeitig zur Makrocyclisierung dient. Die Synthese des Intermediats 71 startete mit der bekannten Umwandlung von (S)-Citronellol zum Aldehyd 116,[50] der anschlieend durch die Reaktion mit Hoffmanns chiralem Crotylboronat 117[51] in den Alkohol 118 berfhrt wurde (Schema 24). Die Prins-Reaktion mit Aldehyd 119

lieferte ber das Oxonium-Intermediat 120 Tetrahydropyran 121. Schutzgruppenmanipulation ergab anschlieend den primren Alkohol 122, der durch eine aromatische Bromierung und eine Grieco-Eliminierung in das Olefin 71 berfhrt wurde. Beim Vergleich mit der Synthese von Smith et al. fllt auf, dass der Tetrahydropyranring zwar in einer Stufe aufgebaut wurde, dafr aber zustzliche Stufen fr das terminale Olefin aufgewendet werden mussten. Die zweite Syntheseroute begann mit der dreistufigen berfhrung des Phenols 123 in das Aryliodid 124 (Schema 25). Eine Sonogashira-Kupplung mit dem aus Aldehyd 84 erhltlichem Alkin 125 lieferte das disubstituierte Alkin 126, das durch Umsetzung mit CsOH in einer 5-endo-dig-Cyclisierung zum Benzofuran 127 reagierte. Phenol-OH-Schutz, Debenzylierung und Iodierung lieferten schlielich Lees Alkyliodid 42. Fr die Synthese der linksseitigen Domne wurde der aus 50 erhaltene Aldehyd 128 mit Crotylboronat 117 zum Vinyliodid 129 umgesetzt (Schema 26). Analog zum Ansatz von Lee et al. (vgl. Schema 11) wurde 42 in das 9-BBN-Derivat berfhrt und in einer Suzuki-Miyaura-Kupplung mit 129 umgesetzt. Das resultierende Olefin 130 lieferte ber Desilylierung, Formylierung und O-Sulfonierung die Secoverbindung 131. Die Prins-Reaktion wurde in hoher Verdnnung in Essigsure unter Zugabe von BF3OEt2 durchgefhrt, um den Ringschluss zum Tetrahydropyran mit der Macrocyclisierung zu verbinden. Die anschlieende Desulfonierung lieferte Lees Schlsselintermediat 56. Rychnovsky und Bahnck vermerkten allerdings in einer FuAngew. Chem. 2010, 122, 5746 5758

5754

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte

Chemie

Schema 27. Anstze von Mulzer et al. fr die Makrocyclisierung. Schema 25. Synthese von Lees Intermediat 42. CAN = Cerammoniumnitrat, NIS = N-Iodsuccinimid.

Carbonsure 134 und den Allylalkoholen 135 und 136 zugnglich waren. Die Synthese der gemeinsamen Vorstufe 134 (Schema 28) gelang ber die bereits etablierte Strategie der Epoxidffnung, bei der Arylbromid 20 und das aus (S)-Citronellen

Schema 26. Formalsynthese von Kendomycin. HMTA = Hexamethylentetramin.

note, dass die berfhrung von 56 in 1 nach Lee et al. fr sie nicht reproduzierbar war.

Schema 28. Benzofuransynthese; R = TBDPS.

10. Totalsynthesen von Mulzer et al. (2009, 2010)


In zwei Publikationen der Gruppe um Mulzer wurden krzlich zwei Totalsynthesen von Kendomycin beschrieben.[52] Beide Routen enthalten eine SN1-Reaktion zum Aufbau des Tetrahydropyranrings, unterscheiden sich aber hinsichtlich der Makrocyclisierung (Schema 27), fr die entweder 132 durch Lactonisierung und Photo-Fries-Reaktion (C4a-C5) in den Makrocyclus berfhrt wurde oder das Trien 133 ber eine RCM-Reaktion (C10/C11) zum Makroolefin geschlossen wurde. Weitere Schlsselschritte waren die Ireland-Claisen-Umlagerungen komplexer Ester, die aus der
Angew. Chem. 2010, 122, 5746 5758

gewonnene Epoxid 137 zum Einsatz kamen. Durch Oxidation zum Keton 138 und surekatalysierte Kondensation wurde das Benzofuran 139 erhalten und in vier weiteren Stufen in die Sure 134 berfhrt. Fr die Ireland-Claisen-Umlagerung wurde 134 mit den Allylalkoholen 135 oder 136 verestert. Die resultierenden Ester 140 bzw. 141 wurden in die entsprechenden OTBS-Ketenacetale berfhrt (Schema 29), die beim Erhitzen in einer [3,3]-sigmatropen Umlagerung zunchst die entsprechenden Carbonsuren und nach deren Reduktion die primren Alkohole 142 bzw. 143 lieferten. Diese wurden ber das jeweilige Mesylat zu den C16-Methylverbindungen 144 bzw. 145 reduziert. www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5755

Kurzaufstze

H. J. Martin, J. Mulzer und T. Magauer

Schema 29. Anwendung der Ireland-Claisen-Umlagerung; R = TBDPS. EDCl = 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimid.

Secosure 132, gefolgt von Makrolactonisierung und PhotoFries-Umlagerung, lieferte das Keton 147. Eine Reduktion mit NaBH4 und anschlieende Aufarbeitung mit Sure ergaben das entsprechende Triol, das beim Erwrmen mit TsOH eine SN1-Cyclisierung einging und so zu Lees Intermediat 56 fhrte. In bereinstimmung mit der Vorschrift von Lee et al. wurde 56 schlielich in 1 berfhrt. In der zweiten Synthese startete der Aufbau der Tetrahydropyranregion mit Acrolein (148), das in sechs Stufen ber das Lacton 149 in den Aldehyd 150 berfhrt wurde (Schema 31). Eine ortho-dirigierte Lithiierung von 145 und Zugabe des Aldehyds 150 lieferten das Trien 133 als Diastereomerenmischung (3.5:1). Das Hauptdiastereomer wurde in der nachfolgenden RCM-Reaktion zum makrocyclischen Dien 151 umgesetzt. Die selektive Reduktion der disubstituierten Doppelbindung mit Diimin und eine nachfolgende SN1-Cyclisierung beendeten die Synthese der Vorstufe 56. Da die RCM-Reaktion mit dem Mindermengendiastereomer 133 nicht erfolgreich war, wurde die Reihenfolge der Cyclisierungsreaktionen vertauscht, um unntigen Materialverlust zu vermeiden. So ergab die Umsetzung der Diastereomerenmischung 133 mit HCl zunchst das Tetrahydropyran 152, das

Die erste Syntheseroute zu 1 (ber die Photo-Fries-Reaktion) wurde mit der Desilylierung und Oxidation der Verbindung 144 eingeleitet (Schema 30). Der resultierende Aldehyd wurde in drei Stufen zum Lacton 146 weitergefhrt, wobei die bereits etablierte Aldolmethodik zum Einsatz kam. Die anschlieende Umsetzung zur 7,9-Acetonid-geschtzten

Schema 30. Synthese von 1 ber Makrolactonisierung und Photo-FriesUmlagerung.

Schema 31. Synthese von 1 ber RCM und Diimid-Reduktion. DDQ = 2,3-Dichlor-5,6-dicyan-p-benzochinon.
Angew. Chem. 2010, 122, 5746 5758

5756

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Antibiotika

Angewandte

Chemie

auch die erwartete Atropisomerie aufwies. Trotz der gehinderten Rotation verlief die RCM-Reaktion glatt, und die selektive Reduktion der weniger substituierten Doppelbindung fhrte erneut zu 56, mit sogar noch besserer Ausbeute und Selektivitt. Diesmal wurde eine Schutzgruppen-freie Endphase der Syntheseroute entwickelt. So ergab die Reaktion von 56 mit DDQ das labile, jedoch isolierbare o-Chinon 153, das bei Umsetzung mit verdnnter Sure Wasser addierte und so zu Kendomycin (1) fhrte.
Abbildung 2. Die meistgenutzten Fragmente auf dem Weg zu 1.

11. Zusammenfassung und Ausblick


Ziel dieses Kurzaufsatzes war es, einen chronologischen berblick ber die Kendomycin-Synthese zu geben. Deren typische Merkmale sind der Ringschluss der Kohlenstoffansakette (Abbildung 1) und die Bildung des Tetrahydropy-

Abbildung 1. Makrocyclisierungspositionen in Kendomycin (1).

ranrings. Die Makrocyclisierung an C4/C5a unter gleichzeitiger Bildung des Tetrahydropyranrings wurde durch eine Makro-C-Glycosidierung (Lee et al.) oder eine intramolekulare Prins-Reaktion (Rychnovsky/Bahnck) erreicht, whrend Mulzer et al. ein Makrolactonisierungs-Photo-Fries-Verfahren whlten, dem eine Reduktion und Tetrahydropyranbildung nachfolgten. Die Makrocyclisierung an C19/C20 gelang durch eine SmI2-Barbier-Reaktion (Panek/Lowe). Verschiedene Versuche wurden zur C13/C14-RCM unternommen (Mulzer et al., Smith III et al., Arimoto et al.). Letztlich erkannten Smith et al., dass als Voraussetzung hierfr das rigide Benzofuran vermieden werden musste. Allerdings war die RCM von moderater Ausbeute und lieferte nur das unerwnschte Z-Olefin. Die 13,14-HWE-Cyclisierung (Mulzer et al.) war zwar erfolgreich, allerdings misslang die Entfernung des C15-Carbonylsauerstoffatoms. Effizienter war die RCM an C10/C11 (Mulzer et al.), die trotz bereits installiertem Benzofuran und Tetrahydropyran in hoher Ausbeute gelang. Fr die Synthese der Macrocyclisierungsvorstufen wurden im Wesentlichen vier Fragmente genutzt (Abbildung 2): ein mehrfach substituierter aromatischer Grundkrper, eine Aldolkomponente (C5C8), ein aus (S)-Citronellen entwickeltes Fragment (C9C13) und eine Dipropionateinheit (C15 C19). Ein breites Reaktionsspektrum kam beim Aufbau der
Angew. Chem. 2010, 122, 5746 5758

Tetrahydropyranheit zum Einsatz, darunter Oxa-MichaelAddition, SN1-Cyclisierung, C-Glycosidierung, Petasis-Ferrier-Umlagerung, [4+2]-Anellierung, Iodveretherung und Prins-Reaktion. Die oxidative Endphase startete ausgehend von einem Benzofuran (Lee et al., Mulzer et al.) oder einem Benzylketon (Smith et al., Panek/Lowe). Hinsichtlich der Ansakette ist die Synthese von Williams und Shamim am krzesten. Die Geschichte des Kendomycins ist ein illustratives Beispiel dafr, wie ein interessantes neuartiges Zielmolekl von der Synthetikergemeinde aufgenommen wird. Nacheinander haben sich verschiedene Gruppen an der Jagd nach der ersten Synthese beteiligt und, nach deren Verwirklichung, alternative Routen entwickelt. Wichtige Elemente wurden wechselseitig rasch von den rivalisierenden Gruppen bernommen und angepasst, was zu weiteren Verbesserungen fhrte. Ganz typisch ergab sich am Schluss eine signifikante Bereicherung der Synthesemethodik, und eine Reihe zuverlssiger Routen hin zu Kendomycin wurde entwickelt. Diese Erkenntnisse sollten eine Erforschung der Struktur-Aktivitts-Beziehungen sowie im Hinblick auf die immense Diversitt der biologischen Eigenschaften von 1 die Entwicklung einer spezifischeren Leitstruktur ermglichen.
Eingegangen am 14. Januar 2010 Online verffentlicht am 16. Juni 2010

[1] a) Y. Funahashi, T. Ishimaru, N. Kawamura, JP Patent 08231551 [A2960910], 1996 ; b) Y. Funahashi, N. Kawamura, T. Ishimaru, JP Patent 08231552 [A2960910], 1996. [2] M. H. Su, M. I. Hosken, B. J. Hotovec, T. L. Johnston, US Patent 5728727 [A980317], 1998. [3] H. B. Bode, A. Zeeck, Perkin 1 2000, 323. [4] Y. A. Elnakady, M. Rohde, F. Sasse, C. Backes, A. Keller, H.-P. Lenhof, K. J. Weissman, R. Mller, ChemBioChem 2007, 8, 1261. [5] C. O. Janssen, S. Lim, E. P. Lo, K. F. Wan, V. C. Yu, M. A. Lee, S. B. Ng, M. J. Everett, A. D. Buss, D. P. Lane, R. S. Boyce, Bioorg. Med. Chem. Lett. 2008, 18, 5771. [6] Diskussion der Synthesetaktik anhand von drei Beispielen: M. Shan, L. Wang, Q. Zhang, G. A. ODooherty, Chemtracts 2009, 22, 1. [7] H. B. Bode, A. Zeeck, Perkin 1 2000, 2665. [8] S. C. Wenzel, H. B. Bode, I. Kochems, R. Mller, ChemBioChem 2008, 9, 2711. [9] H. J. Martin, M. Drescher, H. Kahlig, S. Schneider, J. Mulzer, Angew. Chem. 2001, 113, 3287; Angew. Chem. Int. Ed. 2001, 40, 3186.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5757

Kurzaufstze
[10] S. Pichlmair, M. M. B. Marques, M. P. Green, H. J. Martin, J. Mulzer, Org. Lett. 2003, 5, 4657. [11] A. G. M. Barrett, R. A. E. Carr, S. V. Attwood, G. Richardson, N. D. A. Walshe, J. Org. Chem. 1986, 51, 4840. [12] D. A. Evans, J. S. Clark, R. Metternich, V. J. Novack, G. S. Sheppard, J. Am. Chem. Soc. 1990, 112, 866. [13] D. A. Evans, K. T. Chapman, E. M. Carreira, J. Am. Chem. Soc. 1988, 110, 3560. [14] a) C. H. Heathcock, S. D. Young, J. P. Hagen, R. Pilli, U. Badertscher, J. Org. Chem. 1985, 50, 2095; b) B. A. Johns, C. M. Grant, J. A. Marshall, Org. Synth. 2005, Coll. Vol. 10, 170. [15] W. Oppolzer, D. Dupuis, G. Poli, T. M. Raynham, G. Bernardinelli, Tetrahedron Lett. 1988, 29, 5885. [16] W. Oppolzer, G. Poli, Tetrahedron Lett. 1986, 27, 4717. [17] J. Mulzer, S. Pichlmair, M. P. Green, M. M. B. Marques, H. J. Martin, Proc. Natl. Acad. Sci. USA 2004, 101, 11980. [18] M. P. Green, S. Pichlmair, M. M. B. Marques, H. J. Martin, O. Diwald, T. Berger, J. Mulzer, Org. Lett. 2004, 6, 3131. [19] Y. Yuan, H. Men, C. Lee, J. Am. Chem. Soc. 2004, 126, 14720. [20] B. G. Vong, S. Abraham, A. X. Xiang, E. A. Theodorakis, Org. Lett. 2003, 5, 1617. [21] a) A. G. Myers, B. H. Yang, H. Chen, J. L. Gleason, J. Am. Chem. Soc. 1994, 116, 9361; b) A. G. Myers, B. H. Yang, H. Chen, L. McKinstry, D. J. Kopecky, J. L. Gleason, J. Am. Chem. Soc. 1997, 119, 6496. [22] A. Hercouet, M. Lecorre, Tetrahedron Lett. 1979, 20, 2145. [23] H. Oikawa, Y. Yoneta, T. Ueno, M. Oikawa, T. Wakayama, A. Ichihara, Tetrahedron Lett. 1997, 38, 7897. [24] T. Sengoku, H. Arimoto, D. Uemura, Chem. Commun. 2004, 1220. [25] T. Sengoku, D. Uemura, H. Arimoto, Chem. Lett. 2007, 36, 726. [26] A. K. Ghosh, Y. Wang, J. T. Kim, J. Org. Chem. 2001, 66, 8973. [27] a) A. B. Smith III, E. F. Mesaros, E. A. Meyer, J. Am. Chem. Soc. 2005, 127, 6948; b) A. B. Smith III, E. F. Mesaros, E. A. Meyer, J. Am. Chem. Soc. 2006, 128, 5292; c) A. B. Smith III, R. J. Fox, T. M. Razler, Acc. Chem. Res. 2008, 41, 675. [28] D. A. Evans, J. Bartroli, T. L. Shih, J. Am. Chem. Soc. 1981, 103, 2127. [29] M. Kurihara, W. Hakamata, J. Org. Chem. 2003, 68, 3413. [30] N. A. Petasis, E. I. Bzowej, J. Am. Chem. Soc. 1990, 112, 6392. [31] a) R. J. Ferrier, S. Middleton, Chem. Rev. 1993, 93, 2779; b) N. A. Petasis, S. P. Lu, Tetrahedron Lett. 1996, 37, 141. [32] K. B. Sharpless, M. A. Umbreit, M. T. Nieh, T. C. Flood, J. Am. Chem. Soc. 1972, 94, 6538.

H. J. Martin, J. Mulzer und T. Magauer

[33] J. D. White, H. Smits, Org. Lett. 2005, 7, 235. [34] a) A. Abiko, S. Masamune, Tetrahedron Lett. 1996, 37, 1081; b) M. R. Hale, A. H. Hoveyda, J. Org. Chem. 1992, 57, 1643. [35] U. S. Racherla, H. C. Brown, J. Org. Chem. 1991, 56, 401. [36] a) J. C. Gilbert, U. Weerasooriya, J. Org. Chem. 1979, 44, 4997; b) D. Seyferth, R. S. Marmor, P. Hilbert, J. Org. Chem. 1971, 36, 1379. [37] a) K. H. Dtz, Angew. Chem. 1975, 87, 672; Angew. Chem. Int. Ed. Engl. 1975, 14, 644; b) K. H. Dtz, R. Dietz, A. V. Imhof, H. Lorenz, G. Huttner, Chem. Ber. 1976, 109, 2033. [38] A. Abiko, J. F. Liu, S. Masamune, J. Am. Chem. Soc. 1997, 119, 2586. [39] H. C. Brown, K. S. Bhat, J. Am. Chem. Soc. 1986, 108, 5919. [40] D. R. Williams, K. Shamim, Org. Lett. 2005, 7, 4161. [41] G. S. Garrett, T. J. Emge, S. C. Lee, E. M. Fischer, K. Dyehouse, J. M. McIver, J. Org. Chem. 1991, 56, 4823. [42] a) S. Mller, B. Liepold, G. J. Roth, H. J. Bestmann, Synlett 1996, 521; b) S. Ohira, Synth. Commun. 1989, 19, 561. [43] I. Paterson, T. Temal-Laib, Org. Lett. 2002, 4, 2473. [44] J. T. Lowe, J. S. Panek, Org. Lett. 2008, 10, 3813. [45] J. T. Lowe, J. S. Panek, Org. Lett. 2005, 7, 1529. [46] F. C. A. Gaeta, L. S. L. Degaeta, T. P. Kogan, Y. S. Or, C. Foster, M. Czarniecki, J. Med. Chem. 1990, 33, 964. [47] a) K. C. Nicolaou, X. Huang, N. Giuseppone, P. B. Rao, M. Bella, M. V. Reddy, S. A. Snyder, Angew. Chem. 2001, 113, 4841; Angew. Chem. Int. Ed. 2001, 40, 4705; b) K. C. Nicolaou, P. B. Rao, J. L. Hao, M. V. Reddy, G. Rassias, X. H. Huang, D. Y. K. Chen, S. A. Snyder, Angew. Chem. 2003, 115, 1795; Angew. Chem. Int. Ed. 2003, 42, 1753. [48] K. B. Bahnck, S. D. Rychnovsky, Chem. Commun. 2006, 2388. [49] K. B. Bahnck, S. D. Rychnovsky, J. Am. Chem. Soc. 2008, 130, 13177. [50] a) N. Y. Grigoreva, O. A. Pinsker, E. D. Daeva, A. M. Moiseenkov, Bull. Acad. Sci. USSR Div. Chem. Sci. (Engl. Transl.) 1991, 40, 2037; b) R. Breitenbach, C. K. F. Chiu, S. S. Massett, M. Meltz, C. W. Murtiashaw, S. L. Pezzullo, T. Staigers, Tetrahedron: Asymmetry 1996, 7, 435; c) T. K. Chakraborty, D. Thippeswamy, Synlett 1999, 150. [51] R. W. Hoffmann, K. Ditrich, G. Koster, R. Sturmer, Chem. Ber. 1989, 122, 1783. [52] a) T. Magauer, H. J. Martin, J. Mulzer, Angew. Chem. 2009, 121, 6148; Angew. Chem. Int. Ed. 2009, 48, 6032; b) T. Magauer, H. J. Martin, J. Mulzer, Chem. Eur. J. 2010, 16, 507.

5758

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5746 5758

Aufstze
Amyloid-Toxizitt

H. A. Lashuel und S. M. Butterfield

DOI: 10.1002/ange.200906670

Wechselwirkungen zwischen amyloidogenen Proteinen und Membranen: Modellsysteme liefern mechanistische Einblicke
Sara M. Butterfield und Hilal A. Lashuel*
Stichwrter: Amyloidtoxizitt Fibrillogenese Knstliche Membranen Permeabilisierung Porenbildende Proteine

Angewandte
5760

Chemie
 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Angew. Chem. 2010, 122, 5760 5788

www.angewandte.de

Protein-Membran-Wechselwirkungen

Angewandte
Aus dem Inhalt
1. Einleitung 2. Proteinfehlfaltung und Fibrillbildung an Membranoberflchen 3. Mechanismen der amyloidvermittelten Membranpermeabilisierung 5761

Chemie

Die Toxizitt amyloidbildender Proteine ist mit ihrer Wechselwirkung mit Membranen korreliert. Bemerkenswerterweise fhren Bindungsereignisse zwischen amyloidogenen Proteinen und Membranen beiderseits zu Strukturstrungen, die mit Toxizitt assoziiert sind. Membranoberflchen vermitteln die Umwandlung amyloidbildender Proteine in toxische Aggregate, amyloidbildende Proteine wiederum beeintrchtigen die strukturelle Integritt der Zellmembran. Neuere Untersuchungen an knstlichen Modellmembranen haben eine bemerkenswerte hnlichkeit im Mechanismus der Membranpermeabilisierung von amyloidbildenden Proteinen, porenbildenden Toxinen und antimikrobiellen Peptiden aufgezeigt.

5763

5768

1. Einleitung
Die Alzheimer-Krankheit (AD), die Parkinson-Krankheit (PD), Diabetes mellitus vom Typ II und zahlreiche andere altersbedingte neurodegenerative und systemische Funktionsstrungen sind Krankheiten, die sich auf eine Fehlfaltung von Proteinen zurckfhren lassen und durch die Anreicherung unlslicher Proteinablagerungen gekennzeichnet sind. Diese Proteinablagerungen setzen sich zusammen aus fibrillren Aggregaten, oder Amyloiden, die reich sind an b-Faltblattstrukturen und aus einem einzigen Protein bestehen. Das Amyloid-beta(Ab)-Peptid ist der Hauptbestandteil seniler Plaques im Gehirn von Alzheimerpatienten.[1] In gleicher Weise sind Fibrillen aus a-Synuclein der Hauptbestandteil neuronaler Einschlsse, oder Lewy-Krper, die man im Gehirn von Parkinsonpatienten findet.[2] Darber hinaus ist die Pathologie des Diabetes mellitus Typ II gekennzeichnet durch eine extrazellulre Anreicherung von Amyloidplaques, die hauptschlich aus Amylin (auch InselAmyloid-Polypeptid, IAPP) bestehen und sich nahe der Betazellen des Pankreas ablagern.[3] Amyloidogene Proteine, darunter Ab, IAPP und a-Synuclein, werden als lsliche Proteine gebildet und dann in lsliche Oligomere mit b-Faltblattstruktur (z. B. Dimere, Trimere) und niedrigerem Molekulargewicht berfhrt. Die weitere Proteinanreicherung fhrt zu protofibrillren Oligomeren mit hherem Molekulargewicht und letztendlich zu unlslichen Fibrillen, aus denen die Amyloidplaques bestehen (Schema 1). Oligomere mit niedrigem und hherem Molekulargewicht bezeichnet man als prfibrillre Aggregate. Immer mehr Hinweise sttzen die Hypothese, dass diese prfibrillren Intermediate und nicht die voll entwickelten Amyloidfibrillen die primr toxische Spezies sind, die pathologische Prozesse auslsen.[4] Bemerkenswerte Ergebnisse zeigen, dass oligomere Formen von Ab fr primre Neuronen toxisch sind, die hippokampale Langzeitpotenzierung inhibieren und Gedchtnisschwche in Ratten- oder Maus-Modellsystemen verursachen.[5] Diese Ergebnisse fhrten zur so genannten Hypothese toxischer Oligomere.[4c, 6] Die hnlichen morphologischen und toxikologischen Eigenschaften protofibrillrer Aggregate, die sich von verschiedenen amyloidbildenden Proteinen ableiten, legen nahe, dass der PaAngew. Chem. 2010, 122, 5760 5788

4. Membranmodelle und experimentelle Methoden zur Untersuchung der Mechanismen der Protein-induzierten Membranpermeabilisierung 5775 5. Zusammenfassung und Ausblick 5784

thogenese amyloidbedingter Krankheiten gemeinsame Mechanismen der Aggregation und Toxizitt zugrunde liegen.[7] Dennoch ist wahrscheinlich nicht nur ein einziger Mechanismus fr den Beginn der Neurodegeneration verantwortlich, sondern vielmehr das Zusammenspiel vieler. Nichtsdestotrotz gibt es immer mehr Hinweise darauf, dass die Zellmembran der Angriffsort oligomerer Formen amyloidogener Proteine ist.[7, 8] Biophysikalische Untersuchungen und mechanistische Studien mit vereinfachten Membranmodellsystemen haben wesentlich zu unserem elementaren Verstndnis der Interaktionen zwischen amyloidbildenden Proteinen und Membranen beigetragen. Bemerkenswerterweise zeigten die Untersuchungen, dass diese Interaktionen zwischen amyloidbildenden Proteinen und Membranen zu gegenseitigen Strukturstrungen sowohl des Proteins als auch der Membran fhren.[9] Einerseits knnen Membranoberflchen je nach ihrer chemischen Zusammensetzung als katalytische Stellen dienen, an denen die fehlerhafte Faltung und Aggregation amyloidogener Proteine begnstigt wird (Schema 1).[10] Andererseits stren amyloidogene Proteine die strukturelle Integritt der Membran, wodurch die ungeregelte Passage kleiner Molekle und Ionen durch die Membran mglich wird (Schema 1).[4a,b, 11] Extrapolation dieser Ergebnisse hin zur Situation in vivo deutet auf einen Verlust kritischer Ionengradienten der Membran und eine Depolarisation der Zellmembran als Reaktion auf die Wechselwirkung mit oligomeren Strukturen amyloidogener Proteine hin. Der genaue Mechanismus der Membranpermeabilisierung durch amyloidogene Proteine ist noch nicht vollstndig verstanden, aber
[*] Dr. S. M. Butterfield, Prof. H. A. Lashuel Laboratory of Molecular Neurobiology and Neuroproteomics Swiss Federal Institute of Technology Lausanne (EPFL) SV-BMI-LMNN-AI2351, 1015 Lausanne (Schweiz) E-Mail: hilal.lashuel@epfl.ch

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5761

Aufstze

H. A. Lashuel und S. M. Butterfield

Schema 1. Zusammenhnge zwischen Amyloidbildung und Membranstrung/-zersetzung. Oben: Die Bildung von Amyloidfibrillen geht einher mit der Fehlfaltung lslicher Proteine zu b-Faltblatt-Oligomeren, die sich weiter zu Protofibrillen, darunter auch ringhnlichen (annularen) Protofibrillen und entwickelten Amyloidfibrillen zusammenlagern. Unten: Die Rolle der Membranen bei der Amyloidbildung und deren Toxizitt. Lsliche Proteine binden an die Membranoberflche und wechseln in eine a-Helix-Struktur. Akkumulation der Proteine an der Membranoberflche induziert die Oligomerisierung zu b-Faltblatt-Aggregaten. Wird eine kritische Grenzkonzentration erreicht, bildet sich eine transmembrane Pore (annulare Protofibrille) in der Membran, wodurch ein Auslaufen des Membraninhalts mglich wird. Nach einem anderen mglichen oder koexistenten Mechanismus knnen sich in Lsung gebildete annulare Protofibrillen in die Membran einlagern, undefinierte prfibrillre Aggregate an die Membranoberflche binden und ein Ausdnnen der Membran induzieren, und/oder Lipide knnen von der Membran extrahiert und in die sich entwickelnden Fibrillen in einem detergensartigen Prozess eingelagert werden.

experimentelle Ergebnisse fhrten zu mehreren mechanistischen Modellen. Hinweise auf transmembrane oligomere Poren, die an porenbildende Toxine erinnern,[7b, 12] die unspezifische Bindung amyloidogener Oligomere an die Membranoberflche[4a,b] und eine Auflsung der Membranen durch Amyloidfibrillen, die auf der Membranoberflche wachsen,[13] wurden jeweils experimentell untermauert (Schema 1). Trotz der steigenden Zahl von Berichten, die die Toxizitt eines Amyloidproteins mit seiner Wirkung auf die Membranintegritt in Verbindung bringen, besteht eine Wissenslcke bezglich der molekularen Details, wie amyloidbildende Proteine auf die Membran wirken und dadurch die Membranpermeabilisierung bewirken. Offen bleiben auch andere Fragen dahingehend, wie der Permeabilisierungsmechanismus in Abhngigkeit vom Oligomerisationszustand und der Identitt des Proteins variiert und wie die Membran selbst an der Bildung der oligomeren Spezies des Proteins beteiligt ist und so ihren eigenen Strukturzusammenbruch herbeifhrt.

Ein Ziel dieses Aufsatzes ist, neuere Literatur zusammenzufassen und Ergebnisse hervorzuheben, die anhand von Modellsystemen zum Verstndnis der molekularen Prozesse beigetragen haben, mittels derer: 1) Membranoberflchen die Faltung, Oligomerisierung und Fibrillbildung amyloidogener Proteine beeinflussen und 2) diese oligomeren Proteine die Membranstruktur stren. Weiterhin stellen wir die derzeitigen mechanistischen Modelle, die die Amyloid-induzierte Membranpermeabilisierung erklren, sowie die sie sttzenden oder ihnen widersprechenden experimentellen Ergebnisse vor. Auch sollen die verschiedenen Membranmodellsysteme und experimentellen Hilfsmittel vorgestellt werden, die zur Verfgung stehen, um die Wechselwirkungen zwischen amyloidogenen Proteinen und Membranen zu untersuchen und damit die wichtigsten mechanistischen Aspekte weiter zu entschlsseln, die der Cytotoxizitt zugrunde liegen. In diesem Aufsatz werden hauptschlich Ergebnisse vorgestellt, die in den letzten Jahren (20062009) mit Ab, aSynuclein und IAPP erhalten wurden. Diese Proteine wurden

Sara M. Butterfield promovierte 2004 in Bioorganischer Chemie an der UNC Chapel Hill und arbeitet zurzeit als Research Fellow in der Arbeitsgruppe von Prof. H. Lashuel. Ihre Forschungsinteressen liegen in der Entwicklung chemischer und physikalischer Anstze zur Kontrolle von Proteinfehlfaltungen zur Aufklrung der molekularen Grundlagen neurodegenerativer Erkrankungen.

Hilal A. Lashuel promovierte im Jahr 2000 an der Texas A&M University. 2001 wechselte er an das Center for Neurologic Diseases der Harvard Medical School, zuerst als Research Fellow, spter als Instructor of Neurology. 2005 wechselte er als Assistant Professor zum Brain Mind Institute am Swiss Federal Institute of Technology in Lausanne. Seine Forschunginteressen gelten der Proteinfibrillogenese und ihrer Rolle in neurodegerativen Erkrankungen.

5762

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5760 5788

Protein-Membran-Wechselwirkungen

Angewandte
len charakterisiert ist. Der Latenzphase folgt ein ungnstiger Konformationswechsel hin zu einer b-Faltblattstruktur und die Zusammenlagerung von Monomeren zu einem oligomeren Nukleus, von dem sich wiederum mehrere zu Protofibrillen hherer Ordnung zusammenfgen (Abbildung 1).[15]

Chemie

aufgrund der Flle an aktuellen Ergebnissen und wegen ihrer essentiellen Rolle in den Krankheitsbildern von Alzheimer, Parkinson und Diabetes mellitus Typ II ausgewhlt. In geringerem Detail stellen wir auch Ergebnisse ber Prionproteine vor, besonders wenn mechanistische Analogien zu amyloidbildenen Proteinen bestehen. Die hier vorgestellten Untersuchungen wurden vornehmlich mit vereinfachten Membranmodellen durchgefhrt, in denen das komplexe Zusammenspiel der molekularen Mechanismen, das den wechselseitigen Strukturstrungen zugrunde liegt, in einer relativ kontrollierten und systematischen Weise aufgeklrt werden kann. Wir hoffen, mit diesem Aufsatz einen umfangreichen berblick ber den derzeitigen Wissensstand zum Mechanismus, ber den amyloidogene Proteine auf Membranen wirken, geben zu knnen und so weitere Arbeiten auf diesem Gebiet anzuregen, damit noch bestehende Wissenslcken geschlossen werden knnen. Ein besseres Verstndnis der Mechanismen der toxischen Aktivitt amyloidbildender Proteine auf Membranen ist entscheidend fr ein besseres elementares Verstndnis Amyloid-bedingter Krankheiten und der Entwicklung bentigter Prventions- und Therapiestrategien.

Abbildung 1. Nukleations-/Polyerisations-Weg der Amyloid-Fibrillogenese (nach Wilson et al.).[20]

2. Proteinfehlfaltung und Fibrillbildung an Membranoberflchen


In zahlreichen Studien wurde gezeigt, dass Lipidmembranen die Umwandlung amyloidogener Proteine in fehlgefaltete toxische Aggregate beschleunigen oder sogar katalysieren knnen.[9] Wenn man bedenkt, dass Amyloidproteine und Lipide amphipathische Strukturen haben, ist die Assoziation von Amyloidproteinen an Membranoberflchen ein konzeptionell naheliegendes Szenario. Fr kationische Proteine wie Ab und IAPP und die N-terminale Membranbindungregion von a-Synuclein[14] wird der anfngliche Bindungsvorgang vornehmlich angetrieben durch elektrostatische Wechselwirkungen zwischen basischen Seitenketten und anionischen Lipidkopfgruppen.[10b] Weitere hydrophobe Kontakte mit verdeckten Acylketten sowie die folgende Proteinakkumulation an der Membranoberflche erhhen die lokale Proteinkonzentration und erleichtern so den Aggregationsprozess.[10b] Deswegen knnen Membranen, je nach ihrer Zusammensetzung und ihren chemischen Eigenschaften, als Templat fr die Fehlfaltung amyloidogener Proteine und ihre Anordnung zu Fibrillen dienen.[10a] In diesem Abschnitt geben wir einen berblick ber die neuesten Untersuchungen mit Membran-Modellsystemen zur Rolle von Lipidmembranen als Templat bei der Bildung toxischer Aggregate und Amyloidfibrillen.[9]

2.1. Fibrillogenese durch Nukleation/Polymerisation und mgliche Mechanismen Membran-untersttzter Aggregation Ohne Katalyse folgen Amyloidproteine einem Nukleations-Polymerisations-Mechanismus, der durch eine anfngliche Latenzphase mit vornehmlich monomeren BestandteiAngew. Chem. 2010, 122, 5760 5788

Der Nukleus vergrert sich dann kooperativ und schnell durch Monomeraddition an das wachsende Proteinpolymer, wobei der kinetische Verlauf dieses Prozesses durch eine sigmoidale Kurve gekennzeichnet ist (Abbildung 1).[16] In vitro erfolgt die Nukleation von Ab oberhalb dessen kritischer Micellenkonzentration (CMC), die je nach Lnge des Peptids im Bereich von 17.5 bis 100 mm liegt.[17] Tatschlich liegt die physiologische Konzentration von Ab Grenordnungen unter diesem Level, so etwa in der Rckenmarksflssigkeit im subnanomolekularen Bereich.[18] Dies legt nahe, dass die Fibrillogenese von Ab, ebenso wie die von anderen amyloidogenen Proteinen, in vivo einem anderen Mechanismus folgt. Hierbei handelt es sich mglicherweise um einen templatuntersttzten Mechanismus, bei dem Bestandteile der lokalen Umgebung die Aktivierungsbarriere fr die Nukleation herabsetzen. Daten von Modellsystemen deuten darauf hin, dass die Zellmembran ein wahrscheinlicher Kandidat fr die Katalyse der Fibrillbildung ist,[10, 19] wobei die Bindung des Proteins an die Membranoberflche als Plattform fr die Nukleation und weitere Polymerisation dient.[10b] Es werden mehrere mgliche Mechanismen vorgeschlagen, nach denen die Bindung an die Membranoberflche die Fehlfaltung und Aggregation von Proteinen erleichtern kann. Die Adsorption der ungefalteten amphipathischen Peptide an die Membranoberflche knnte die Konformation des Peptids fixieren (dessen Entropie verringern) und so eine strukturelle Ordnung vermitteln, wodurch die Bildung der Sekundrstruktur induziert wrde.[21] Der Einfluss von Membranen auf die Bildung von Regionen lokal konzentrierter Proteine wird auch als molecular crowding-Effekt bezeichnet.[22] Grbner und Mitarbeiter untersuchten vor kurzem den Einfluss des molecular crowding auf Konformationsnderungen von Ab in Gegenwart von Modellwww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5763

Aufstze
membranoberflchen. Durch Einfhrung von Ficoll 70, einem groen neutralen Crowding-Polymer, konnte der bergang der Konformation von Vesikel-gebundenem Ab in eine b-Faltblattstruktur begnstigt werden.[23] Neben der Erhhung der lokalen Proteinkonzentrationen wurden noch andere Faktoren vorgeschlagen, die in der membranvermittelten Fibrillogenese eine Rolle spielen knnten. Eine verringerte Dielektrizittskonstante des Mediums, die von der Mikroumgebung der Membranoberflche hervorgerufen wird, kann die Bildung von Peptid-PeptidWasserstoffbrcken im b-Faltblatt-Aggregat erleichtern.[24] Die Verminderung der Dimensionalitt von drei Dimensionen in Lsung zu nherungsweise zwei Dimensionen an der Membrangrenzflche kann auch rumliche Beschrnkungen einfhren, die die Fibrillbildung begnstigen knnen.[22]

H. A. Lashuel und S. M. Butterfield

Abbildung 2. Sequenzen von Ab42, der humanen Form von IAPP (hIAPP), und a-Synuclein. Unterstrichen sind diejenigen Reste von Ab42 und IAPP, die an Membranen unter Induktion a-helicaler Strukturen binden. Bei a-Synuclein sind die an der Membranbindung beteiligten, 11-meren Wiederholungen unterstrichen; die NAC-Region ist kursiv und die C-terminale saure Region ist fett dargestellt.

2.2. Membranbindungsregionen fr Ab, IAPP und a-Synuclein sowie die Rolle a-helicaler Intermediate Die membranvermittelte Proteinfehlfaltung und Fibrillbildung verluft in vielen Fllen ber a-helicale Intermediate (Schema 1).[25] In Abhngigkeit vom relativen Peptid/LipidAnteil[11b] wechseln sowohl Ab,[26] IAPP[27] als auch a-Synuclein[28] zu einer a-helicalen Struktur nach Bindung an die Membran. Dies erscheint als ein unproduktiver Weg hinsichtlich der Fibrillbildung.[21] Selbst in einem a-helicalen Zustand wird jedoch das Verankern der aggregationsempfindlichen Peptide an die Membranoberflche nichtsdestotrotz die lokale Proteinkonzentration in der direkten Mikroumgebung erhhen und damit einen Konformationswechsel zu einer b-Faltblattstruktur und Proteinaggregation begnstigen.[10b, 25] Der Konformationswechsel von einem freien Zufallsknuel in Lsung zu einer membrangebundenen aHelix hin zu einem b-Faltblatt-Aggregat durch die Alterung der Probe wurde fr Ab[26a] und IAPP beschrieben.[27b, 29] Dies deutet darauf hin, dass ein Mechanismus der membranvermittelten Fibrillogenese zugrundeliegt. Die Existenz von ahelicalen Zustnden, die vor der b-Faltblatt-Bildung durchlaufen werden, wurde auch bei der Fibrillbildung von Ab und IAPP in Lsung (also von nicht-membrangebundenen Peptiden) gefunden.[25, 27a, 30] Im Folgenden prsentieren wir den aktuellen Wissensstand bezglich der Strukturen membrangebundener a-Helices von Ab, IAPP und a-Synuclein sowie der Schlsselregionen, die bei der Vermittlung der Wechselwirkungen dieser Peptide mit Membranen beteiligt sind. 2.2.1. Ab Das Ab-Peptid ist ein aus 39 bis 42 Aminosuren bestehendes Peptid, das durch sequentielle Spaltung des transmembranen Amyloid-Vorluferproteins (amyloid precursor protein, APP) durch b- und g-Secretasen gebildet wird (Abbildung 2). Das Peptid enthlt je sechs negativ bzw. positiv geladene Aminosuren und einen hydrophoben C-Terminus. Frhere Untersuchungen mit Micellen oder membranimitierenden Lsungsmitteln wie Trifluorethanol (TFE) oder Hexafluorisopropylalkohol (HFIP) zeigten, dass Ab40 und Ab42 in Gegenwart dieser Membranmimetika a-helicale Struktu-

ren einnehmen. Welche Proteinregion die helicale Struktur einnimmt, ist jedoch stark abhngig von den experimentellen Bedingungen.[26bd, 31] Fletcher und Keire beobachteten eine helicale Struktur im Bereich der Aminosuren 1624 im Fragment Ab(1228) in Gegenwart von SDS-Micellen (3 mm ).[26b] Andere Untersuchungen mit Micellmodellen aus SDS und Dodecylphosphocholin (DPC) zeigten a-helicale Strukturen in den zentralen Regionen (Aminosuren 1236), die flankiert sind von unstrukturierten N- und C-Termini,[26c, 31a] sowie Helix-Schlaufe-Helix-Regionen sowohl in Ab40 als auch in Ab42.[26d] 2.2.2. IAPP Humanes IAPP (hIAPP) ist ein aus 37 Aminosuren bestehendes Peptidhormon mit einer Disulfidbrcke zwischen Cys 2 und Cys 7, die die ersten vier Aminosuren in eine ungeordnete Haarnadel-Struktur zwingt (Abbildung 2).[32] Das Peptid enthlt mehrere kationische Aminosuren, die den Kontakt mit anionischen Membranen vermitteln, sowie eine hydrophobe C-terminale Region (Aminosuren 3037). Die Aminosuren 2329 bilden ein hochgradig amyloidogenes Fragment, das bei der Einleitung der Proteinaggregation beteiligt sein knnte. [27c] Die Aufklrung der a-helicalen Konformation des an SDS-Micellen gebundenen Peptids mittels NMR-Spektroskopie lieferte eine Kern-Helix, bestehend aus den Aminosuren 528, und einen ungeordneten C-Terminus.[32] Das verkrzte Peptid hIAPP119 bindet ebenfalls an Membranen und erfhrt dabei einen Wechsel zu einer a-helicalen Struktur, bildet aber keine Fibrillen.[33] Durch die Anwendung paramagnetischer Collider auf spinmarkierte IAPP-Derivate konnten Langen und Mitarbeiter die Struktur von IAPP gebunden an POPS-haltige Vesikel bestimmen.[27c] Die Aminosuren 922 von membrangebundenem IAPP bilden eine amphipathische a-Helix, die parallel zur Membranoberflche orientiert ist (Abbildung 3). Die hydrophobe Flche der Helix war fr die polaren paramagnetischen Collider am wenigsten zugnglich, was darauf hindeutet, dass hydrophobe Reste in die Membran eindringen und die polare Flche der Helix dem LsungsAngew. Chem. 2010, 122, 5760 5788

5764

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
Proteins fr die Membranbindung) (Abbildung 2).[14] NMRSpektroskopie und Molekldynamik(MD)-Simulationen lieen den Schluss zu, dass die N-terminalen Aminosuren eine geringfgig ungewundene a-11/3-Helix (elf Aminosuren pro drei vollstndige Windungen) einnehmen im Gegensatz zu einer kanonischen a-18/5-Helix , um die amphiphilen Eigenschaften der membrangebundenen Helix zu optimieren.[36] In MD-Simulationen steht die hydrophobe Seite der a-11/3-Helix in Kontakt mit der Membran, die anionische Seite zeigt zum Lsungsmittel, und die Lys-Thr-Wiederholungen liegen an der Polar/unpolar-Grenzflche der Membran. Das Entfernen der N-terminalen Aminosuren fhrte zur Abschwchung der Toxizitt von a-Synuclein gegenber Hefepilzen, was die Annahme sttzt, dass die Toxizitt von aSynuclein mit seiner Bindung an Membranen ber N-terminale Aminosuren korreliert ist.[35, 37] Abhngig von der Oberflchenkrmmung der Modellmembran kann membrangebundenes a-Synuclein entweder eine gestreckte a-Helix,[28d] eine gekrmmte a-Helix[28a] oder eine antiparallele Helix-Turn-Helix-Konformation einnehmen.[28b,c, 34b] An SDS-Micellen gebundenes a-Synuclein nimmt eine antiparallele Helix-Turn-Helix-Konformation ein, um der hohen Oberflchenkrmmung der Membran Rechnung zu tragen (Abbildung 4 a).[28b] Gekrmmte a-helicale Strukturen von vesikelgebundenem a-Synuclein wurden durch Messungen mit spinmarkierten Sonden bestimmt (Abbildung 4 b).[28a] Eine vollstndig gestreckte aHelix wurde fr a-Synuclein gefunden, das an groe Vesi-

Chemie

Abbildung 3. Struktur von membrangebundenem hIAPP, abgeleitet aus Messungen mit einer zielgerichtet spinmarkierten Probe.[27c]

mittel exponiert ist. Die Helix ist flankiert von ungefalteten Konformationen, und die amyloidogenen Aminosuren 23 29 verblieben unstrukturiert und dem Lsungsmittel exponiert. Die Autoren vermuteten, dass die Oberflchenakkumulation von IAPP, neben anderen Faktoren wie einer verminderten Dielektrizittskonstanten des Mediums an der Membranoberflche, den Konformationsbergang des Peptids zu b-Faltblatt-Aggregaten erleichtert, eingeleitet durch das amyloidogene Fragment 2329.[27c, 28a] Durch InfrarotReflexions-Absorptions-Spektroskopie wurde auch eine membrangebundene a-helicale Konformation von IAPP, die durch Wechselwirkung mit der kationischen N-terminalen Region an anionische POPG-Monoschichten verankert ist, nachgewiesen.[29] Der Wechsel von membrangebundenem IAPP von einer anfnglich a-helicalen Konformation zu vernetzten b-Faltblattstrukturen konnte beobachtet werden, indem man ber einen Zeitraum von 15 h die charakteristischen Wellenzahlen fr die a-Helices und b-Faltblattstrukturen verfolgte.[29] 2.2.3. a-Synuclein Die Sequenz von a-Synuclein kann man in drei Hauptregionen unterteilen: 1) Der N-Terminus (Aminosuren 1 60), der an Membranoberflchen unter gleichzeitigem Konformationswechsel zu einer a-helicalen Struktur bindet;[14, 28a,d, 34] 2) die mittlere hydrophobe Region, oder nichtamyloide Komponente (non-amyloid component, NAC), die aus den Aminosuren 6095 besteht und eine hohe Tendenz zur Aggregation in b-Faltblatt-reiche Amyloidfibrillen zeigt; und 3) die saure C-terminale Region (Aminosuren 95140), die stark negativ geladen und unstrukturiert ist (Abbildung 2).[35] Die N-terminale Membranbindungsregion enthlt sieben amphiphile unvollstndige Wiederholungen, die aus elf Aminosuren bestehen, reich sind an Lys und Thr und sich in die NAC-Region ausdehnen (bezeichnet als Hot Spots des
Angew. Chem. 2010, 122, 5760 5788

Abbildung 4. a-Helicale Konformationen von a-Synuclein, gebunden an verschiedene Modellmembranen: a) berlagerung von 20 aus NMR-Messungen abgeleiteten Strukturen von a-Synuclein, gebunden an SDS-Micellen; man erkennt einen ausgefransten C-Terminus (nach Ulmer et al.);[28b] b) gekrmmte a-Helix von vesikelgebundenem a-Synuclein, abgeleitet aus Messungen mit spinmarkierten Sonden;[28a] c) gestreckte a-helicale Konformation von micellgebundenem a-Synuclein (nach Georgieva et al.).[28d]

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5765

Aufstze
kel[34c] oder Bicell-Modellmembranen mit einer flachgedrckten Membranoberflche gebunden war (Abbildung 4 c).[28d] In allen Fllen stand die C-terminale Region jedoch nicht in Kontakt mit der Membran und verblieb unstrukturiert. Gestreckte a-helicale Strukturen von membrangebundenem a-Synuclein reprsentieren eher die Situation in vivo, in der Membranoberflchen eine nur relativ kleine Krmmung haben. Sogar gealterte Proben von aSynuclein, fr die man eine oligomere b-Faltblatt-Konformation erwartet, banden unter Induktion einer a-helicalen Struktur an Vesikel.[38] Ein direkter Beweis fr einen spteren Wechsel zu b-Faltblatt-Aggregaten fehlt bislang fr a-Synuclein. Beschrieben wurde sowohl eine Inhibierung der Fibrillbildung mit PG/PC-Vesikeln[39] als auch eine Verstrkung der Fibrillbildung mit Membranen aus dem Gehirn.[40] Necula et al. berichteten ber die beschleunigte Bildung der a-Synuclein-Fibrillen in Gegenwart von Micellen,[41] die Existenz von helicalen Intermediaten wurde in diesem Fall aber nicht gezeigt.

H. A. Lashuel und S. M. Butterfield

verschiebung der Tryptophan-Markierung in Gegenwart der anionischen Vesikel zeigte das Eindringen des Proteins in die anionischen Liposomen an.[11b] PG enthaltende Vesikel induzierten eine b-Faltblatt-Konformation von Ab40 sowie eine Oligomerisierung des Peptids.[11b] Die Induktion der Fibrillbildung an anionischen Membranen wurde auch mit IAPP[27b,d] und a-Synuclein[34a, 38, 43] beobachtet. Die Bindung von IAPP an anionische Membranen, die PS oder PG enthalten, kann zu einer drastischen Verstrkung der Fibrillbildung fhren.[19, 21, 24, 27d] RntgenReflektometrie offenbarte eine Lipid-induzierte Fibrillnukleation von IAPP in Gegenwart anionischer gemischter DOPC/DOPG-Monoschichten, aber nicht mit reinen zwitterionischen DOPC-Monoschichten.[44] Ein erhhter Anteil anionischer Kopfgruppen in gemischten Vesikeln frdert die Bindung von a-Synuclein-Monomeren[34a, 45] und -Oligomeren.[46] Darber hinaus erhht sich die Tendenz von a-Synuclein zur Zusammenlagerung an der Membranoberflche mit zunehmendem Gehalt der Membran an anionischen Lipiden.[43] Diese Steigerung der Fibrillbildung von a-Synuclein zeigt sich auch in Gegenwart anionischer Micellen.[41] 2.3.2. Gangliosid-Cluster, Cholesterin und Lipid-Rafts An der ueren Membranseite aggregieren Gangliosidlipide mit Sphingomyelin und Cholesterin unter Bildung steifer Mikrodomnen (Lipid-Rafts), die durch eine langsame seitliche Diffusion der Lipid-Acylketten und eine Resistenz gegenber Detergentien charakterisiert sind.[47] Gangliosidlipide sind eine Klasse von Glycolipiden, die eine anionische Sialylsure-Kopfgruppe enthalten und in der Membran neuronaler Zellen verbreitet vorkommen.[48] Der Gehalt an Gangliosid und Chlosterin und die gesamte Fluiditt (geordnet vs. ungeordnet) der Membranen sind wichtige Faktoren, die zum einen der Verankerung amyloidogener Proteine an Membranen dienen und zum anderen auch ihre Fibrillierungsgeschwindigkeiten beeinflussen.[49] ber eine verstrkte Bindung von Ab sowie eine Beschleunigung der Fibrillbildung an Gangliosid enthaltenden Membranen wurde vielfach berichtet.[26a, 42a, 50] Matsuzaki schlug vor, dass Gangliosidcluster auf der Zellmembran Stellen bilden, von denen Ab nach Abspaltung von APP abgesondert wird und die als Keim der Ab-Fibrillbildung dienen (Abbildung 5).[42a] Gesttzt wird diese Hypothese durch den Nachweis von Korrelationen zwischen dem Gangliosidgehalt der Zellmembran und dem Auftreten von Alzheimer.[42a, 51] Gangliosidcluster dienten in jngerer Zeit als Target fr Verbindungen, die an die Membran binden und Ab-Aggre-

2.3. Faktoren, die die membranvermittelte Fibrillbildung beeinflussen In diesem Abschnitt untersuchen wir neueste Ergebnisse zur Beschleunigung der Fibrillbildung von amyloidogenen Proteinen, die bei bestimmten Membranzusammensetzungen und unter bestimmten experimentellen Bedingungen beobachtet wurden. Der Fokus liegt hierbei auf: 1) anionischen Lipiden, 2) Gangliosidclustern, Cholesterin und Lipid-Rafts, 3) dem Einfluss von Metallionen, und 4) der Rolle des Peptid/ Lipid-Verhltnisses. 2.3.1. Anionische Lipide Immer wieder beobachtet man, dass Ab bevorzugt an Membranen mit anionischen Lipidkopfgruppen bindet.[10a, 23, 42] Durch Rntgen- und Neutronenbeugungstechniken konnten Lee und Mitarbeiter zeigen, dass sich Ab40 bevorzugt in anionische DPPG- statt zwitterionische DPPCLipidmonoschichten einlagert.[10a] Nur die DPPG-Monoschichten konnten eine kristalline Ordnung von Ab induzieren, die sich in Beugungsmustern zeigt, die an b-FaltblattAggregate erinnern.[10a] Durch einen Anstieg des pH-Werts auf 7.4, bei dem Ab anionisch wird und daher die anionischen Lipidkopfgruppen abstt, wurde die Wechselwirkung zwischen Ab40 und DPPG jedoch aufgehoben. Die Autoren besttigten auch den Fibrill-Templateffekt der PG-Kopfgruppen durch Inkubation von Ab mit POPC-Vesikeln, die wssriges 30-proz. POPG enthielten, wodurch eine Beschleunigung der Fibrillbildung erzielt wurde. Die Exposition der anionischen Lipide an der ueren Seite der Zellmembranen als Ergebnis von oxidativem Stress knnte ein Auslser der Fibrillogenese in vivo sein. In einem FRET-Assay (FRET = resonanter FrsterEnergietransfer) mit Tryptophan-markiertem Ab40 wiesen Wong und Mitarbeiter einen drastischen Anstieg der Ab40Bindung an DPPC-Vesikel nach Einfhrung von 30 % anionischen DPPG-Kopfgruppen nach.[11b] Eine deutliche Blau-

Abbildung 5. Templateffekt bei der Bildung von Ab-Fibrillen an Gangliosidclustern in Lipid-Rafts.


Angew. Chem. 2010, 122, 5760 5788

5766

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
gen.[56] Weiterhin zeigten Rasterkraftmikroskopie(AFM)Aufnahmen eine merkliche Abnahme der Zahl und Gre der IAPP-Partikel, die nach Einbau von Cholesterin in die Membran an der Oberflche von planaren PC/PS-LipidDoppelschichten akkumuliert waren. Dies deutet darauf hin, dass der Cholesteringehalt der Membran auch die IAPPFibrillogenese beeinflusst.[58] 2.3.3. Der Einfluss von Metallionen In der Substantia Nigra von Parkinsonpatienten hat man erhhte Spiegel an Metallionen gefunden,[59] und in neuronalen Plaques von Alzheimerpatienten waren Cu2+-, Fe3+und Zn2+-Ionen angereichert.[60] Dies deutet darauf hin, dass Metallionen die Aggregation und Toxizitt amyloidogener Proteine beeinflussen knnen.[61] In vitro haben bestimmte Ionen einen Einfluss auf die Strukturen und die Geschwindigkeit der Fibrillbildung amyloidogener Proteine.[62] Zum Beispiel induziert die Zugabe von Metallkationen wie Cu2+, Fe3+ oder Co3+ die Sekundrstruktur von a-Synuclein und beschleunigt signifikant die Fibrillbildung.[63] Untersuchungen in vitro haben gezeigt, dass Metallionen ferner die Wechselwirkung zwischen Amyloidproteinen und Membranen vermitteln knnen. Interessanterweise fhrt die Zugabe von Ca2+- und anderen Schwermetallionen zu monomerem a-Synuclein zur schnellen Produktion von annularen Poren aus oligomerem a-Synuclein mit unterschiedlichen Durchmessern.[6, 64] Am C-Terminus verkrzte Varianten von a-Synuclein nahmen jedoch keine annularen Strukturen ein, was darauf hindeutet, dass die Bindung von Metallkationen durch Wechselwirkungen mit dem sauren C-Terminus vermittelt wird. Da annulare Oligomere als mgliche toxische Spezies mit Membranen als Angriffsort diskutiert werden,[7, 12b, 65] knnten erhhte Konzentrationen an Metallkationen toxische Wechselwirkungen zwischen a-SynucleinOligomeren und Membranen stimulieren. Tatschlich induzierte Fe3+ detergensresistente oligomere Strukturen von aSynuclein.[66] Ebenso wurde die Zusammenlagerung von aSynuclein auf der Oberflche anionischer POPG/PC-Doppelschichten in Gegenwart zweiwertiger Metallkationen erleichtert.[43] Mglicherweise vermitteln Metallkationen die Wechselwirkung des anionischen C-Terminus von a-Synuclein mit anionischen Membranen durch partielle Ladungsneutralisation der Membran oder durch die Bildung koordinativer Brcken. Frhere Studien zeigten, dass Zn2+- und Cu2+-Ionen die Insertion von Ab42 in POPC/POPS-Vesikel bei einem pHWert von 5.57.5 induzieren, mit der entsprechenden Induktion einer a-helicalen Struktur.[55] Ohne Metallkationen konnte Ab42 die Membran nur bei einem pH unterhalb 5.5 penetrieren, was darauf hinweist, dass eine erhhte positive Ladung in Ab42, entweder durch ein Absenken des pHWertes oder die Komplexierung mit Metallkationen, die Bindung von Ab42 an Membranen verstrkt. Vor kurzem fand man durch 31P- und 2H-Festphasen-NMR-Messungen heraus, dass Cu2+-Ionen allein die Modellmembranen zerstren und die Bildung kleinerer Vesikel induzieren.[67] Zugabe von Ab42 zum System schtzte die Membran vor einer Zerstrung durch Cu2+, mglicherweise durch Ausspwww.angewandte.de

Chemie

gation an ihrer Oberflche und die damit verbundenen toxischen Effekte auf PC12-Zellen hemmen.[52] Die Bindung von Ab an Gangliosid enthaltende Membranen induziert einen bergang von einer Random-CoilStruktur zu einer a-Helix bei niedrigen Peptid/Lipid-Verhltnissen ( 0.025) und begnstigt bei hheren Peptid/LipidVerhltnissen (! 0.05) eine b-Faltblatt-Konformation, die dann die Fibrillbildung auslst (Abbildung 5).[26a] Inkubation von Ab40 mit Monogangliosid GM1 im molaren Verhltnis 1:1 induziert die b-Faltblatt-Bildung und Aggregation des Peptids nach 12 h.[26a] Unter denselben Bedingungen, aber in Abwesenheit von GM1 verbleibt Ab monomer und unstrukturiert. Interessanterweise zeigen die Fibrillen von Ab40, die in Gegenwart von GM1 gebildet wurden, eine hhere Cytotoxizitt auf PC12-Zellen als solche ohne GM1, und sie offenbaren im Transmissionselektronenmikroskop (TEM) ausgeprgte morphologische Eigenschaften.[26a] Dies legt nahe, dass Ganglioside mit Ab unter Bildung strukturell einzigartiger fibrillrer Strukturen mit erhhter Cytotoxizitt wechselwirken. Auch bekannt ist die beschleunigte b-FaltblattBildung und Aggregation in Gegenwart von Raft-hnlichen Liposomen, die GM1, Cholesterin und Sphingomyelin enthalten.[50] Die resultierenden Ab-Fasern haben eine einzigartige strukturelle Morphologie und eine erhhte Cytotoxizitt.[50] Die Existenz von GM1 in einer Raft-hnlichen Membranumgebung ist essentiell fr die Bildung der Ab-Fibrillen, da keine Induktion der b-Faltblatt-Aggregate mit Raft-hnlichen Sphingomyelin/Cholesterin-Liposomen in Abwesenheit weder von GM1 noch gemischter GM1/PC-Liposomen beobachtet werden konnte. Die Akkumulation von IAPP-Amyloidablagerungen auf Membranen, die Gangliosid-reiche Domnen enthalten, wurde durch Fluoreszenzbildgebung gezeigt.[53] Eine direkte Korrelation zwischen der Menge der IAPP-Fibrillen, die sich auf der Membran ablagern, und dem Gangliosidgehalt in der Membran legt nahe, dass ein hoher Gangliosidgehalt in vivo die IAPP-Fibrillbildung stimuliert.[53] Auch Prionproteine zeigen eine klare Prferenz dafr, an GM1/Cholesterin/ Sphingomyelin enthaltende Vesikel als monomere a-Helices zu binden, was nahelegt, dass Lipid-Rafts auch bei der Verankerung von Prionproteinen an Membranen eine Rolle spielen.[54] Im Gegensatz zur Akkumulation von Ab, IAPP und Prionproteinen auf geordneten Lipid-Raft-Domnen bevorzugt a-Synuclein eine Lokalisierung auf flssig-ungeordneten Phasen in anionischen Vesikeln.[45, 46] Es wurde vorgeschlagen, dass die grere Packungsdichte anionischer Kopfgruppen auf der Oberflche flssig-ungeordneter Phasen in LipidRafts den negativ geladenen C-Terminus des a-Synucleins abstt.[46] Widersprchliche Ergebnisse haben gezeigt, dass Cholesterin das Eindringen von Ab40 in Modell-Liposomen entweder inhibieren[55] oder begnstigen[56] kann, je nach molarem Anteil des Cholesterins in der Membran. In Neuroblastomzellen unterdrckt die Anreicherung von Cholesterin in Lipid-Raft-Domnen die Assoziation von Ab42-Oligomeren an der Zelloberflche.[57] Diese Befunde legen nahe, dass ein spezifischer Anteil an Cholesterin in den Lipid-Rafts ntig ist, um die Oberflchenbindung von Ab zu begnstiAngew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5767

Aufstze
len der Kationen durch Koordination.[67, 68] Ab42-Cu2+-Komplexe konnten mit der Oberflche anionischer Phospholipidmembranen assoziieren, wie mittels 31P-NMR-Spektroskopie nachgewiesen wurde.[67a] 2.3.4. Der Einfluss des Lipid/Peptid-Verhltnisses Eine gemeinsame Eigenschaft von Ab,[11b, 50, 69] [21, 27a,b] [28ac, 34c, 38] IAPP und a-Synuclein ist die Umwandlung einer weitgehend ungefalteten Konformation in eine a-Helix bei Bindung an die Membran, was einen allgemeinen Mechanismus der membranvermittelten Fehlfaltung und Aggregation dieser und anderer amyloidbildender Proteine nahelegt. Nach der anfnglichen Bindung an die Membran hngt die Fehlfaltung amyloidbildender Proteine zu b-Faltblatt-Aggregaten wesentlich von den relativen Konzentrationen der Proteine und Lipide ab.[11b, 27b] Arbeiten von Wong und Mitarbeitern zeigen, dass die Zugabe steigender Mengen von POPC/PG- oder DPPC/PG-Vesikeln einen Wechsel der Konformation von membrangebundenem Ab40 von einer bFaltblatt- zu einer a-helicalen Struktur bewirkt. Dies fhrte zu einem sehr reizvollen mechanistischen Modell, das die relative Peptid/Lipid-Konzentration mit der membrangebundenen Struktur des Proteins in Beziehung setzt.[11b] Bei einem niedrigen Peptid/Lipid-Verhltnis (hohem LipidGehalt) schirmt die Adsorption von Amyloidproteinen an die Membranoberflche Protein-Protein-Wechselwirkungen effektiv ab und erschwert somit die Fibrillogenese. In diesem Fall dominiert die a-helicale Konformation des membrangebundenen Proteins (Abbildung 6). Durch Erhhung der

H. A. Lashuel und S. M. Butterfield

bran kann also je nach Peptid/Lipid-Verhltnis bei hohen relativen Konzentrationen die Fibrillogenese entweder hemmen oder bei niedrigen oder mittleren Konzentrationen die Fibrillogenese beschleunigen. Dieses mechanistische Phnomen beobachtet man bei Ab[10a, 11b, 26c, 50] und IAPP[21] bei Kontakt mit anionischen Membranen, und es entspricht frheren Beschreibungen von Wechselwirkungen zwischen antimikrobiellen Peptiden und Membranen.[70, 71] Zum Beispiel hat Ab bei einer konstanten Peptidkonzentration eine a-helicale Struktur in Gegenwart von DPC-Micellen (20 mm ) und eine b-Faltblatt-Struktur in Gegenwart von DPC-Micellen (5.5 mm ).[26c]

2.4. Die Umkehr der Amyloidfibrillbildung mit Lipiden Ein bemerkenswerter Befund von Rosseau und Mitarbeitern war, dass DOPC-Liposomen reife und inerte Ab42Amyloidfibrillen in lsliche toxische protofibrillre Spezies zerlegen und somit den zur Fibrillogenese reversen Prozess induzieren.[72] Die biophysikalischen und toxikologischen Eigenschaften der Protofibrillen, die durch die reverse Reaktion erhalten wurden, waren identisch mit denen von Protofibrillen, die durch Alterung von monomerem Ab42 erhalten wurden. Dieser Befund wird besttigt durch Widenbrant und Mitarbeiter, die Ab-Fibrillen in Gegenwart von DOPA-Membranen in kleine Nano-Verbnde fragmentierten.[73] Diese Ergebnisse stehen im Gegensatz zu den vielzhligen anderen Berichten, die eine Beschleunigung der Fibrillbildung an Membranoberflchen belegen, allerdings ist zu bedenken, dass diese Untersuchungen zum Einfluss der Membranen auf den Vorwrts-Prozess der Fibrillbildung mit lslichen, monomeren Protein-Zubereitungen durchgefhrt wurden. Rosseau et al. geben eines der wenigen Beispiele fr die Untersuchung des Einflusses von Lipiden auf den reversen Prozess, indem sie entwickelte Fibrillen als Ausgangspunkt verwendeten. Beide Arten von Studien stimmen darin berein, dass sie die Fhigkeit der Lipide demonstrieren, amyloidogene Proteine in toxische, lsliche Aggregate zu berfhren egal ob anfnglich lsliche Monomere oder unlsliche reife Amyloidfibrillen vorliegen , und sie unterstreichen die Bedeutung der Membranen fr die Aggregation und Toxizitt amyloidogener Proteine.

3. Mechanismen der amyloidvermittelten Membranpermeabilisierung


Die Toxizitt amyloidbildender Proteine ist direkt korreliert mit ihrer Fhigkeit, die Funktion der Membranbarriere zu unterbrechen. Die ursprngliche Entdeckung von Arispe und Mitarbeitern, dass Ab Ionenkanal-Aktivitt in planaren Lipid-Doppelschichten besitzt, fhrte zu der Annahme, dass die Toxizitt von Ab in einem Ionenkanal-Mechanismus begrndet ist, der eine Membrandepolarisation, das Ausstrmen von Ca2+ und die Strung der Ionenhomostase zur Folge hat.[8, 12eg, 74] Kanal-Aktivitt wurde spter auch fr andere amyloidogene Proteine, darunter IAPP,[74c] aSynuclein,[11a, 65, 75] Polyglutamin[76] und von Prionen abgeleiAngew. Chem. 2010, 122, 5760 5788

Abbildung 6. Einfluss des Peptid/Lipid-Verhltnisses auf die Geschwindigkeit der Fibrillbildung (nach Wong et al.).[11b]

relativen Peptidkonzentration erreicht man schlielich ein kritisches Peptid/Lipid-Verhltnis, und ein crowding des Proteins an der Membranoberflche stimuliert Protein-Protein-Wechselwirkungen, einen Wechsel zur b-FaltblattStruktur und das Fibrillwachstum (Abbildung 6). Die Mem-

5768

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
3.1. Porenbildung kontra unspezifische Membranpermeabilisierung Die derzeitige Debatte bezglich des Mechanismus der Membranpermeabilisierung durch amyloidbildende Proteine rankt sich um deren Fhigkeit zur Bildung von Membrankanlen oder -poren. Die vorliegenden experimentellen Befunde, z. B. von Ionenkanal-Aktivitt, sttzen die Annahme eines ber porenartige Strukturen verlaufenden Mechanismus und der toxischen Eigenschaften amyloidbildender Proteine (Schema 1). Alternativ dazu gibt es auch signifikante experimentelle Daten, die belegen, dass oligomere Formen dieser Proteine an die Membranoberflche binden und eine allgemeine Ausdnnung der Membran und damit das Ausstrmen von Ionen bewirken (Schema 1). Neueste Experimente, die beide Modelle sttzen, werden neben zentralen lteren Arbeiten vorgestellt. 3.1.1. Hinweise fr eine Porenbildung Experimentelle Beobachtungen, die sich mit dem Porenmodell in Einklang bringen lassen, sind: 1) Die Induktion einzelner Ionenkanalstrme, die charakteristisch sind fr Ionenkanle oder porenbildende Proteine, durch eine Reihe von amyloidogenen Proteinen in Modellmembranen;[7b, 8a, 12e, 65, 77a] 2) die verglichen mit lslichen Monomeren und reifen Fibrillen erhhte Membranpermeabilisierungsaktivitt amyloider Oligomere;[4a, 11a, 38, 65, 75, 84] 3) die Blockade der Kanalaktivitt amyloider Oligomere mittels Aggregationsinhibitoren wie ()-Epigallocatechingallat;[65, 85] 4) eine Grenabhngigkeit des Ausstrmens von Farbstoffen aus Modellvesikelmembranen, was auf die Bildung von Poren definierten Duchmessers hinweist;[11a, 75, 86] 5) hochaufgelste Aufnahmen annularer porenartiger oligomerer Strukturen mehrerer amyloidogener Proteine, sowohl in Gegenwart von Membranen als auch ohne Membranen;[7, 8, 12b] 6) die Bindung des anti-amyloiden Oligomer-Antikrpers A11 an amyloide Oligomere und an Oligomere porenbildender Toxine wie aHmolysin mit daraus resultierender Unterdrckung der Membranpermeabilisierungsaktivitt.[4a, 87] Die Details dieser Beobachtungen werden in den folgenden Abstzen behandelt. Die Fhigkeit einer Reihe amyloidbildender Proteine wie Ab,[12f,g, 88] a-Synuclein,[7b, 65, 89] IAPP,[74c] Polyglutamin,[76] Serumamyloid A[7b] und der Prionenproteine,[12e, 77, 90] Ionenkanalstrme mit definierten Leitfhigkeitszustnden in planaren Lipid-Doppelschichten zu induzieren, liefert den stichhaltigen Beweis, dass diese Proteine eine Kanal- oder Porenaktivitt in Membranen aufweisen.[7b] In vielen Fllen zeigen diese amyloidbildenden Proteine Spannungsabhngigkeit und Kationenselektivitt, was charakteristische Eigenschaften echter Ionenkanle sind.[91] Bei Ab fhren experimentelle Bedingungen, die eine Peptidaggregation frdern, z. B. ein saurer pH-Wert, zu einer erhhten Kanalaktivitt, whrend die Zugabe von Stoffen, die die Aggregation hemmen, z. B. Kongorot, die Kanalaktivitt abschwcht.[12e, 74d] Dies weist darauf hin, dass die durch Ab gebildeten Kanalstrukturen oligomer sind. Die Kanalaktivitt von Ab konnte durch externe Stoffe wie Tris (Tris(hydroxymethyl)aminowww.angewandte.de

Chemie

tete Peptide[77] nachgewiesen. Dies legt nahe, dass die Toxizitt dieser Proteine mit ihrer Fhigkeit zur Bildung von Kanlen oder Poren zusammenhngt, wodurch ein unreguliertes Ausstrmen von Ionen analog zu den porenbildenden Toxinen mglich ist (Schema 1).[7b, 12a,e] Diese Hypothese ist konsistent mit der Tatsache, dass eine Strung der Homostase der Ca2+-Ionen ein charakteristisches Merkmal verschiedener neurodegenerativer Krankheiten ist, darunter Alzheimer und Parkinson.[78] Gestrkt wurde die Amyloidporen-Hypothese durch die direkte Visualisierung annularer oder ringhnlicher Strukturen oligomerer Protofibrillen verschiedener amyloidogener Proteine durch Elektronen- und Rasterkraftmikroskopie (AFM).[7, 8, 12b,c, 79] Auch wenn der strende Einfluss amyloidogener Proteine auf Membranen offensichtlich geworden ist, sind die exakten Mechanismen, ber die diese Proteine die Membranpermeabilisierung induzieren, bisher noch nicht vollstndig verstanden. Die Amyloidporen-Hypothese ist ein vorgeschlagener Mechanismus, aber auch andere Theorien werden durch experimentelle Daten untermauert. Zum Beispiel fhren verschiedene Argumentationslinien experimentelle Beweise gegen das Poren-Modell an und sprechen fr die Theorie, dass prfibrillre Aggregate die Membran nicht vollstndig durchdringen, sondern eher mit der Membranoberflche assoziieren und so eine Verdnnung und Leckage der Membran hervorrufen (Schema 1).[4a,b, 80] Darber hinaus ist nicht gesagt, dass dem Poren-Modell eine statische Struktur zugrunde liegt. Vielmehr knnte es sich um einen Zwischenzustand handeln, auf den weitere Prozesse wie eine Tensidartige Auflsung der Membran folgen.[13b,c, 81] Solche intermediren Porenstrukturen charakterisieren den Wirkmechanismus vieler antimikrobieller Peptide und knnen auch mit der Aktivitt amyloidogener Proteine in Beziehung gebracht werden.[71, 82] In der Tat gibt es viele chemische hnlichkeiten zwischen amyloidogenen Proteinen und antimikrobiellen Peptiden, z. B. die amphipathische Struktur, die darauf hinweisen, dass man mechanistische Einblicke aus den fr den Permeabilierungsmechanismus antimikrobieller Peptide vorgeschlagenen Modellen ableiten kann. Neben der Reihe mglicher Wirkmechanismen wird der Sachverhalt weiter verkompliziert durch das Auftreten membranaktiver oligomerer Zustnde der amyloidogenen Proteine. Demnach ist der Prozess der Fibrillbildung mit mehreren Zwischenzustnden verbunden, die alle unterschiedliche Membranpermeabilisierungsaktivitten haben knnten.[83] Der Wirkmechanismus kann weiterhin auch vom Proteintyp, der Membranzusammensetzung und den experimentellen Bedingungen abhngen. Um auf molekularer Ebene die Toxizitt amyloidbedingter Krankheiten vollstndig verstehen zu knnen, mssen diese mechanistischen berlegungen beschrieben werden. In diesem Abschnitt wollen wir daher einen berblick geben ber die verschiedenen diskutierten Modelle der Membranpermeabilisierung durch amyloidbildende Proteine und, falls vorhanden, die neuesten experimentellen Absicherungen der vorgeschlagenen Mechanismen vorstellen.

Angew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5769

Aufstze
methan), Al3+,[12f] Zn2+[74b] oder andere bestimmte Molekle[92] blockiert werden, was Mglichkeiten fr eine therapeutische Intervention bezglich der Porenaktivitt aufzeigt. Viele dieser frheren Ionenkanalexperimente wurden jedoch mit monomeren Prparaten oder rekonstituierten Proteinen in schlecht definierten heterogenen oligomeren Zustnden durchgefhrt. Vor kurzem konnte gezeigt werden, dass die Zugabe definierter oligomerer Prparate von a-Synuclein Ionenkanalaktivitt in PC-Monoschichten induziert (Abbildung 7 a).[65]

H. A. Lashuel und S. M. Butterfield

Abbildung 7. a) Leitfhigkeit in planaren Lipid-Doppelschichten in Gegenwart oligomerer Prparate von a-Synuclein (nach Kim et al.).[65] b) AFM-Aufnahmen von oligomeren Strukturen von Ab(140) und aSynuclein nach Rekonstitution in planaren DOPC-Lipid-Doppelschichten (nach Quist et al.).[7b] c) EM-Aufnahmen der protofibrillren pathogenen Mutanten A53T und A30P von a-Synuclein und der arktischen Mutante Ab(140) (nach Lashuel et al.).[12b] d) EM-Aufnahmen der aSynuclein-Poren, die durch Einwirkung von Detergentien auf Einschlsse aus atrophierten Gehirnproben freigesetzt wurden (nach Pountney et al.).[94]

Eine Ionenkanal-hnliche Leitfhigkeit ist spezifisch fr das oligomere Prparat und wurde mit monomeren und fibrillren Prparaten von a-Synuclein nicht beobachtet.[65] Eine in diesem System durch oligomeres a-Synuclein induzierte Kanalaktivitt konnte mit dem Polyphenol ()-Epigallocatechingallat (aus grnem Tee) effektiv inhibiert werden.[65] Neuere Untersuchungen zeigen, dass eine Membranpermeabilisierung mit oligomeren Prparationen von Ab mit Disacchariden und Trimethylamin-N-oxid also Verbindungen, die auch die Aggregation von Ab abschwchen effektiv gehemmt werden kann.[85] Vesikelpermeabilisierungsassays mit prfibrillren Aggregaten aus a-Synuclein,[75] IAPP[84a, 86] und Ab[85] lieferten weitere Hinweise darauf, dass Membranpermeabilisierung

durch diese Proteine ber einen porenartigen Mechanismus erfolgt. Nur oligomeres protofibrillres a-Synuclein, und nicht die monomeren oder fibrillren Formen, band an und permeabilisierte PG- und PC-Vesikel.[11a] Die mit den Krankheitsbildern in Verbindung gebrachten a-SynucleinMutanten A30P und A53T zeigten auerdem hhere Permeabilisierungsaktivitten als der Wildtyp, was darauf hindeutet, dass die Permeabilisierungsaktivitt mit der Toxizitt des Proteins direkt korreliert.[75] Ebenso fhrten toxische oligomere und nicht-amyloide nativ-hnliche Fibrillen des Hefeprions Ure2p, aber nicht die nicht-toxischen Amyloidfibrillen des Proteins, zur Freisetzung von Farbstoffen aus PS-Vesikeln.[84b] Fr protofibrillres a-Synuclein wurde auf der Grundlage der Grenabhngigkeit der Farbstoff-Leckage aus Farbstoffbeladenen Vesikeln ein ber porenartige Strukturen verlaufender Mechanismus vorgeschlagen. Kleinere Komponenten wie Ca2+ und Dopamin zeigten in Gegenwart des Proteins weitaus hhere Leckage-Geschwindigkeiten als groe Polymere wie FITC-Dextran und Cytochrom c.[75] In gleicher Weise war die Leckage von Ca2+ aus PG-Vesikeln, die durch protofibrillres IAPP permeabilisiert waren, viel schneller als die von FITC-Dextran, was ebenso fr eine Leckage durch definierte Poren begrenzten Durchmessers spricht.[86] Die optische Beobachtung oligomerer Kanalstrukturen von in Lipid-Doppelschichten rekonstituierten amyloidogenen Proteinen mittels Rasterkraftmikroskopie ist einer der bedeutendsten experimentellen Beweise fr einen Porenmechanismus.[7b, 8a] Die ersten AFM-Aufnahmen von in DOPCLipid-Doppelschichten rekonstituierten tetrameren bis hexameren Oligomeren von Ab(142) lieferten Lal und Mitarbeiter.[8a] Im Jahr 2005 berichtete dieselbe Gruppe ber hnliche oligomere Kanle fr eine Reihe in DOPC-Doppelschichten rekonstituierter amyloidbildender Proteine, darunter a-Synuclein, IAPP, Ab(140) und Serumamyloid A. Dies weist darauf hin, dass die Porenaktivitt ein allgemeines Charakteristikum ist, das die Toxizitt amyloidbildender Proteine untermauert.[7b] In ungefhr 15 % der Aufnahmen ist zu sehen, dass die rekonstituierten Proteine multimere supramolekulare Komplexe aus vier bis sechs Untereinheiten mit einem ueren Durchmesser von 810 nm und einem inneren Porendurchmesser von 12 nm bilden (Abbildung 7 b).[7b] Lashuel und Lansbury zeigten, dass isolierte Protofibrillen mutierter amyloidbildender Proteine, die mit familirem Alzheimer oder Parkinson in Verbindung gebracht werden, darunter die arktische Ab(140)-Mutante, a-SynA30P und a-SynA53T sowie Wildtyp-a-Synuclein, auch in Abwesenheit einer Lipid-Doppelschicht annulare Porenstrukturen bilden.[12b,c] Die Porenabmessungen waren in exzellenter bereinstimmung mit denen von Quist und Lal publizierten; die ueren Porendurchmesser lagen zwischen 7 und 10 nm und die inneren Durchmesser zwischen 1.5 und 2 nm (Abbildung 7 c). AFM-Aufnahmen zeigten auch Poren, die durch das amyloidogene Prionproteinfragment PrP106 126 in gesttzten Lipid-Doppelschichten hervorgerufen wurden, hier wurde jedoch der innere Porendurchmesser nicht publiziert.[93] Annulare Strukturen wurden auch aus post mortem entnommenen Proben isoliert; sie zeigen eine auffallende morAngew. Chem. 2010, 122, 5760 5788

5770

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
Die Summe dieser allgemeinen Eigenschaften sttzt fast unbestreitbar die Annahme, dass Amyloid-Oligomere die Membranpermeabilisierung ber eine aktive Struktur und einen Mechanismus induzieren, die den Strukturen und Wirkungsweisen entsprechen, die man fr PFTs und PFPs annimmt. Mechanistische Fragestellungen bezglich der Aktivitt amyloidogener Proteine auf Membranen knnen mittels biophysikalischer Methoden und mechanistischer Assays untersucht werden, die auch hilfreich waren bei der Untersuchung der Wirkungsweise von PFPs und verwandten antimikrobiellen Peptiden gegenber Modellmembranen (siehe Abschnitt 4). 3.1.2. Dreidimensionale Modelle oligomerer Poren Die optische Beobachtung der topologischen Eigenschaften oligomerer Poren erbrachte wichtige Schlussfolgerungen bezglich des Mechanismus der Membranpermeabilisierung durch amyloidbildende Proteine jedoch konnten dreidimensionale Strukturen auf atomarer Ebene bisher experimentell nicht bestimmt werden. Die Forschung auf diesem Gebiet wird behindert durch die inhrente Lslichkeit und Nicht-Kristallinitt amyloider Proteine, Faktoren, die beim Einbringen in Membranumgebungen noch verschrft werden. Darber hinaus sind wohldefinierte Strukturen amyloidbildender Proteine inhrent kurzlebig und schwer zu isolieren und charakterisieren.[65] Nichtsdestotrotz wurden dreidimensionale Porenmodelle rechnergesttzt konstruiert und lieferten Einblicke in mgliche Konformationen. Durch computergesttzte Modellierung des per NMR-Spektroskopie erhaltenen b-Faltblatt-Turn-b-Faltblatt-Motivs von Ab1742 zu annularen scheibenhnlichen Strukturen konnten Nussinov und Mitarbeiter ein Modell fr die Ab-Pore entwickeln, deren Abmessungen in auffallend guter bereinstimmung mit den Ergebnissen von AFM- und EM-Studien sind (Abbildung 8).[98] Nach Insertion dieser Scheiben aus Ab1742 in eine DOPC-Doppelschicht, bei der der hydrophobe C-terminale Strang an die Doppelschicht ankoppelt, zeigten MDSimulationen eine Relaxation der Porenstrukturen zu Untereinheiten analog zu den per AFM dargestellten Einheiten (Abbildungen 7 b und 8 a).[98] Die inneren Porenabmessungen waren ein wenig grer als die der AFM-Proben (2.2 2.5 nm), dafr waren die ueren Durchmesser in sehr guter bereinstimmung, und die Hhe entsprach genau der Dicke einer DOPC-Doppelschicht, was diese Modelle als annehmbare dreidimensionale Beschreibungen erscheinen lsst.[98] Man sollte anmerken, dass der N-Terminus von Ab vermutlich nicht an der Kanalstruktur beteiligt ist und sich von der Membran wegstreckt. In einem anderen Modell des AbKanals, das auf Perutz Rntgenbeugungsmodell von Polyglutaminfasern beruht, werden tubulre Anordnungen aus zylindrisch gewundenen monomeren Ab-Untereinheiten, die linear gestapelt sind und die Breite der Doppelschicht umspannen, angenommen.[99] Dieses Modell sagt auch einen wassergefllten Kanal von 1.5 nm Durchmesser voraus. Molecular Modeling der helicalen Struktur von a-Synuclein offenbarte eine Kopf-Kopf-Anordnung von dimeren aSynuclein-Untereinheiten, die sich zu ringartigen Hexameren und Pentameren anordnen und mit der per EM bestimmten www.angewandte.de

Chemie

phologische hnlichkeit zu Porenstrukturen, die in vitro bei rekombinanten und synthetischen Amyloidproteinen beobachtet wurden, was nahelegt, dass diese Strukturen obligate Intermediate sind, die in vivo auftreten. Sogar grere annulare Partikel aus a-Synuclein-Oligomeren mit einem Durchmesser zwischen 30 und 50 nm wurden durch Einwirkung von Detergentien auf cytoplasmatische Einschlsse in atrophierten Gehirnproben post mortem erhalten (Abbildung 7 d).[6, 94] Inoue beobachtete mittels TEM Porenstrukturen von Ab in neuronalen Zellmembranen und Mitochondrien-artigen Organellen aus dem Hirngewebe von Alzheimer-Patienten. Diese Poren waren also grer als die in vitro beobachteten; sie hatten einen ueren Durchmesser von 16 nm und Porenffnungen von 10 nm.[95] Die berraschend hnlichen Morphologien oligomerer amyloidbildender Proteine sowohl in Gegenwart einer Membran als auch ohne Membran, sowie der Proteine, die aus In-vivo-Proben extrahiert wurden, gaben einen klaren Hinweis darauf, dass diese Konformationen veranwortlich sind entweder fr die direkte Insertion in die Membranen oder die Bildung auf der Membranoberflche, um die zellulre Toxizitt in amyloidbedingten Krankheiten zu induzieren (Schema 1). Seitdem es akzeptiert ist, dass amyloidbildende Polypeptide beliebiger Sequenz durch ihre Tendenz zur Aggregation zu unlslichen Fasern hherer Ordnung mit gemeinsamen morphologischen und strukturellen Eigenschaften miteinander in Verbindung gebracht werden knnen, ist es auch begrndet anzunehmen, dass sie eine hnliche Tendenz zur Bildung verwandter intermedirer Strukturen wie z. B. oligomerer Poren, die die Zellmembranen angreifen, gemeinsam haben. Neuere Arbeiten zeigen, dass gewhnliche oligomere Strukturen, die die cytotoxischen Konformationen amyloidbildender Proteine darstellen knnten, auch von anderen porenbildenden Toxinen (pore-forming toxins, PFTs) und porenbildenden Proteinen (pore-forming proteins, PFPs) eingenommen werden. Amyloidbildende Proteine und PFTs, darunter a-Hmolysin und Anthraxtoxin, haben mehrere auffallende strukturelle und funktionelle Eigenschaften gemeinsam, was einen hnlichen Mechanismus der Membranpermeabilisierung impliziert.[7a, 87] Die ringfrmige Konfiguration amyloidbildender Proteine, die in der AFM und EM beobachtet wird, hnelt sehr der Konfiguration von PFPs wie Perforin und Perfringolysin O.[87, 96] Zustzlich haben porenbildende und amyloidbildende Proteine die Eigenschaft gemeinsam, als lsliche Proteine gebildet zu werden, die spter in zirkulre toxische oligomere, oft b-Faltblatt-reiche transmembrane Poren berfhrt werden.[96] Der Prozess der Oligomerisierung, der die Kanalbildung begnstigt, wird in beiden Proteinklassen durch Lipid-Rafts beschleunigt, die als Anreicherungsplattform fungieren (Abbildung 5).[97] Der konformationsspezifische, gegen Amyloid-Oligomere gerichtete Antikrper A11, der unabhngig von ihrer Primrsequenz an Amyloid-Oligomere bindet, reagiert auch mit Oligomeren aber nicht Monomeren von a-Hmolysin und humanem Perforin.[87] Darber hinaus unterdrckt eine Bindung an A11, von der man wei, dass sie die Toxizitt und Membranpermeabilisierungsaktivitt von Amyloid-Oligomeren inhibiert, auch die hmolytische Aktivitt von a-Hmolysin-Oligomeren.[87]
Angew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5771

Aufstze

H. A. Lashuel und S. M. Butterfield Aktivitt.[4a] Whrend dieser Befund klar die Annahme sttzt, dass oligomere Formen amyloidbildender Proteine die membranpermeabilisierende Spezies sind, spricht er gegen die Amyloidkanal-Hypothese. Vor kurzem zeigten Sokolov et al., dass gereinigte Zubereitungen von Ab-Oligomeren, die sich mit Antioligomer-Antikrpern positiv anfrben lieen, ebenfalls einen allgemeinen konzentrationsabhngigen Anstieg der Leitfhigkeit von Modellmembranen hervorriefen, wenn sie der Doppelschicht extern zugegeben wurden.[4b] Diese Berichte sichern ein Modell ab, wonach Amyloidoligomere an die Membranoberflche binden und die Lipidzusammenlagerung stren und so eine Verdnnung der Membran und erhhte Membran-Leckage verursachen, ohne dass eine Bildung definierter Poren auftritt (Schema 1).[4b] 3.1.4. HFIP bringt Klarheit: Das Porenmodell setzt sich durch Der Grund fr die Unstimmigkeiten bezglich der Ionenkanal-Aktivitt amyloidbildender Proteine war einige Zeit Gegenstand der Debatte. Ionenkanal-Aktivitt wurde beobachtet, wenn Proteine mit der Membran unter Bildung von Proteoliposomen fusioniert wurden. In den Fllen, in denen ein allgemeiner Anstieg der Membranleitfhigkeit beobachtet wurde, waren Zubereitungen des vorgebildeten oligomeren Proteins extern der Doppelschicht zugegeben worden.[4a,b, 80b] Eine Erklrung war, dass die Proteoliposomen, die durch Ultraschallbehandlung gebildet werden, die Kanalbildung verstrken und dass die Insertion der extern zugegebenen Oligomere in die Membran gehindert sein knnte, sodass lediglich eine Bindung an die Oberflche resultiert.[80a] Ein jngster Bericht zeigt nun jedoch, dass das Fehlen diskreter Ionenkanalleitfhigkeitsmuster ein Artefakt der Membranpermeabilisierung durch Reste von Hexafluorisopropylalkohol (HFIP) ist, der bei der Zubereitung der vorgebildeten Oligomere verwendet wird und die eigentliche Ionenkanal-Aktivitt amyloidbildender Proteine maskiert.[12d] In dieser Arbeit zeigten Capone und Mitarbeiter, dass HFIP-Proben sowohl mit als auch ohne Ab identische Stromspuren ohne definierte Leitfhigkeitszustnde zeigen, was darauf hinweist, dass der beobachtete Strom durch HFIP allein induziert wurde. Bemerkenswerterweise konnte durch sorgfltiges Entfernen von HFIP aus den Proben von oligomerem Ab (durch Splen mit Stickstoff) der schrittweise Ionenfluss durch planere Lipid-Doppelschichten, der charakteristisch ist fr Ionenkanal-Aktivitt, vollstndig wiederhergestellt werden.[12d] Damit kann das Porenmodell fr die Strung der Membranintegritt durch Proteinoligomere als experimentell belegt gelten.

Abbildung 8. Computermodelle a) der oligomeren Ab-Pore (nach Jang et al.)[98] und b) des oligomeren a-Synuclein-Kanals, berlagert mit der von Lashuel et al.[12b] bestimmten Porenstruktur (nach Tsigelny et al.).[100]

Porenstruktur in Deckung gebracht werden knnen (Abbildung 8 b).[12b,c, 100] 3.1.3. Nachweis der unspezifischen Membranpermeabilisierung Trotz zahlreicher Berichte ber die Ionenkanal-Aktivitt mit definierten offenen und geschlossenen Leitfhigkeitszustnden,[7b, 12e, 101] die charakteristische Eigenschaften von Ionenkanlen und Porentoxinen sind,[91] sowie der Bestimmung gut aufgelster Porenstrukturen fr Amyloid-Oligomere (Abbildung 7) konnte ein Nachweis der Ionenkanal-Aktivitt nicht in jedem Labor reproduziert werden.[80a] Wegweisende Arbeiten von Glabe und Mitarbeitern zeigten, dass vorgebildete lsliche Oligomere aus Ab, IAPP, Polyglutamin oder Prion 106126 aber keine Monomere oder ausgereifte Fibrillen die allgemeine Leitfhigkeit der Modell-Doppelschichten deutlich erhhen, und das ohne das Auftreten diskreter Leitfhigkeitsnderungen oder offener und geschlossener Zustnde, die charakteristisch sind fr eine Ionenkanal-

3.2. Welche oligomeren Formen sind fr die Membranzersetzung zustndig? Wie in den voranstehenden Abschnitten beschrieben, zeigen oligomere und protofibrillre Formen amyloidbildender Proteine in Untersuchungen mit Modellsystemen eine hhere Membranpermeabilisierungsaktivitt als die enstprechenden fibrillren oder niedermolekularen Varianten, was darauf hindeutet, dass diese erstgenannten Formen die primr
Angew. Chem. 2010, 122, 5760 5788

5772

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
zur Membraninsertion. Vorgebildete Poren aus a-Hmolysin konnten ebenso kein Eindringen in die Membran induzieren,[103] was einen hnlichen Mechanismus nahelegt.

Chemie

toxischen Spezies sind.[4a, 11a, 75, 86] Bisher nur wenig verstanden ist jedoch das unterschiedliche Ausma an Membranpermeabilisierungsaktivitt der verschiedenen oligomeren Spezies, die vom Monomer bis hin zu den ausgebildeten Fibrillen reichen. Die Zahl mglicher oligomerer Zustnde fr amyloidbildende Proteine, die vom Dimer bis hin zu den vollstndig ausgebildeten Fibrillen in der Grenordnung von 106 Dalton reichen, sowie die verschiedenen Morphologien der intermediren Aggregate[83] machen die Identifizierung einer membranaktiven Spezies mit definiertem oligomerem Zustand und Konformation zu einer gewaltigen Aufgabe. Es wurden erhebliche Forschungsanstrengungen unternommen, um die strukturellen Typen von Amyloid-Oligomeren auf der Basis ihrer verschiedenen Immunaktivitten mit konformationsspezifischen Antikrpern zu klassifizieren.[83] Prfibrillre Oligomere (PFOs), die im Test gegen den oligomergerichteten Antikrper A11 positiv sind, sind sphrische Partikel mit Durchmessern von 3 bis 10 nm, die sich zu einem frhen Zeitpunkt der Inkubation bilden. Bei lngeren Inkubationszeiten oder unter Katalyse mit einer Hydrophob/hydrophil-Grenzflche, lagern sich PFOs zu annularen Protofibrillen (APFs) um,[102] von denen man annimmt, dass sie zirkulre Formen von PFO-Untereinheiten sind. Sie zeigen unter dem Elektronenmikroskop porenartige Morphologien (Abbildung 7).[12b] APFs frben mit aAPF-Antikrpern stark und mit A11-Antikrpern schwach an, was fr eine abweichende Morphologie zu den PFOs spricht. Heptamere Poren aus a-Hmolysin frben ebenso mit aAPF an, was nahelegt, dass APFs eine b-Barrel-Konformation einnehmen. Fibrillre Oligomere sind eine andere Klasse oligomerer Intermediate, die nicht an A11-Antikrper binden, aber eine positive Bindung an OC-Antikrper zeigen und sich somit strukturell von PFOs unterscheiden.[83] Da OC-Antikrper auch fr ausgebildete Fibrillen spezifisch sind, nimmt man an, dass fibrillre Oligomere kleine Stcke von Fibrillen darstellen oder wie Fibrillkeime wirken, die das Fibrillwachstum einleiten.[83] Die morphologische hnlichkeit zwischen APFs und PFTs legt instinktiv nahe, dass APFs die oligomere Form amyloidogener Proteine sind, die die Membranpermeabilisierung verursachen. Weiterhin verstrken familir auftretende Mutationen, die zur vererbten Form von Parkinson und Alzheimer fhren, die Population von AFPs, weswegen man vermuten sollte, dass diese oligomeren Formen die primr toxische Spezies sind.[12b] berraschenderweise berichteten jedoch Glabe und Mitarbeiter, dass PFOs von Ab42 und aSynuclein eine viel grere Membranpermeabilisierungsaktivitt zeigen als ihre entsprechenden APFs in planaren LipidDoppelschichten.[102] Modellmembranen beschleunigten jedoch den Konformationswechsel von PFOs zu APFs, was durch Immunreaktion mit A11 und aAPF festgestellt wurde.[102] Die Autoren schlugen vor, dass PFOs an die Membran binden und dass der Schlsselschritt das Zusammenlagern von APFs aus PFOs auf der Membran ist. Dieser Schlsselschritt ist mit der Membranpermeabilisierung assoziiert, und es ist derjenige Prozess, der AFP ermglicht, eine in die Membran eingebettete Pore mit bBarrel-Konformation zu bilden. Im Gegensatz dazu fehlt vorgebildeten APFs in Lsung eine ausreichende Fhigkeit
Angew. Chem. 2010, 122, 5760 5788

3.3. Mechanistische Einblicke durch Studien an antimikrobiellen Peptiden Die Mechanismen, die die Membranpermeabilisierungsaktivitt antimikrobieller Peptide steuern und die ber rein auf Porenbildung beruhende Mechanismen hinausgehen, knnen auch fr die Aufklrung der membranaktiven Strukturen amyloidogener Proteine relevant sein.[70, 71] Tatschlich teilen antimikrobielle Peptide und amyloidbildende Proteine viele Charakteristika, was nahelegt, dass sie ber hnliche Mechanismen auf die Membran wirken. Zum Beispiel haben beide Klassen von Polypeptiden die Fhigkeit, amphipathische Strukturen mit hydrophoben und kationisch hydrophilen Enden anzunehmen und zeigen erhhte Affinitten fr negativ geladene Membranoberflchen.[42a, 70] Darber hinaus ndern Ab,[11b, 26bd] IAPP[27c, 32, 33] und a-Synuclein[8d, 28a, 34a,b] ihre Struktur von einer Random-Coil-Struktur zu einer a-Helix bei erstem Kontakt mit Membranoberflchen, was die konformativen Wechsel antimikrobieller Peptide in Gegenwart von Membranen widerspiegelt (Schema 1).[71b] Sowohl fr antimikrobielle Peptide als auch fr amyloidogene Proteine wird fr die Induktion der oligomeren membranpermeabilisierenden Spezies eine Schwellenkonzentration an Peptid an der Membranoberflche bentigt (Schema 1).[11b, 71b] Bemerkenswerterweise wandeln sich membrangebundene oligomere Spezies bestimmter antimikrobieller Peptide, wie z. B. der Temporine B und L, sogar weiter zu amyloidartigen Fibrillen um.[104] Auch wenn ber den Mechanismus, mit dem antimikrobielle Peptide auf Membranen einwirken, noch diskutiert wird und viele Fragen offen sind, stehen doch relativ viele experimentelle Daten zur Verfgung, aus denen eine Reihe klassischer Aktivittsmodelle abgeleitet wurden. In den folgenden Abschnitten werden wir diese mechanistischen Modelle kurz vorstellen, die den Wirkmechanismus antimikrobieller Peptide, porenbildender Toxine und konstruierter amphipathischer permeabilisierender Peptide auf Membranen erklren; dies geschieht in der Hoffnung, anhand dieser Modelle ein wenig Licht auf die Membranaktivitt amyloidogener Proteine werfen zu knnen.[71, 81] Wenn die Anreicherung permeabilisierender Peptide auf der Membran eine kritische lokale Grenzkonzentration erreicht, bilden sich oligomere Spezies, die eine transmembrane Pore bilden, fr die zwei strukturelle Anordnungen vorgeschlagen wurden. In einer Barrel-Stave(Fassdauben)-Pore berhren die hydrophoben Regionen des Peptid-Oligomers das hydrophobe Membraninnere, und die hydrophilen Enden kleiden eine wassergefllte Pore aus. Bei diesem Porentyp rhren Variationen in der Leitfhigkeit von einem Monomeraustausch mit dem transmembranen Oligomer her (Abbildung 9 a).[71a] Barrel-Stave-Poren stren die Membranarchitektur nur minimal, erzeugen aber rtlich fixierte Lcher, durch die Molekle in die oder aus der Membran lecken.[97] Alternativ dazu gibt es eine toroidale Porenwww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5773

Aufstze

H. A. Lashuel und S. M. Butterfield

Membranstrungen schlieen sich wahrscheinlich an (Abbildung 9 b). Im folgenden Abschnitt stellen wir Daten verschiedener Arbeitsgruppen vor, die belegen, dass auch fr IAPP und mglicherweise auch andere amyloidogene Proteine ein Tensid-artiger Mechanismus gltig ist.

3.4. Sind Fibrillbildung an Membranoberflchen und Membranpermeabilisierung konzertierte Prozesse? Ein Tensid-Modell zur Membranpermeabilisierung In vielen Fllen, in denen Lipidmembranen die Fehlfaltung von Amyloidproteinen in b-Faltblatt-Aggregate begnstigen, wird auch eine entsprechende Strung der Membranstruktur beobachtet.[10a, 11b, 106] Derartige Ergebnisse zeigen, dass diese scheinbar separat verlaufenden Prozesse kooperativ und energetisch gekoppelt sind. Ein neueres und berzeugendes Modell zur Amyloidprotein-bedingten Toxizitt verknpft direkt die Amyloid-Aggregation auf Membranoberflchen unter Zerstrung der Zellmembran mit der Entstehung von Toxizitt.[13a, 107] Mit anderen Worten: Wenn sich die Fibrille auf der Membranoberflche entwickelt, wird gleichzeitig die strukturelle Integritt der Membran beeintrchtigt. In einer eleganten Untersuchung konnten Engel und Mitarbeiter zeigen, dass die kinetischen Profile fr das Wachstum von hIAPP-Fibrillen, das mittels Fluoreszenz von Thioflavin T (ThT) verfolgt wurde, und fr die Induktion eines Farbstoff-Leckage aus co-inkubierten gemischten DOPC/DOPS-Vesikeln bereinstimmen (Abbildung 10 a).[13a] Beide Profile sind charakterisiert durch eine Latenzphase von etwa 3 h Dauer, der sich ein sigmoider Verlauf entsprechend der Bildung von hIAPP-Fibrillen und ein nahezu kompletter Farbstoff-Ausstrom aus dem Vesikel anschliet. Dieses Ergebnis belegt, dass es der Prozess der Fibrillbildung auf den Membranoberflchen ist, der die Barrierefunktion der Membran beseitigt. Kryo-TEM-Aufnahmen von groen unilamellaren Vesikeln (large unilamellar vesicles, LUVs) aus DOPC/DOPS, die mit humanem IAPP (hIAPP) co-inkubiert wurden, zeigten eine Strung und Quetschung von Membranregionen, die in Kontakt mit den Fibrillen waren (Abbildung 10 b), wohingegen Vesikel, die in Gegenwart von nicht-amyloidogenem Maus-IAPP (mIAPP) inkubiert wurden, intakt blieben.[13a] Als mechanistisches Modell schlugen die Autoren vor, dass das Wachstum von IAPP-Fibrillen auf der Membran begleitend auftritt mit einem erzwungenen Wechsel der Membrankrmmung und geschwchter Lipidpackung, wodurch es zu einem Ausstrmen des intravesikulren Inhalts kommt (Abbildung 10 b). Interessanterweise ist diese Ansicht konsistent mit Toxizittsuntersuchungen, die gezeigt haben, dass es kein spezifischer oligomerer Zustand ist, der Zelltod und Toxizitt hervorruft, sondern vielmehr der dynamische Prozess der Fibrillbildung.[108] Neuere Ergebnisse liefern berzeugende Hinweise darauf, dass IAPP auf Membranoberflchen durch die Extraktion und den Einbau von Lipiden in die sich entwickelnden Fasern die Membran zersetzt.[13b,c] Mit Rhodaminmarkierten Lipiden in riesigen unilamellaren Vesikeln (giant
Angew. Chem. 2010, 122, 5760 5788

Abbildung 9. a) Modell der Barrel-Stave- und toroidalen Poren; b) zweidimensionale Darstellungen des Sinking-Raft- und CarpetModells der Membranpermeabilisierung.

struktur, bei der die hydrophilen Enden des Peptids mit den Lipidkopfgruppen in Kontakt bleiben, wodurch eine Verkrmmung der Membran hervorgerufen wird und eine Pore erzeugt wird, die mit Lipidkopfgruppen und Peptiden ausgekleidet ist, wodurch die Passage von Moleklen durch die Membran ermglicht wird (Abbildung 9 a). Von der toroidalen Pore nimmt man an, dass sie eine metastabile Struktur ist und nach einem von zwei denkbaren Mechanismen zerfllt. Im Sinking-Raft-Modell zerfllt die Pore unter Bildung einer wiederverschlossenen Doppelschicht mit Peptiden auf der inneren und ueren Membranseite (Abbildung 9 b).[81] Alternativ dazu zerfllt die Membran im Carpet-Modell unter Bildung von tensidischen Peptid-Lipid-Aggregaten (Abbildung 9 b).[82] Neuere Daten zeigen, dass insbesondere IAPP ber toroidale Porenintermediate wirkt. Dynamische Differenzkalorimetrie (DSC) und Festphasen-NMR-Experimente zeigen, dass IAPP eine schwerwiegende Krmmungsspannung bei Modellmembranen hervorruft, was bezeichnend ist fr toroidale Porenstrukturen.[105] Der Einbau der membranzerstrenden IAPP-Fragmente (hIAPP137, hIAPP119 und Ratten-IAPP119 (rIAPP119)) in DiPoPE-Lipid-Doppelschichten fhrte gem DSC zu einer Abnahme der bergangstemperatur von der flssig-kristallinen (La) in die invers hexagonale (HII) Phase, was dafr spricht, dass die Peptide eine negative Krmmungsspannung in der Membran induzieren.[105] Das nicht-membranpermeabilisierende Peptid rIAPP137 hatte einen schwachen Einfluss auf die Stabilitt der HII-Phase. Weiterhin offenbarten 31P-Verschiebungen die bevorzugte Bindung der permeabilisierenden IAPP-Peptide an stark gekrmmte Regionen von Modell-Bicellen, die statische Mimetika der in toroidalen Porenintermediaten erzeugten Membranperforationen darstellen.[105] Wenn ein toroidales Porenmodell fr IAPP gltig ist, ist es wahrscheinlich keine statische Struktur, und andere Mechanismen fr

5774

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte

Chemie

Abbildung 11. Konfokale Fluoreszenzmikroskopie von GUVs, die mit hIAPP co-inkubiert wurden. Zu sehen ist die Aufnahme von Rhodaminmarkierten Lipiden in die wachsenden Peptidfibrillen, die letztendlich zur Zerstrung des Vesikels fhrt: a) GUVs vor der Zugabe von hIAPP (Carboxyfluorescein wurde dem extravesikulren Lsungsmittel zugegeben, um die intakte Barrierefunktion des Vesikels zu zeigen), b) 2 3 min nach Zugabe von hIAPP und c) 10 min nach Zugabe von hIAPP (nach Sparr et al.).[13b] Skalenbalken 25 mm.

Abbildung 10. Fibrillwachstum an der Membranoberflche induziert Membranpermeabilisierung. a) Das kinetische Profil der hIAPP-Fibrillbildung, die mittels ThT-Fluoreszenz verfolgt wurde (oben), stimmt mit dem Profil des hIAPP-induzierten Farbstoff-Ausflusses aus gemischten DOPC/DOPS-Vesikeln (unten) berein; b) Kryo-EM-Aufnahmen der hIAPP-Fibrillen im Kontakt mit gekrmmten Vesikeln (Nach Engel et al.).[13a]

unilamellar vesicles, GUVs) aus DOPC konnte die Aufnahme fluoreszierender Lipide in co-inkubierte wachsende IAPPFibrillen mittels konfokaler Fluoreszenzmikroskopie visualisiert werden (Abbildung 11).[13b] Nach nur 10 min Inkubation war eine vollstndige Membranzerstrung sichtbar (Abbildung 11 c). In hnlicher Weise konnte mit BODIPY-markiertem PC in einer gesttzten, trgerfixierten Lipid-Doppelschicht die Extraktion und Aufnahme fluoreszierender Lipide in die wachsenden IAPP-Fasern mittels konfokaler Mikroskopie nach 25 h Inkubation visualisiert werden.[13c] Nach 20 h Inkubation waren die fluoreszierenden Lipide vollstndig in die entwickelten IAPP-Fibrillen inkorporiert. Ein FRET zwischen Faser-gebundenem ThT und BODIPYPC belegte eine enge Assoziation der extrahierten Lipide und der fertigen Faser. Die Aufnahme von Rhodamin-markierten Lipiden, die aus Modell-Lipid-Rafts durch BODIPY-markierte IAPP-Fasern gewonnen wurden, wurde ebenfalls mittels Fluoreszenzmikroskopie beobachtet.[109] Die extrahierten
Angew. Chem. 2010, 122, 5760 5788

Membranfraktionen verliehen der Faser thermodynamische Stabilitt, mglicherweise durch elektrostatische Interaktionen mit freiliegenden positiv geladenen IAPP-Seitenketten oder durch die Bereitstellung einer physikalischen Barriere fr den proteolytischen Abbau der sich entwickelnden Fasern in vivo.[13c] Die Ergebnisse widersprechen nicht dem beobachteten Zusammenhang zwischen Fibrillbildung auf Membranoberflchen und Membranzerstrung, und sie sttzen die Annahme, dass die wachsende IAPP-Faser nach einem Tensidhnlichen Mechanismus agiert, nmlich durch Lipid-Extraktion und Auflsung der Doppelschicht im Gegensatz zu bloem Quetschen der Membranoberflche.[21] Membranverzerrungen knnen mechanistisch jedoch der Lipidaufnahme vorangehen. Kombiniert man die Beweise fr eine Tensid-artige Aktivitt von IAPP mit denen fr die Induktion toroidaler Porenstrukturen, kann man annehmen, dass IAPP dem Carpet-Modell der Membranpermeabilisierung folgt (Abbildung 9 b). Die Strukturanalogien zwischen IAPP und Ab[110] legen nahe, dass Ab nach einem hnlichen Mechanismus auf Membranen wirkt. Tatschlich zeigen TEM-Aufnahmen gemischter POPC/POPG-Vesikel, die mit Ab co-inkubiert wurden, den Einbau von Lipidvesikeln in das fertige Fibrill-Netzwerk.[10a] Im Widerspruch zu den oben erwhnten Argumenten berichteten Ramamoorthy und Mitarbeiter, dass das membranbindende N-terminale Fragment 119 von humanem IAPP, dem das amyloidogene Fragment 2029 fehlt und das keine Fibrillen bildet, einen Farbstoff-Ausfluss aus POPGVesikeln im selben Ausma induziert wie die volle Sequenz.[33b] Zustzlich konnte Ratten-IAPP, das keine Fibrillen bildet, in signifikantem Ausma Membranen permeabilisieren.[27b] Die Autoren folgerten, dass die Fibrillbildung kein notwendiger Faktor der Membranzerstrung ist und dass diese zwei Prozesse nach unterschiedlichen Mechanismen ablaufen.

4. Membranmodelle und experimentelle Methoden zur Untersuchung der Mechanismen der Proteininduzierten Membranpermeabilisierung
4.1. Biologische Membranen kontra Modellmembranen Natrliche Zellmembranen sind komplexe Strukturen, die aus einer Lipid-Doppelschicht mit eingelagerten globuwww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5775

Aufstze

H. A. Lashuel und S. M. Butterfield

Abbildung 12. Membranmodellsysteme als Derivate natrlicher Zellmembranen: a) Darstellung einer Zellmembran; b) Vesikel oder Liposom; c) Micelle; d) Bicelle; e) gesttzte Lipid-Monoschicht; f) selbstorganisierte Lipid-Monoschicht an der Luft-Wasser-Grenzschicht; g) gebundene gesttzte Lipid-Doppelschicht; h) planare Lipid-Doppelschicht.

lren Proteinen, Rezeptoren, transmembranen Kanlen und Glycoproteinen sowie variierenden fluiden Regionen bestehen (Abbildung 12).[111] Ihre strukturelle Komplexitt ist ein Spiegelbild ihrer mannigfaltigen Funktionen, zu denen die Kommunikation zwischen intra- und extrazellulren Kompartimenten und der selektive Molekltransport in die und aus der Zelle gehren. In Anbetracht der Komplexitt biologischer Membranen sind viele Wissenschaftler auf die Verwendung strukturell und bezglich der Zusammensetzung vereinfachter Membranmodellsysteme angewiesen. Diese Systeme bieten die Mglichkeit, die chemische Zusammensetzung und Fluiditt der Membran systematisch zu verndern und die daraus resultierenden Vernderungen von Proteinbindung und Permeabilisierungsaktivitt zu verfolgen.[112] Der Unterschied zwischen Modellmembranen und biologischen Membranen liegt im Wesentlichen in ihrer Komplexitt: Modellmembranen fehlen Bestandteile wie integrale Membranproteine und Polysaccharide, die die experimentellen Ergebnisse und deren Interpretation strend beeinflussen knnen.[112] Modellmembranen sind daher die bevorzugten Systeme, um den Einfluss von Proteinen speziell auf lipidische Membranbestandteile in einer systematisch kontrollierten Weise zu untersuchen. Der Hauptnachteil von Modellmembranen ist, dass das Gesamtbild der komplexen Ordnung biochemischer Prozesse, die die Proteinaktivitt beeinflussen, bei der alleinigen Verwendung von Modellsystemen nicht eingefangen werden kann. Modellsysteme bieten die Mglichkeit, sich auf ausgewhlte Protein-Membran-Wechselwirkungen und Schlsselschritte

im Mechanismus zu konzentrieren, die der biologischen Aktivitt zugrunde liegen. Indem man jedoch die Interpretation experimenteller Beobachtungen und die Entwicklung mechanistischer Modelle vereinfacht, knnen neue Hypothesen spter in komplexeren biologischen Umgebungen getestet werden. Im folgenden Abschnitt stellen wir die verschiedenen Typen verfgbarer Membranmodellsysteme vor, die von zentraler Bedeutung fr ein mechanistisches Verstndnis amyloidogener Proteine und anderer membranpermeabilisierender Proteine wie antimikrobieller Peptide oder porenbildender Toxine waren. Bezglich komplexerer Modelle verweisen wir auf einen aktuellen bersichtsartikel von Chan et al.[113]

4.2. Klassen von Membranmodellsystemen 4.2.1. Vesikel, Micellen und Bicellen Vesikel (Liposomen) sind wassergefllte sphrische Lipid-Doppelschichten, die verschiedene Durchmesser haben knnen (Abbildung 12 b). Man unterscheidet drei Arten von Vesikeln: 1) kleine unilamellare Vesikel (SUVs) mit Durchmessern von 2050 nm, 2) groe unilamellare Vesikel (LUVs) mit Duchmessern von etwa 100 nm und 3) sehr groe unilamellare Vesikel (GUVs) mit Durchmessern von 110 mm (Abbildung 12 b).[112b, 113] Der Begriff unilamellar bezeichnet die Tatsache, dass die Vesikel aus einer einzigen Doppelschicht bestehen. Mit ihrer sphrischen Form und ihrem wassergefllten Inneren geht man davon aus, dass Vesikel die
Angew. Chem. 2010, 122, 5760 5788

5776

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
4.2.2. Lipid-Monoschichten Eine Lipid-Monoschicht ist vielleicht die einfachste Nachahmung der Auenseite einer biologischen Membran. Eine planare gesttzte Lipid-Monoschicht wird hergestellt durch die Verteilung kleiner, unilamellarer Vesikel auf einer selbstorganisierten Monoschicht, die auf einem festen Trger verankert ist, z. B. einer Goldoberflche (Abbildung 12 e).[119] Auf diese Weise stehen die hydrophoben Schwanzgruppen der Lipidketten in Kontakt mit der Oberflche und die polaren Lipid-Kopfgruppen zeigen in die wssrige Phase hinein (Abbildung 12 e). Die Adsorption oder Insertion membranbindender Peptide an gesttzte Lipid-Monoschichten kann mit Techniken wie SPR (Oberflchenplasmonenresonanz; surface plasmon resonance) oder AFM direkt verfolgt werden.[119] Durch AFM-Aufnahmen einer POPC/POPSLipid-Monoschicht auf einer Goldoberflche wurden z. B. nderungen oder Defekte in der Struktur der Monoschicht nach Behandlung mit Wildtyp-a-Synuclein charakterisiert.[120] Eine Lipid-Monoschicht kann auch an der Luft-WasserPhasengrenze in einem Langmuir-Blodgett-Trog konstruiert werden. In diesem System ragen die hydrophilen Kopfgruppen in die Wasserphase und die hydrophoben Gruppen in die Luft (Abbildung 12 f).[121] Messungen des Oberflchendrucks von DOPC/DOPS-Lipid-Monoschichten an der Luft-WasserGrenzflche liefern einen Grenwert fr die MembranLipid-Packung und wurden genutzt, um die bevorzugte Membraninsertion von IAPP-Monomeren gegenber entwickelten Fibrillen zu untersuchen.[122] Zustzlich wurden Monoschichten aus Glycolipidlactosylceramid verwendet, um das zur Glycolipid-Bindung bentigte minimale IAPP-Fragment festzustellen.[123] Rntgenbeugungs- und Neutronenreflexionsexperimente mit Lipid-Monoschichten an der LuftWasser-Grenzflche ermglichten vor kurzem die Charakterisierung von nderungen in der Schichtdicke und der Membranpenetration in Gegenwart von in die wssrige Phase injiziertem Ab.[10a] 4.2.3. Modell-Lipid-Doppelschichten Gesttzte Lipid-Doppelschichten werden durch Langmuir-Transfer oder Vesikel-Fusion auf einer geeigneten Oberflche hergestellt.[124, 125] Um zu vermeiden, dass die feste Oberflche mit den Membraneigenschaften interferiert, werden hufig polymere Trger oder chemische Abstandhalter (tether) zur Verankerung der Lipid-Doppelschicht auf der festen Oberflche verwendet (Abbildung 12 g). Die Doppelschicht kann auch ber ein markiertes Membranprotein angebunden werden. Neue bersichtsartikel geben einen berblick ber Methoden sowie Vor- und Nachteile verschiedener Strategien zur Herstellung gesttzter Lipid-Doppelschichten.[124, 25] Die Art der Oberflche richtet sich nach der technischen Anwendung. Goldoberflchen verwendet man in SPR oder Ionenkanal-Aktivittsmessungen,[126] whrend Glimmer, Silicium oder flaches Gold bei AFM-Messungen Anwendung finden.[127] In einer neueren Untersuchung wird ber ein per AFM abgebildetes Wachstum von Ab2635-Fasern parallel zu Glimmer-gesttzten POPC-LipidDoppelschichten berichtet.[128] Gesttzte Lipid-Doppelwww.angewandte.de

Chemie

biologisch relevantesten Mimetika natrlicher Zellmembranen sind. Fr Details zur Vesikelherstellung verweisen wir auf einen aktuellen bersichtsartikel.[112b] Die Mglichkeit zur Einfhrung von Farbstoffen in das Vesikelinnere macht insbesondere LUVs zu einem beliebten Instrument fr die Untersuchung der peptidinduzierten Membranpermeabilisierung mittels Farbstoffleckage-Assays, die im folgenden Abschnitt beschrieben werden. SUVs gelten als weniger attraktive Systeme, da ihre hohe Krmmung Strukturspannungen und hohe Hintergrund-Leckagen verursacht. Zur Untersuchung von Peptid-Membran-Wechselwirkungen mit Fluoreszenzmethoden wie FRET knnen auch eine Vielfalt fluoreszenzmarkierter Kopfgruppen eingefhrt werden.[73, 114] Die physikalische Beobachtung von SUVs und LUVs erfordert Elektronenmikroskopie-Techniken wie Kryo-EM, wohingegen GUVs bereits durch Lichtmikroskopie charakterisiert werden knnen.[46, 115] Der Nachweis der Bindung von TAMRA-markiertem a-Synuclein speziell an Oberflchen anionischer GUVs, die mit fluoreszierenden NBD-Kopfgruppen markiert waren, gelang durch bildgebende Fluoreszenzverfahren.[45] Micellen sind relativ kleine Tensid- oder Lipid-Aggregate mit Durchmessern von etwa 5 nm, die sich oberhalb einer kritischen Micellbildungskonzentration (CMC) des amphiphilen Tensids bilden (Abbildung 12 c). Sie wurden verwendet als Modell fr die Wechselwirkung von Ab mit einer Zellmembran in vitro[69] und fr die Bestimmung der Struktur von micellgebundenem Ab,[26bd, 31a] a-Synuclein,[28b, 36b] IAPP[32, 116] und antimikrobiellen Peptiden[117] mittels NMRSpektroskopie. Im Unterschied zum wssrigen Milieu im Inneren von Vesikeln befinden sich im Innenraum von Micellen die Kohlenwasserstoff-Schwanzgruppen des Tensids (Abbildung 12 c). Ein potentieller Nachteil ist, dass die hohe Krmmung der Micellen eine unnatrlich gekrmmte Sekundrstruktur der micellgebundenen Proteine und Peptide bewirken kann. Zum Beispiel nimmt LUV-gebundenes aSynuclein eine gestreckte a-Helix-Konformation ein,[28a, 34c] whrend micellgebundenes a-Synuclein eine Helix-TurnHelix-Konformation hat, die wahrscheinlich an die stark gekrmmte Membranoberflche angepasst ist (Abbildung 4).[28b] Man geht davon aus, dass die gestreckte helicale Konformation membrangebundenes a-Synuclein im Assoziat mit relativ flachen synaptischen Vesikeln prziser reprsentiert. Die hohe Krmmung von Micellen kann reduziert werden, indem Tenside und Phospholipide in einem bestimmten molaren Verhltnis gemischt werden, sodass die Bildung von Bicellen resultiert. Bicellen (DoppelschichtMicellen) sind scheibenfrmige Strukturen mit flachen lamellaren Oberflchen und Bereichen hoher Krmmung (Abbildung 12 d), und sie sind daher eine genauere Nachahmung der Membranoberflche in vivo. In der Tat nimmt bicellgebundenes a-Synuclein eine gestreckte a-Helix-Konformation ein, wie durch ESR-Abstandsmessungen bestimmt wurde (Abbildung 4).[28d] Darber hinaus richten sich Bicellen spontan in Gegenwart eines ueren magnetischen Feldes aus, was zu scharf aufgelsten Signalen in ihren NMR-Spektren fhrt.[105] Infolgedessen fanden Bicellen Anwendung in NMR-Untersuchungen von membranbindenden und amyloidbildenden Proteinen,[118] darunter IAPP.[105]
Angew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5777

Aufstze
schichten wurden auch als Modellsysteme zur Untersuchung der IAPP-Fibrillbildung[13c] und a-Synuclein-Aggregation an Membranoberflchen mittels Fluoreszenzmikroskopie verwendet.[43] Planare Lipid-Doppelschichten, die man auch als schwarze Lipid-Membranen bezeichnet, sind eines der ltesten Membranmodellsysteme[129] und dienen als Standardsysteme zur Durchfhrung von Einzel- oder Mehrkanal-Ionenleitfhigkeits- und Ionenselektivittsexperimenten.[4b] In einem typischen experimentellen Aufbau fr Leitfhigkeitsmessungen werden zwei Kammern mit elektrolythaltigem Puffer befllt und durch die Lipid-Doppelschicht getrennt, die sich in einem mikrometerlangen Durchlass in einem hydrophoben Film z. B. aus Teflon befindet (Abbildung 12 h).[129] Eine Ionenkanal- oder porenbildende Probe wird typischerweise in die Membran ber die cis-Kammer eingebracht, und der durch den Kanal flieende Strom wird als Funktion der Zeit in Reaktion auf die angelegte Spannung aufgezeichnet. Das ffnen und Schlieen eines einzelnen Kanals kann typischerweise in Echtzeit als ein An- bzw. Abschalten des Stromes beobachtet werden. Ionenkanal-Messungen in planaren Lipid-Doppelschichten wurden zur Bestimmung der Ionenkanal-Aktivitt von a-Synuclein,[65, 66, 89] Ab,[7b, 88] Polyglutamin und von Prionen abgeleiteten Polypeptiden verwendet.[7b, 76]

H. A. Lashuel und S. M. Butterfield

selwirkung zwischen amyloidogenen Proteinen und Membranen verbessern. 4.3.1. Beschleunigt die Bindung eines Proteins/Peptids an die Membranoberflche seine Aggregation? Eine Vielfalt an Techniken kann verwendet werden, um die membranvermittelte Katalyse der Fibrillogenese nachzuweisen, darunter bildgebende Verfahren (AFM und TEM), die Bindung an Amyloid-spezifische Farbstoffe oder Methoden zur Beobachtung von nderungen der Proteingre (z. B. Gelelektrophorese, Grenausschlusschromatographie und Lichtstreuung). In-situ-AFM wurde krzlich genutzt, um das Wachstum von Ab2635-Fibrillen auf gesttzten POPC-Lipid-Doppelschichten parallel zur Membranoberflche abzubilden.[128] Die Visualisierung der Fibrillbildung nach Inkubation von Amyloidproteinen in Gegenwart von Lipidmembranen gelingt auch mittels TEM.[69] Mithilfe von TEM konnte auch die beschleunigte Fibrillbildung von Ab(140) in Gegenwart von Gangliosid-Modellmembranen gezeigt werden.[26a] Umgekehrt wurde in einer anderen Untersuchung die Spaltung von Ab(140)-Fibrillen in kleinere lsliche Oligomere in Gegenwart einer Lipid-Monoschicht nachgewiesen.[73] Die beschleunigte Bildung von Proteinaggregaten oder Fibrillen durch Membranen kann leicht durch Fluoreszenzverstrkung des amyloidspezifischen Farbstoffs Thioflavin-T (ThT) detektiert werden.[130] Eine beschleunigte Aggregation von Ab(140) in Gegenwart von Gangliosiden[26a, 50, 106] sowie DPPG enthaltenden Vesikeln[11b] und SDS-Micellen[69] konnte mit dieser Technik nachgewiesen werden. Die membraninduzierte Oligomerisierung von Amyloidproteinen konnte auch durch Gelelektrophorese beobachtet werden. Nach Inkubation der Amyloidproteine in Gegenwart oder bei Fehlen einer Membran wurden die Amyloidproteine mit Glutaraldehyd vernetzt, um die dominanten oligomeren Zustnde zur Analyse durch denaturierende SDS-PAGE kovalent zu fixieren. Amyloidproteine, darunter a-Synuclein und Ab, bilden Oligomere hherer Ordnung nach Rekonstitution und Extraktion aus DOPC-Liposomen mittels Gelelektrophorese.[7b] 4.3.2. Detektion der Membranpermeabilisierung/-strung Die Strung der strukturellen Integritt von ModellLipid-Doppelschichten in Gegenwart eines Proteins ist ein erster Indikator einer toxischen Wirkung. Der Einbau spektroskopischer Sonden entweder in das Vesikelinnere oder in die Lipidschichten selbst erffnet eine Reihe an Wegen, die Schwchung der Membranstruktur indirekt zu untersuchen. Andere Methoden sind Kalorimetrie oder direkte Bildgebung der Membran durch Fluoreszenzmikroskopie und KryoElektronenmikroskopie. Auch wenn einige dieser Methoden angepasst werden knnen, um detailliertere Informationen zum Mechanismus zu erhalten (siehe folgende Abschnitte), eignen sich die hier vorgestellten nur zur Detektion allgemeiner Membran-Destabilisierung, knnen aber keine strukturellen und mechanistischen Details des Prozesses liefern.
Angew. Chem. 2010, 122, 5760 5788

4.3. Mechanistische Fragen: experimentelle Anstze In diesem Abschnitt erlutern wir, wie die oben diskutierten Modellsysteme mit biophysikalischen Methoden untersucht werden knnen, um die mechanistischen Schlsselfragen bezglich der Aktivitt amyloidogener Proteine auf Membranen zu beantworten. Die biophysikalischen Methoden werden in einer logischen Reihenfolge vorgestellt, beginnend mit Methoden zum Nachweis von Proteinaggregation auf Membranoberflchen und von allgemeinen Membranstrungen, gefolgt von Methoden, die auf strukturelle Details des toxischen Protein-Membran-Komplexes abzielen (z. B. Bildung transmembraner Poren, Porengre und -struktur). Mit bestimmten Methoden lassen sich Membranintegritt und strukturelle Eigenschaften untersuchen, andere dienen der Beobachtung von nderungen in der Proteinstruktur. Anhand ausgewhlter Beispiele demonstrieren wir den Nutzen der Methoden zur Klrung mechanistischer Aspekte von membranaktiven Proteinen und Peptiden. Durch viele der vorgestellten Methoden wurden bereits grundlegende Informationen bezglich der membranpermeabilisierenden Aktivitt amyloidogener Proteine gewonnen. Fr Techniken, die bisher noch nicht zur Untersuchung amyloidogener Proteine angewendet wurden, werden wir aufzeigen, wie diese Methoden zum Verstndnis der molekularen Mechanismen beigetragen haben, nach denen antimikrobielle Peptide, porenbildende Toxine und andere membrandurchdringende Peptide auf die Membranen einwirken. Angesichts der strukturellen und mechanistischen hnlichkeiten, die amyloidogene Proteine mit porenbildenden Toxinen und antimikrobiellen Peptiden verbinden, wird die Anwendung letzterer Techniken sicher unser Verstndnis ber die Wech-

5778

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
hohen Konzentrationen im Versikelinneren beladen (Abbildung 13). Farbstoff-Leckage aus dem Vesikelinneren als Folge peptidinduzierter Membranpermeabilisierung fhrt dann zur Wiederherstellung der Fluoreszenz im extravesikulren Puffer.[133] Die Komplexierung von Kationen durch fluoreszierende Farbstoffe ist eine andere gngige Methode zur Detektion von protein- oder peptidvermittelter Vesikelpermeabilisierung. Der Tb3+/DPA-Assay beruht auf der Bildung eines stark fluoreszierenden Ligand-Rezeptor-Komplexes zwischen Terbiumkationen (Tb3+) und Dipicolinsure (DPA).[81, 131] Das Vesikel wird entweder mit Tb3+ oder DPA beladen, und der entsprechende Partner wird an die Vesikeloberflche gebunden, sodass die komplexierenden Spezies durch die Doppelschicht vollstndig getrennt sind. Bei einer peptidinduzierten Permeabilisierung wird dann Tb3+ und/ oder DPA die Membran passieren, und es kommt zur Bildung eines stark fluoreszierenden Komplexes, der eine Vesikelpermeabilisierung anzeigt. In hnlicher Weise detektieren mit Fura-2 beladene Vesikel Membranpermeabilisierungen durch die Bildung eines stark fluoreszierenden Komplexes mit extravesikulrem Ca2+.[11a, 75] Andere Farbstoffe wie Arsenazo III und Pyrocatechol-Violett reagieren auf eine Membranpermeabilisierung nach Bindung extravesikulrer Kationen wie Cu2+ oder Ca2+ mit einer Farbnderung der Lsung.[132] Diese Assays bentigen typischerweise jedoch Kationenkonzentrationen im millimolaren Bereich, die gewiss mit der Aggregation von Amyloidproteinen und ihren Wechselwirkungen mit der Membran interferieren.[55, 62, 63, 67] Im ANTS/DPX-Assay (ANTS, 8-Amino-1,3,6-trisulfonsure; DPX, p-Xylolbispyridiniumbromid) werden anionische Fluorophore gemeinsam mit kationischen DPX-Fluoreszenzlschern in Lipidvesikel gebracht. Die Trennung des ANTS-Akzeptors vom DPX-Donor, die durch peptidinduzierte Leckage verursacht wird, wird ber die Verstrkung der ANTS-Emission detektiert.[81] Der Hauptnachteil von Farbstoffleckage-Assays ist, dass sie kein genaues mechanistisches Bild peptidinduzierter Membranzerstrung liefern, da nahezu alle Mechanismen, die Defekte in der Doppelschichtstruktur hervorrufen, die Passage von Farbstoffen oder Ionen durch die Lipid-Doppelschicht befrdern (Abbildung 13). 4.3.2.2. Lipophile Fluoreszenzsonden

Chemie

4.3.2.1. Farbstoffleckage-Assays Farbstoffleckage-Assays werden normalerweise genutzt, um nderungen in der Membranpermeabilisierung und Strungen der Doppelschicht-Integritt zu detektieren, die als Folge einer Peptid- oder Proteinbindung auftreten.[131] In diesen Experimenten werden zunchst LUVs mit fluoreszierenden oder farbigen Farbstoffen beladen. Als Folge der Bindung des Peptids an die Membran kann die Lipidpackung geschwcht werden, sodass der intravesikulre Farbstoff in das uere Puffermedium ausluft, was wiederum eine Fluoreszenz- oder Farbnderung bewirkt (Abbildung 13).[132]

Abbildung 13. Farbstoffleckage-Assay mit Vesikeln am Beispiel des Carboxyfluorescein(CF)-Dequenching. Die Farbstoffleckage kann durch mehrere Mechanismen induziert werden, die auch fr die Amyloidtoxizitt vorgeschlagen werden: a) Amyloidporenbildung; b) Tensid-artige Membranauflsung durch wachsende Amyloidfibrillen oder -aggregate; und c) unspezifische Leckage, die durch Bindung von Amyloidaggregaten an die Vesikeloberflche verursacht wird.

Lipophile Fluoreszenzsonden wie 1,6-Diphenyl-1,3,5-hexatrien (DPH) und Laurdan reagieren auf nderungen der Membranfluiditt und Lipidkettendynamik, als Folge der Bindung von Peptiden oder Proteinen.[114, 134] Die Tabelle 1: Farbstoffleckage-Assays zum Nachweis von Membranpermeabilisierungen. Vesikel wurden so hergestellt, dass Farbstoff Kation lex/lem Gegenwart von Poren Lit. ca. 1 Mol-% der Fluoreszenzsonde +[a] [b] +[b] [a] im Mebraninneren eingebaut [c] 3+ DPA Tb 270/545 aus an/grn [131] wurden. Im Fall von DPH spiegelt [d] 492/517 orange gelb aus an/grn [85] CF [e] die Abnahme der FluoreszenzanANTS/DPX 360/530 aus an/grn [81] isotropie eine Abnahme der MemFura-2 Ca2+ 340/510 aus an/grn [75] Arsenazo III Ca2+, Cu2+ 560 rot blau [132] branordnung wider.[134] Laurdan ist PV[d] Cu2+ 450 gelb blau [132] ein polarittssensitiver Farbstoff, [a] Farbe. [b] Fluoreszenz. [c] DPA = Dipicolinsure. [d] CF = Carboxyfluorescein. [e] ANTS = 8-Amino- der auf das Eindringen von Wassermoleklen in die hydrophobe 1,3,6-trisulfonsure, DPX = p-Xylolbispyridiniumbromid.
Angew. Chem. 2010, 122, 5760 5788  2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Tabelle 1 gibt einen berblick ber in FarbstoffleckageAssays gebruchliche Fluorophore und Farbstoffe, zusammen mit den jeweiligen nderungen in Farbe oder Fluoreszenz, die bei einer Membranpermeabilisierung auftreten. Einer der gebruchlichsten Farbstoffleckage-Assays zur Beobachtung von Protein- oder Peptid-induzierter Membranpermeabilisierung beruht auf Fluoreszenz-Dequenching. Bei diesem Verfahren werden LUVs mit selbstlschenden Fluorophoren wie Carboxyfluorescein[85] oder Calcein[46, 84b] in

www.angewandte.de

5779

Aufstze
Lipid-Doppelschicht als Folge einer strukturellen Membrandestabilisierung mit einem Anstieg der Fluoreszenz anspricht.[114, 134] Interessanterweise fhrte die Zugabe von monomerem a-Synuclein zu LUVs zu einem Anstieg der strukturellen Ordnung der Doppelschichten bei Verwendung dieser zwei Sonden.[134] In einer spteren Untersuchung wurde die Abnahme der Membranfluiditt mittels DPH in Gegenwart von gealterten ThT-aktiven undefinierten a-Synuclein-Aggregaten detektiert, was vermuten lsst, dass die membranstrende Struktur ein b-Faltblatt-Aggregat ist.[38] Ein Anstieg in der strukturellen Lipidordnung von Cholesterin enthaltenden POPC-Vesikeln wurde auch beobachtet nach dem Einbau von Ab(142) unter Verwendung von Laurdan als spektroskopische Sonde.[135] 4.3.2.3. Fluoreszenz- und Kryo-Elektronenmikroskopie von Membranen Fluoreszenzmikroskopie (FM) kann verwendet werden, um die nderungen der Membranoberflchenmorphologie als Folge einer Injektion von Peptiden oder Proteinen abzubilden.[106] Hierfr werden die Membranen so hergestellt, dass sie etwa 1 % an Kopfgruppen-markierten fluoreszierenden Lipiden enthalten. Gebruchliche Fluoreszenz-Markierungen sind Texas-Rot, BODIPY und Rhodamin. Im Fall von Lipid-Monoschichten erscheinen FM-Aufnahmen von geordneten, kondensierten Lipidphasen dunkel, wenn Farbstoffmarkierungen von diesen Regionen wegen sterischer Hinderung ausgeschlossen wurden, wohingegen weniger geordnete Phasen (flssig-expandierte Phasen), in denen sich die Farbstoffmolekle verteilt haben, hell erscheinen.[106] Eine Strung der Lipidpackung als Folge der Bindung von Peptiden ist charakterisiert durch eine Abnahme der dunklen und eine Zunahme der hellen Regionen in FM-Aufnahmen.[106] In Gangliosid enthaltenden Membranen wurden Membrandefekte nach Zugabe von Ab[106] und in PG enthaltenden gesttzten Lipid-Doppelschichten nach Injektion von hIAPP[13c] mittels FM beobachtet. nderungen in der GUV-Oberflchenmorphologie in Gegenwart von hIAPP[13b] (Abbildung 11) und a-Synuclein[46] konnten vor kurzem auch durch FM abgebildet werden. Die Kryo-Elektronenmikroskopie (Kryo-EM) bietet ebenfalls einen attraktiven Weg, um nderungen der Vesikelmorphologie als Reaktion auf membranaktive Proteine abzubilden. Der Vorteil der Kryo-EM gegenber anderen bildgebenden Verfahren ist, dass keine Probenfixierung oder Frbemittel bentigt werden und somit die Vesikelstruktur im hydratisierten Zustand erhalten bleibt. Zum Beispiel konnten Strukturstrungen von DOPC/DOPS-Vesikeln bei Kontakt mit hIAPP-Fasern mittels Kryo-EM dargestellt werden (Abbildung 10 b).[13a] 4.3.3. Wirkt das permeabilisierende Peptid an der Oberflche oder dringt es in die Membran ein? Peptide knnen an die Membran entweder ber Oberflchenassoziation oder Insertion in den hydrophoben Innenraum binden. Methoden zur Unterscheidung oberflchenaktiver von membranpenetrierenden Proteinen gehen

H. A. Lashuel und S. M. Butterfield

gewhnlich mit einer Markierung der Peptid- oder Lipidalkylketten mit entweder paramagnetischen oder fluoreszierenden Reportermoleklen einher, die auf die lokale Lsungsmittelumgebung reagieren.

Abbildung 14. Ortsgerichtete Spinmarkierung von Proteinen: Beispiel eines Peptids mit einem Cysteinrest, der mit einer Nitroxid-Spinmarkierung modifiziert wurde.

4.3.3.1. Ortsgerichtete Spinmarkierung von Proteinen Die ortsgerichtete Spinmarkierung (site-directed spin labeling, SDSL) von Proteinen und Peptiden ist eine EPRMethode zur strukturellen Aufklrung der Wechselwirkung von Proteinen und Peptiden mit Membranen.[136] Ausgewhlte Aminosuren werden zu Cystein mutiert, entweder durch ortsgerichtete Mutagenese oder durch Festphasenpeptidsynthese, und anschlieend mit einem Nitroxid-Reagens zur Einfhrung einer Spinmarkierung zur Reaktion gebracht (Abbildung 14). Das Ausma, zu dem markierte Aminosuren fr polare (Nickelethylendiamindiacetat, NiEDDA) oder unpolare (Sauerstoff) paramagnetische Collider zugnglich sind, wird zur Berechnung von seitenkettenspezifischen Lsungsmittelzugnglichkeitsparametern P genutzt, wodurch Informationen bezglich der Umgebung des membrangebundenen Proteins auf Aminosureebene erhalten werden. Die Aminosuren, die in die Membran eindringen, sind fr unpolare Fluoreszenzlscher besser zugnglich, wogegen lsungsmittelexponierte Aminosuren fr polare Reagentien besser zugnglich sind. Die P-Werte fr eine bestimmte Aminosure fr polare vs. unpolare Fluoreszenzlscher sind gegeneinander phasenverschoben. Zugnglichkeitsparameter knnen auch genutzt werden zur Berechnung der Tiefenparameter F [F = ln{P(O2)/P(NiEDDA)}], die der Membraneindringtiefe einer einzelnen Aminosure direkt proportional sind. Mithilfe der SDSL-Methode konnte die Membranpenetration von IAPP[27c] und a-Synuclein[28a] nachgewiesen werden (Abbildungen 4 b und 5 b). Detaillierte strukturelle Informationen, z. B. ber die Proteinkonformation oder die Bildung wassergefllter Kanle, knnen aus SDSL-Messungen abgeleitet werden, wie wir in den folgenden Abschnitten nher erlutern. 4.3.3.2. Tryptophanfluoreszenz Tryptophane dienen als ortsgerichtete Fluoreszenzsonden, um das Ausma der Membrandurchdringung eines Proteins oder Peptids zu beobachten. Die Blauverschiebung der Fluoreszenz von Tryptophanresten amyloidbildender
Angew. Chem. 2010, 122, 5760 5788

5780

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
gen des Peptids in die Membran uert sich in einem Anstieg der Monoschichtflche infolge der Verringerung der Lipidpackung. Umgekehrt wrde eine Auflsung der Membran durch das Peptid zu einer Verkleinerung der Monoschichtoberflche fhren. Die bevorzugte Insertion von Ab40 in anionische Monoschichten[142a] und Gangliosidmembranen[106] konnte mit dieser Methode demonstriert werden. Die bevorzugte Insertion monomerer Strukturen von hIAPP gegenber fibrillren Formen in DOPC/DOPS wurde ber Druck-Flche-Isothermen auf Lipid-Monoschichten gezeigt.[122] 4.3.3.4. Rntgen- und Neutronenreflexionsmessungen Rntgen- und Neutronenreflexion sind analoge Methoden, die eine Bestimmung der Dicke- und Dichtenderungen von Lipid-Monoschichten infolge der Bindung von Peptiden oder Proteinen im -Bereich ermglichen. Die Reflexionsdaten werden an ein Modell angepasst, und detaillierte strukturelle Informationen des Protein-Membran-Komplexes, wie die Eindringtiefe des Proteins in die Membran, die Abmessungen des in die wssrige Phase ausgedehnten Proteins und die Orientierung des membrangebundenen Proteins, werden extrapoliert. Die selektive Insertion von Ab40 in anionische Lipid-Monoschichten an der Luft-Wasser-Grenzflche sowie der Templateffekt der Lipide bei der Amyloidfibrillbildung an anionischen Membranoberflchen wurden auf der Grundlage dieser Techniken aufgezeigt.[10a] Rntgenreflexionsdaten wurden krzlich zur Modellierung der zeitabhngigen Fibrillbildung von hIAPP auf der Oberflche von DOPC/DOPG-Lipid-Monoschichten genutzt, beginnend mit der Peptidinsertion gefolgt von der Dissoziation der aggregierten Formen von hIAPP von der Membranoberflche.[109] 4.3.3.5. Festphasen- und Flssig-NMR-Spektroskopie sowie Circulardichroismus Festphasen-NMR-Spektroskopie von 15N-, 13C- oder 2Hmarkierten Peptiden, die in makroskopisch orientierten Lipid-Doppelschichten rekonstituiert wurden, wurden zur Untersuchung der Orientierung von membranbindenden Proteinen auf Membranen verwendet.[143] Unter anderem wurde die transmembrane Anordnung der porenbildenden antimikrobiellen Peptide Alamethicin[143a, 144] und Melittin[143b] bestimmt. NMR-Spektroskopie in flssiger Phase mit paramagnetischer Relaxationsverstrkung ermglicht die Bestimmung der Membranimmersionstiefe von Schweratommarkierten Proteinatomen. Mit dieser Methode wurde die transmembrane Anordnung von Alamethicin besttigt.[145] In hnlicher Weise wurde gerichteter Circulardichroismus unter Verwendung rekonstituierter Proteine in gepackten Multischichtmembranen adaptiert, um zu zeigen, dass das cytolytische Peptid Mellitin sich parallel oder senkrecht zu der eine transmembrane Pore bildenden Membran anordnen kann.[146] Diese Methoden wurden bisher jedoch nicht zur Untersuchung der Orientierung membrangebundener amyloidogener Proteine verwendet.

Chemie

Proteine oder Peptide zeigt ein Eindringen der Peptide in die hydrophobe Umgebung der Doppelschicht an.[137] Hierbei muss in vielen Fllen zur Einfhrung des Tryptophan-Reporters die natrliche Sequenz modifiziert werden. Bei modifiziertem Ab40[Y10W] wurde nach Zugabe von anionischen DPPC/PG- und POPC/PG-SUVs, nicht aber von elektrisch neutralen Vesikeln, eine Blauverschiebung um 15 nm beobachtet.[11b] Zur Bestimmung der Eindringtiefe eines membranaktiven Peptids werden Spinmarkierungen oder Schweratome, wie z. B. in Dibrom- oder Nitroxidderivaten, in unterschiedlicher Tiefe der Lipide der Modellmembran eingefhrt (d. h. an den Lipidkopfgruppen oder an einem bestimmten Kohlenstoffatom der Lipidalkylkette).[138] Auch wenn diese Methode bisher noch nicht bei amyloidogenen Proteinen angewendet wurde, kann das Muster der Tryptophanfluoreszenzlschung in Abhngigkeit von der Tiefe des Fluoreszenzlschers zur Bestimmung der Eindringtiefe (die im -Bereich liegt) eines bestimmten Tryptophans in die Membran genutzt werden.[138, 139] Durch Spinmarkierung mit Phosphatidylcholin an den Acylkohlenstoffatomen C5 und C15 des Bienengiftes Mellitin wurde eine Eindringtiefe von 10.511.0 fr das einzige Tryptophan der Seitenkette sowohl in neutralen als auch anionischen Vesikeln ermittelt.[140] Durch Beobachtung verschiedener Tryptophansonden an verschiedenen Positionen des Proteins kann eine Strukturkarte erhalten werden, die die Eindringtiefe von verschiedenen Regionen des membrangebundenen Proteins beschreibt. Unter Verwendung bromierter spinmarkierter Fettsuren in PC-Vesikeln zeigten Raja und Mitarbeiter, dass smtliche natrlichen Tryptophane eines porenbildenden a-Toxins aus Staphylococcus aureus an der Membran-Lsungsmittel-Grenzflche positioniert sind.[137] Diese Methode wurde auch zur Bestimmung der pH-abhngigen Membraninsertion der N-terminalen Region des Diphterietoxins in LUVs mit selektiv bromierten Kohlenstoffatomen in den Lipidsureketten genutzt.[141] Ein weiteres Ma fr die Eindringtiefe in die Membran ist der Grad, zu dem Tryptophane vor Kollisionslschern wie Acrylamid[11b] oder Iodid (I)[81] geschtzt sind. Wenn die Seitenketten des lipidgebundenen Peptids in der Doppelschicht vergraben sind, so sind die Tryptophane vor den im wssrigen Lsungsmittel vorliegenden Kollisionslschern geschtzt. So war der Zugang von Kollisionslschern zum Tryptophan in tryptophanmarkiertem Ab40[Y10W] in Gegenwart von DPPC/PG-SUVs um 97 % reduziert.[11b] 4.3.3.3. Expansionsanalyse von Lipid-Monoschichten Zum Nachweis, dass antimikrobielle Peptide, Toxine und amyloidogene Proteine in die Membran eindringen, wurde die Expansionsanalyse von Lipid-Monoschichten auf Langmuir-Lipidfilmen an der Luft-Wasser-Grenzflche angewendet.[106, 123, 142] Oberflchendruck-Flchen-Isothermen wurden bestimmt, indem die Lipide auf einer proteinfreien Subphase aufgespreizt und anschlieend der Lipidfilm unter konstant gehaltenem Druck verdichtet wurde.[121] Nach Injektion des Peptids in die wssrige Subphase wird die nderung der Flche pro Lipidmolekl (DA/A) bestimmt.[121] Das EindrinAngew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5781

Aufstze
4.3.4. Welche Konformation hat das membrangebundene Protein? a-Helices an der Membranoberflche und in die Membran eindringende b-Barrel- oder a-helicale Oligomere sind einige der mglichen Konformationen membranaktiver amyloidogener Proteine, antimikrobieller Peptide und Proteintoxine. Neben dem Circulardichroismus (CD) gibt es Methoden wie SDSL oder NMR-Spektroskopie, die Informationen ber die Konformation des membrangebundenen Proteins in einer Auflsung auf der Ebene der Aminosuren liefern. Aus der Periodizitt der Tiefenparameter F, die mittels SDSL von jeder Aminosure in der Sequenz eines membrangebundenen Proteins bestimmt wurde, kann eine Karte erzeugt werden, die die Konformation des membrangebundenen Proteins und seiner Orientierung zur Membran beschreibt.[136] Fr ein membranassoziiertes a-helicales Peptid haben die Aminosuren i und i + 4, die auf derselben Seite der Helix lokalisiert sind und eine hnliche Lsungsmittelumgebung haben, hnliche F- und P-Werte. Demgegenber sind die Aminosuren i und i + 2, die sich auf entgegengesetzten Seiten der Helix befinden und von denen die eine dem Lsungsmittel exponiert ist und die andere im Kontakt mit der Membran steht, gegenseitig phasenverschoben. Mit dieser Methode konnten die membrangebundenen a-helicalen Konformationen von hIAPP (Abbildung 3)[27c] und a-Synuclein (Abbildung 4 b und 15)[28a] auf der Ebene der einzelnen Aminosuren aufgelst werden. Hochauflsende NMR-Techniken sind nicht in der Lage, die Konformation von Peptiden im Kontakt mit ganzen Zellen zu ermitteln. Modellmembranen haben sich daher als geeignete Hilfsmittel zur Strukturbestimmung mittels NMRSpektroskopie erwiesen. Die a-helicale Konformation von micellgebundenem Ab,[26c,d, 31a] IAPP[32, 33, 116] und a-Synuclein[28b, 147] konnte mit NMR-Methoden in Lsung aufgeklrt werden (Abbildung 4 a).[28b, 147] Die Strukturaufklrung membrangebundener b-Faltblatt-Aggregate und/oder oligomerer transmembraner Poren amyloidbildender Proteine, die sich wahrscheinlich zu einem spteren Zeitpunkt nach der Bindung an die Membran bilden (Schema 1), kann mit NMRMethoden in Lsung schwieriger sein, da die Proteinlslichkeit abnimmt. Festphasen-NMR-Methoden, die bei der Strukturaufklrung von Amyloidfibrillen erfolgreich angewendet wurden, knnen bei der Bestimmung membrangebundener Strukturen toxischer b-Faltblatt-Aggregate amyloidbildender Proteine ebenso ntzlich sein.[148] Auch zur Konformationsbestimmung anderer oligomerer porenbildender Proteine wie der Pore aus a-helicalem Alamethin wurden Festphasen-NMR-Methoden eingesetzt.[149] Darber hinaus wurden auch Einblicke in die oligomere transmembrane b-Barrel-Struktur des antimikrobiellen Peptids Protegrin-1 gewonnen.[150] Fr die Porenstruktur von Protegrin-1 werden strukturelle Analogien zur Ab-Pore angenommen, was ein Potential der NMR-Methoden fr die Strukturaufklrung der Amyloidporen zu erkennen gibt.[148, 151] Ebenso wie beim SDSL ist ein Vorteil der Konformationsbestimmung von Proteinen mittels NMR-Spektroskopie die hochaufgelste Strukturinformation, die man im Ver-

H. A. Lashuel und S. M. Butterfield

Abbildung 15. Periodizitt der F-Werte von spinmarkiertem a-Synuclein in Gegenwart von Lipidvesikeln, verwendet zur Bestimmung der membrangebundenen Konformation in Abbildung 4. Aminosuren mit hohen F-Werten (rot) sind lipidexponierte Stellen. Aminosuren mit roten Markierungen befinden sich auf derselben membranexponierten Seite der Helix (d. h. mit den Abstnden i, i + 4); Aminosuren mit grnen Markierungen befinden sich auf der gegenberliegenden, lsungsmittelexponierten Seite der Helix (nach Jao et al.).[28a]

gleich zu allgemeineren Methoden wie z. B. CD erhlt. Es sollte angemerkt werden, dass die strukturelle Auflsung der membrangebundenen Strukturen amyloidbildender Proteine, die mit diesen Methoden erzielt werden kann, bis jetzt hauptschlich auf monomeren oder heterogenen Prparationen amyloidbildender Proteine beruhte. Auf atomarer Ebene aufgelste Strukturen wohldefinierter oligomerer Proben ob allein oder an Membranen gebunden wurden bisher nicht verffentlicht. Das Fehlen von Strukturinformationen zu wohldefinierten oligomeren Prparationen im Aggregat mit Membranen ist hauptschlich ihrer kurzlebigen Natur und den Schwierigkeiten bei ihrer Isolierung geschuldet.[65] 4.3.5. Unspezifische Leckage kontra Bildung diskreter Ionenkanle oder Poren Die Detektion einer Peptidpenetration durch die oben erwhnten Methoden zeigt nicht zwangslufig auch die Bildung einer transmembranen Pore an, da Regionen oder Seitenketten des Proteins auch nur partiell in die Membran
Angew. Chem. 2010, 122, 5760 5788

5782

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
Doppelschichtbarriere ohne die Bildung diskreter Kanle oder Poren.[4a,b] 4.3.6. Messung von Porengren Zustzlich zu den oben beschriebenen Methoden knnen die hier vorgestellten Techniken weitere Beweise fr die Porenbildung eines membranpermeabilisierenden Proteins oder Peptids liefern und die Porengre charakterisieren. Die Porengre kann bestimmt werden durch Grenselektivittsuntersuchungen mit farbstoffbeladenen Vesikeln oder durch direkte bildgebende Messungen mit EM, AFM und Kryo-EM. 4.3.6.1. Grenabhngigkeit der Farbstoff-Leckage FITC-Dextrane wurden in LUVs eingebracht und als Sonden fr die Porengre verwendet. Die Gre des FITCDextrans wird kontrolliert durch die Gre des Dextranpolymers. Durch Vergleich der Leckage-Geschwindigkeit kleiner Fluorophore wie Calcein oder Carboxyfluorescein mit denen von FITC-Dextranen verschiedener Gren kann die ungefhre Porengre ermittelt werden.[152] Typischerweise setzt man FITC-Dextrane mit Molekulargewichten MW = 400040 000 ein. Kleine Poren von etwa 23 nm Durchmesser lassen auch nur kleine Fluorophore passieren (z. B. Carboxyfluorescein), Poren von 57 nm Durchmesser erlauben die Passage von FITC-Dextranen mit MW = 400020 000, und groe Poren von 8 nm Durchmesser oder mehr erlauben auch die Passage von FITC-Dextranen mit MW = 40 000.[152] Es ist davon auszugehen, dass eine unspezifische oder Tensidartige Auflsung der Membran durch das Peptid keine Grendifferenzierung der Farbstoff-Leckage ergibt. Typische bakterielle Poren sind zu klein (d = 0.81.1 nm), um Molekle ber 600 Da durchzulassen,[91] auch wenn Porendurchmesser von bis zu 1545 nm fr die PFTs Streptolysin O[153] und Perfingolysin O[154] berichtet wurden. Der Grenzwert der Moleklgre fr die Membranpermeabilisierung durch verschiedene amyloidogene Proteine muss erst noch ermittelt werden. Die Passage von Ca2+ und Dopamin, die durch protofibrillres IAPP und a-Synuclein induziert wurde, ist wesentlich schneller als die Passage grerer FITC-Dextrane, was eine Grenselektivitt vermuten lsst. Der spezifische Porendurchmesser wurde in dieser Untersuchung jedoch nicht bestimmt.[86] 4.3.6.2. Elektronenmikroskopie und Rasterkraftmikroskopie Zur direkten Visualisierung und Bestimmung der Porengre sind EM und AFM die Methoden der Wahl. Sie fanden verbreitet Einsatz zur Charakterisierung von Aggregationsintermediaten, darunter auch Amyloidporen, die sich whrend der Fibrillbildung von Amyloidproteinen in vitro bilden (Schema 1). EM wurde eingesetzt zur Bestimmung der inneren Porendurchmesser protofibrillrer Spezies von a-Synuclein und Ab, die im Bereich von 1.52.5 nm liegen (Abbildung 7 c).[12ac] Mittels AFM gelingt es, Porengren bis in den Nanometerbereich aufzulsen. AFM-Aufnahmen lieferten hochaufgelste strukturelle Informationen ber verwww.angewandte.de

Chemie

eindringen knnen. Der Nachweis eines wassergefllten Kanals gelingt ber die Zugnglichkeitsparameter, die man durch SDSL membranbindender Proteine erhalten kann.[136c] Die wohl direkteste Methode zum Nachweis einer echten Ionenkanal- oder Porenaktivitt ist die Messung der Einzelionenleitfhigkeit eines Kanals.[91] Wurde eine echte Porenbildung erst einmal festgestellt, kann mittels der nachfolgend beschriebenen Methoden die Porengre bestimmt werden. Der Beweis einer wassergefllten Pore gelingt ber das Muster der P-Werte spinmarkierter Peptide. Die Gren der P-Werte entlang einer Sequenz sind normalerweise recht einheitlich fr ein oberflchenadsorbiertes Protein oder Peptid, wobei die Aminosuren, die mit der Membran in Kontakt sind ebenso wie diejenigen, die nicht im Kontakt sind , nherungsweise die gleichen P-Werte haben (Abbildung 16).[136c] Bei einer wassergefllten Pore sind nun die

Abbildung 16. Auftragung der idealisierten P-Werte gegen die Position in der Sequenz fr eine wassergefllte Pore (links) und eine oberflchenadsorbierte Helix (rechts). Die Zugnglichkeit der Aminosuren fr unpolare und polare paramagnetische Collider ist durch die schwarzen bzw. weien Kurven dargestellt (nach Hubbell et al.).[136c]

Aminosuren nahe der Porenffnung besser fr das Lsungsmittel zugnglich, whrend Aminosuren im Zentrum der Doppelschicht eine unpolare Umgebung haben. Im Fall einer wassergefllten Pore sollten daher die P-Werte im Zentrum der Doppelschicht in Gegenwart unpolarer paramagnetischer Collider grer sein, whrend die Werte an der Porenffnung in Gegenwart polarer paramagnetischer Collider grer sein sollten (Abbildung 16).[136c] Die Methode wurde zur Identifizierung oberflchenadsorbierter a-Helices sowohl fr hIAPP[27c] als auch fr a-Synuclein verwendet.[28a] Einzelkanal-Leitfhigkeit: Die Leitfhigkeit von Einzelkanlen, die durch ein Protein oder Peptid in planaren LipidDoppelschichten induziert wird (Abbildung 13 h), liefert starke Beweise fr die Bildung diskreter Ionenkanle oder Poren.[7b, 91] Typische Ionenkanle bleiben nur fr den Bruchteil einer Sekunde offen und erlauben so die Passage von Ionen durch die Pore. Die Messung des Stroms als Funktion der Zeit zeigt Stromsprnge entsprechend dem ffnen und Schlieen der Kanle, wenn diskrete Ionenkanle oder Poren existieren (Abbildung 7 a).[129] Spannungssteuerung (d. h. ffnen oder Schlieen des Kanals als Antwort auf eine nderung des elektrischen Feldes)[91] und Ionenspezifitt sind ebenso allgemeine Eigenschaften einer Ionenkanaloder Porenaktivitt.[76] Ein gradueller Anstieg der Doppelschicht-Leitfhigkeit ohne Hinweis auf offene oder geschlossene Zustnde ist bezeichnend fr eine Schwchung der
Angew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5783

Aufstze
schiedene amyloidogene Proteine, die in Lipid-Doppelschichten oder auf einem festen Glimmertrger rekonstituiert waren (Abbildung 7 b).[7b, 8a] Neutronenstreuung wurde zur Bestimmung des inneren Durchmessers einer Alamethicin-Pore eingesetzt.[155] Mittels Kryo-EM wurde die Porengre von Magainin, einem antimikrobiellen Peptid, bestimmt.[156] Eine Vielzahl von KryoEM-Spektren, die die porsen Vesikel in Gegenwart des Peptids zeigen, wurden gemittelt, um ein Pendant einer Elektronenbeugungskurve zu erhalten, woraus eine durchschnittliche Porengre von 8 nm fr die Magainin-Pore abgeleitet wurde.[156] Bis jetzt wurden Poren, die von amyloidogenen Proteinen gebildet werden, mit diesen Methoden noch nicht untersucht. 4.3.7. Barrel-Stave- kontra toroidale Poren Die Klassifizierung einer Peptidpore als Barrel-Staveoder toroidale Struktur ist ein wichtiger Schritt zur strukturellen Auflsung der membranaktiven Spezies (Abbildung 9 a). Das klassische Beispiel eines antimikrobiellen Peptids, das eine Barell-Stave-Struktur bildet, ist Alamethicin, fr das wichtige Hinweise auf die Porenstruktur aus Einzelkanal-Leitfhigkeitsmessungen erhalten wurden.[146, 157] Insbesondere konnten diskrete Leitfhigkeitsniveaus beobachtet werden, was die Bildung eines durchgehenden Kanals anzeigt. Weitere Hinweise auf ein Barrel-Stave-Modell fr Alamethicin lieferte eine Kombination von FestphasenNMR,[143a, 144, 149, 158] NMR in Lsung und MD-Simulationen, die smtlich darauf hindeuteten, dass dieses Protein eine transmembrane a-helicale Pore bildet.[145] Weniger reproduzierbare Muster der Ionenkanal-Leitfhigkeit wurden fr ahelicale Magainin-Peptide gefunden, von denen man annimmt, dass sie toroidale Poren bilden. Der experimentelle Befund spiegelt die Tatsache wider, dass toroidale Poren variable statt diskrete Strukturen sind.[146] Mit derartigen Methoden knnen also Informationen zur Struktur von Amyloidporen abgeleitet werden. Andere Methoden wie dynamische Differenz-Kalorimetrie (DSC) und Festphasen-NMR-Spektroskopie mit BicellModellen wurden verwendet, um die Induktion einer Membrankrmmung zu detektieren, die charakteristisch ist fr toroidale Porenintermediate.[105] Mittels DSC wurde eine Verschiebung des Phasenbergangs von der flssig-kristallinen (La) in die invers hexagonale (HII) Phase in DiPoPEMembranen in Gegenwart von IAPP-Peptiden beobachtet, was die Induktion einer negativen Krmmungsspannung anzeigt und auf eine mgliche toroidale Porenstrukturen hinweist.[105] Die bevorzugte Bindung von Peptiden an stark gekrmmte Regionen der Bicell-Modellmembranen sttzt die Annahme einer Membranpermeabilisierung durch die Bildung toroidaler Poren. In Gegenwart von z. B. IAPP wurden Verschiebungen fr die 31P-Kopfgruppen an Perforationen gekrmmter Bicellen beobachtet, was auf die Induktion toroidaler Porenstrukturen durch das Protein hinweist.[105] Ebenfalls verfgbar sind spektroskopische Assays zum Nachweis toroidaler Porenintermediate. Der Lipid-Flip-FlopAssay detektiert die Translokation von Lipiden von der ueren zur inneren Membranseite, was durch toroidale Poren

H. A. Lashuel und S. M. Butterfield begnstigt wird.[117, 152, 159] Durch Kopplung von Lipid-FlipFlop mit Farbstoff-Leckage aus farbstoffbeladenen Vesikeln lsst sich die Bildung toroidaler Poren anzeigen. Die Methode wurde bisher noch nicht bei mechanistischen Untersuchungen mit amyloidbildenden Proteinen eingesetzt. 4.3.8. Detektion der Membranfusion Eine Membranpermeabilisierung kann auch bei der durch Peptide oder Proteine induzierten Membranfusion auftreten. Es ist unwahrscheinlich, dass ein einzelner Fusionsmechanismus allein fr die Membrandestabilisierung im Fall amyloidogener Proteine verantwortlich ist, da sogar Fusionskomplexe mit der Bildung von Poren assoziiert werden knnen.[160] Der Prozess der peptid-/proteininduzierten Fusion geht einher mit: 1) der Anbindung von Membranen, 2) der Membrandestabilisierung, whrend der der Inhalt der Doppelschicht auslaufen kann, und 3) der Fusion zu greren Membranstrukturen.[161] Membranfusionsaktivitt konnte mehrfach fr Ab[10a, 106, 162] und das amyloidogene Prionproteinfragment PrP(106126)[163] nachgewiesen werden und wurde auch mit der Membranaktivitt von a-Synuclein in Zusammenhang gebracht.[164] Vesikelfusionsassays verfolgen die Vesikelfusion spektroskopisch und wurden zum Nachweis der Membranfusionsaktivitt eines Ab-Fragments genutzt.[162b] Typische Vesikelfusionsassays beruhen auf FRET mit fluorophormarkierten Lipidvesikeln[163, 165] oder Core-Mixing-Assays.[166] Dynamische Lichtstreuung bietet die Mglichkeit, die nderung des hydrodynamischen Radius des Vesikels als Folge peptidinduzierter Fusion zu untersuchen; die Methode wurde zum Nachweis des Anstiegs des Vesikelradius nach Inkubation mit Ab verwendet.[10a, 106] Ferner kann die Bildung grerer Vesikel als Folge peptidinduzierter Vesikelfusion durch Fluoreszenzmikroskopie unter Verwendung markierter Lipide[167] oder mittels Kryo-EM direkt abgebildet werden.

5. Zusammenfassung und Ausblick


Umfangreiche experimentelle Beweise zeigen, dass die Toxizitt amyloidbildender Proteine mit ihrer Wechselwirkung mit Zellmembranen zusammenhngt. So wurde ein Zusammenhang beobachtet zwischen der membraninduzierten Fibrillbildung und einer durch amyloidogene Proteine induzierten Membranstrung. Der Prozess der Amyloidfibrillbildung wird an der Oberflche anionischer Membranen verstrkt, mglicherweise durch Verkrzung der Latenzphase (d. h. lsliches Protein ! a-Helix ! prfibrillre b-FaltblattOligomere). Ein wahrscheinlicher Angriffsort fr diese prfibrillren Aggregate ist die Zellmembran selbst, da die prfibrillren Aggregate eine hhere Membranpermeabilisierungsaktivitt haben als die monomeren oder fibrillren Formen. Die direkte Visualisierung annularer porenhnlicher protofibrillrer Oligomere mit auffallenden morphologischen hnlichkeiten zu den membranaktiven Strukturen porenbildender Toxine, sowie der Nachweis kanalhnlicher Leitfhigkeitszustnde in mehreren amyloidbildenden Proteinen sttzen die Annahme, dass der Toxizitt amyloidogener
Angew. Chem. 2010, 122, 5760 5788

5784

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
charakterisierten amyloidbildenden Proteine zu schlieen. Wir hoffen, dass die in diesem Aufsatz vorgestellten Informationen weitere Forschungsbemhungen auf diesem Gebiet anregen.

Chemie

Proteine ein porenhnlicher Mechanismus zugrunde liegt. Porenaktivitt kann jedoch nur einen Bruchteil des Permeabilisierungsprozesses widerspiegeln. Neuere Untersuchungen speziell mit IAPP zeigen einen vollstndigen Membranabbau durch Lipidextraktion und Aufnahme in die wachsenden IAPP-Fibrillen, in Analogie zum Tensid-hnlichen CarpetModell, das fr bestimmte antimikrobielle Peptide diskutiert wird. Auch wenn weitere Untersuchungen ntig sind, kann man beginnen, durch Einarbeitung der hier vorgestellten Ergebnisse ein mechanistisches Modell des Permeabilisierungsprozesses zu konstruieren. Prfibrillre Aggregate binden an die Membran oder bilden sich auf ihr aus a-helicalen Vorlufern und bilden transmembrane annulare b-FaltblattStrukturen, was den unregulierten Ausstrom des Zellinhalts durch die Pore ermglicht. In spteren Stadien der Aggregation beginnt die sich entwickelnde Faser, Lipidmolekle aus der Membran zu extrahieren, was letztendlich zu einem vollstndigen Verlust der Barrierefunktion der Membran fhrt. Dies knnte erklren, weshalb in manchen Berichten nicht etwa einzelne Intermediate mit der Membranzersetzung und Toxizitt assoziiert werden, sondern vielmehr der Prozess der Fibrillbildung. Man sollte anmerken, dass viele der hier vorgestellten Untersuchungen mit monomeren oder gealterten heterogenen Proben mit unklarer Struktur oder in einem oligomeren Zustand durchgefhrt wurden. Angesichts der Komplexitt der Amyloidfibrillbildung, der enormen Zahl intermedirer oligomerer Zustnde, die sich im Austausch befinden, sowie der fehlenden Kenntnis der 3D-Strukturen dieser verschiedenen intermediren Zustnde kann ein vollstndiger logischer Zusammenhang der experimentellen Ergebnisse solange nicht mglich sein, bis standardisierte Verfahren der Proteinherstellung angewendet werden. Um einige dieser Unstimmigkeiten zu klren, sollten die ersten Schritte die Optimierung der Isolierung der vorherrschenden oligomeren Intermediate und, wenn mglich, die Aufklrung ihrer 3DStrukturen sein. Mechanistische Untersuchungen und Assays mit diesen Proben knnten dann zur Identifizierung der Spezies mit der hchsten Membranpermeabilisierungsaktivitt und der Aufklrung des molekularen Prozesses der Membranzersetzung fhren. Allerdings kann es auch sein, dass nicht nur ein einzelner oligomerer Zustand, sondern vielmehr der dynamische Austausch zwischen mehreren Zustnden whrend der Fibrillbildung fr die Membranzersetzung verantwortlich ist. Hierauf wurde in mehreren Berichten hingewiesen. Laufende Untersuchungen mit knstlichen Modellmembransystemen erbrachten bereits erste wertvolle Einblicke in den Mechanismus, ber den amyloidogene Proteine mit Membranen wechselwirken und Zelltoxizitt induzieren, und haben dem Forschungsgebiet neue Untersuchungsmglichkeiten erffnet. In diesen Studien wurden mehrere Analogien zwischen amyloidbildenden Proteinen, porenbildenden Toxinen und antimikrobiellen Peptiden gefunden. Deshalb knnen Methoden, mit denen bereits mechanistische Informationen ber die Aktivitten porenbildender Toxine und antimikrobieller Peptide gewonnen wurden, auch verwendet werden, um die Wissenslcken bezglich der weniger gut
Angew. Chem. 2010, 122, 5760 5788

Abkrzungen
DiPoPE DMPC DMPG DPC DPPC DPPG DOPA DOPC DOPG DOPS NBD POPC POPG POPS PC PG PS SDS Dipalmitoleoylphosphatidylethanolamin 1,2-Dimyristoyl-sn-glycero-3-phosphocholin 1,2-Dimyristoyl-sn-glycero-3-phospho-(1rac-glycerin) Dodecylphosphocholin 1,2-Dipalmitoyl-sn-glycero-3-phosphocholin 1,2-Dipalmitoyl-sn-glycero-3-phospho-(1rac-glycerin) 1,2-Dioleoyl-sn-glycero-3-phosphat 1,2-Dioleoyl-sn-glycero-3-phosphocholin 1,2-Dioleoyl-sn-glycero-3-phospho-(1-racglycerin) 1,2-Dioleoyl-sn-glycero-3-phospho-l-serin (7-Nitro-2-1,3-benzoxadiazol-4-yl) 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholin 1-Palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1-rac-glycerin) 1-Palmitoyl-2-oleoyl-sn-glycero-3-phospho-l-serin Phosphatidylcholin Phosphatidylglycerin Phosphatidylserin Natriumdodecylsulfat

Die Autoren danken Prof. Ralf Langen, Prof. Maarten Engel, Prof. Ratnesh Lal, Prof. Eliezer Masliah, Prof. Ruth Nussinov und Prof. Wei-Ping Gai fr die Verwendung von Daten in diesem Aufsatz. H.A.L. dankt Prof. Peter T. Lansbury und Prof. Thomas Walz fr ihre Beitrge zu unseren Arbeiten in diesem Forschungsgebiet und fr umsichtige Diskussionen. Diese Arbeit wurde untersttzt durch Frderungen der Ecole Polytechnique Fdrale de Lausanne (EPFL) und ein Stipendium der Swiss National Science Foundation (H.A.L., FE310000-110027).
Eingegangen am 26. November 2009 Online verffentlicht am 9. Juli 2010 bersetzt von Dr. Ina Emme-Papastavrou, Lrrach

[1] F. M. LaFerla, K. N. Green, S. Oddo, Nat. Rev. Neurosci. 2007, 8, 499. [2] M. G. Spillantini, M. L. Schmidt, V. M. Lee, J. Q. Trojanowski, R. Jakes, M. Goedert, Nature 1997, 388, 839. [3] P. Westermark, C. Wernstedt, E. Wilander, D. W. Hayden, T. D. OBrien, K. H. Johnson, Proc. Natl. Acad. Sci. USA 1987, 84, 3881. [4] a) R. Kayed, Y. Sokolov, B. Edmonds, T. M. McIntire, S. C. Milton, J. E. Hall, C. G. Glabe, J. Biol. Chem. 2004, 279, 46363;

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5785

Aufstze
b) Y. Sokolov, J. A. Kozak, R. Kayed, A. Chanturiya, C. Glabe, J. E. Hall, J. Gen. Physiol. 2006, 128, 637; c) L. Haataja, T. Gurlo, C. J. Huang, P. C. Butler, Endocr. Rev. 2008, 29, 303. a) D. M. Walsh, I. Klyubin, J. V. Fadeeva, W. K. Cullen, R. Anwyl, M. S. Wolfe, M. J. Rowan, D. J. Selkoe, Nature 2002, 416, 535; b) S. Lesn, M. T. Koh, L. Kotilinek, R. Kayed, C. G. Glabe, A. Yang, M. Gallagher, K. H. Ashe, Nature 2006, 440, 352. D. L. Pountney, N. H. Voelcker, W. P. Gai, Neurotoxic. Res. 2005, 7, 59. a) H. A. Lashuel, P. T. Lansbury, Jr., Q. Rev. Biophys. 2006, 39, 167; b) A. Quist, I. Doudevski, H. Lin, R. Azimova, D. Ng, B. Frangione, B. Kagan, J. Ghiso, R. Lal, Proc. Natl. Acad. Sci. USA 2005, 102, 10427. a) H. Lin, R. Bhatia, R. Lal, FASEB J. 2001, 15, 2433; b) H. B. Pollard, N. Arispe, E. Rojas, Cell. Mol. Neurobiol. 1995, 15, 513. A. Relini, O. Cavalleri, R. Rolandi, A. Gliozzi, Chem. Phys. Lipids 2009, 158, 1. a) E. Y. Chi, C. Ege, A. Winans, J. Majewski, G. Wu, K. Kjaer, K. Y. Lee, Proteins Struct. Funct. Genet. 2008, 72, 1; b) C. Aisenbrey, T. Borowik, R. Bystrm, M. Bokvist, F. Lindstrm, H. Misiak, M.-A. Sani, G. Grbner, Eur. Biophys. J. 2008, 37, 247. a) M. J. Volles, S. J. Lee, J. C. Rochet, M. D. Shtilerman, T. T. Ding, J. C. Kessler, P. T. Lansbury, Jr., Biochemistry 2001, 40, 7812; b) P. T. Wong, J. A. Schauerte, K. C. Wisser, H. Ding, E. L. Lee, D. G. Steel, A. Gafni, J. Mol. Biol. 2009, 386, 81. a) H. A. L. Lashuel, P. T. Lansbury, Q. Rev. Biophys. 2006, 39, 167; b) H. A. Lashuel, D. Hartley, B. M. Petre, T. Walz, P. T. Lansbury, Jr., Nature 2002, 418, 291; c) H. A. Lashuel, B. M. Petre, J. Wall, M. Simon, R. J. Nowak, T. Walz, P. T. Lansbury, Jr., J. Mol. Biol. 2002, 322, 1089; d) R. Capone, F. G. Quiroz, P. Prangkio, I. Saluja, A. M. Sauer, M. R. Bautista, R. S. Turner, J. Yang, M. Mayer, Neurotoxic. Res. 2009, 16, 1; e) B. L. Kagan, R. Azimov, R. Azimova, J. Membr. Biol. 2004, 202, 1; f) N. Arispe, E. Rojas, H. B. Pollard, Proc. Natl. Acad. Sci. USA 1993, 90, 567; g) H. B. Pollard, E. Rojas, N. Arispe, Ann. N. Y. Acad. Sci. 1993, 695, 165. a) M. F. Engel, L. Khemtemourian, C. C. Kleijer, H. J. Meeldijk, J. Jacobs, A. J. Verkleij, B. de Kruijff, J. A. Killian, J. W. Hoppener, Proc. Natl. Acad. Sci. USA 2008, 105, 6033; b) E. Sparr, M. F. Engel, D. V. Sakharov, M. Sprong, J. Jacobs, B. de Kruijff, J. W. Hoppener, J. A. Killian, FEBS Lett. 2004, 577, 117; c) Y. A. Domanov, P. K. Kinnunen, J. Mol. Biol. 2008, 376, 42. J. N. Rao, Y. E. Kim, L. S. Park, T. S. Ulmer, J. Mol. Biol. 2009, 390, 516. F. Chiti, C. M. Dobson, Annu. Rev. Biochem. 2006, 75, 333. R. M. Murphy, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1923. R. Sabat, J. Estelrich, J. Phys. Chem. B 2005, 109, 11 027. P. Seubert, C. Vigo-Pelfrey, F. Esch, M. Lee, H. Dovey, D. Davis, S. Sinha, M. Schiossmacher, J. Whaley, C. Swindlehurst, R. McCormack, R. Wolfert, D. Selkoe, I. Lieberburg, D. Schenk, Nature 1992, 359, 325. J. D. Knight, A. D. Miranker, J. Mol. Biol. 2004, 341, 1175. M. R. Wilson, J. J. Yerbury, S. Poon, Mol. Biosyst. 2008, 4, 42. J. A. Hebda, A. D. Miranker, Annu. Rev. Biophys. 2009, 38, 125. R. Bystrm, C. Aisenbrey, T. Borowik, M. Bokvist, F. Lindstrm, M. A. Sani, A. Olofsson, G. Grbner, Cell Biochem. Biophys. 2008, 52, 175. M. Bokvist, G. Grbner, J. Am. Chem. Soc. 2007, 129, 14848. S. A. Jayasinghe, R. Langen, Biochim. Biophys. Acta Biomembr. 2007, 1768, 2002. A. Abedini, D. P. Raleigh, Protein Eng. Des. Sel. 2009, 22, 453. a) T. Okada, M. Wakabayashi, K. Ikeda, K. Matsuzaki, J. Mol. Biol. 2007, 371, 481; b) T. G. Fletcher, D. A. Keire, Protein Sci. 1997, 6, 666; c) P. K. Mandal, J. W. Pettegrew, Neurochem. Res. [27]

H. A. Lashuel und S. M. Butterfield

[5]

[28]

[6] [7]

[8] [9] [10]

[29] [30] [31]

[11]

[32] [33]

[12]

[34]

[35] [36]

[13]

[37] [38] [39] [40] [41] [42]

[14] [15] [16] [17] [18]

[43] [44]

[19] [20] [21] [22]

[45] [46] [47] [48] [49]

[23] [24] [25] [26]

[50]

2004, 29, 2267; d) H. Shao, S. Jao, K. Ma, M. G. Zagorski, J. Mol. Biol. 1999, 285, 755. a) J. A. Williamson, J. P. Loria, A. D. Miranker, J. Mol. Biol. 2009, 393, 383; b) J. D. Knight, J. A. Hebda, A. D. Miranker, Biochemistry 2006, 45, 9496; c) M. Apostolidou, S. A. Jayasinghe, R. Langen, J. Biol. Chem. 2008, 283, 17205; d) S. A. Jayasinghe, R. Langen, Biochemistry 2005, 44, 12113. a) C. C. Jao, B. G. Hegde, J. Chen, I. S. Haworth, R. Langen, Proc. Natl. Acad. Sci. USA 2008, 105, 19666; b) T. S. Ulmer, A. Bax, N. B. Cole, R. L. Nussbaum, J. Biol. Chem. 2005, 280, 9595; c) M. Drescher, F. Godschalk, G. Veldhuis, B. D. van Rooijen, V. Subramaniam, M. Huber, ChemBioChem 2008, 9, 2411; d) E. R. Georgieva, T. F. Ramlall, P. P. Borbat, J. H. Freed, D. Eliezer, J. Am. Chem. Soc. 2008, 130, 12856. D. H. Lopes, A. Meister, A. Gohlke, A. Hauser, A. Blume, R. Winter, Biophys. J. 2007, 93, 3132. M. D. Kirkitadze, M. M. Condron, D. B. Teplow, J. Mol. Biol. 2001, 312, 1103. a) M. Coles, W. Bicknell, A. A. Watson, D. P. Fairlie, D. J. Craik, Biochemistry 1998, 37, 11064; b) T. Kohno, K. Kobayashi, T. Maeda, K. Sato, A. Takashima, Biochemistry 1996, 35, 16094. S. M. Patil, S. Xu, S. R. Sheftic, A. T. Alexandrescu, J. Biol. Chem. 2009, 284, 11982. a) R. P. Nanga, J. R. Brender, J. Xu, G. Veglia, A. Ramamoorthy, Biochemistry 2008, 47, 12689; b) J. R. Brender, E. L. Lee, M. A. Cavitt, A. Gafni, D. G. Steel, A. Ramamoorthy, J. Am. Chem. Soc. 2008, 130, 6424. a) L. Kjaer, L. Giehm, T. Heimburg, D. Otzen, Biophys. J. 2009, 96, 2857; b) M. Drescher, G. Veldhuis, B. D. van Rooijen, S. Milikisyants, V. Subramaniam, M. Huber, J. Am. Chem. Soc. 2008, 130, 7796; c) A. J. Trexler, E. Rhoades, Biochemistry 2009, 48, 2304; d) D. Eliezer, E. Kutluay, R. Bussell, Jr., G. Browne, J. Mol. Biol. 2001, 307, 1061. K. Vamvaca, M. J. Volles, P. T. Lansbury, Jr., J. Mol. Biol. 2009, 389, 413. a) M. Mihajlovic, T. Lazaridis, Proteins Struct. Funct. Genet. 2008, 70, 761; b) R. Bussell, Jr., D. Eliezer, J. Mol. Biol. 2003, 329, 763. M. J. Volles, P. T. Lansbury, Jr., J. Mol. Biol. 2007, 366, 1510. D. P. Smith, D. J. Tew, A. F. Hill, S. P. Bottomley, C. L. Masters, K. J. Barnham, R. Cappai, Biochemistry 2008, 47, 1425. M. Zhu, A. L. Fink, J. Biol. Chem. 2003, 278, 16873. H. J. Lee, C. Choi, S. J. Lee, J. Biol. Chem. 2002, 277, 671. M. Necula, C. N. Chirita, J. Kuret, J. Biol. Chem. 2003, 278, 46674. a) K. Matsuzaki, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1935; b) C. H. Davis, M. L. Berkowitz, Biophys. J. 2009, 96, 785. A. P. Pandey, F. Haque, J. C. Rochet, J. S. Hovis, Biophys. J. 2009, 96, 540. F. Evers, C. Jeworrek, S. Tiemeyer, K. Weise, D. Sellin, M. Paulus, B. Struth, M. Tolan, R. Winter, J. Am. Chem. Soc. 2009, 131, 9516. M. Stckl, P. Fischer, E. Wanker, A. Herrmann, J. Mol. Biol. 2008, 375, 1394. B. D. van Rooijen, M. M. Claessens, V. Subramaniam, FEBS Lett. 2008, 582, 3788. J. A. Allen, R. A. Halverson-Tamboli, M. M. Rasenick, Nat. Rev. Neurosci. 2007, 8, 128. Y. Tamai, S. Matsukawa, M. Satake, J. Biochem. 1971, 69, 235. a) D. R. Taylor, N. M. Hooper, Mol. Membr. Biol. 2006, 23, 89; b) S. I. Kim, J. S. Yi, Y. G. Ko, J. Cell. Biochem. 2006, 99, 878; c) T. J. Pinheiro, Chem. Phys. Lipids 2006, 141, 66. T. Okada, K. Ikeda, M. Wakabayashi, M. Ogawa, K. Matsuzaki, J. Mol. Biol. 2008, 382, 1066.
Angew. Chem. 2010, 122, 5760 5788

5786

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Protein-Membran-Wechselwirkungen

Angewandte
[78] a) M. P. Mattson, S. L. Chan, J. Mol. Neurosci. 2001, 17, 205; b) P. Hajieva, C. Kuhlmann, H. J. Luhmann, C. Behl, Neurosci. Lett. 2009, 451, 119. [79] H. A. Lashuel, D. M. Hartley, B. M. Petre, J. S. Wall, M. N. Simon, T. Walz, P. T. Lansbury, Jr., J. Mol. Biol. 2003, 332, 795. [80] a) D. Eliezer, J. Gen. Physiol. 2006, 128, 631; b) G. Valincius, F. Heinrich, R. Budvytyte, D. J. Vanderah, D. J. McGillivray, Y. Sokolov, J. E. Hall, M. Losche, Biophys. J. 2008, 95, 4845. [81] J. M. Rausch, J. R. Marks, R. Rathinakumar, W. C. Wimley, Biochemistry 2007, 46, 12124. [82] B. Bechinger, K. Lohner, Biochim. Biophys. Acta Biomembr. 2006, 1758, 1529. [83] C. G. Glabe, J. Biol. Chem. 2008, 283, 29639. [84] a) Y. Porat, S. Kolusheva, R. Jelinek, E. Gazit, Biochemistry 2003, 42, 10971; b) L. Pieri, M. Bucciantini, P. Guasti, J. Savistchenko, R. Melki, M. Stefani, Biophys. J. 2009, 96, 3319. [85] W. Qi, A. Zhang, T. A. Good, E. J. Fernandez, Biochemistry 2009, 48, 8908. [86] M. Anguiano, R. J. Nowak, P. T. Lansbury, Jr., Biochemistry 2002, 41, 11338. [87] Y. Yoshiike, R. Kayed, S. C. Milton, A. Takashima, C. G. Glabe, NeuroMolecular Med. 2007, 9, 270. [88] M. R. de Planque, V. Raussens, S. A. Contera, D. T. Rijkers, R. M. Liskamp, J. M. Ruysschaert, J. F. Ryan, F. Separovic, A. Watts, J. Mol. Biol. 2007, 368, 982. [89] S. D. Zakharov, J. D. Hulleman, E. A. Dutseva, Y. N. Antonenko, J.-C. Rochet, W. A. Cramer, Biochemistry 2007, 46, 14369. [90] R. Bahadi, P. V. Farrelly, B. L. Kenna, J. I. Kourie, F. Tagliavini, G. Forloni, M. Salmona, Am. J. Physiol. Cell Physiol. 2003, 285, C862. [91] G. Bainbridge, I. Gokce, J. H. Lakey, FEBS Lett. 1998, 431, 305. [92] N. Arispe, J. C. Diaz, O. Simakova, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1952. [93] a) J. Zhong, C. Yang, W. Zheng, L. Huang, Y. Hong, L. Wang, Y. Sha, Biophys. J. 2009, 96, 4610; b) J. Zhong, W. Zheng, L. Huang, Y. Hong, L. Wang, Y. Qiu, Y. Sha, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1420; c) W. Zheng, L. Wang, Y. Hong, Y. Sha, Biochem. Biophys. Res. Commun. 2009, 379, 298. [94] D. L. Pountney, R. Lowe, M. Quilty, J. C. Vickers, N. H. Voelcker, W. P. Gai, J. Neurochem. 2004, 90, 502. [95] S. Inoue, Amyloid 2008, 15, 223. [96] M. Bischofberger, M. R. Gonzalez, F. G. van der Goot, Curr. Opin. Cell Biol. 2009, 21, 589. [97] M. R. Gonzalez, M. Bischofberger, L. Pernot, F. G. van der Goot, B. Frche, Cell. Mol. Life Sci. 2008, 65, 493. [98] H. Jang, J. Zheng, R. Lal, R. Nussinov, Trends Biochem. Sci. 2008, 33, 91. [99] a) S. J. Singer, N. N. Dewji, Proc. Natl. Acad. Sci. USA 2006, 103, 1546; b) J. A. Yong, Y. Pin, Chin. Sci. Bull. 2007, 52, 1576. [100] I. F. Tsigelny, P. Bar-On, Y. Sharikov, L. Crews, M. Hashimoto, M. A. Miller, S. H. Keller, O. Platoshyn, J. X.-J. Yuan, E. Masliah, FEBS J. 2007, 274, 1862. [101] M. R. R. de Planque, V. Raussens, S. A. Contera, D. T. S. Rijkers, R. M. J. Liskamp, J.-M. Ruysschaert, J. F. Ryan, F. Separovic, A. Watts, J. Mol. Biol. 2007, 368, 982. [102] R. Kayed, A. Pensalfini, L. Margol, Y. Sokolov, F. Sarsoza, E. Head, J. Hall, C. Glabe, J. Biol. Chem. 2009, 284, 4230. [103] R. Fssle, S. Bhakdi, A. Sziegoleit, J. Tranum-Jensen, T. Kranz, H. J. Wellensiek, J. Cell Biol. 1981, 91, 83. [104] A. K. Mahalka, P. K. Kinnunen, Biochim. Biophys. Acta Biomembr. 2009, 1788, 1600. [105] P. E. Smith, J. R. Brender, A. Ramamoorthy, J. Am. Chem. Soc. 2009, 131, 4470. [106] E. Y. Chi, S. L. Frey, K. Y. Lee, Biochemistry 2007, 46, 1913. [107] R. Friedman, R. Pellarin, A. Caflisch, J. Mol. Biol. 2009, 387, 407.

Chemie

[51] K. Yanagisawa, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1943. [52] K. Matsuzaki, T. Noguch, M. Wakabayashi, K. Ikeda, T. Okada, Y. Ohashi, M. Hoshino, H. Naiki, Biochim. Biophys. Acta Biomembr. 2007, 1768, 122. [53] M. Wakabayashi, K. Matsuzaki, FEBS Lett. 2009, 583, 2854. [54] F. Re, S. Sesana, A. Barbiroli, F. Bonomi, E. Cazzaniga, E. Lonati, A. Bulbarelli, M. Masserini, FEBS Lett. 2008, 582, 215. [55] C. C. Curtain, F. E. Ali, D. G. Smith, A. I. Bush, C. L. Masters, K. J. Barnham, J. Biol. Chem. 2003, 278, 2977. [56] L. Qiu, A. Lewis, J. Como, M. W. Vaughn, J. Huang, P. Somerharju, J. Virtanen, K. H. Cheng, Biophys. J. 2009, 96, 4299. [57] C. Cecchi, D. Nichino, M. Zampagni, C. Bernacchioni, E. Evangelisti, A. Pensalfini, G. Liguri, A. Gliozzi, M. Stefani, A. Relini, Biochim. Biophys. Acta Biomembr. 2009, 1788, 2204. [58] W. J. Cho, S. Trikha, A. M. Jeremic, J. Mol. Biol. 2009, 393, 765. [59] E. C. Hirsch, J. P. Brandel, P. Galle, F. Javoy-Agid, Y. Agid, J. Neurochem. 1991, 56, 446. [60] M. A. Lovell, J. D. Robertson, W. J. Teesdale, J. L. Campbell, W. R. Markesbery, J. Neurol. Sci. 1998, 158, 47. [61] A. Gaeta, R. C. Hider, Br. J. Pharmacol. 2005, 146, 1041. [62] E. House, J. Collingwood, A. Khan, O. Korchazkina, G. Berthon, C. Exley, J. Alzheimers Dis. 2004, 6, 291. [63] a) V. N. Uversky, J. Li, A. L. Fink, J. Biol. Chem. 2001, 276, 44284; b) Bharathi, S. S. Indi, K. S. J. Rao, Neurosci. Lett. 2007, 424, 78. [64] R. Lowe, D. L. Pountney, P. H. Jensen, W. P. Gai, N. H. Voelcker, Protein Sci. 2004, 13, 3245. [65] H.-Y. Kim, M.-K. Cho, A. Kumar, E. Maier, C. Siebenhaar, S. Becker, C. O. Fernandez, H. A. Lashuel, R. Benz, A. Lange, M. Zweckstetter, J. Am. Chem. Soc. 2009, 131, 17482. [66] M. Kostka, T. Hogen, K. M. Danzer, J. Levin, M. Habeck, A. Wirth, R. Wagner, C. G. Glabe, S. Finger, U. Heinzelmann, P. Garidel, W. Duan, C. A. Ross, H. Kretzschmar, A. Giese, J. Biol. Chem. 2008, 283, 10992. [67] a) J. D. Gehman, C. C. OBrien, F. Shabanpoor, J. D. Wade, F. Separovic, Eur. Biophys. J. 2008, 37, 333; b) T. L. Lau, E. E. Ambroggio, D. J. Tew, R. Cappai, C. L. Masters, G. D. Fidelio, K. J. Barnham, F. Separovic, J. Mol. Biol. 2006, 356, 759. [68] D. P. Smith, D. G. Smith, C. C. Curtain, J. F. Boas, J. R. Pilbrow, G. D. Ciccotosto, T.-L. Lau, D. J. Tew, K. Perez, J. D. Wade, A. I. Bush, S. C. Drew, F. Separovic, C. L. Masters, R. Cappai, K. J. Barnham, J. Biol. Chem. 2006, 281, 15145. [69] V. Rangachari, B. D. Moore, D. K. Reed, L. K. Sonoda, A. W. Bridges, E. Conboy, D. Hartigan, T. L. Rosenberry, Biochemistry 2007, 46, 12451. [70] Y. Shai, Biopolymers 2002, 66, 236. [71] a) M. N. Melo, R. Ferre, M. A. Castanho, Nat. Rev. Microbiol. 2009, 7, 245; b) H. W. Huang, Biochemistry 2000, 39, 8347. [72] I. C. Martins, I. Kuperstein, H. Wilkinson, E. Maes, M. Vanbrabant, W. Jonckheere, P. Van Gelder, D. Hartmann, R. DHooge, B. De Strooper, J. Schymkowitz, F. Rousseau, EMBO J. 2008, 27, 224. [73] M. J. O. Widenbrant, J. Rajadas, C. Sutardja, G. G. Fuller, Biophys. J. 2006, 91, 4071. [74] a) N. Arispe, H. B. Pollard, E. Rojas, Proc. Natl. Acad. Sci. USA 1993, 90, 10573; b) N. Arispe, H. B. Pollard, E. Rojas, Proc. Natl. Acad. Sci. USA 1996, 93, 1710; c) T. A. Mirzabekov, M. C. Lin, B. L. Kagan, J. Biol. Chem. 1996, 271, 1988; d) Y. Hirakura, M. C. Lin, B. L. Kagan, J. Neurosci. Res. 1999, 57, 458. [75] M. J. Volles, P. T. Lansbury, Jr., Biochemistry 2002, 41, 4595. [76] H. Monoi, S. Futaki, S. Kugimiya, H. Minakata, K. Yoshihara, Biophys. J. 2000, 78, 2892. [77] a) J. I. Kourie, A. Culverson, J. Neurosci. Res. 2000, 62, 120; b) J. I. Kourie, P. V. Farrelly, C. L. Henry, J. Neurosci. Res. 2001, 66, 214.
Angew. Chem. 2010, 122, 5760 5788

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5787

Aufstze
[108] a) A. Jan, O. Gokce, R. Luthi-Carter, H. A. Lashuel, J. Biol. Chem. 2008, 283, 28176; b) M. Wogulis, S. Wright, D. Cunningham, T. Chilcote, K. Powell, R. E. Rydel, J. Neurosci. 2005, 25, 1071. [109] D. Radovan, N. Opitz, R. Winter, FEBS Lett. 2009, 583, 1439. [110] L.-M. Yan, A. Velkova, M. Tatarek-Nossol, E. Andreetto, A. Kapurniotu, Angew. Chem. 2007, 119, 1268; Angew. Chem. Int. Ed. 2007, 46, 1246. [111] S. J. Singer, G. L. Nicolson, Science 1972, 175, 720. [112] a) M. Vestergaard, T. Hamada, M. Takagi, Biotechnol. Bioeng. 2008, 99, 753; b) L. Maler, A. Graslund, Methods Mol. Biol. 2009, 480, 129. [113] Y. H. Chan, S. G. Boxer, Curr. Opin. Chem. Biol. 2007, 11, 581. [114] L. A. Munishkina, A. L. Fink, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1862. [115] A. Fischer, T. Oberholzer, P. L. Luisi, Biochim. Biophys. Acta Biomembr. 2000, 1467, 177. [116] R. P. Nanga, J. R. Brender, J. Xu, K. Hartman, V. Subramanian, A. Ramamoorthy, J. Am. Chem. Soc. 2009, 131, 8252. [117] D. J. Schibli, L. T. Nguyen, S. D. Kernaghan, O. Rekdal, H. J. Vogel, Biophys. J. 2006, 91, 4413. [118] S. V. Dvinskikh, U. H. Durr, K. Yamamoto, A. Ramamoorthy, J. Am. Chem. Soc. 2007, 129, 794. [119] M. A. Cooper, A. C. Try, J. Carroll, D. J. Ellar, D. H. Williams, Biochim. Biophys. Acta Biomembr. 1998, 1373, 101. [120] E. Giannakis, J. Pacifico, D. P. Smith, L. W. Hung, C. L. Masters, R. Cappai, J. D. Wade, K. J. Barnham, Biochim. Biophys. Acta Biomembr. 2008, 1778, 1112. [121] A. Cruz, J. Prez-Gil, Methods Mol. Biol. 2007, 400, 439. [122] M. F. M. Engel, H. Yigittop, R. C. Elgersma, D. T. S. Rijkers, R. M. J. Liskamp, B. de Kruijff, J. W. M. Hppener, J. A. Killian, J. Mol. Biol. 2006, 356, 783. [123] M. Levy, N. Garmy, E. Gazit, J. Fantini, FEBS J. 2006, 273, 5724. [124] C. Rossi, J. Chopineau, Eur. Biophys. J. 2007, 36, 955. [125] R. P. Richter, R. Berat, A. R. Brisson, Langmuir 2006, 22, 3497. [126] B. A. Cornell, V. L. Braach-Maksvytis, L. G. King, P. D. Osman, B. Raguse, L. Wieczorek, R. J. Pace, Nature 1997, 387, 580. [127] B. Seantier, M.-C. Giocondi, C. Le Grimellec, P.-E. Milhiet, Curr. Opin. Colloid Interface Sci. 2008, 13, 326. [128] L. Zhang, J. Zhong, L. Huang, L. Wang, Y. Hong, Y. Sha, J. Phys. Chem. B 2008, 112, 8950. [129] P. Van Gelder, F. Dumas, M. Winterhalter, Biophys. Chem. 2000, 85, 153. [130] R. Khurana, C. Coleman, C. Ionescu-Zanetti, S. A. Carter, V. Krishna, R. K. Grover, R. Roy, S. Singh, J. Struct. Biol. 2005, 151, 229. [131] J. M. Rausch, W. C. Wimley, Anal. Biochem. 2001, 293, 258. [132] S. M. Butterfield, A. Hennig, S. Matile, Org. Biomol. Chem. 2009, 7, 1784. [133] G. Das, P. Talukdar, S. Matile, Science 2002, 298, 1600. [134] F. Kamp, K. Beyer, J. Biol. Chem. 2006, 281, 9251. [135] R. H. Ashley, T. A. Harroun, T. Hauss, K. C. Breen, J. P. Bradshaw, BMC Struct. Biol. 2006, 6, 21. [136] a) G. E. Fanucci, D. S. Cafiso, Curr. Opin. Struct. Biol. 2006, 16, 644; b) M. Margittai, R. Langen, Methods Enzymol. 2006, 413, 122; c) W. L. Hubbell, A. Gross, R. Langen, M. A. Lietzow, Curr. Opin. Struct. Biol. 1998, 8, 649. [137] S. M. Raja, S. S. Rawat, A. Chattopadhyay, A. K. Lala, Biophys. J. 1999, 76, 1469. [138] A. Chattopadhyay, H. Raghuraman, Curr. Sci. 2004, 87, 175. [139] A. S. Ladokhin, Biophys. J. 1993, 64, A290. [140] A. K. Ghosh, R. Rukmini, A. Chattopadhyay, Biochemistry 1997, 36, 14291. [141] C. Montagner, A. Perier, S. Pichard, G. Vernier, A. Menez, D. Gillet, V. Forge, A. Chenal, Biochemistry 2007, 46, 1878.

H. A. Lashuel und S. M. Butterfield

[142] a) C. Ege, K. Y. Lee, Biophys. J. 2004, 87, 1732; b) V. Vie, N. Van Mau, L. Chaloin, E. Lesniewska, C. Le Grimellec, F. Heitz, Biophys. J. 2000, 78, 846; c) D. Gidalevitz, Y. Ishitsuka, A. S. Muresan, O. Konovalov, A. J. Waring, R. I. Lehrer, K. Y. Lee, Proc. Natl. Acad. Sci. USA 2003, 100, 6302. [143] a) M. Bak, R. P. Bywater, M. Hohwy, J. K. Thomsen, K. Adelhorst, H. J. Jakobsen, O. W. Sorensen, N. C. Nielsen, Biophys. J. 2001, 81, 1684; b) A. Naito, T. Nagao, K. Norisada, T. Mizuno, S. Tuzi, H. Saito, Biophys. J. 2000, 78, 2405. [144] a) E. S. Salnikov, M. De Zotti, F. Formaggio, X. Li, C. Toniolo, J. D. ONeil, J. Raap, S. A. Dzuba, B. Bechinger, J. Phys. Chem. B 2009, 113, 3034; b) B. Bechinger, D. A. Skladnev, A. Ogrel, X. Li, E. V. Rogozhkina, T. V. Ovchinnikova, J. D. ONeil, J. Raap, Biochemistry 2001, 40, 9428. [145] J. Dittmer, L. Thogersen, J. Underhaug, K. Bertelsen, T. Vosegaard, J. M. Pedersen, B. Schiott, E. Tajkhorshid, T. Skrydstrup, N. C. Nielsen, J. Phys. Chem. B 2009, 113, 6928. [146] L. Yang, T. A. Harroun, T. M. Weiss, L. Ding, H. W. Huang, Biophys. J. 2001, 81, 1475. [147] C. R. Bodner, C. M. Dobson, A. Bax, J. Mol. Biol. 2009, 390, 775. [148] A. Naito, I. Kawamura, Biochim. Biophys. Acta Biomembr. 2007, 1768, 1900. [149] K. Bertelsen, J. M. Pedersen, B. S. Rasmussen, T. Skrydstrup, N. C. Nielsen, T. Vosegaard, J. Am. Chem. Soc. 2007, 129, 14717. [150] a) M. Tang, M. Hong, Mol. Biosyst. 2009, 5, 317; b) R. Mani, S. D. Cady, M. Tang, A. J. Waring, R. I. Lehrer, M. Hong, Proc. Natl. Acad. Sci. USA 2006, 103, 16242. [151] H. Jang, B. Ma, R. Lal, R. Nussinov, Biophys. J. 2008, 95, 4631. [152] a) F. Yoneyama, Y. Imura, K. Ohno, T. Zendo, J. Nakayama, K. Matsuzaki, K. Sonomoto, Antimicrob. Agents Chemother. 2009, 53, 3211; b) T. Tachi, R. F. Epand, R. M. Epand, K. Matsuzaki, Biochemistry 2002, 41, 10723. [153] K. Sekiya, R. Satoh, H. Danbara, Y. Futaesaku, J. Bacteriol. 1993, 175, 5953. [154] A. Olofsson, H. Hebert, M. Thelestam, FEBS Lett. 1993, 319, 125. [155] K. He, S. J. Ludtke, D. L. Worcester, H. W. Huang, Biophys. J. 1996, 70, 2659. [156] M. Han, Y. Mei, H. Khant, S. J. Ludtke, Biophys. J. 2009, 97, 164. [157] D. O. Mak, W. W. Webb, Biophys. J. 1995, 69, 2323. [158] E. S. Salnikov, H. Friedrich, X. Li, P. Bertani, S. Reissmann, C. Hertweck, J. D. ONeil, J. Raap, B. Bechinger, Biophys. J. 2009, 96, 86. [159] A. Pokorny, P. F. Almeida, Biochemistry 2004, 43, 8846. [160] A. Engel, P. Walter, J. Cell Biol. 2008, 183, 181. [161] R. Jahn, T. Lang, T. C. Sdhof, Cell 2003, 112, 519. [162] a) S. Dante, T. Hauss, A. Brandt, N. A. Dencher, J. Mol. Biol. 2008, 376, 393; b) T. Pillot, M. Goethals, B. Vanloo, C. Talussot, R. Brasseur, J. Vandekerckhove, M. Rosseneu, L. Lins, J. Biol. Chem. 1996, 271, 28 757. [163] I. Dupiereux, W. Zorzi, L. Lins, R. Brasseur, P. Colson, E. Heinen, B. Elmoualij, Biochem. Biophys. Res. Commun. 2005, 331, 894. [164] J. Madine, E. Hughes, A. J. Doig, D. A. Middleton, Mol. Membr. Biol. 2008, 25, 518. [165] a) D. K. Struck, D. Hoekstra, R. E. Pagano, Biochemistry 1981, 20, 4093; b) Y. Gong, Y. Luo, D. Bong, J. Am. Chem. Soc. 2006, 128, 14430. [166] H. Ellens, J. Bentz, F. C. Szoka, Biochemistry 1985, 24, 3099. [167] G. J. Gabriel, J. G. Pool, A. Som, J. M. Dabkowski, E. B. Coughlin, M. Muthukumar, G. N. Tew, Langmuir 2008, 24, 12489.

5788

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5760 5788

Zuschriften
Wasserspaltung
DOI: 10.1002/ange.201000664

Gekoppelte Herstellung von Wasserstoff und Ethylen in einem Membranreaktor**


Heqing Jiang,* Zhengwen Cao, Steffen Schirrmeister, Thomas Schiestel und Jrgen Caro*

Angewandte
5790

Chemie
 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim Angew. Chem. 2010, 122, 5790 5794

Angewandte
Mit Blick auf die Prozessintensivierung[1, 2] ist die Kopplung von zwei chemischen Reaktionen in einer Anlage sowohl fr die Forschung als auch fr die Industrie zunehmend interessant.[35] In den vergangenen Jahren konzentrierten sich die meisten dieser Studien auf die Verknpfung einer endothermen Dehydrierung mit einer exothermen Hydrierung von Kohlenwasserstoffen in einem Pd-Membranreaktor.[6, 7] Solche gekoppelten Dehydrierungen/Hydrierungen werden auch in Festbettreaktoren untersucht; ein Beispiel ist die simultane Dehydrierung von Ethylbenzol und Hydrierung von Benzol.[8] Vor einiger Zeit berichteten Kondratenko et al. ber die Herstellung von Ethylen bei gleichzeitig annhernd 100-proz. Umsatz von Lachgas (N2O) durch die Kopplung des N2O-Abbaus mit der thermischen Dehydrierung von Ethan in einem katalytischen Festbettreaktor.[9] Durch die Kopplung der beiden Reaktionen im Festbettreaktor wird jedoch ein nachtrgliches Trennverfahren notwendig, um das Zielprodukt Ethylen zu separieren. Fhrt man die Reaktionen dagegen in einem Membranreaktor durch, knnen die Produkte auf beiden Seiten der Membran getrennt gehalten werden. Deshalb ist es attraktiv, nach neuen industriell interessanten Reaktionspaaren fr Membranreaktoren zu suchen. In den vergangenen Jahrzehnten hat die Wasserstoffproduktion durch Wasserspaltung viel Aufmerksamkeit auf sich gezogen, da Wasserstoff eine vielversprechende Alternative zu fossilen Energietrgern ist.[10, 11] Um die Wasserstoffproduktion der gleichgewichtskontrollierten thermischen Wasserspaltung zu beschleunigen, kann der simultan anfallende Sauerstoff in situ entnommen werden, indem eine gemischtleitende Membran fr Sauerstoffionen- und Elektronenleitung eingesetzt wird.[1216] Hierbei war eine hohe Betriebstemperatur von 1683 8C notwendig, um eine brauchbare Wasserstoffproduktionsgeschwindigkeit von 0.6 cm3 min1 cm2 mit einer gemischtleitenden ZrO2-TiO2-Y2O3-Membran zu erhalten.[17] Um die Betriebstemperatur abzusenken, koppelten Balachandran et al. die Wasserspaltung mit einer Wasserstoffverbrennung als Modellreaktion in einem Membranreaktor, indem Wasserstoff auf der Permeatseite zugefhrt wurde, um den permeierten Sauerstoff zu verbrauchen.[18] Eine maximale Wasserstoffproduktionsgeschwindig[*] Dr. H. Jiang, Z. Cao, Prof. Dr. J. Caro Institut fr Physikalische Chemie und Elektrochemie Leibniz-Universitt Hannover Callinstrae 3A, 30167 Hannover (Deutschland) Fax: (+ 49) 511-7621-9121 E-Mail: heqing.jiang@pci.uni-hannover.de juergen.caro@pci.uni-hannover.de Dr. S. Schirrmeister Uhde GmbH Friedrich-Uhde-Strae 15, 44141 Dortmund (Deutschland) Dr. T. Schiestel Fraunhofer Institut fr Grenzflchen- und Bioverfahrenstechnik (IGB), Nobelstrae 12, 70569 Stuttgart (Deutschland) [**] Die Autoren danken dem BMBF (Projekt 03C0343A SynMem unter der Schirmherrschaft von ConNeCat (Competence Network Catalysis)) fr die finanzielle Untersttzung sowie A. Feldhoff und F. Steinbach fr Hilfe bei der Elektronenmikroskopie. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201000664 zu finden.
Angew. Chem. 2010, 122, 5790 5794

Chemie

keit von 10.0 cm3 min1 cm2 wurde bei 900 8C als Nachweis der prinzipiellen Machbarkeit des Konzepts erreicht. Da bei dieser Modellreaktion die Menge des hergestellten Wasserstoffs maximal der Menge des verbrauchten Wasserstoffs entsprechen kann, haben wir nach praxisrelevanten gekoppelten Reaktionen in Membranreaktoren mit sauerstofftransportierender Membran gesucht. Vor einiger Zeit berichteten wir ber die Kopplung der Wasserspaltung mit der Partialoxidation von Methan fr die simultane Herstellung von Wasserstoff und Synthesegas (Gemisch aus CO + H2) bei Temperaturen zwischen 850 und 950 8C in einem Perowskit-BaCoxFeyZr1xyO3d(BCFZ)-Hohlfasermembranreaktor.[19] Die BCFZ-Hohlfasermembran zeigt eine hohe Sauerstoffpermeationsrate und wurde daher fr die Herstellung von sauerstoffangereicherter Luft und den Abbau von Stickoxiden ausgeprft.[2022] In vorliegender Arbeit kombinieren wir Wasserspaltung und oxidative Ethandehydrierung in einem sauerstoffpermeablen BCFZ-Hohlfasermembranreaktor bei moderaten Temperaturen (700 bis 800 8C) (Abbildung 1). Zuerst disso-

Abbildung 1. Diagramm der gekoppelten Wasserspaltung und Ethandehydrierung in einem sauerstoffpermeablen Perowskit-Membranreaktor.

ziiert Wasser zu Wasserstoff und Sauerstoff auf der Innenseite der BCFZ-Membran. Der entstandene Sauerstoff wird als Sauerstoffion (O2) auf Vakanzen des Perowskitgitters eingebaut und durch Bulk-Diffusion auf die Ethanseite der Membran transportiert, wo Sauerstoff verbraucht wird, um Ethan zu Ethylen nach C2H6 + O2 !C2H4 + H2O + 2 e oxidativ zu dehydrieren. Die lokale Ladungsneutralitt wird durch die Gegendiffusion von Elektronen aufrechterhalten. Der bei der thermischen Wasserspaltung entstehende Sauerstoff kann auf diese Weise kontinuierlich ber die BCFZMembran abgefhrt werden, und der Wasserstoff verbleibt zusammen mit unreagiertem Dampf im Retentat. Gleichzeitig kann mehr Ethylen nach Kondensation des Dampfes auf der Auenseite der Membran gewonnen werden. Der Vorteil dieser Kopplungsstrategie besteht darin, dass der durch Wasserspaltung hergestellte Wasserstoff und das durch oxidative Ethandehydrierung entstandene Ethylen im Membranreaktor immer getrennt anfallen. Experimentell wurde festgestellt, dass die Wasserstoffproduktion durch Wasserspaltung auf der Innenseite der Hohlfaser bei Temperaturen unter 950 8C sehr langsam ist (<0.025 cm3 min1 cm2), wenn nur das inerte Splgas He auf www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5791

Zuschriften
der Auenseite der BCFZ-Hohlfasermembran eingesetzt wird, um den Sauerstoff-Partialdruck zu reduzieren.[19] Signifikante Mengen von Wasserstoff wurden jedoch auf der Dampfseite sogar bei migen Temperaturen (700-800 8C) gewonnen, wenn der Sauerstoff reaktiv verbraucht wurde, indem die Wasserdissoziation mit der Ethandehydrierung gekoppelt wurde. Abbildung 2 a zeigt, dass bei Zufuhr von
Tabelle 1: Ethanumsatz X(C2H6) und Ethylenselektivitt S(C2H4) auf der Auenseite der BCFZ-Membran bei unterschiedlichen Temperaturen. T [8C] 700 750 775 800 X(C2H6) [%] 6 20 37 59 S(C2H4) [%] 67 89 88 89

Innenseite: 40 cm3 min1 (FH2 O = 30 cm3 min1, FHe = 10 cm3 min1). Auenseite: 40 cm3 min1 (FC2 H6 = 3 cm3 min1, FHe = 36 cm3 min1, FNe = 1 cm3 min1).

Abbildung 2. Geschwindigkeit der H2-Produktion auf der Innenseite der Membran als Funktion der Temperatur. Innenseite: FH2 O = 30 cm3 min1, FHe = 10 cm3 min1; Auenseite: Ftotal = 40 cm3 min1 mit einer Ethankonzentration von a) 7.5 % und b) 20 %.

7.5 Vol.-% Ethan an die Auenseite der Hohlfaser die Wasserstoffproduktionsrate durch Wasserspaltung von 0.1 auf 0.4 cm3 min1 cm2 steigt, wenn die Temperatur von 700 auf 800 8C ansteigt. Durch die ansteigende Temperatur verschiebt sich das Gleichgewicht der endothermen Wasserspaltung in Richtung auf die Spaltprodukte Sauerstoff und Wasserstoff. Laut Wagner-Theorie steigt die Sauerstoffpermeationsrate der BCFZ-Membran mit steigender Temperatur.[23, 24] Die schnelle Entnahme des durch Wasserspaltung hergestellten Sauerstoffs fhrt dazu, dass mehr Wasser dissoziiert und so die Gleichgewichtslimitierung der Wasserstoffproduktion berwunden wird. Laut der Wagner-Theorie ist die Sauerstoffpermeationsrate neben der Betriebstemperatur und der Membrandicke[23, 24] auch vom Gradienten des Sauerstoff-Partialdrucks ber die Membran abhngig. Indem mehr sauerstoffverbrauchendes Ethan der Auenseite der BCFZ-Membran zugefhrt wird, kommt eine grere Triebkraft fr die schnelle Entnahme des Sauerstoffs von der Dampfseite her zustande, und die Wasserstoffproduktion wird beschleunigt. Abbildung 2 zeigt die Temperaturabhngigkeit der Wasserstoffproduktionsrate, wenn 7.5 Vol.-% (a) oder 20 Vol.-% Ethan (b) im Eduktgas an die Auenseite der Hohlfaser gefhrt werden. Im Fall (b) ist die Wasserstoffproduktionsrate hher als im Fall (a) und erreicht bei 800 8C 1.2 cm3 min1 cm2 (Abbildung 2 b). Der permeierte Sauerstoff aus der Wasserspaltung kann fr die oxidative Dehydrierung von Ethan (ODE) zu Ethylen auf der Auenseite der Membran benutzt werden. Tabelle 1 zeigt, wie sich der Ethanumsatz von 6 % auf 59 % und die Ethylenselektivitt von 67 % auf 89 % bei Temperaturerhhung von 700 auf 800 8C erhhte. Bei einer Temperatur von 700 8C wurde nur eine sehr kleine Menge Wasserstoff auf der

Auenseite (< 0.15 % H2) nachgewiesen. Dies zeigt, dass der ODE-Prozess (C2H6 + O2 !C2H4 + H2O + 2 e) gegenber der thermischen Dehydrierung von Ethan (TDE: C2H6QC2H4 + H2) dominiert. Da lediglich Spuren von COx gefunden wurden und der permeierte Sauerstoff hauptschlich mit Wasserstoff zu Wasser reagierte, kann die Menge Wasser, die auf der Auenseite produziert wird, aus der Differenz der Strmungsgeschwindigkeiten zwischen H2 und C2H4 am Ausgang abgeschtzt werden. Die Produktionsrate fr Wasser auf der Auenseite betrgt 0.06 cm3 min1 cm2 bei 700 8C und 0.5 cm3 min1 cm2 bei 800 8C, was ungefhr dem Wasserverbrauch auf der Innenseite entspricht. Bei einer Temperatur von 800 8C kann der TDE-Prozess nicht vernachlssigt werden, er findet parallel zum ODE-Prozess statt.[2527] Als Folge waren Ethylen, Wasserstoff, Wasser und nichtumgesetztes Ethan auf der Auenseite vorhanden; die Ethylenausbeute betrgt ca. 55 % bei 800 8C. Als Referenzversuch wurde die Dehydrierung von Ethan in der Anwesenheit von Wasserdampf auch in einem mit BCFZ-Perowskit gefllten Festbettreaktor untersucht. Bei einer Temperatur von 800 8C wurde eine Ethylenausbeute von 47 % mit einer Ethylenselektivitt von 71 % im Festbettreaktor erreicht (Tabelle S1 in den Hintergrundinformationen). Es liegt auf der Hand, dass auf der Basis der Kopplungsstrategie im BCFZ-Membranreaktor mehr Ethylen gewonnen wurde. Abbildung 3 zeigt die simultane Herstellung von Wasserstoff und Ethylen im BCFZ-Hohlfasermembranreaktor als Funktion der Zeit. ber 100 h wurden konstant ca. 60 % Ethanumsatz und 90 % Ethylenselektivitt erzielt. Gleichzeitig erreichte die Wasserstoffproduktionsrate

Abbildung 3. H2-Produktion an der Innenseite des Membranreaktors und simultane Ethylenproduktion an der Auenseite bei 800 8C. Innenseite: FH2 O = 30 cm3 min1 und FHe = 10 cm3 min1; Auenseite: 40 cm3 min1 (FC2 H6 = 3 cm3 min1, FHe = 36 cm3 min1 und FNe = 1 cm3 min1).
Angew. Chem. 2010, 122, 5790 5794

5792

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
0.8 cm3 min1 cm2 auf der Dampfseite. Nach Abbruch des Versuchs nach 100 h war die BCFZ-Hohlfasermembran noch intakt und gebrauchsfhig. Die ausgebaute Hohlfaser wurde durch Rasterelektronenmikroskopie (SEM) charakterisiert. Die Membranoberflche war zwar auf der Ethanseite erodiert, aber es gab keine Rissentwicklung in den mittleren dichten Teil der Membran hinein. Im Unterschied zu den porsen Membranen[28, 29] erlaubt die nichtporse, dichte BCFZ-Membran den Transport von Sauerstoffionen mit unendlicher Selektivitt, und deshalb gibt es keine Permeation von anderen Gasen (einschlielich Wasser) durch diese Membran.[13, 22] Abbildung 4 a Forschungsanstrengungen zielen darauf, die niedrige Effizienz und die ungengende Stabilitt photoelektrolytischer und photokatalytischer Verfahren unter Einsatz von Sonnenlicht zu berwinden.[32, 33] Verglichen mit der Wasserspaltung durch Elektrolyse oder Photokatalyse wrde die direkte thermische Wasserstoffherstellung erfordern, Wasser auf ber 2500 8C zu erhitzen, um eine nennenswerte Ausbeute zu erzielen. Insbesondere im Hinblick auf die Materialien ist es schwierig, diese Temperatur zu erreichen und zu erhalten. In dieser Arbeit wurde die Gleichgewichtslimitierung der Wasserspaltung berwunden, indem die Wasserspaltung mit dem ODE-Verfahren auf den beiden Seiten eines sauerstoffpermeablen BCFZ-Membranreaktors gekoppelt wurde. Bei einer Betriebstemperatur von nur 800 8C wurde dadurch eine Wasserstoffproduktion von ca. 1.0 cm3 min1 cm2 erreicht. Gleichzeitig kann der permeierte Sauerstoff der Wasserspaltung verwendet werden, um auf der anderen Seite der Membran Ethan oxidativ zu Ethylen zu dehydrieren. Wir weisen darauf hin, dass sich die membranbasierte Wasserstoffherstellung durch Wasserspaltung noch in einem Anfangsstadium befindet und weitere Bemhungen im Labor notwendig sind, um in naher Zukunft die Eigenschaften und die Stabilitt der Membran zu verbessern.

Chemie

Experimentelles
Die dichten BCFZ-Hohlfasermembranen wurden durch ein Phaseninversionsverfahren mit anschlieendem Sintern hergestellt.[34] Die gesinterte Faser hatte eine Wandstrke von ca. 0.17 mm mit einem Auendurchmesser von 1.1 mm und einem Innendurchmesser von 0.76 mm. Um die gewnschten isothermen Bedingungen zu erreichen, wurden zwei Enden der Faser mit einer Au-Paste beschichtet und bei 950 8C gesintert; dadurch entstand eine dichte Au-Schicht, die fr Sauerstoff nicht permeabel ist. Die Lnge des unbeschichteten mittleren Teils betrgt hier 3 cm, und die wirksame Membranflche betrgt 0.86 cm2. Die Messungen wurden, wie in einer frheren Studie beschrieben, in einem Hochtemperaturreaktor durchgefhrt.[1921] Abbildung S1 in der Hintergrundinformationen zeigt ein Diagramm des eingesetzten Membranreaktors. Die Au-beschichtete Hohlfaser wurde mit einem Silicon-Gummiring abgedichtet, und der unbeschichtete Teil, der fr den Sauerstoff permeabel ist, wurde in die Mitte des Ofens gehalten. Verdnntes H2O wurde in einem He-Strom an der Membraninnenseite zugefhrt; ein Gemisch von C2H6, Ne und He wurde an der Auenseite zugefhrt. Die Strmungsgeschwindigkeiten fr C2H6, He und Ne wurden durch Gasdurchflussregler kontrolliert (Bronkhorst). Die Strmungsgeschwindigkeit fr H2O wurde durch einen Flssigkeitsdurchflussregler kontrolliert (Bronkhorst). Wasser wurde bei 180 8C vollstndig verdampft, bevor es zum Reaktor gefhrt wurde. Alle Gasleitungen des Reaktors und des Gaschromatographen wurden auf 180 8C erhitzt. Die Gaskonzentrationen am Ausgang des Reaktors wurden durch einen Online-Gaschromatographen (Agilent 6890) ermittelt. Unter der Annahme, dass der Sauerstoff der Wasserspaltung auf der Innenseite vollstndig permeiert und die Strmungsgeschwindigkeit am Ausgang der Geschwindigkeit am Eingang gleichkommt, wurde die H2-Produktionsrate auf der Innenseite mit der Gesamtstrmungsgeschwindigkeit Fcore (cm3 min1), der Wasserstoffkonzentration c(H2) und der wirksamen Membranflche S (cm2) mit Gleichung (1) berechnet: J H2 Fcore cH2 S 1

Abbildung 4. SEM-Aufnahmen der Ethanseite der BCFZ-Hohlfasermembran nach 100 h Reaktionszeit (siehe Abbildung 3). a) Querschnitt; b, c) Draufsicht; d) Verteilung von elementarem Cobalt.

zeigt den Querschnitt der eingesetzten BCFZ-Hohlfaser auf der Ethanseite mit einer ca. 10 mm erodierten Schicht auf der Membranoberflche. Kleine Partikel von 0.21.0 mm waren auf der Membranoberflche gleichmig verteilt (Abbildung 4 b und c). Mittels energiedispersiver Rntgenspektroskopie (EDXS) (Abbildung 4 d) wurde Cobaltoxid als Hauptbestandteil der kleinen Partikel nachgewiesen. Schon frher wurde berichtet, dass es durch Cobalt-Extraktion infolge der Reduktion von Cobaltkationen im Perowskit zur Bildung von Cobalt-angereicherten Oberflchenpartikeln kommt.[30] Wegen der reduzierenden Ethan/Ethylen-Atmosphre knnten auch hier Cobaltkationen des PerowskitBCFZ-Gitters teilweise reduziert werden. Dies fhrte zur Bildung der auf der Oberflche erodierten Schicht mit einer Strke von ca. 10 mm. Prinzipiell kann Wasserstoff aus Wasser auch durch Elektrolyse oder Photokatalyse hergestellt werden.[3133] Gegenwrtig ist die Wasserelektrolyse eine bliche Methode fr die Herstellung von Wasserstoff in kleinen Mengen. Das Hauptproblem bei der kommerziellen Anwendung dieser Technik fr die Wasserstoffproduktion in groen Mengen sind die hohen Kosten fr den Strom, die Edelmetallkatalysatoren und letztlich die geringe Effizienz.[31, 32] Gegenwrtige
Angew. Chem. 2010, 122, 5790 5794

Die C2H6-Umwandlung X(C2H6) und die C2H4-Selektivitt S(C2H4) wurden mit den Gleichungen (2) und 3 berechnet, wobei F(i)

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5793

Zuschriften
die Strmungsgeschwindigkeit der Molekle i auf der Auenseite der Hohlfasermembran ist.  X C2 H6 1  F C2 H6 ; out 100% F C2 H6 ; in 2 [14] Y. T. Liu, X. Y. Tan, K. Li, Catal. Rev. Sci. Eng. 2006, 48, 145 198. [15] C. Chen, S. J. Feng, S. Ran, D. C. Zhu, W. Liu, H. J. M. Bouwmeester, Angew. Chem. 2003, 115, 5354 5356; Angew. Chem. Int. Ed. 2003, 42, 5196 5198. [16] J. Caro, K. J. Caspary, C. Hamel, B. Hoting, P. Klsch, B. Langanke, K. Nassauer, T. Schiestel, A. Schmidt, R. Schomcker, A. Seidel-Morgenstern, E. Tsotsas, I. Voigt, H. H. Wang, R. Warsitz, S. Werth, A. Wolf, Ind. Eng. Chem. Res. 2007, 46, 2286 2294. [17] H. Naito, H. Arashi, Solid State Ionics 1995, 79, 366 370. [18] U. Balachandran, T. H. Lee, S. E. Dorris, Int. J. Hydrogen Energy 2007, 32, 451 456. [19] H. Q. Jiang, H. H. Wang, S. Werth, T. Schiestel, J. Caro, Angew. Chem. 2008, 120, 9481 9484; Angew. Chem. Int. Ed. 2008, 47, 9341 9344. [20] H. Q. Jiang, L. Xing, O. Czuprat, H. H. Wang, S. Schirrmeister, T. Schiestel, J. Caro, Chem. Commun. 2009, 6738 6740. [21] H. Q. Jiang, H. H. Wang, F. Y. Liang, S. Werth, T. Schiestel, J. Caro, Angew. Chem. 2009, 121, 3027 3030; Angew. Chem. Int. Ed. 2009, 48, 2983 2986. [22] H. H. Wang, S. Werth, T. Schiestel, J. Caro, Angew. Chem. 2005, 117, 7066 7069; Angew. Chem. Int. Ed. 2005, 44, 6906 6909. [23] M. Schroeder, Phys. Chem. Chem. Phys. 2005, 7, 166 172. [24] R. Merkle, J. Maier, H. J. M. Bouwmeester, Angew. Chem. 2004, 116, 5179 5183; Angew. Chem. Int. Ed. 2004, 43, 5069 5073. [25] S. Gaab, M. Machli, J. Find, R. K. Grasselli, J. A. Lercher, Top. Catal. 2003, 23, 151 158. [26] F. Cavani, N. Ballarini, A. Cericola, Catal. Today 2007, 127, 113 131. [27] O. Czuprat, S. Werth, S. Schirrmeister, T Schiestel, J. Caro, ChemCatChem 2009, 1, 401 405. [28] A. V. Gaikwad, V. Boffa, J. E. ten Elshof, G. Rothenberg, Angew. Chem. 2008, 120, 5487 5490; Angew. Chem. Int. Ed. 2008, 47, 5407 5410. [29] R. Kreiter, M. D. A. Rietkerk, H. L. Castricum, H. M. van Veen, J. E. ten Elshof, J. F. Vente, ChemSusChem 2009, 2, 158 160. [30] L. Bedel, A. C. Roger, C. Estournes, A. F. Sammels, Catal. Today 2003, 85, 207 218. [31] M. C. Petri, B. Yildiz, A. E. Klickman, Int. J. Nuclear Hydrogen Production and Application 2006, 1, 79 91. [32] J. D. Holladay, J. Hu, D. L. King, Y. Wang, Catal. Today 2009, 139, 244 260. [33] R. M. Navarro, M. C. Snchez-Snchez, M. C. Alvarez-Galvan, F. del Valle, J. L. G. Fierro, Energy Environ. Sci. 2009, 2, 35 34. [34] T. Schiestel, M. Kilgus, S. Peter, K. J. Caspary, H. H. Wang, J. Caro, J. Membr. Sci. 2005, 258, 1 4.

SC2 H4

F C2 H4 ; out 100% F C2 H6 ; in F C2 H6 ; out

Die Oberflchenmorphologie der eingesetzten Faser wurde mit einem Feldemissions-SEM der Bauart JEOL JSM-6700F untersucht. Ein EDX-Spektrometer der Bauart Oxford Instruments INCA-300 wurde fr die Elementaranalyse verwendet. Eingegangen am 3. Februar 2010, vernderte Fassung am 22. Mrz 2010 Online verffentlicht am 9. Juni 2010

Stichwrter: Ethandehydrierung Membranreaktoren Perowskit Wasserspaltung Wasserstoff

[1] S. A. Bhat, J. Sadhukhan, AIChE J. 2009, 55, 408 422. [2] J. Prez-Ramrez, B. Vigeland, Angew. Chem. 2005, 117, 1136 1139; Angew. Chem. Int. Ed. 2005, 44, 1112 1115. [3] V. R. Choudhary, B. S. Uphade, S. A. R. Mulla, Angew. Chem. 1995, 107, 721 723; Angew. Chem. Int. Ed. Engl. 1995, 34, 665 666. [4] R. C. Ramaswamy, P. A. Ramachandran, M. P. Dudukovic, Chem. Eng. Sci. 2008, 63, 1654 1667. [5] J. H. Blank, J. Beckers, P. E. Collignon, F. Clerc, G. Rothenberg, Chem. Eur. J. 2007, 13, 5121 5128. [6] T. M. Moustafa, S. S. E. H. Elnashaie, J. Membr. Sci. 2000, 178, 171 184. [7] M. H. Khademi, A. Jahanmiri, M. R. Rahimpour, Int. J. Hydrogen Energy 2009, 34, 5091 5107. [8] M. E. E. Abashar, Chem. Eng. Process. 2004, 43, 1195 1202. [9] E. V. Kondratenko, O. Ovsitser, Angew. Chem. 2008, 120, 3271 3273; Angew. Chem. Int. Ed. 2008, 47, 3227 3229. [10] D. Lu, T. Takata, N. Saito, Y. Inoue, K. Domen, Nature 2006, 440, 295 297. [11] O. Coskuner, E. A. A. Jarvis, T. C. Allison, Angew. Chem. 2007, 119, 7999 8001; Angew. Chem. Int. Ed. 2007, 46, 7853 7855. [12] H. H. Wang, Z. Cong, W. S. Yang, Chem. Commun. 2002, 1468 1469. [13] J. Sunarso, S. Baumann, J. M. Serra, W. A. Meulenberg, S. Liu, Y. S. Lin, J. D. Costa, J. Membr. Sci. 2008, 320, 13 41.

5794

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5790 5794

Angewandte
DOI: 10.1002/ange.201001938

Chemie

Schwerer Cyanwasserstoff

Die Bindungsverhltnisse in schweren Analoga des Cyanwasserstoffs: der merkwrdige Fall des HPSi**
Valerio Lattanzi, Sven Thorwirth, DeWayne T. Halfen, Leonie Anna Mck, Lucy M. Ziurys, Patrick Thaddeus, Jrgen Gauss* und Michael C. McCarthy*
Bindungen zwischen Elementen der zweiten und dritten Periode knnen sich grundlegend unterscheiden. So haben z. B. die einfachen ungesttigten Siliciumwasserstoffe Si2H2 und Si2H4 ungewhnliche Strukturen, wenn man sie mit den analogen Kohlenwasserstoffen vergleicht.[1] Im Unterschied zum linearen Acetylen, HCCH, hat Si2H2 in seiner stabilsten Form eine gewinkelte Struktur mit C2v-Symmetrie und zwei verbrckenden H-Atomen. Phosphor und Stickstoff haben hnliche Bindungseigenschaften, aber P bildet eher Einfachals Mehrfachbindungen. Aus diesen Grnden ist es schwierig, a priori die stabilste Konstitution vorherzusagen. Dies gilt selbst fr kleine Molekle mit nur einem einzigen P- oder SiAtom und besonders dann, wenn beide Elemente enthalten sind. Silicium-Phosphor-Bindungen sind in den Materialwissenschaften[2] und der metallorganischen Chemie[3] von Bedeutung. Rntgenographisch wurden die Strukturen einiger hundert grerer Molekle mit Si-P-Bindungen ermittelt,[4] jedoch mit Genauigkeiten von nur etwa 0.05 . PhosphorSilicium-Mehrfachbindungen wurden bisher ausschlielich bei sterisch stabilisierten Phosphasilenen R2Si = PR beobachtet.[5] Die Strukturen zweier dieser Spezies wurden durch
[*] Dr. V. Lattanzi, Prof. P. Thaddeus, Dr. M. C. McCarthy Harvard-Smithsonian Center for Astrophysics 60 Garden Street, Cambridge, MA 02138 (USA) und School of Engineering and Applied Sciences Harvard University, Cambridge, MA 02138 (USA) Fax: (+ 1) 617-495-7013 Dr. S. Thorwirth I. Physikalisches Institut, Universitt zu Kln (Deutschland) und Max-Planck-Institut fr Radioastronomie (Deutschland) Dr. D. T. Halfen, Prof. L. M. Ziurys Departments of Chemistry and Astronomy and Steward Observatory, University of Arizona (USA) Dipl.-Chem. L. A. Mck, Prof. Dr. J. Gauss Institut fr Physikalische Chemie, Universitt Mainz 55099 Mainz (Deutschland) Fax: (+ 49) 6131-39-23895 E-Mail: gauss@uni-mainz.de [**] Die Arbeiten in Cambridge und Tucson wurden vom National Science Foundation Center for Chemical Innovation (Grant CHE 0847919) finanziell untersttzt. D.T.H. wird durch ein NSF Astronomy and Astrophyics Postdoctoral Fellowship (AST 06-02282) untersttzt. S.T. und J.G. danken der Deutschen Forschungsgemeinschaft (TH1301/3-1 und GA370/5-1). L.A.M wird durch ein Stipendium der Graduale School of Excellence MAINZ untersttzt. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201001938 zu finden.
Angew. Chem. 2010, 122, 5795 5798

Rntgenbeugung am Einkristall bestimmt.[6] Unsere Kenntnis der Si-P-Bindung ist dementsprechend als unzureichend zu bezeichnen. Gasphasenuntersuchungen an Phosphor-Silicium-Verbindungen werden durch deren hohe Reaktivitt erschwert; infolgedessen liegen nur fr wenige Spezies mit Si-P-Bindungen przise (d. h. mit einer Genauigkeit von besser als 0.05 ) charakterisierte Strukturen vor.[7] Zu erwhnen ist auch, dass kleine Si- oder P-haltige Molekle von Interesse fr die Astronomie sind,[8] da einige von ihnen im interstellaren Raum nachgewiesen wurden. HPSi ist die vielleicht einfachste ungesttigte Substanz, die eine chemische Bindung zwischen Silicium und Phosphor aufweist. Quantenchemische Rechnungen und experimentelle Untersuchungen[9] zeigen, dass die bei weitem stabilste Anordnung fr HCN, HNC und die schweren Analoga HNSi und HCP linear ist. Bis zur vorliegenden Untersuchung lagen keine experimentellen Daten fr HPSi vor, jedoch lieen Abinitio-Rechnungen darauf schlieen,[1012] dass eine berbrckte Struktur mit einer Si=P-Doppelbindung (in der Folge als HPSi bezeichnet) stabiler als lineares HSiP ist. Die Rechnungen[12] sagten einen Energieunterschied in der Grenordnung von 10 kcal mol1 zwischen beiden Formen voraus; ein 13 kcal mol1 ber HPSi liegender bergangszustand verbindet beide Isomere. Wasserstoffbrcken kommen zwar in Siliciumwasserstoff-Verbindungen vor, allerdings waren bisher keine phosphorhaltigen Molekle dieses Typs bekannt. Fr den Nachweis von HPSi sowie zur Bestimmung seiner Geometrie und Bindungssituation wurde das Rotationsspektrum dieser Verbindung experimentell untersucht. Die Rotationsspektroskopie ist eine ideale Technik zur Untersuchung von HPSi und anderen polaren Moleklen, da die Rotationsfrequenzen in direkter Relation zu den Trgheitsmomenten um die drei Haupttrgheitsachsen des Molekls stehen. Die Substitution mit Isotopen ermglicht schlielich die sehr genaue Bestimmung der Moleklstrukturen, denn die Bindungslngen knnen so mit einer Unsicherheit von nur etwa 0.010 ermittelt werden. Werden die experimentellen Rotationskonstanten um den Einfluss der Nullpunktsschwingungseffekte korrigiert, ist es sogar mglich, Genauigkeiten von 0.001 oder besser zu erreichen. Fr die hier vorgestellten experimentellen Untersuchungen dienten Coupled-Cluster-Rechnungen auf gleichem Niveau wie beim unlngst charakterisierten Silanthion, H2SiS,[13] als Leitfaden. Details zur Methode, die fr die quantitative Behandlung von Elektronenkorrelation und Basissatzeffekten in den quantenchemischen Berechnungen verwendet wurde, sind unten aufgefhrt oder knnen Lit. [14] entnommen werden.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5795

Zuschriften
HPSi wurde in der Gasphase durch Entladung von Silan und Phosphin in Neon erzeugt und mithilfe von FourierTransformations-Mikrowellenspektroskopie und Millimeterwellenspektroskopie charakterisiert. Das Molekl konnte durch Beobachtung des niedrigsten Rotationsbergangs bei einer Frequenz um 16 GHz eindeutig nachgewiesen werden (Abbildung 1). Das Spektrum zeigt eine Hyperfeinstruktur 40 kHz (quadratischer Mittelwert, rms) reproduziert werden, was bei den meisten Messungen nur einem Bruchteil der spektralen Linienbreite entspricht. Die mit einer Genauigkeit von besser als 0.1 % bestimmten Rotationskonstanten sind in Tabelle 1 zusammengefasst, wo sie den theoretischen VorTabelle 1: Rotationskonstanten von HPSi und DPSi (in MHz).[a] Konstante A0 B0 C0 HPSi DPSi experimentell theoretisch[b] experimentell theoretisch[b] 297 187(20) 296 559.5 8168.95742(81) 8170.0 7936.6581(11) 7939.0 152 598(63) 152 442.0 8169.9398(16) 8171.5 7737.4098(16) 7740.0

[a] 1s-Unsicherheiten (in Klammern) in den Einheiten der letzten signifikanten Stelle. [b] Siehe Text.

Abbildung 1. Der energetisch niedrigste Rotationsbergang von HPSi (10,100,0) zeigt aufgrund der Wechselwirkung des 31P-Kernspins (I = 1=2 ) mit einem kleinen rotationsinduzierten magnetischen Feld eine so genannte Hyperfeinstruktur. Ein simuliertes Strichspektrum mit berechneten relativen Intensitten ist in Grau unter dem beobachteten Spektrum gezeigt. Jeder Rotationsbergang ist in zwei Komponenten aufgespalten, da sich der berschallmoleklstrahl kollinear zu den beiden Ausbreitungsrichtungen des molekularen Emissionsfeldes bewegt. Die Integrationszeit betrug 1 min.

mit eng zusammen liegenden Linien, wie sie charakteristisch fr 31P-haltige (I = 1=2 ) Molekle ist. Wegen des gnstigen Signal/Rausch-Verhltnisses konnten die entsprechenden Linien der 29Si- und 30Si-isotopensubstituierten Spezies ebenfalls detektiert werden, obwohl deren natrliche Isotopenhufigkeit mit 4.7 (29Si) und 3.1 % (30Si) vergleichsweise gering ist. Zustzliche Linien wurden bei 32 GHz beobachtet, was in etwa der doppelten Frequenz des Fundamentalbergangs entspricht. Bei Verwendung von SiD4 anstelle von SiH4 konnten die entsprechenden bergnge auch fr DPSi, DP29Si und DP30Si detektiert werden. Da die A-Rotationskonstante durch die D-Substitution etwa halbiert wird, war es mglich, fr DPSi zwei zustzliche Linien mit Ka = 1 zu messen. Basierend auf den Messungen bei 1632 GHz wurden die Rotationsspektren von HPSi und DPSi bei hheren Frequenzen (287421 GHz) aufgenommen, um die spektroskopischen Konstanten der beiden Isotopenspezies genauer bestimmen zu knnen. Fr HPSi wurden mehr als 200 und fr DPSi 30 Rotationsbergnge gemessen. Die spektroskopischen Konstanten der beiden isotopologen Spezies wurden ber eine nichtlineare Fehlerquadratminimierung unter Verwendung eines Hamilton-Operators fr asymmetrische Kreisel bestimmt (vollstndiger Datensatz siehe Hintergrundinformationen). Die bergnge fr beide Spezies konnten mit den drei bestimmten Rotationskonstanten und den fnf Zentrifugaldehnungskonstanten mit einer Genauigkeit von besser als

hersagen gegenbergestellt sind. Eine umfassendere Darstellung der Messungen, der Datenanalyse und der quantenchemischen Rechnungen soll an anderer Stelle verffentlicht werden. Da die drei Rotationskonstanten umgekehrt proportional zu den Haupttrgheitsmomenten dieser Molekle sind, ist es mglich, die Position aller drei Kerne durch eine Fehlerquadratminimierung der HPSi- und DPSi-Datenstze zu ermitteln. Fr die przise Bestimmung der Strukturparameter wurden die experimentellen Rotationskonstanten vor der Minimierung um den kleinen, aber wichtigen Nullpunktsschwingungsbeitrag korrigiert. Die so abgeleitete Struktur ist in Abbildung 2 zu sehen. Mit dem vorliegenden Datensatz gelang die Bestimmung der Bindungslngen und des ]SiPHWinkels mit einer Genauigkeit von besser als 0.006 bzw. 0.58. Aus einer rein geometrischen Perspektive scheint die SiP-Bindung in HPSi am besten als eine starke Si=P-Doppelbindung charakterisiert zu werden; der ermittelte Abstand ist um 0.05 kleiner als der Wert, der in Phosphasilenen durch Rntgenstrukturanalyse ermittelt wurde (2.094 ),[4] aber um 0.05 grer, als fr eine Dreifachbindung zu erwarten wre (1.993 ).[10] Der P-H-Abstand ist um 5 % grer als bei einer

Abbildung 2. Struktur von HPSi basierend auf den experimentellen, um Nullpunktsschwingungseffekte korrigierten Rotationskonstanten (siehe Text) von HPSi und DPSi. Statistische Unsicherheiten sind in Klammern aufgefhrt. Die mithilfe von Coupled-Cluster-Methoden berechneten Strukturparameter sind kursiv angegeben; die berechneten Dipolmomentkomponenten entlang der gezeigten Achsen betragen ma = 0.89 D und mb = 0.25 D.
Angew. Chem. 2010, 122, 5795 5798

5796

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
gewhnlichen P-H-Bindung (d. h. PH3 ; 1.41 ).[15] Der Si-HAbstand (1.843 ) ist um etwa 0.4 grer als in SiH4 (1.471 [16]) und um 0.2 grer als im berbrckten Si2H2 (1.668 [1]), aber sehr viel kleiner als die Summe der Van-derWaals-Radien (3.2 ), was fr wesentliche Bindungsanteile spricht. Eine Analyse der natrlichen Bindungsorbitale (NBO)[17] ergab zwei Bindungsorbitale fr die P-Si-Bindung und eines fr PH. Allerdings wird kein Bindungsorbital fr HSi gefunden. Zustzliche wurden zwei freie Elektronenpaare, eines am P- und eines am Si-Atom, identifiziert. Gem diesen Befunden nimmt HPSi keine streng cyclische, sondern eine gewinkelte Struktur an, wenngleich der HP-Si-Winkel von 60.5(3)8 eine nicht zu vernachlssigende PHSi-Wechselwirkung anzeigt. Die Bindung in HPSi kann wie in Abbildung 3 mit einer klassischen P-Si-Doppelbindung, einer P-H-Bindung sowie einer Donor-Akzeptor-Wechselwirkung zwischen PH und einem leeren p-Orbital am Si-Atom beschrieben werden. schlielich auf Grundlage quantenchemischer Rechnungen diskutiert. Im Lichte der vorliegenden Befunde ist es zweifellos wnschenswert, weitere Spezies mit komplexeren Strukturen, z. B. HPSiH2,[10, 12] zu untersuchen. Wie die Detektion eines neuen, recht stabilen berbrckten Isomers von Si2H4 zeigt,[1c] knnten auch bei anderen einfachen SiP-Verbindungen Isomere mit verbrckenden H-Atomen existieren. Molekle wie H2PSiH, HPSiH2 usw. knnten mit der vorliegenden Technik detektierbar sein, da HPSi unter Verwendung von PH3 als P-Quelle und Silan als Si-Quelle effizient gebildet wird. Die hochgenaue Bestimmung der Struktur und der Bindungseigenschaften einer Vielzahl fundamentaler SiPhaltiger Molekle scheint somit mglich zu sein. Da HCN, HCP und andere kleine P- und Si-haltige Verbindungen in den zirkumstellaren Hllen kohlenstoffreicher Sterne in spten Entwicklungsstadien (d. h. CCP, PO) und anderen astronomischen Quellen enthalten sind,[8] ist HPSi ein aussichtsreicher Kandidat fr die radioastronomische Detektion. Eine Suche nach HPSi unter Verwendung des Arizona-Radio-Observatory-12-m-Teleskops soll an anderer Stelle beschrieben werden.

Chemie

Experimentelle und theoretische Methoden


FT-Mikrowellenspektroskopie: Das verwendete FT-Mikrowellenspektrometer ist in Lit. [20] beschrieben. HPSi wurde ber Gleichspannungsentladung durch einen kurzen Gaspuls in einer Pulsdse erzeugt. Im vorliegenden Fall war das Gas eine Mischung aus stark in Neon verdnntem (0.2 %) Phosphin (PH3) und Silan (SiH4). Die strksten Linien wurden bei einem Entladungspotential von 1.2 kV, einer Flussrate von ca. 20 cm3 min1, einer Pulsrate von 6 Hz und einem Hintergrunddruck hinter der Dse von 2.5 kTorr beobachtet. Millimeterwellenspektrosopie: Das verwendete Spektrometer ist in Lit. [21] beschrieben. HPSi wurde in einer 1 m langen Glaszelle aus einer Mischung von elementarem Phosphor, H2 und in Argon verdnntem SiH4 in einer 200-W-Wechselstrom-Glhentladung gebildet; D2 wurde anstelle von H2 verwendet, um DPSi zu erzeugen. Typische Drcke waren 20 mTorr fr H2 und 20 mTorr fr 0.8 % SiH4 in Argon. Quantenchemische Rechnungen: Durchfhrung mithilfe des CFOUR-Programmpakets.[22] Die genaueste Struktur wurde auf einem Niveau erhalten, das als fc-CCSD(T)/cc-pV1Z + DT/ccpVTZ + DQ/cc-pVDZ + Dcore/cc-pCV5Z[14] mit einem frozencore-CCSD(T)-Beitrag bezeichnet wird, wobei zum Basissatzlimit (cc-pV1Z) extrapoliert wird und Korrekturen fr das vollstndige CC Singles, Doubles, Triples(CCSDT)-Niveau (unter Verwendung des cc-pVTZ-Basissatzes), fr Vierfachanregungen auf CC Singles, Doubles, Triples, Quadruples(CCSDTQ)-Niveau (unter Verwendung der cc-pVDZ-Basis) und fr die core-valence-Korrelationseffekte auf CCSD(T)/cc-pCV5Z bercksichtigt wurden. Schwingungskorrekturen fr die Rotationskonstanten wurden auf CCSD(T)/ cc-pwCVQZ-Niveau unter Verwendung der Vibrationsstrungstheorie in zweiter Ordnung erhalten.[14] Die NBO-Analysen wurden auf CCSD/cc-pVTZ-Niveau unter Verwendung des Programmpakets MOLPRO, Version 2006.1, durchgefhrt.[23] Eingegangen am 1. April 2010, vernderte Fassung am 8. Mai 2010 Online verffentlicht am 7. Juli 2010

Abbildung 3. Orbitalwechselwirkungsschema von HPSi.

Anders als im Fall von HCP und HNSi ist eine Erklrung, warum die HPSi-Form dem Isomer HSiP vorgezogen wird, mit qualitativen Argumenten nicht ohne Weiteres mglich. Lineares HPSi, das kein Minimum auf der Potentialhyperflche darstellt, ist nur geringfgig instabiler (um ca. 1 kcal mol1) als lineares HSiP, sodass die Bevorzugung der HPSiAnordnung ausschlielich auf die Abknickung zurckgefhrt werden kann. P hat eine geringe Neigung, Hybridorbitale zu bilden[18] und zieht daher Strukturen mit freien Elektronenpaaren einer Dreifachbindung vor, was die gewinkelte Struktur hervorruft. In HPSi vermeidet P die Bildung einer Dreifachbindung und bildet stattdessen eine Doppelbindung und ein freies Elektronenpaar mit vornehmlichem s-Charakter. Wir betonen die Bedeutung der PH-Si-Donor-Akzeptor-Wechselwirkungen, da diese entscheidend fr die Stabilisierung der nichtlinearen Struktur sind. Es ist bemerkenswert, dass die stabilste Konstitution von H, Si und P berbrckt ist, whrend die drei isovalenten Analoga von HPSi HCN, HNSi und HCP linear sind. Rechnungen lassen vermuten, dass HPSi unter den SiP-Verbindungen einzigartig ist, da bisher keine andere Substanz mit einer verbrckten Struktur experimentell charakterisiert wurde. hnliche Beispiele, namentlich das P2H+-Kation mit einer cyclischen Struktur und Verbindungen des Typs HPPR mit elektronenziehenden Substituenten R,[19] wurden ausAngew. Chem. 2010, 122, 5795 5798

Stichwrter: Mehrfachbindungen Phosphor Quantenchemie Rotationsspektroskopie Silicium www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5797

Zuschriften
[1] a) M. Bogey, H. Bolvin, C. Demuynck, J. L. Destombes, Phys. Rev. Lett. 1991, 66, 413 416; b) M. Cordonnier, H. Bolvin, C. Demuynck, J.-L. Destombes, J. Chem. Phys. 1992, 97, 7984 7989; c) L. Sari, M. C. McCarthy, H. F. Schaefer III, P. Thaddeus, J. Am. Chem. Soc. 2003, 125, 11409 11417. [2] J. M. Jasinski, B. S. Myerson, B. A. Scott, Annu. Rev. Phys. Chem. 1987, 38, 109 140. [3] G. Fritz, P. Scheer, Chem. Rev. 2000, 100, 3341 3401. [4] F. H. Allen, J. E. Davies, J. J. Galloy, O. Johnson, O. Kennard, C. F. Macrae, E. M. Mitchell, G. F. Mitchell, J. M. Smith, D. G. Watson, J. Chem. Inf. Comput. Sci. 1991, 31, 187 204. [5] a) C. N. Smith, F. Bickelhaupt, Tetrahedron Lett. 1984, 25, 3011 3014; b) C. N. Smit, F. Bickelhaupt, Organometallics 1987, 6, 1156 1163; c) Y. van den Winkel, H. Bastiaans, F. Bickelhaupt, J. Organomet. Chem. 1991, 405, 183 194; d) M. Driess, Angew. Chem. 1991, 103, 979 981; Angew. Chem. Int. Ed. Eng. 1991, 30, 1022 1024; e) M. Driess, H. Pritzkow, J. Chem. Soc. Chem. Commun. 1993, 1585 1587. [6] a) H. R. G. Bender, E. Niecke, M. Nieger, J. Am. Chem. Soc. 1993, 115, 3314 3315; b) M. Driess, S. Rell, H. Pritzkow, J. Chem. Soc. Chem. Commun. 1995, 253 254. [7] R. Varma, K. R. Ramaprasad, J. F. Nelson, J. Chem. Phys. 1975, 63, 915 918. [8] a) M. Agndez, J. Cernicharo, J. R. Pardo, M. Gulin, T. G. Phillips, Astron. Astrophys. 2008, 485, L33 36; b) E. D. Tenenbaum, L. M. Ziurys, Astrophys. J. 2008, 680, L121 124; c) D. T. Halfen, D. J. Clouthier, L. M. Ziurys, Astrophys. J. 2008, 677, L101 104. [9] a) A. D. McLean, J. Chem. Phys. 1962, 37, 627 630; b) J. B. Ingels, J. M. Turney, N. A. Richardson, Y. Yamaguchi, H. F. Schaefer III, J. Chem. Phys. 2006, 125, 104306; c) M. C. Lind, F. C. Pickard IV, J. B. Ingels, A. Paul, Y. Yamaguchi, H. F. Schaefer III, J. Chem. Phys. 2009, 130, 104301. [10] a) K. J. Dykema, T. N. Troung, M. S. Gordon, J. Am. Chem. Soc. 1985, 107, 4535 4541; b) A. G. Baboul, H. B. Schlegel, J. Am. Chem. Soc. 1996, 118, 8444 8451. [11] C.-H. Lai, M.-D. Su, S.-Y. Chu, Inorg. Chem. 2002, 41, 1320 1322. [12] D. B. Chesnut, Chem. Phys. 2005, 315, 59 64. [13] S. Thorwirth, J. Gauss, M. C. McCarthy, F. Shindo, P. Thaddeus, Chem. Commun. 2008, 5292 5294. [14] C. Puzzarini, M. Heckert, J. Gauss, J. Chem. Phys. 2008, 128, 194108. [15] C. C. Loomis, M. W. P. Strandberg, Phys. Rev. 1951, 81, 798 807. [16] K. Ohno, H. Matsuura, Y. Endo, E. Hirota, J. Mol. Spectrosc. 1986, 118, 1 17. [17] A. E. Reed, L. A. Curtiss, F. Weinhold, Chem. Rev. 1988, 88, 899 926. [18] W. Kutzelnigg, Angew. Chem. 1984, 96, 262 286; Angew. Chem. Int. Ed. Engl. 1984, 23, 272 295. [19] T. Busch, W. W. Schoeller, E. Niecke, M. Nieger, H. Westermann, Inorg. Chem. 1989, 28, 4334 4340. [20] M. C. McCarthy, W. Chen, M. J. Travers, P. Thaddeus, Astrophys. J. Suppl. Ser. 2000, 129, 611 623. [21] C. Savage, L. M. Ziurys, Rev. Sci. Instrum. 2005, 76, 043106. [22] Weitere Informationen siehe www.cfour.de. [23] Weitere Informationen siehe www.molpro.net.

5798

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5795 5798

Angewandte
DOI: 10.1002/ange.200907256

Chemie

DNA-Nanofunktionseinheiten

Selektive dsDNA-gesteuerte Bildung von Kupfer-Nanopartikeln in Lsung**


Alexandru Rotaru, Subrata Dutta, Elmar Jentzsch, Kurt Gothelf und Andriy Mokhir*
DNA-Sequenzen knnen selektiv miteinander hybridisieren und so lineare oder verzweigte doppelstrngige (ds) helikale Strukturen bilden. Diese Fhigkeit macht sie zu idealen Bausteinen zur Herstellung von Nanostrukturen bestimmter Form und Gre. So wurden beispielsweise komplexe 2Dund sogar 3D-Strukturen durch die Selbstanordnung von DNA-Strngen erhalten.[1] Die Herstellung leitfhiger dsDNAs wurde bereits durch die Beschichtung mit Metallen, Metalloxiden oder Metallsulfiden realisiert. So wurde etwa eine Vielzahl von Verfahren fr die Beschichtung von DNA mit Au0, Pd0, Pt0, Ag0, Cu0 und CdS beschrieben.[2, 3] Allerdings ist erst wenig ber die kontrollierte Modifizierung von ausgewhlten Bereichen der DNA bekannt. Das erste Beispiel fr die selektive Metallbeschichtung einer DNA wurde von Braun und Mitarbeitern vorgestellt.[4] Hierbei wurde zunchst ein Teil einer l-DNA durch Bildung eines RecAssDNA-Komplexes geschtzt und der ungeschtzte Teil der DNA durch sequenzielle Reduktion von Ag+ und Au3+ metallisiert. Abschlieend wurde das Protein entfernt. Durch diese Methode erhlt man zwei Bereiche aus leitenden DNADrhten, die von einem etwa 1 mm langen nichtleitenden DNA-Stck unterbrochen sind. Allerdings ist die RecA-induzierte homologe Rekombination nur fr lange DNAStrnge effizient und somit eher auf die Konstruktion von groen molekularen Objekten (> 1 mm) beschrnkt. ber die chemische Synthese von dsDNAs, die Metallionen zwischen ihren Basenpaaren enthalten, ist ebenfalls berichtet worden.[5] ber die Zahl solcher Basenpaare kann die Lnge der Metallionen enthaltenden Bereiche in der DNA verndert werden.[5] Zuknftig muss noch experimentell besttigt werden, dass diese Metallionen enthaltenden DNA-Komplexe leitend sind und somit als potenzielle elektrische Drhte genutzt werden knnten. Hier beschreiben wir eine Methode fr die selektive Metallisierung einer dsDNA in Gegenwart von ssDNA (Abbildung 1). In den Doppelstrngen vorhandene ssDNAs

Abbildung 1. Kupfer-Nanopartikel bilden sich in einer Lsung aus Cu2+ und Ascorbat in Gegenwart eines DNA-Doppelstrangs (Reaktion A und B). Einzelstrngige DNAs frdern diese Reaktion nicht (C). Die Gre der Nanopartikel ist abhngig von der Zahl der im Doppelstrang enthaltenen Basenpaare. Einzelstrngige Regionen der metallisierten Doppelstrnge knnen genutzt werden, um Cu-Nanopartikel in komplexere Strukturen zu organisieren.

[*] S. Dutta,[+] Dr. E. Jentzsch, Dr. A. Mokhir Anorganisch-Chemisches Institut Ruprecht-Karls-Universitt Heidelberg Im Neuenheimer Feld 270, 69120 Heidelberg (Deutschland) Fax: (+ 49) 6221-548-439 E-Mail: andriy.mokhir@urz.uni-heidelberg.de Dr. A. Rotaru,[+] Prof. Dr. K. Gothelf Centre for DNA Nanotechnology, Department of Chemistry and iNANO, Aarhus University, rhus C (Dnemark) [+] Die Autoren haben gleichermaen zu dieser Studie beigetragen. [**] Wir danken der Ruprecht-Karls-Universitt Heidelberg und der Danish National Research Foundation fr die finanzielle Untersttzung. Hintergrundinformationen zu diesem Beitrag (experimentelle Details und zustzliche spektroskopische Experimente) sind im WWW unter http://dx.doi.org/10.1002/ange.200907256 zu finden.
Angew. Chem. 2010, 122, 5799 5802

knnen als Ankergruppen fr die Herstellung funktioneller Bausteine auf der Grundlage metallisierter dsDNAs genutzt werden. Wir konnten so eine einfache Funktionseinheit bestehend aus zwei metallisierten dsDNAs, die durch einen nichtmetallisierten starren Linker verbunden waren, herstellen. Woolley und Mitarbeiter berichteten, dass l-DNA, die auf SiO2-Oberflchen immobilisiert war, durch 0.11m Cu(NO3)2 und 0.1m Ascorbat mit Kupfer metallisiert werden kann.[3] Die hohe Konzentration der Reagentien fhrte zur unspezifischen Bildung von Cu0 selbst bei Abwesenheit eines Templats. Dieses Problem konnte durch die Vorbehandlung der dsDNA-modifizierten Oberflche mit Alkalimetallionen verringert werden.[3] Allerdings wurden die DNA-Template durch Hydroxylradikale (HOC), die in der konzentrierten Cu2+/Ascorbat-Mischung gebildet wurden, zerstrt.[3, 6] Bei unseren Experimenten nutzten wir wesentlich kleinere Konzentrationen (< 1000-fach) eines Cu2+-Salzes. Laut HPLC-Analyse sind sowohl ssDNA als auch dsDNA unter diesen Bedingungen stabil (Hintergrundinformationen, Abbildung S1). Die Sequenzen der in dieser Studie getesteten DNAs sind in Tabelle 1 wiedergegeben. Durch Rasterkraftmikroskopie (AFM) konnten wir beobachten, dass bei geringen CuSO4-Konzentrationen die ssDNA keine Nanopartikel bildet (Abbildung 2 A), wohin-

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5799

Zuschriften
Tabelle 1: Sequenzen und Benennungen der eingesetzten DNAs. 5!3 DNA1 DNA2 DNA3 DNA4a DNA4b DNA5 DNA6 DNA7 DNA8 DNA9 DNA10 GAA CGT ATG TAC TCC ATA CGT TCT GTA C GTT CAT CAC G GTT TAT CAC G GTT CTT CAC G CGT GAT GAA CGT ATG AGC GTA T ATG AAC GTA TGA GC TAC TCG CTC ATA CGT TCA TTG TAC CGT GAT GAA CGT ATG AGC GTA T TACTCATACGCTCATACGTTCATCACGACTAC GTAGTCGTGATGAACGTATGAGCGTATGAGTA 9-mer 19-mer 10-mer 10-mer 10-mer 22-mer 14-mer 24-mer 22-mer 32-mer 32-mer

Ascorbat ist in wenigen Minuten abgeschlossen (Abbildung 3 B und Abbildung 4). In Abwesenheit der dsDNA oder in Anwesenheit einer ssDNA werden praktisch keine Nano-

Abbildung 4. A) Zeitabhngigkeit der Fluoreszenzintensitt bei lem = 600 nm (lex = 340 nm) nach Zugabe von CuSO4 (100 mm) zu gepufferten Lsungen (MOPS, pH 7.5, 10 mm ; NaCl 150 mm ; Natriumascorbat 1 mm) von DNAs (100 nm): 32 bp: DNA9/DNA10 ; 22 bp: DNA8/DNA9 ; 14 bp: DNA6/DNA7; 10 bp: DNA3/DNA5 ; 0 bp: DNA9. Wir beobachteten, dass DNA1/DNA2 (9-mere dsDNA) kein Templat fr die Nanopartikelbildung ist (Daten nicht gezeigt). B) Anstieg der Fluoreszenzintensitt bei lem = 600 nm (lex = 340 nm) nach Zugabe von CuSO4 (100 mm) zu gepufferten Lsungen von DNAs mit unterschiedlicher Lnge. Abbildung 2. AFM-Aufnahmen von DNA-Templaten nach (versuchter) Bildung von Cu-Nanopartikel: A) ssDNA (DNA7), B) kurze dsDNA (DNA6/DNA7), C) lange dsDNA (DNA8/DNA9). DNA-Konzentrationen: 9 nm, CuSO4 : 10 mm, Ascorbinsure: 2 mm, MOPS-Puffer, pH 7.5: 10 mm, Mg2+: 12.5 mm.

gegen sich die dsDNA als ein effizientes Templat erwies (Abbildung 2 B). Interessanterweise ist die Gre der Nanopartikel proportional zur Zahl der Basenpaare in der dsDNA (Abbildung 2 und Abbildung S4). Die bei der dsDNA-gesteuerten Metallisierung entstehenden Cu-Nanopartikel fluoreszieren (lem = 587600 nm, lex = 340 nm, Abbildung 3 A). In der gleichen spektralen Region emittieren auch metallisches Kupfer[7] sowie 12 und 30 nm groe Cu-Nanopartikel, die durch Poly(N-vinylpyrrolidon) in Ethanol stabilisiert sind (600 bzw. 610 nm, lex = 337 nm).[8] Die dsDNA-gesteuerte Reduktion von Cu2+ durch

Abbildung 3. A) Fluoreszenzspektrum (lex = 340 nm) 30 min nach Zugabe von CuSO4 (100 mm) zu Mischungen aus MOPS (pH 7.5; 10 mm), NaCl (150 mm), Natriumascorbat (1 mm) und entweder DNA8 (graue Linie), DNA9 (gestrichelte Linie) oder DNA8/DNA9-Doppelstrang (schwarze Linie). DNA-Konzentrationen: 200 nm. B) Zeitabhngigkeit der Fluoreszenzintensitt (lem = 600 nm) nach Zugabe von CuSO4 zu gepufferten DNA-Lsungen. Linienbeschriftung und Konzentrationen der Reagentien wie in (A).

partikel gebildet (Abbildung 3). So betrgt das Verhltnis FdsDNA/FssDNA = 96, wobei FdsDNA und FssDNA die Fluoreszenzintensitten von DNA8/DNA9 bzw. DNA8 in der Cu2+/ Ascorbat-Mischung sind (Abbildung 3 A). Ab einer Konzentration von [Cu2+] ! 100 mm ist das Fluoreszenzsignal, das aus der Metallisierung resultiert, gesttigt (Abbildung S2). Diese Metallionenkonzentration wurde von uns in allen weiteren Versuchen eingesetzt. Wir bemerkten, dass der Anstieg der Fluoreszenzintensitt, der aus der Templat-gesteuerten Bildung von Cu-Nanopartikeln resultiert, mit der Zahl der Basenpaare in den dsDNAs korrelierte (Abbildung 4). El-Sayed und Mitarbeiter berichteten, dass die Fluoreszenzquantenausbeute von Cu-Nanopartikeln mit deren Gre ansteigt.[8] bereinstimmend damit deuten auch unsere Daten darauf hin, dass lngere dsDNA-Template die Bildung von greren Cu-Nanopartikeln induzieren. Diese Aussage stimmt ebenso mit den AFM-Messungen berein, die fr zwei dsDNAs mit unterschiedlicher Lnge (ein 14-mer und ein 32-mer) ausgefhrt wurden (Abbildung 2 und Abbildung S4). Selbst bei geringen Konzentrationen von dsDNA ist die Bildung von Cu-Nanopartikeln recht effizient. Die fr die Nanopartikel charakteristische Fluoreszenzintensitt steigt bereits bei der Zugabe von Ascorbat und Cu2+-Ionen zu einer 3.5 nm Lsung einer 22-meren dsDNA (Abbildung S3). Die Nanopartikelbildung ist sehr empfindlich gegenber einzelnen Nukleotid-Fehlpaarungen. Zum Beispiel wirken 10-mere dsDNAs (DNA4a/DNA5 und DNA4b/DNA5), die einzelne fehlgepaarte Basenpaare aufweisen (C4 !T4- bzw. A5 !T5-Mutationen in DNA4a bzw. DNA4b), nicht lnger als Template fr die Nanopartikelbildung (Abbildung 5). Dies ist nicht weiter erstaunlich, da diese DNAs unter unseren Reaktionsbedingungen einzelstrngig vorliegen, wie
Angew. Chem. 2010, 122, 5799 5802

5800

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Dreifachstrang-(Doppelstrang2/Cu-Nanopartikel)-Einheit besttigt (Schema 1 und Abbildung S9). Unsere Methode ist das erste Beispiel fr eine selektive Bildung von Metall-Nanopartikeln an einer dsDNA in Lsung. Insbesondere die Tatsache, dass die Gre der Cu-

Chemie

Abbildung 5. Fluoreszenzspektren (lex = 340 nm) 20 min nach Zugabe von CuSO4 (100 mm) zu einer gepufferten Lsung von DNAs (100 nm) gekennzeichnet als match (DNA3/DNA5), mismatch 1 (DNA4a/DNA5) und mismatch 2 (DNA4b/DNA5). Puffer: MOPS (pH 7.5, 10 mm), NaCl (150 mm), Natriumascorbat (1 mm).

Schema 1. Struktur einer Nanofunktionseinheit bestehend aus zwei metallisierten DNA-Doppelstrngen, die durch einen starren Dreifachstrang verbunden sind (Cu-Nanopartikel/Doppelstrang 1)Dreifachstrang(Doppelstrang 2/Cu-Nanopartikel).

durch UV-Schmelzpunktmessungen bewiesen wurde: kein Schmelzen bei ! 22 8C. Demgegenber ist der gepaarte Doppelstrang gleicher Gre (DNA3/DNA5, Tm = (40.5 0.7) 8C) ein effizientes Templat (Abbildung 5). In allen vorausgegangenen Untersuchungen von Templatgesteuerten Metallabscheidungen wurden die DNA-Template erst mit Metallsalzen und anschlieend mit reduzierenden Reagentien behandelt.[2, 5] Man whlte diesen Ablauf, da man annahm, dass die anfngliche DNA-Cu2+-Koordination eine Voraussetzung fr die selektive Abscheidung von Metall an der Nukleinsure ist. Wir konnten beobachten, dass dieses Vorgehen unter unseren Bedingungen zu sehr geringen Ausbeuten von Cu-Nanopartikeln fhrte. Eine effiziente Nanopartikelbildung wurde hingegen beobachtet, wenn CuSO4 dem Puffer zugesetzt wurde, der bereits ein reduzierendes Mittel (Ascorbat) enthielt (Abbildung 35). Dies weist darauf hin, dass die anfngliche Bindung von Cu2+ an die DNA die Reaktion eher hemmt, als sie zu frdern. Der Effekt ist nicht berraschend, da die O-Atome der Phosphodiester-Gruppe eher potenzielle Bindungsstellen fr Cu2+ an der DNA sind als die N- und O-Atome der Nukleobasen. Diese Liganden knnen als harte (O-Atome) oder mittlere Lewis-Basen (NAtome) klassifiziert werden. Es ist bekannt, dass diese Liganden Cu2+ stabilisieren, was zur Inhibierung der Cu2+! Cu0-Transformation fhren sollte. Aufgrund dieser Beobachtung drfen wir annehmen, dass der erste Schritt der Reaktion die Reduktion von Cu2+ zu Cu+ ist, an die sich die Umsetzung von Cu+ zu Cu2+ und Cu0 anschliet. Das gebildete Cu0 wird dann auf der dsDNA gebndelt und bildet so stabile Nanopartikel. Wir fanden auch, dass DNA-Dreifachstrnge die Nanopartikelbildung nicht frdern (Abbildung S6). Dies deutet darauf hin, dass die Nanopartikel in der groen Furche der dsDNA, die im Dreifachstrang blockiert ist und in der ssDNA fehlt, akkumulieren. Die Ladung des Doppelstrangs scheint ebenso wichtig zu sein, da ein weniger geladener PNA/DNA-Doppelstrang berhaupt nicht als Templat agiert (Abbildung S5). Da PNA/DNA-Doppelstrnge und DNA-Dreifachstrnge nicht als Template fr die Nanopartikelbildung fungieren, kann man sie als starre Verbindungen nutzen, um Nanostrukturen mit abwechselnd metallisierten und nichtmetallisierten Bereichen zu erzeugen. Wir haben diese Mglichkeit durch den Aufbau einer (Cu-Nanopartikel/Doppelstrang1)Angew. Chem. 2010, 122, 5799 5802

Nanopartikel ber die Lnge des dsDNA-Templats gesteuert werden kann, lsst auf vielseitige Anwendungen dieses Verfahrens hoffen. Aufgrund der uerst selektiven Metallisierung von dsDNAs gegenber ssDNAs kann die Methode fr den Nachweis von dsDNAs durch einfache Fluoreszenzmessung genutzt werden. Des Weiteren ist es mglich, einzelne Fehlpaarungen sehr effizient nachzuweisen. Die Methode hat das Potenzial, fr die Metallisierung komplexerer DNA-Nanostrukturen eingesetzt zu werden. Untersuchungen zur selektiven Metallisierung von oberflchenimmobilisierten DNA-Origami, die einzelstrngige Domnen enthalten, sind Gegenstand unserer aktuellen Forschung. Zuknftige Studien werden zeigen, ob die Selektivitt des Metallisierungsprozesses genutzt werden kann, um Halbleiterschaltkreise auf der Grundlage metallisierter DNA herzustellen.
Eingegangen am 23. Dezember 2009, vernderte Fassung am 8. Mrz 2010 Online verffentlicht am 13. Juli 2010

Stichwrter: DNA Fluoreszenz Kupfer Metallisierung Nanopartikel

[1] a) N. C. Seeman, Nature 2003, 421, 427 431; b) C. X. Lin, Y. Liu, S. Rinker, H. Yan, ChemPhysChem 2006, 7, 1641 1647; c) P. W. K. Rothemund, Nature 2006, 440, 297 302; d) N. C. Seeman, Mol. Biotechnol. 2007, 37, 246 257; e) K. V. Gothelf, T. H. LaBean, Org. Biomol. Chem. 2005, 3, 4023 4037. [2] Eine aktuelle bersicht zur DNA-Metallisierung: a) H. A. Becerril, A. T. Woolley, Chem. Soc. Rev. 2009, 38, 329 337; ausgewhlte Arbeiten zur Abscheidung von Metallen auf DNA: Gold: b) L. A. Stearns, R. Chhabra, J. Sharma, Y. Liu, W. T. Petuskey, H. Yan, J. C. Chaput, Angew. Chem. 2009, 121, 8646 8648; Angew. Chem. Int. Ed. 2009, 48, 8494 8496; Palladium: c) J. Richter, R. Seidel, R. Kirsch, M. Mertig, W. Pompe, J. Plaschke, H. K. Schackert, Adv. Mater. 2000, 12, 507 510; Platin: d) R. Seidel, L. Colombi Ciacchi, M. Weigel, W. Pompe, M. Mertig, J. Phys. Chem. B 2004, 108, 10801 10811; Silber: e) L. Berti, A. Alessandrini, P. Facci, J. Am. Chem. Soc. 2005, 127, 11216 11217; f) E. Braun, Y. Eichen, U. Sivan, G. Ben-Yoseph, Nature 1998, 391, 775 778; g) A. A. Zinchenko, K. Yoshikawa, D. Baigl, Adv. Mater. 2005, 17, 2820 2823; eine aktuelle bersicht zur Herstellung von Halbleiternanomaterialien auf DNA-Templaten: h) A. Houlton, A. R. Pike, M. A. Galindo, B. R. Horrocks, Chem. Commun. 2009, 1797 1806.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5801

Zuschriften
[3] a) C. F. Monson, A. T. Woolley, Nano Lett. 2003, 3, 359 363; b) H. A. Becerril, R. M. Stoltenberg, C. F. Monson, A. T. Woolley, J. Mater. Chem. 2004, 14, 611 616; c) H. A. Becerril, R. M. Stoltenberg, D. R. Wheeler, R. C. Davis, J. N. Harb, A. T. Woolley, J. Am. Chem. Soc. 2005, 127, 2828 2829. [4] K. Keren, M. Krueger, R. Gilad, G. Ben-Yoseph, U. Sivan, E. Braun, Science 2002, 297, 72 75. [5] bersichten ber Metallionen-modifizierte DNA-Doppelstrnge: a) K. Tanaka, M. Shinoya, Coord. Chem. Rev. 2007, 251, 2732 2742; b) G. H. Clever, C. Kaul, T. Carell, Angew. Chem. 2007, 119, 6340 6350; Angew. Chem. Int. Ed. 2007, 46, 6226 6236; c) J. Mller, Eur. J. Inorg. Chem. 2008, 3749 3763. [6] a) M. H. Zareie, G. Erdem, C. Oner, R. Oner, A. Ogus, E. Piskin, Biol. Macromol. 1996, 19, 69 73; b) D. C. A. John, K. T. Douglas, Transition Met. Chem. 1996, 21, 460 463. [7] A. Mooradian, Phys. Rev. Lett. 1969, 22, 185 187. [8] Q. Darugar, W. Qian, M. A. El-Sayed, J. Phys. Chem. B 2006, 110, 143 149.

5802

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5799 5802

Angewandte
DOI: 10.1002/ange.201001275

Chemie

Borchemie

B19 : ein aromatischer Wankel-Motor**


J. Oscar C. Jimnez-Halla, Rafael Islas, Thomas Heine* und Gabriel Merino*
Huang et al. entdeckten vor kurzem die energetisch stabilste Struktur von B19 (1): eine Radstruktur, bestehend aus zwei ineinandergeschachtelten ebenen aromatischen p-Systemen.[1] Der innere Fnfring (Ring A) ist eine Gruppe von sechs Atomen mit zwei p-Elektronen. Er wird von einem ueren Ring, bestehend aus 13 Boratomen, (Ring B) umschlossen, dem weitere zehn p-Elektronen zugeordnet werden (siehe Abbildung 1). Interessanterweise erfllen In den letzten zehn Jahren wurden mithilfe der Computerchemie mehrere radfrmige Borstrukturen vorgeschlagen, die Hauptgruppenelement-[814] oder bergangsmetallatome[1518] im Ringzentrum enthalten. 2005 untersuchten Erhardt et al. einige aromatische radfrmige Borcluster (C2B8, C3B93+ und C5B11+) mit mehr als einem Kohlenstoffatom im Zentrum (Abbildung 2).[19] Sie stellten fest, dass das Kohlenstoff-Fragment in einen umschlieenden Ring aus einer adquaten Zahl an Boratomen eingebettet werden kann. Es

Abbildung 1. Die Strukturen des globalen Minimums 1 und des bergangszustands 2 fr B19 stehen ber eine Rotation des Rings A (helle Kugeln) im Ring B (dunkle Kugeln) miteinander in Beziehung.

beide Fragmente unabhngig die (4n+2)p-Hckel-Aromatenregel. Aus der Literatur ist bekannt, dass neutrale und anionische Borcluster von B3 bis B20 nicht als dreidimensionale Cluster, sondern als ebene Strukturen vorliegen, die in den meisten Fllen doppelt aromatisch sind.[2] Die Cluster B82, B9 , B10, B11 , B12 und B13+ knnen als Boranaloga von Benzol verstanden werden.[37] B19 unterscheidet sich von den anderen planaren Systemen: Zwar sind andere konzentrische p-Systeme aus der organischen Chemie bekannt, keines hat jedoch die gleiche elektronische Konfiguration wie B19 .
[*] Dr. J. O. C. Jimnez-Halla, R. Islas, Prof. Dr. G. Merino Departamento de Qumica, Divisin de Ciencias Naturales yExactas Universidad de Guanajuato. Col. Noria Alta s/n 36050 Guanajuato (Mexiko) Fax: (+ 52) 7372-006 E-Mail: gmerino@quijote.ugto.mx Prof. Dr. T. Heine School of Engineering and Science Jacobs University Bremen, 28759 Bremen (Deutschland) Fax: (+ 49) 421 200 49 3223 E-Mail: t.heine@jacobs-university.de [**] Wir bedanken uns fr die Untersttzung durch das Air Force Research Laboratory Latin American Initiative Project und DAIPUGTO. R.I. dankt CONACYT fr ein Doktorandenstipendium. Wir bedanken uns bei Prof. Miquel Sol und Prof. Miguel A. GarcaGaribay fr die produktive Diskussion. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201001275 zu finden.
Angew. Chem. 2010, 122, 5803 5806

Abbildung 2. Strukturen aromatischer Carboran-Rder nach Erhardt et al.[19] und Wu et al.[10]

ist bemerkenswert, dass das innere Kohlenstoff-Fragment und der uere Borring quasi frei in entgegengesetzter Richtung rotieren knnen. Die damit verbundenen Rotationsbarrieren betragen 2.6, 0.7 und 0.1 kcal mol1 fr C2B8, C3B93+ bzw. C5B11+ (berechnet mit B3LYP/6-311 + G(d)). C6B122 ist ein System, das sich hnlich verhlt.[10] Allerdings haben diese Cluster energetisch stabilere Isomere mit Kohlenstoffatomen im ueren Ring. Boldyrev und Wang verallgemeinerten, dass Carborane den Kohlenstoff nicht im Ringzentrum enthalten.[14, 20, 21] Wenn Cluster bei hohen Temperaturen in der Gasphase synthetisiert werden, wird die Verteilung der Produktisomere durch die Thermodynamik bestimmt.[22] In den meisten Fllen ist nur ein Cluster-Isomer das globale Energieminimum in der Produktfraktion enthalten. Wang und Boldyrev besttigen diese Aussage mit zahlreichen Studien in Experiment und Theorie.[1, 3, 4, 14] Es ist daher nicht mglich, die erwhnten

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5803

Zuschriften
Carborane in thermodynamisch bestimmten Experimenten herzustellen. Die wichtigste Frage ist nun, ob 1, eine Struktur, die ein globales Energieminimum reprsentiert, das gleiche fluxionale Verhalten wie die Systeme von Erhardt et al. zeigt. Wir beantworten diese Frage mit einer sorgfltigen theoretischen Studie, in der wir den die Rotation charakterisierenden bergangszustand bestimmen und die Fluxionalitt des Systems mit Born-Oppenheimer-Molekldynamik (BO-MD) untersuchen. Wir haben weiterhin die Aromatizitt von 1 anhand des induzierten Magnetfelds Bind analysiert.[23, 24] Die dynamische Abhngigkeit zwischen den Ringen A und B kann zunchst durch die harmonische Analyse verstanden werden. Eine Optimierung mithilfe von B3LYP/6311 + G(d) resultiert fr 1 in einer ebenen Struktur mit C2vSymmetrie.[25] Die Schwingungsanalyse charakterisiert 1 als Energieminimum auf der Potentialflche. Die kleinste Schwingungsfrequenz, eine weiche Mode von 60 cm1, kann der Rotation des inneren Borrings A zugeordnet werden. Folgt man der Mode mit der geringsten Frequenz, erreicht man den ebenfalls C2v-symmetrischen bergangszustand 2 der entgegengesetzten Ringrotation 1!2 !1 (die charakteristische imaginre Frequenz betrgt 59i cm1).[26] Die Energiedifferenz zwischen 1 und 2 ist vernachlssigbar (geringer als 0.1 kcal mol1), was auf eine quasi freie Rotation des inneren Borrings hinweist. Die relativen Energien der B19-Isomere wurden von Huang et al. bestimmt. Dabei wurden die Strukturen mit B3LYP/6-311 + G(d) optimiert, und die Ergebnisse wurden durch Punktrechnungen mithilfe der CCSD(T)/6-311 + G(d)Methode besttigt. Interessanterweise fanden Huang et al. ein globales Minimum der Potentialflche mit Cs-Symmetrie, allerdings ist das C2v-Isomer 1 stabiler, sofern die Nullpunktskorrekturen beachtet werden. Da sich die Nullpunktsenergien strker als die Potentialenergien unterscheiden, knnen wir von einer schwingungsgemittelten Struktur sprechen. Wir nutzen die Daten von Huang et al. fr 1 als Ausgangspunkt fr unsere weiteren Untersuchungen. Wir fanden weiterhin den bergangszustand, der die Isomerisierung von 1 zur nchststabilen Struktur 4 beschreibt, die von Huang et al. erhalten wurde (siehe Abbildung 3). Die Energiedifferenz zwischen 1 und 4 betrgt 2.8 kcal mol1, und die Isomerisierungsbarriere betrgt 22.7 kcal mol1, was diesen bergang bei tiefen Temperaturen ausschliet. Die Integritt des ueren Borrings whrend der Transformation wird bewahrt, der bergangszustand 3 ist daher nicht eben (205i cm1). BO-MD-Simulationen mit PBE/DZVP-GGA[27] zeigen ebenfalls ein fluxionales Verhalten. Die Simulationen wurden mit der Gleichgewichtsstruktur 1 gestartet. Den Atomen wurden Zufallsgeschwindigkeiten zugeordnet, und die Struktur wurde jeweils fr 300 K und 600 K mithilfe eines Nos-Hoover-Thermostats fr 20 ps ins Gleichgewicht gebracht. Danach wurden 60-ps-Trajektorien berechnet. Whrend der BO-MD-Simulationen bleibt das Molekl nahezu planar, und der innere und der uere Ring rotieren quasi frei gegeneinander. Das fluxionale Verhalten von 1 ist schon an seiner Gleichgewichtsstruktur ersichtlich: Jedes Boratom des inneren Fnfecks ist zu drei Atomen des ueren Rings koordiniert. Einige Bindungen zwischen den Ringen A und B sind exklusiv (d. h. das entsprechende Atom im Ring B hat nur eine Bindung zu einem Atom im Ring A), in anderen Fllen gehen zwei Bindungen zu einem Ring-B-Atom. Diese Anordnung resultiert in einer Unterbrechung des regulren Netzes von Dreiecken durch drei Vierecke, sodass das innere Fnfeck von drei Vier- und zwlf Dreiecken umgeben ist. Eine Rotation erfolgt dann nach einem einfachen Prinzip, das an der Struktur des bergangszustands 2 zu erkennen ist: Eine kleine Verschiebung eines Atoms des inneren Fnfecks in Richtung des Zentrums eines der Vierecke bewirkt die Bildung einer neuen Bindung ber die Diagonale des Vierecks hinweg. Die Bindung wird dadurch verstrkt, und das Atom wird strker ins Zentrum des Vierecks gezogen. Dadurch wird die lngere Bindung zwischen dem Atom und Ring B gestreckt und schlielich gebrochen, und ein neues Viereck wird gebildet. Es ergibt sich eine Topologie wie in der Ausgangsstruktur, jedoch mit den einzelnen Atomen an anderen Positionen als vor der Rotationsbewegung. Man beachte, dass der Fnfring in 1 nur um 13.88 gedreht werden muss, um den bergangszustand 2 zu erreichen.[28] Wir knnen zusammenfassend davon ausgehen, dass B19 der erste molekulare Cluster ist, der sich wie ein Wankel-Motor verhlt. Das Bindungsverhalten dieses Borclusters ist auerordentlich interessant. Daher untersuchten Huang et al. detailliert die Bindungseigenschaften von 1 mithilfe der adaptiven natrlichen Dichtepartitionierung (Adaptive Natural Density Partitioning, AdNDP). Sie zeigten, dass in dem Cluster das s- und das p-System stark delokalisiert sind.[1] Einige Details zur Aromatizitt des Systems, die zum Verstndnis des fluxionalen Verhaltens von 1 beitragen, wurden jedoch bisher nicht untersucht. NMR-Berechnungen mit PW91/IGLO-III und der GIAO-Methode zeigen, dass sich die chemischen Verschiebungen der 11B-Atome[29] im Zentrum und im ueren Ring stark unterscheiden sollten. Das zentrale Atom zeigt eine Verschiebung von dB = 40.1 ppm, die Boratome des Rings A sind um 20 ppm strker abgeschirmt als das zentrale Atom, und fr die Atome des Rings B wurden Werte von dB = 17 bis 37 ppm erhalten.

Abbildung 3. Isomerisierung von 1 zum zweitstabilsten Isomer 4, berechnet mit B3LYP/6-311 + G(d).

5804

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5803 5806

Angewandte
Abbildung 4 zeigt die diatropen Isolinien der z-Komponente des induzierten Magnetfelds, Bindz, hervorgerufen durch ein externes Feld, das senkrecht zur Moleklebene von 1 ausgerichtet ist.[23] Ein ueres Magnetfeld entlang der z. B. Coronen, wo die Rotation des inneren Rings stark den berlapp des p-Systems und damit die Aromatizitt verndert. Der Vergleich zwischen 1 und dem von Erhardt et al. vorgeschlagenen System (siehe Abbildung 2) zeigt deutlich, dass die Rotationsbarriere von der Gre des ueren Rings abhngt. Die richtige Gre vermindert den berlapp zwischen den Ringen A und B, was die quasi freie Rotationsbewegung ermglicht. Die im Prinzip barrierefreie Rotation hngt jedoch auch von der elektronischen Struktur des Systems ab, denn die Delokalisierung der s- und p-Elektronen wird whrend der Rotation (sowohl am Minimum 1 als auch am bergangszustand 2) aufrechterhalten. Man beachte weiterhin, dass sich whrend der Rotation die B-B-Mehrzentrenbindungen von einer Anordnung in die nchste verschieben und dass die B-B-Bindungen sowohl im Minimum als auch im bergangszustand ausgeprgt sind. Das dynamische Verhalten von B19 ist aus BO-MD-Simulationen ersichtlich: Die Ergebnisse dieser Rechnungen zeigen Bewegungen, die an einen Wankel-Motor erinnern. Weitere fluxionale Borcluster werden zurzeit in unseren Arbeitsgruppen studiert.
Eingegangen am 2. Mrz 2010, vernderte Fassung am 21. April 2010 Online verffentlicht am 6. Juli 2010

Chemie

Abbildung 4. Die diatrope Region von Bindz fr 1, berechnet mit PW91/ IGLO-III und der IGLO-Methode, in Aufsicht (oben) und Seitenansicht (unten).

Hauptachse des Molekls kann einen Ringstrom innerhalb und parallel zur Moleklebene induzieren. Die gesamte magnetische Respons, mathematisch identisch mit NICSzz, zeigt einen langreichweitigen Abschirmkegel senkrecht zur Moleklebene. Dieser Kegel ist sogar intensiver als fr Benzol. Man beachte, dass der Ring A von einem stark abschirmenden Gebiet umgeben ist (ca. 100 ppm). Die Bindz-Intensitt sinkt vom inneren zum ueren Ring B, was das Vorliegen von zwei konzentrischen p-Ringen unterstreicht. Unsere Methode ermglicht die Aufspaltung von Bindz in Beitrge von Rumpf-, s- und p-Orbitalen.[30] Die Rumpfelektronen haben auer in direkter Kernnhe keine nennenswerten Beitrge zu Bind. Interessanterweise erzeugen die lokalen diamagnetischen Beitrge der s-Elektronen eine langreichweitige Respons und eine diatrope (abschirmende) Region im Fnfring. Die p-Orbitale zeigen die typische Respons eines aromatischen Systems. Die Feldlinien parallel zur Moleklebene verlieren die Form des Molekls und werden zu Kreisen. Im Ring sind keine paratropen (entschirmenden) Beitrge zu finden. Auerhalb des Molekls bilden die Feldlinien langreichweitige Kegel (Abschirmkegel). Die p-Beitrge sind jedoch kleiner als die Beitrge des s-Gersts, was zu einer starken Gesamtrespons des Systems fhrt. Es ist also, hnlich wie bei Al42,[31, 32] der Beitrag des p-Systems in 1 kleiner als der des s-Systems, aber er ist immer noch wichtig fr die Gesamtrespons. In diesem Sinne ist B19 ein doppelt aromatisches System. Die Bindz-Isolinien von 2 zeigen bezglich Form und Intensitt im Wesentlichen die gleiche magnetische Respons wie fr 1. Daher sind die nderungen der s- und p-Aromatizitt whrend der Rotation vernachlssigbar. Das ist ein groer Unterschied zu klassischen organischen Systemen,
Angew. Chem. 2010, 122, 5803 5806

Stichwrter: Aromatizitt Bor Dichtefunktionaltheorie Konzentrische p-Systeme Molekldynamik

[1] W. Huang, A. P. Sergeeva, H. J. Zhai, B. B. Averkiev, L.-S. Wang, A. I. Boldyrev, Nat. Chem. 2010, 2, 202 206. [2] D. Y. Zubarev, A. I. Boldyrev, J. Comput. Chem. 2007, 28, 251 268. [3] H. J. Zhai, A. N. Alexandrova, K. A. Birch, A. I. Boldyrev, L.-S. Wang, Angew. Chem. 2003, 115, 6186 6190; Angew. Chem. Int. Ed. 2003, 42, 6004 6008. [4] A. N. Alexandrova, H. J. Zhai, L.-S. Wang, A. I. Boldyrev, Inorg. Chem. 2004, 43, 3552 3554. [5] P. W. Fowler, B. R. Gray, Inorg. Chem. 2007, 46, 2892 2897. [6] H. J. Zhai, B. Kiran, J. Li, L.-S. Wang, Nature Mater. 2003, 2, 827 833. [7] J. E. Fowler, J. M. Ugalde, J. Phys. Chem. A 2000, 104, 397 403. [8] B. B. Averkiev, A. I. Boldyrev, Russ. J. Gen. Chem. 2008, 78, 769 773. [9] K. Exner, P. von R. Schleyer, Science 2000, 290, 1937 1940. [10] Y. B. Wu, C. X. Yuan, P. Yang, J. Mol. Struct. (THEOCHEM) 2006, 765, 35 38. [11] R. Islas, T. Heine, K. Ito, P. von R. Schleyer, G. Merino, J. Am. Chem. Soc. 2007, 129, 14767 14774. [12] J. M. Xiong, L. F. Gong, Q. S. Li, Chem. J. Chin. Univ. 2007, 28, 1968 1971. [13] Y. Pei, X. C. Zeng, J. Am. Chem. Soc. 2008, 130, 2580 2592. [14] B. B. Averkiev, L. M. Wang, W. Huang, L.-S. Wang, A. I. Boldyrev, Phys. Chem. Chem. Phys. 2009, 11, 9840 9849. [15] K. Ito, Z. Pu, Q. S. Li, P. von R. Schleyer, Inorg. Chem. 2008, 47, 10906 10910. [16] J. C. Guo, W. Z. Yao, Z. Li, S. D. Li Sci. China, Sci. China Ser. B 2009, 52, 566 570. [17] C. Q. Miao, J. C. Guo, S. D. Li, Sci. China Ser. B 2009, 52, 900 904.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5805

Zuschriften
[18] Z. F. Pu, K. Ito, P. von R. Schleyer, Q. S. Li, Inorg. Chem. 2009, 48, 10679 10686. [19] S. Erhardt, G. Frenking, Z. F. Chen, P. von R. Schleyer, Angew. Chem. 2005, 117, 1102 1106; Angew. Chem. Int. Ed. 2005, 44, 1078 1082. [20] B. B. Averkiev, D. Y. Zubarev, L. M. Wang, W. Huang, L.-S. Wang, A. I. Boldyrev, J. Am. Chem. Soc. 2008, 130, 9248 9250. [21] L. M. Wang, W. Huang, B. B. Averkiev, A. I. Boldyrev, L.-S. Wang, Angew. Chem. 2007, 119, 4634 4637; Angew. Chem. Int. Ed. 2007, 46, 4550 4553. [22] Z. Slanina, S. L. Lee, F. Uhlik, L. Adamowicz, S. Nagase, Theor. Chem. Acc. 2007, 117, 315 322. [23] G. Merino, T. Heine, G. Seifert, Chem. Eur. J. 2004, 10, 4367 4371. [24] G. Merino, A. Vela, T. Heine, Chem. Rev. 2005, 105, 3812 3841. [25] Fr diesen Teil der Analyse haben wir Gaussian03 rev. D.02 verwendet (M. J. Frisch, et al. Gaussian Inc., Pittsburgh, PA, 2003). hnliche geometrische Resultate und Energiewerte wurden auf PBE/6-311 + G(d)-Niveau erhalten. Alle optimier[26] [27] ten Strukturen sind in den Hintergrundinformationen angegeben. Wir haben durch IRC-Rechnungen sichergestellt, dass der bergangszustand mit beiden Minima korreliert. Bei diesen Rechnungen kam das Programm deMon zum Einsatz (A. M. Kster, et al., deMon2k, The deMon Developers Community, Mexico, 2008); a) B. Hammer, L. B. Hansen, J. K. Norskov, Phys. Rev. B. 1999, 59, 7413 7421; b) P. Calaminici, F. Janetzko, A. M. Kster, R. Mejia-Olvera, B. Zuniga-Gutierrez, J. Chem. Phys. 2007, 126, 044108. Ein Film dieser Trajektorie ist abzurufen auf http://quimera.ugto.mx/qtc/b19.html und http://www.youtube.com/ watch?v = Dj7-4NjowiQ. Die angegebenen Werte beziehen sich auf BF3OEt2 als Standard. T. Heine, R. Islas, G. Merino, J. Comput. Chem. 2007, 28, 302 309. A. I. Boldyrev, L.-S. Wang, Chem. Rev. 2005, 105, 3716 3757. R. Islas, T. Heine, G. Merino, J. Chem. Theory Comput. 2007, 3, 775 781.

[28]

[29] [30] [31] [32]

5806

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5803 5806

Angewandte
DOI: 10.1002/ange.201000911

Chemie

Kleinringsysteme

Eine vielseitige und stereoselektive Synthese funktionalisierter Cyclobutene**


Frdric Frbault, Marco Luparia, Maria Teresa Oliveira, Richard Goddard und Nuno Maulide*
Viergliedrige Carbocyclen sind ein hufiges Strukturelement von natrlich vorkommenden und/oder biologisch aktiven Verbindungen (Schema 1).[1] Ihre inhrente Ringspannung bietet zahlreiche prparative Mglichkeiten, sodass der

Schema 1. Strukturen von Naturstoffen mit Cyclobutan- oder Cyclobutengruppe.[4]

Schema 2. Photochemischer Ansatz fr die Synthese von Cyclobutenen.

Aufbau solcher Strukturen seit jeher ein wichtiges Thema in der organischen Chemie ist. Die am hufigsten untersuchten Cyclobutanderivate sind Cyclobutanone und Cyclobutenone,[2] hingegen sind effiziente stereoselektive Methoden fr die Synthese von Cyclobutan- und Cyclobutenderivaten ohne Carbonylgruppe vergleichsweise selten.[3] Jedoch sind insbesondere Cyclobutene durch die C-C-Doppelbindung im Ring ein besonders vielseitiger Synthesebaustein.[3] Die Photocycloaddition von Maleinsureanhydrid und Acetylen kann als Referenzsystem und Gradmesser fr die Synthese von Cyclobutenen gelten (Schema 2 a).[3a, 5] Trotz zahlreicher Fortschritte bei der Desymmetrisierung des entstehenden Addukts 1 (und analogen Verbindungen) durch Ringffnungsreaktionen,[6] sind die erhltlichen Produkte, die zwei direkt am Vierring gebundene Carboxygruppen enthalten, aus prparativer Sicht nicht sehr vielseitig. Daraus ergibt
[*] Dr. F. Frbault,[+] Dr. M. Luparia,[+] M. T. Oliveira, Dr. R. Goddard, Dr. N. Maulide Max-Planck-Institut fr Kohlenforschung Kaiser-Wilhelm-Platz 1, 45470 Mlheim an der Ruhr (Deutschland) Fax: (+ 49) 208-306-2999 E-Mail: maulide@mpi-muelheim.mpg.de Homepage: http://www.kofo.mpg.de/maulide [+] Die Autoren trugen zu gleichen Teilen zu dieser Arbeit bei. [**] Wir danken der Max-Planck-Gesellschaft und dem Max-Planck-Institut fr Kohlenforschung fr die Finanzierung unserer Forschung sowie den HPLC-, NMR- und Rntgenanalyse-Abteilungen des MPI Mlheim. Dr. W. Klotzbcher (MPI Mlheim) danken wir fr photochemisches Equipment, U. Specht fr die Untersttzung bei den photochemischen Experimenten und der ANKA-Synchrotroneinrichtung, Karlsruhe, fr Messzeit. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201000911 zu finden.
Angew. Chem. 2010, 122, 5807 5811

sich die Notwendigkeit eines flexibleren stereoselektiven Zugangs zu substituierten Cyclobutenen. Bei unseren Recherchen stieen wir auf die 40 Jahre alte, jedoch wenig untersuchte Photoisomerisierung von 2-Pyron (2) zum Lacton 3 (Schema 2 b).[7a] Verbindung 3 ist bekannt als eine empfindliche, instabile und potenziell explosive Substanz,[7a,b] die, vielleicht wenig berraschend, bisher nicht als Ausgangsverbindung fr Folgereaktionen in Betracht gezogen wurde.[7] Hier beschreiben wir die erste katalytische stereoselektive Transformation von 3 als Grundlage fr eine vielseitige Route zu funktionalisierten Cyclobutenen in nur zwei Synthesestufen ausgehend von 2-Pyron (2). Die photochemische Isomerisierung des leicht verfgbaren 2 zu 3 verlief in quantitativer Ausbeute. Stammlsungen von 3 in Diethylether konnten in Konzentrationen zwischen 0.1 und 0.2 m aufbewahrt und ohne spezielle Vorsichtsmanahmen gehandhabt werden.[8] Erste Versuche zur metallvermittelten Funktionalisierung von 3 machten schnell deutlich, dass das sterisch gespannte allylische Lacton-Motiv in Gegenwart von Palladiumkatalysatoren reaktiv ist.[9] Unter optimierten Bedingungen[10] lieferte die Umsetzung von 3 mit Natriumdimethylmalonat in Gegenwart von 5 Mol-% [Pd(PPh3)4] in nahezu quantitativer Ausbeute die cis-Cyclobutencarbonsure 4 a als einzelnes Diastereomer (Schema 3).[11] Aufbauend auf diesem Ergebnis, das einer stereoselektiven Synthese von hochfunktionalisierten Cyclobutenen in nur zwei Stufen entspricht, testeten wir eine Serie von Nucleophilen (Tabelle 1). Zur einfacheren Reinigung und Analytik wurden die meisten der direkt erhaltenen Suren 4 mit Thionylchlorid und Methanol in die Methylester 5 berfhrt. Wie aus Tabelle 1 ersichtlich wird, ist eine Reihe von aktivierten Methylenverbindungen fr diese Reaktion geeignet

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5807

Zuschriften
(Schema 4). Eine Einkristall-Rntgenstrukturanalyse zeigte jedoch, dass es sich um den umgelagerten Azabicyclus 7 a handelte.[11] Offenbar folgt auf eine Spaltung der Azlactoneinheit des angenommenen Produkts A eine ungewhnlich

Schema 3. Erstes Ergebnis bei Versuchen zur katalytischen Funktionalisierung von Lacton 3.

Tabelle 1: Substratspektrum der katalytischen Alkylierung von Lacton 3.[a]

Nr. 1 2 3 4 5 6 7 8 9 10 11 12

R Me Bn tBu Et

R H H H Me Et nBu Bn Allyl CH2C6H4(4-NO2) -(CH2)2CHCH CH2CO2Et H

EWG CO2Me CO2Bn CO2tBu CO2Et

Produkt 4a 4b 4c 5d 4e 5f 5g 5h 5i 5j 5k 5l

Ausb. [%][b] [92] [47] [42] 80 [90] 74 83 76 59 88 51 46[c] Schema 4. Alkylierung von Lacton 3 mit Azlacton 6 a mit unerwarteter Umlagerung.

Me Et Me

CO2Me CO2Et CONPh2

[a] Alle Reaktionen wurden, falls nicht anders erwhnt, in einem Mastab von 0.1 oder 0.2 mmol mit 5 Mol-% [Pd(PPh3)4], 2.0 quivalenten NaH und 2.2 quivalenten Nucleophil bei 0 8C durchgefhrt. Bn = Benzyl, Me = Methyl, Et = Ethyl, Ph = Phenyl. [b] Ausbeute an reinem isoliertem Produkt. Ausbeuten in Klammern beziehen sich auf analytisch reine Carbonsuren 4, die als Rohprodukt erhalten wurden. [c] Verbindung 5 l wurde als ein einzelnes Diastereomer nach Methylierung erhalten.[8]

einfach ablaufende Cyclisierung zum Lactam 7 a (Schema 4). Unseres Wissens ist eine solche Umlagerung bislang unbekannt in der Chemie der Azlactone.[13] Ein weiterer interessanter Aspekt war die sehr hohe Diastereoselektivitt dieser Reaktion. Die sorgfltige Analyse des Rohprodukts von 7 a ergab nur einen geringen Anteil (typischerweise 10 %) des an C4 epimeren Lactams (Schema 4). Es handelt sich hierbei um einen seltenen Fall von hoher doppelter Diastereoselektivitt in Reaktionen von Azlactonen ohne Einsatz externer chiraler Liganden (siehe unten).[14] Die Untersuchung des Substratspektrums deckte eine Reihe von Trends auf (Tabelle 2).[10] Interessanterweise spielt der aromatische Rest des angreifenden Azlacton-Nucleophils

trotz der ausgeprgten Instabilitt von Lacton 3. Die elektronenziehenden Substituenten R konnten variiert werden (Tabelle 1, Nr. 13 und 12), und substituierte Nucleophile fhrten problemlos zur Bildung von quartren Kohlenstoffzentren (Tabelle 1, Nr. 411). Bedeutsam ist, dass Alkyl-, Benzyl-, Acetat-, Allyl- und Homopropargylgruppen gut toleriert wurden. Des Weiteren wurde hohe Diastereoselektivitt verzeichnet, wenn die Carbonylgruppen des Nucleophils nicht identisch waren (Tabelle 1, Nr. 12). Die hohe Atomkonomie dieser Reaktionsfolge, ausgehend von 2-Pyron (2), geht mit einem signifikanten Anstieg der molekularen Komplexitt unter Verwendung einfachster Ausgangsmaterialien einher. Damit bot es sich an, die Syntheseroute zum Aufbau biologisch relevanter Substrukturen zu nutzen, so etwa von Cyclobutenaminosuren. Tatschlich hat man vor kurzem das biologische Potenzial von Aminosuren mit gespannten Ringen erkannt.[12] Uns erschienen Azlactone als geeignete Nucleophile, um komplexe Aminosuregerste aufbauen zu knnen. Bei der Umsetzung von Lacton 3 mit Azlacton 6 a unter den Bedingungen aus Schema 3 entstand ein neues Produkt, das wir zunchst als die alkylierte Sure A vermuteten

Tabelle 2: Substratspektrum der katalytischen Synthese der Azabicyclen 7.[a]

Nr. 1 2 3 4 5 6 7 8 9 10

Azlacton 6a 6b 6c 6d 6e 6f 6g 6h 6i 6j

Ar Ph (4-OMe)C6H4 (3,5-CF3)C6H3 (4-NO2)C6H4 Ph (4-NO2)C6H4

R Me

Produkt 7a 7b 7c 7d 7e 7f 7g 7h 7i 7j

Ausb. [%] (d.r.)[b] 57 (90:10) 37 (90:10) 45 (91:9) 68 (93:7) 26 (> 95:5) 46 (95:5) 54 (93:7) 57 (94:6) 47 (88:12) 56 (90:10)

Bn Bn Et Bu (CH2)2Ph Allyl

[a] Alle Reaktionen wurden, falls nicht anders erwhnt, in einem Mastab von 0.2 mmol mit 5 Mol-% [Pd(PPh3)4], 2.0 quivalenten NEt3 und 2.25 quivalenten 6 bei 0 8C durchgefhrt. [b] Ausbeute an reinem, diastereomerenreinem isoliertem Produkt; d.r.-Werte beziehen sich auf das Rohprodukt.
Angew. Chem. 2010, 122, 5807 5811

5808

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
eine wichtige Rolle (Tabelle 2, Nr. 14), und beim bergang von elektronenschiebenden Substituenten (p-OMe) zu induktiv elektronenziehenden (p-CF3), neutralen (H) und stark elektronenziehenden Substituenten (p-NO2) wurden beinahe 10 % Ausbeutedifferenz verzeichnet. Dass es sich dabei um keinen einfachen Umsatzeffekt handelte, wurde bei der Analyse der NMR-Spektren der Rohprodukte deutlich, die wesentlich weniger Nebenprodukte anzeigten, wenn p-Nitroazlacton 6 d eingesetzt wurde. Dieser Effekt[15] trat auch bei anderen Substraten deutlich hervor (vgl. z. B. Nr. 5 und 6 in Tabelle 2), sodass wir den Nitrophenyl-Rest fr alle weiteren Untersuchungen des Substratspektrums einsetzten. Bezglich des Substituenten R wurden Alkyl-, Allyl- und Benzylgruppen toleriert (Tabelle 2, Nr. 610). Die durch diese einfache Sequenz erhaltenen Addukte konnten in einer Vielzahl von Folgereaktionen eingesetzt werden, die die latente Reaktivitt der gebildeten funktionellen Gruppen nutzen (Schema 5). Beispielsweise konnte die gespannte Doppelbindung im Cyclobuten 5 d mhelos dihydroxyliert werden, wodurch das tetrasubstituierte Cyclobutan 10 in guter Ausbeute und mit vollstndiger Kontrolle aller vier Stereozentren gewonnen wurde. Im Hinblick auf biologisch relevante Strukturen wurde das Amid 8 einer Hofmann-Umlagerung unterzogen und lieferte problemlos die vollstndig geschtzte, sterisch gespannte Cyclobuten-gaminosure 9.[16] Weitere Experimente bekrftigen den prparativen Nutzen der Cyclobuten-Doppelbindung und zeigen Anwendungsmglichkeiten dieser Methode in der Totalsynthese auf. So lieferte die Ringffnungsmetathese/Kreuzmetathese[17] des Azabicyclus 11 unter Ethylenatmosphre (1 atm) in Gegenwart des Grubbs-Katalysators der zweiten Generation diastereomerenreines Pyrrolidin 12, dessen Struktur an Derivate der Kain- und Domoinsure erinnert.[18] Eine zweistufige Halolactonisierung des Triesters 5 a fhrte zum Bicyclus 13, der die Gerststruktur von Pestalotiopsin A aufweist.[19] Die Tatsache, dass prparativ relevante Strukturen in nur drei einfachen Synthesestufen aus 2-Pyron erhalten werden knnen, belegt das Leistungsvermgen dieses Ansatzes. Schlielich gaben erste Experimente ermutigende Ergebnisse im Hinblick auf die Entwicklung einer asymmetrischen Variante (Schema 6). Der Austausch des Palladium-

Chemie

Schema 6. Erste Ergebnisse zur asymmetrischen Alkylierung von Lacton 3. Die absolute Konfiguration der Hauptenantiomere ()-14 und (+)-15 wurde nicht bestimmt. EDCl = 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimid.

Schema 5. Folgereaktionen der erhaltenen Additionsprodukte. MTBE = Methyl-tert-butylether, DCM = Dichlormethan, NIS = N-Iodsuccinimid, TFA = Trifluoressigsure.
Angew. Chem. 2010, 122, 5807 5811

systems durch ein Katalysatorsystem aus dimerem [{Pd(C3H5)Cl}2] und dem Trost-Liganden (R,R)-L1 fhrte bei sonst gleichen Reaktionsbedingungen zur Bildung von ()-14 (isoliert als das Benzamidderivat) mit einem Enantiomerenverhltnis von 89.5:10.5[20] (Schema 6; die absolute Konfiguration des Hauptenantiomers wurde nicht bestimmt). Die Umsetzung des Azlactons 6 a unter Einsatz des Liganden (R,R)-L2 lieferte den Azabicyclus (+)-15 mit einem beeindruckenden Enantiomerenverhltnis von 97:3 (Schema 6). Interessanterweise war die starke asymmetrische Induktion des Liganden L2 in der Lage, die inhrent hohe Diastereoselektivitt des racemischen Prozesses stark zu beeinflussen (siehe Schema 4 und Tabelle 2), sodass ein nahezu 2:1-Diastereomerenverhltnis von C4-Epimeren erhalten wurde (abgebildet in Schema 6 ist das Hauptdiastereomer; die absolute Konfiguration des Hauptenantiomers wurde nicht bewww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5809

Zuschriften
stimmt). Die Ursache dieses Effekts ist nicht klar, aber die Aussicht auf Abschwchung oder sogar Aufhebung der inhrenten Diastereoprferenz in der Kupplung des Lactons 3 mit Nucleophilen durch die Wahl eines geeigneten Liganden ist auerordentlich spannend und wird weiter untersucht werden. Zusammenfassend haben wir eine neue und direkte Synthese von funktionalisierten Cyclobutenen entwickelt. Um dieses Ziel zu erreichen, spielte die Palladium-Katalyse eine entscheidende Rolle, um die Instabilitt des empfindlichen Lactons 3 zu bndigen. Der hier vorgestellte Prozess kombiniert die Effizienz sauberer, uerst leistungsfhiger photochemischer Umsetzungen mit der hohen Selektivitt der Metallkatalyse und sollte breite Anwendung in der Synthese finden. Die Reaktionssequenz besitzt eine ausgezeichnete Atomeffizienz und geht von preisgnstigen und leicht verfgbaren, achiralen flachen Pyronen aus, um vielseitige Produkte von hohem prparativem Nutzen zu erzeugen. Weiterentwicklungen der Methode und die Entwicklung verwandter Reaktionssequenzen, die auf das Lacton 3 und dessen Derivate zurckgreifen, sowie Anwendungen in der Totalsynthese biologisch relevanter Zielmolekle sind derzeit Gegenstand unserer Arbeiten.
Eingegangen am 12. Februar 2010, vernderte Fassung am 12. Mrz 2010 Online verffentlicht am 13. Juli 2010 [5] d) M. Pulici, F. Sugawara, H. Koshino, J. Uzawa, S. Yoshida, E. Lobkovsky, J. Clardy, J. Org. Chem. 1996, 61, 2122 2124. Verwandte Beispiele von [2+2]-Alkin-Enon- oder Halogenolefin-Enon-Cycloadditionen: a) J. D. White, M. A. Avery, J. P. Carter, J. Am. Chem. Soc. 1982, 104, 5486 5489; b) J. D. White, J. Kim, N. E. Drapela, J. Am. Chem. Soc. 2000, 122, 8665 8671; c) G. Mehta, K. Sreenivas, Tetrahedron Lett. 2002, 43, 703 706; d) M. Inoue, T. Sato, M. Hirama, J. Am. Chem. Soc. 2003, 125, 10772 10773; e) R. Alibs, P. de March, M. Figueredo, J. Font, M. Racamonde, T. Parella, Org. Lett. 2004, 6, 1449 1452. a) M. E. Jung, A. W. Sledeski, J. Chem. Soc. Chem. Commun. 1993, 589 591; b) F. Binns, R. Hayes, K. J. Hodgetts, S. T. Saengchantara, T. W. Wallace, C. J. Wallis, Tetrahedron 1996, 52, 3631 3658; c) M.-E. Gourdel-Martin, C. Comoy, F. Huet, Tetrahedron: Asymmetry 1999, 10, 403 404; d) J. E. Baldwin, R. C. Burrell, J. Org. Chem. 2000, 65, 7139 7144; e) S. Ogawa, D. Urabe, Y. Yokokura, H. Arai, M. Arita, M. Inoue, Org. Lett. 2009, 11, 3602 3605. a) E. J. Corey, J. Streith, J. Am. Chem. Soc. 1964, 86, 950 951; weitere Studien zur photochemischen Umwandlung von 2 in 3 : b) H. Javaheripour, D. C. Neckers, J. Org. Chem. 1977, 42, 1844 1850; c) W. H. Pirkle, L. H. McKendry, J. Am. Chem. Soc. 1969, 91, 1179 1186; d) B. R. Arnold, C. E. Brown, J. Lusztyk, J. Am. Chem. Soc. 1993, 115, 1576 1577. Unseres Wissens ist bislang nur ein Bericht ber die Lactonffnung von 3 literaturbekannt (mit konzentrierter HCl; Ausbeuten wurden nicht erwhnt).[7b] Weitere Details sind in den Hintergrundinformationen verfgbar. Zur palladiumkatalysierten Allylsubstitution: a) J. Tsuji, in Palladium Reagents and Catalysts, Wiley, New York, 1996, Kap. 4, S. 290 404; b) C. G. Frost, J. Howarth, J. M. J. Williams, Tetrahedron: Asymmetry 1992, 3, 1089 1122; c) T. Hayashi in Catalytic Asymmetric Synthesis (Ed.: I.Ojima), VCH, New York, 1993, S. 325; d) B. M. Trost, D. L. Van Vranken, Chem. Rev. 1996, 96, 395 422. Siehe Hintergrundinformationen. Die Strukturen von 4 a und 7 a wurden durch Einkristall-Rntgenstrukturanalyse besttigt (Hintergrundinformationen). CCDC 765516 (4 a) und CCDC 765517 (7 a) enthalten die ausfhrlichen kristallographischen Daten zu dieser Verffentlichung. Die Daten sind kostenlos beim Cambridge Crystallographic Data Centre ber www.ccdc.cam.ac.uk/data_request/cif erhltlich. Zur Verwendung von a,a-disubstituierten (quartren) a-Aminosuren in Peptidmimetika: a) B. M. Trost, X. Ariza, J. Am. Chem. Soc. 1999, 121, 10727 10737, zit. Lit.; bersichtsartikel ber a,a-disubstituierte (quartre) a-Aminosuren: b) C. Cativiela, M. D. Diaz-de-Villegas, Tetrahedron: Asymmetry 1998, 9, 3517 3599; c) C. Cativiela, M. D. Diaz-de-Villegas, Tetrahedron: Asymmetry 2000, 11, 645 732; d) Y. Ohfune, T. Shinada, Eur. J. Org. Chem. 2005, 5127 5143; e) H. Vogt, S. Brse, Org. Biomol. Chem. 2007, 5, 406 430. Fr eine entfernt verwandte Transformation siehe: S. Cabrera, E. Reyes, J. Alemn, A. Milelli, S. Kobbelgaard, K. A. Jorgensen, J. Am. Chem. Soc. 2008, 130, 12031 12037. Zum Vergleich: In einer verwandten Reaktion erzielten Trost und Lee mit dem achiralen Komplex [Pd(PPh3)4] ein Diastereomerenverhltnis von 1:1.6 (das unseres Wissens einzige literaturbekannte Diastereomerenverhltnis fr eine Reaktion dieses Typs): B. M. Trost, C. Lee, J. Am. Chem. Soc. 2001, 123, 12191 12201. Der genaue Ursprung dieses bislang unbekannten Effekts ist noch unklar. Ausgewhlte Arbeiten ber Cyclobutanaminosuren: a) M. Martn-Vil, E. Muray, G. P. Aguado, A. Alvarez-Larena, V. Branchadell, C. Minguilln, E. Giralt, R. M. Ortuo, Tetrahedron: Asymmetry 2000, 11, 3569 3584; b) S. Izquierdo, F. Ra,
Angew. Chem. 2010, 122, 5807 5811

[6]

[7]

[8] [9]

Stichwrter: Azlactone Cyclobutene Palladium Photochemie Stereoselektive Reaktionen


[10] [11] [1] a) V. M. Dembitsky, J. Nat. Med. 2008, 62, 1 33; b) T. V. Hansen, Y. Stenstrm, in Organic Synthesis: Theory and Applications, Vol. 5 (Eds.: H. Baltes, W. Gpel, J. Hesse), Elsevier, Amsterdam, 1996, S. 1 38; bersichtsartikel: c) J. C. Namyslo, D. E. Kaufmann, Chem. Rev. 2003, 103, 1485 1538; d) E. LeeRuff, G. Mladenova, Chem. Rev. 2003, 103, 1449 1484. , B. Ernst, Angew. Chem. 1988, 100, 820 850; [2] a) D. Bellus Angew. Chem. Int. Ed. 1988, 27, 797 827; b) B. B. Snider, Chem. Rev. 1988, 88, 793 811. [3] a) N. Gauvry, C. Lescop, F. Huet, Eur. J. Org. Chem. 2006, 5207 5218; b) A. de Meijere, in Carbocyclic Four-membered Ring Compounds, Houben-Weyl, Methods of Organic Chemistry, Vol. 17f, Thieme, Stuttgart, 1997; c) J. P. Hehn, C. Mller, T. Bach in Handbook of Synthetic Photochemistry (Hrsg.: A. Albini, M. Fagnoni), Wiley-VCH, Weinheim, 2009, S. 171 215; d) T. Bach, Synthesis 1998, 683 703; Beispiele fr bergangsmetallkatalysierte Reaktionen zur Bildung von Cyclobutenprodukten: e) A. Frstner, P. W. Davies, T. Gress, J. Am. Chem. Soc. 2005, 127, 8244 8245; f) M. Shi, L. P. Liu, J. Tang, J. Am. Chem. Soc. 2006, 128, 7430 7431; g) O. Debleds, J. M. Campagne, J. Am. Chem. Soc. 2008, 130, 1562 1563; h) A. Masarwa, A. Frstner, I. Marek, Chem. Commun. 2009, 5760 5762; i) Y. T. Lee, T. K. Kang, Y. K. Chung, J. Org. Chem. 2009, 74, 7922 7934, zit. Lit. [4] Grandisol: a) J. H. Tumlinson, D. D. Hardee, R. C. Gueldner, A. C. Thompson, P. A. Hedin, J. P. Minyard, Science 1969, 166, 1010 1012; unbenanntes Illudan: b) F. Bohlmann, M. Grenz, P. Wegner, J. Jakupovic, Liebigs Ann. Chem. 1983, 2008 2020; Illudosin: c) A. Amone, R. Cardillo, G. Nasini, O. V. de Pava, J. Chem. Soc. Perkin Trans. 1 1991, 1787 1791; Pestalotiopsin A:

[12]

[13]

[14]

[15] [16]

5810

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
A. Sbai, T. Parella, A. Alvarez-Larena, V. Branchadell, R. M. Ortuo, J. Org. Chem. 2005, 70, 7963 7971; c) D. J. Aitken, C. Gauzy, E. Pereira, Tetrahedron Lett. 2004, 45, 2359 2361; d) A. Avenoza, J. H. Busto, N. Canal, J. M. Peregrina, J. Org. Chem. 2005, 70, 330 333; e) A. Mondire, R. Peng, R. Remuson, D. J. Aitken, Tetrahedron 2008, 64, 1088 1093; f) E. Torres, E. Gorrea, E. Da Silva, P. Nolis, V. Branchadell, R. M. Ortuo, Org. Lett. 2009, 11, 2301 2304; g) B. Basler, O. Schuster, T. Bach, J. Org. Chem. 2005, 70, 9798 9808; Cyclobuten-Nucleoside: h) M.-E. Gourdel-Martin, F. Huet, J. Org. Chem. 1997, 62, 2166 2172; Cyclobuten-Analoga von Acetylcholin: i) J. G. Cannon, D. M. Crockatt, J. P. Long, W. Maixner, J. Med. Chem. 1982, 25, 1091 1094. [17] Ausgewhlte Arbeiten: a) R. O. Jeon, D. Rayabarapu, A. Rolfe, K. Volp, I. Omar, P. R. Hanson, Tetrahedron 2009, 65, 4992 5000; b) G. Barbe, A. B. Charette, J. Am. Chem. Soc. 2008, 130, 13873 13875; c) H. Ovaa, C. Stapper, G. A. van der Marel, H. S. Overkleeft, J. H. van Boom, S. Blechert, Tetrahedron 2002, 58, 7503 7518. [18] a) A. F. Parsons, Tetrahedron 1996, 52, 4149 4174; b) J. Clayden, B. Read, K. R. Hebditch, Tetrahedron 2005, 61, 5713 5724. [19] Ausgewhlte Studien zur Synthese von Pestalotiopsin A: a) D. Johnston, E. Couch, D. J. Edmonds, K. W. Muir, D. J. Procter, Org. Biomol. Chem. 2003, 1, 328 337; b) T. M. Baker, D. J. Edmonds, D. Hamilton, C. J. OBrien, D. J. Procter, Angew. Chem. 2008, 120, 5713 5715; Angew. Chem. Int. Ed. 2008, 47, 5631 5633; c) L. A. Paquette, G. D. Parker, T. Tei, S. Dong, J. Org. Chem. 2007, 72, 7125 7134; d) L. A. Paquette, S. Dong, G. D. Parker, J. Org. Chem. 2007, 72, 7135 7147; die bislang einzige abgeschlossene Totalsynthese: e) K. Takao, N. Hayakawa, R. Yamada, T. Yamaguchi, U. Morita, S. Kawasaki, K.-i. Tadano, Angew. Chem. 2008, 120, 3474 3477; Angew. Chem. Int. Ed. 2008, 47, 3426 3429. [20] Hierbei handelt es sich sehr wahrscheinlich um ein Beispiel fr eine dynamische kinetische asymmetrische Transformation (DYKAT) vom Typ II. Fr allgemeine bersichten ber dynamische kinetische Racematspaltungen siehe: a) R. S. Ward, Tetrahedron: Asymmetry 1995, 6, 1475 1490; b) H. Pellissier, Tetrahedron 2003, 59, 8921 8927; ein spezieller bersichtsartikel ber Pd und DYKAT: c) B. M. Trost, D. R. Fandrick, Aldrichimica Acta 2007, 40, 59 72; fr eine Klassifizierung der DYKAT-Mechanismen siehe: d) J. Steinreiber, K. Faber, H. Grieng, Chem. Eur. J. 2008, 14, 8060 8072.

Chemie

Angew. Chem. 2010, 122, 5807 5811

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5811

Zuschriften
Polymorphie
DOI: 10.1002/ange.201000680

Die Strukturen von d-PdCl2 und g-PdCl2 : Phasen mit negativer thermischer Ausdehnung in einer Richtung**
Jrgen Evers,* Wolfgang Beck, Michael Gbel, Stefanie Jakob, Peter Mayer, Gilbert Oehlinger, Marianne Rotter und Thomas M. Klaptke
Professor Rolf Huisgen zum 90. Geburtstag gewidmet Palladium(II)-chlorid existiert bei Normaldruck in vier Modifikationen, von denen bislang lediglich die a- und die bPhase strukturell untersucht worden sind. Nach einer Einkristall-Rntgenstrukturuntersuchung von Wells[1] aus dem Jahr 1938 kristallisiert a-PdCl2 mit orthorhombischer Symmetrie in der Raumgruppe Pnnm und mit zwei Formeleinheiten pro Elementarzelle und bildet Bnder kantenverknpfter PdCl4-Quadrate. Eine Verfeinerung der Strukturdaten von Wells mit moderner Beugungstechnik schien nach ber 70 Jahren sinnvoll und wurde in der hier vorgestellten Arbeit durchgefhrt. b-PdCl2 wurde von Schfer et al. entdeckt,[2] und seine Struktur wurde von Belli DellAmico et al. mit einer Einkristall-Rntgenstrukturuntersuchung aufgeklrt.[3] Danach kristallisiert b-PdCl2 mit rhomboedrischer Symmetrie in der Raumgruppe R" 3 und mit einer Formeleinheit Pd6Cl12 pro Elementarzelle. Die Pd6Cl12-Cluster bilden analog zu Pt6Cl12[4, 5] isolierte Wrfel, auf deren Wrfelflchen PdCl4Quadrate liegen. Die Pd-Atome besetzen dabei die Flchenmitten und die Chloratome die Kantenmitten. Erste Hinweise auf die beiden weiteren polymorphen Phasen ergaben sich bereits 1965 aus einer Rntgenpulveruntersuchung von Soulen und Chapell.[6] Demnach ist aPdCl2, analog zu a-PtCl2, eine Hochtemperaturphase und kann durch Abschrecken auf Raumtemperatur als metastabile Phase erhalten werden. Soulen und Chapell[6] grenzten zu a-PdCl2 auch eine Tieftemperaturphase ab, von der sie vier dWerte des Rntgenpulverdiagramms publizierten. Diese Phase wird als g-PdCl2 bezeichnet. Kufliches PdCl2 hat diese Kristallstruktur. Auerdem wiesen Soulen und Chapell[6] auf die Existenz einer zweiten Hochtemperaturphase hin, die im Thermogramm bei 504 8C ein schwaches endothermes Signal zeigte. Diese Phase wird als d-PdCl2 bezeichnet. Die Aufklrung der Struktur von g-PdCl2 scheiterte bislang an einer Deutung der Rntgenpulverdaten. Die Dissertation von G. Thiele[7] (1964) enthlt ein Strichdiagramm des Debye-Scherrer-Rntgenfilms dieser Phase sowie eine Tabelle mit 21 q-Werten. In der Dissertation von M. Klein[8] (1969) findet sich eine Tabelle mit 17 d-Werten von g-PdCl2,[6] die bei der Auswertung des Guinier-Rntgenfilms erhalten wurden. Eine Indizierung dieser Daten gelang allerdings nicht. Das Thermogramm (Abbildung 1) zeigt drei endotherme Signale fr Phasenumwandlungen bei 401 (g !a), 504 (a !d) und 683 8C (d !Schmelze) und besttigt die Daten von

Abbildung 1. Thermogramm von g-PdCl2 (140 mg, drei abgeschmolzene Quarzglasrhrchen, 2.0 mm Durchmesser) in statischer Argonatmosphre. Die Heizgeschwindigkeit ist 208C min1. Die Umwandlungen bei 504 und 683 8C sind beim Abkhlen reversibel, die bei 401 8C ist es nicht.

[*] Prof. Dr. J. Evers, Prof. Dr. W. Beck, Dr. M. Gbel, Dr. S. Jakob, Dr. P. Mayer, G. Oehlinger, M. Rotter, Prof. Dr. T. M. Klaptke Department fr Chemie, Ludwig-Maximilians-Universitt Mnchen Butenandtstrae 5-13, 81377 Mnchen (Deutschland) Fax: (+ 49) 89-2180-77950 E-Mail: eve@cup.uni-muenchen.de [**] J.E. dankt ganz besonders Prof. Dr. H. Brnighausen und Prof. Dr. M. Ruck fr Anregungen und kritische Diskussionen. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201000680 zu finden.

Soulen and Chapell.[6] Die der Umwandlung bei 504 8C entsprechende Signalflche ist etwa 15 Mal kleiner als die der Signale bei 401 und 683 8C. Dies legt einen displaziven und nur mit geringen Strukturnderungen verlaufenden Phasenbergang a !d nahe. Als Folge davon kann d-PdCl2 nicht auf Raumtemperatur abgeschreckt werden. Strukturuntersuchungen an dieser Phase waren daher nur in situ zwischen 504 und 683 8C mglich. Abbildung 1 zeigt weiterhin, dass die bei der Phasenumwandlung g !a auftretenden StrukturndeAngew. Chem. 2010, 122, 5812 5817

5812

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
rungen hnlich gro sind wie die beim Phasenbergang d ! Schmelze auftretenden. Darber hinaus ist die Umwandlung g !a bei 401 8C im Gegensatz zu den beiden anderen Umwandlungen nicht reversibel. Dies deutet auf eine rekonstruktive Phasenumwandlung mit groer kinetischer Hemmung hin. Nach Untersuchungen von Klein[8] wandelt sich das bei Raumtemperatur metastabile a-PdCl2 innerhalb von neun Monaten zu etwa 50 % in das thermodynamisch stabile gPdCl2 um. In Tabelle 1 sind fr die orthorhombische Hochtemperaturphase a die Kristallachsen, das Zellvolumen, die Positionsparameter der Chloratome und die isotropen Auslenkungsparameter bei vier Temperaturen zusammengestellt.[9] Tabelle 2 enthlt die Abstnde und die Winkel fr diese
Tabelle 1: Einkristalldaten[9] (Gitterkonstanten a, b, c [], Zellvolumen V [3], Positionsparameter der Chloratome xCl und yCl und isotrope Auslenkungsparameter U [2] von a-PdCl2, das im untersuchten Temperaturbereich T [K] metastabil ist. T a b c V xCl yCl UPd UCl 100 3.7572(4) 10.8941(11) 3.3463(3) 136.97(2) 0.1674(3) 0.13309(8) 0.0087(1) 0.0127(3) 200 3.7832(6) 10.9967(17) 3.3513(5) 139.42(4) 0.1648(4) 0.13274(9) 0.0158(1) 0.0228(3) 300 3.8115(5) 11.0371(13) 3.3429(3) 140.63(3) 0.1627(5) 0.13199(11) 0.0240(2) 0.0352(4) 400 3.8489(5) 11.1329(14) 3.3388(3) 143.07(3) 0.1589(4) 0.13138(10) 0.0337(1) 0.0498(3)

Chemie

Abbildung 2. Diamond-Abbildungen[10] von a-PdCl2 bei 400 K[9] mit unendlich langen Ketten chloridverbrckter quadratisch-planar koordinierter Palladiumatome. Die entstehenden Bnder aus kantenverknpften PdCl4-Quadraten verlaufen parallel zu [001] durch die oberen und unteren Zellkanten und die Zellmitte und sind symmetrisch gegen die bAchse verkippt (22.78, + 22.78). Die anisotropen Auslenkungsparameter entsprechen einer Aufenthaltswahrscheinlichkeit von 50 %.

Tabelle 2: Abstnde [] und Winkel [8] von a-PdCl2 bei vier verschiedenen Temperaturen.[9] T 100 200 2.3081(7) 2.3081(7) 3.174(1) 3.351(1) 3.351(1) 93.10(4) 86.90(4) 3.611(2) 3.783(2) 3.783(2) 3.867(2) 3.863(2) 300 2.3023(9) 2.3023(9) 3.167(1) 3.343(1) 3.343(1) 93.10(5) 86.90(5) 3.635(2) 3.812(2) 3.812(2) 3.886(2) 3.886(2) 400 2.3022(9) 2.3022(9) 3.171(1) 3.339(1) 3.339(1) 92.96(4) 87.04(4) 3.670(2) 3.849(2) 3.849(2) 3.931(2) 3.925(2)

gleicher Strang Pd-Cl 4 2.3016(7) Cl-Pd 2 2.3016(7) Cl-Cl 1 3.161(1) Cl-Cl 2 3.346(1) Pd-Pd 2 3.346(1) Cl-Pd-Cl 93.26(4) Cl-Pd-Cl 86.74(4) Nachbarstrang Cl-Cl 4 3.580(2) Cl-Cl 2 3.757(2) Pd-Pd 2 3.757(2) Cl-Cl 1 3.828(2) Pd-Cl 4 3.832(2)

(NTE)[1113] der c-Achse mit steigender Temperatur (Tabelle 1). Im Temperaturbereich von 100 bis 400 K ndern sich die Pd-Cl-Abstnde (Tabelle 2) nur gering. Oberhalb von 400 K wurden die Strukturuntersuchungen an mikrokristallinen Prparaten von PdCl2 in Guinier-Rntgentechnik durchgefhrt. Bei 500 8C liegt im Diffraktogramm neben a-PdCl2 die neue Phase d-PdCl2 im Verhltnis von etwa 1:1 vor, bei 520 8C wird d-PdCl2 dann phasenrein erhalten. Das Guinier-Diffraktogramm von d-PdCl2 zeigte keine Auslschungen, sodass die Raumgruppen P2, Pm oder P2/m in Frage kamen. Letztere fhrte zur Lsung der Struktur. Die Kristallstrukturen von a-PdCl2 und d-PdCl2 stehen in einer Gruppe-Untergruppe-Beziehung[15] zueinander. Die monokline Raumgruppe P 1 1 2/m (P2/m) (d-PdCl2) ist eine Untergruppe der Raumgruppe P 21/n 21/n 2m (Pnnm) (a-PdCl2). Das Schema in Abbildung 3 macht den gruppentheoretischen Zusammenhang deutlich. Es handelt sich um einen translationsgleichen bergang vom Index 2 (t2). Die Koordinaten der Palladiumatome

Phase. Der Vergleich mit den Daten von Wells[1] ergab fr aPdCl2 bei 300 K eine gute bereinstimmung mit nur geringen Positionsnderungen fr die Palladium- und die Chloratome (Pd: 0.037, Cl: 0.039 ). Abbildung 2 zeigt die Elementarzelle von a-PdCl2.[10] Mit steigender Temperatur nimmt der Verkippungswinkel der Bnder geringfgig verzerrter PdCl4-Quadrate gegen die bAchse stetig von 23.58 und + 23.58 bei 100 K bis auf 22.78 und + 22.78 bei 400 K ab. a-PdCl2 zeigt das ungewhnliche Verhalten einer negativen thermischen Expansion
Angew. Chem. 2010, 122, 5812 5817

Abbildung 3. Gruppentheoretischer Zusammenhang zwischen den Kristallstrukturen von a- und d-PdCl2. In einem t2-bergang wird die Symmetrie reduziert. Fr a-PdCl2 sind die Kristallachsen bei 500 8C und die Positionsparameter der Einkristallmessung bei 400 K eingesetzt,[9] fr d-PdCl2 die Daten bei 520 8C (Tabelle 3).

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5813

Zuschriften
(0,0,1/2) und (1/2,1/2,0) bleiben erhalten, die der Chloratome ndern sich geringfgig. Mit den Positionsparametern von aPdCl2 als Startwerten ergab sich schlielich bei Freigabe aller Parameter ein R-Wert von 0.0695. Die kristallographischen Daten der monoklinen Hochtemperaturphase d-PdCl2 sind in Tabelle 3 zusammengestellt. Abbildung 4 zeigt einen Blick entlang der c-Achse auf die monokline Elementarzelle von dPdCl2 bei 520 8C. Wie in a-PdCl2 liegen in d-PdCl2 Bnder geringfgig verzerrter PdCl4-Quadrate entlang der c-Achse vor. Die PdCl-Abstnde betragen bei 520 8C in den Quadraten 2.35(2) (4 ), die Cl-Pd-Cl-Winkel 89(1) und 91(1)8 (jeweils 2 ). In a-PdCl2 (Raumgruppe Pnnm) verlaufen die Bnder durch die Ecken und die Zellmitte und werden durch eine einzige kristallographische Lage erzeugt, wobei sie symmetrisch gegeneinander verkippt sind. Die Struktur von d-PdCl2 (Raumgruppe P2/m) ist von niedrigerer Symmetrie (Abbildung 3). Sie enthlt zwei unabhngige Bnder, die durch zwei kristallographische Lagen erzeugt werden (Tabelle 3, Abbildung 4). Diese Bnder sind unterschiedlich stark gegen die bAchse verkippt. Der Winkel zwischen den Bndern nimmt in a-PdCl2 mit steigender Temperatur stetig ab (100 K: 47.08 ; 400 K: 45.48) und betrgt in d-PdCl2 bei 793 K nur noch 308. d-PdCl2 hat eine lngere c-Achse und damit einhergehend ein greres Zellvolumen und eine grere thermische Ausdehnung des Volumens als a-PdCl2. Ungewhnlich ist jedoch, dass die Hochtemperaturphase d-PdCl2 eine niedrigere Symmetrie (P2/m) aufweist als die bei tieferer Temperatur stabile Phase a-PdCl2 (Pnnm). Auch in d-PdCl2 tritt der NTEEffekt auf. Die c-Achse kontrahiert von 3.296(3) bei 777 K (= 504 8C) auf 3.266(3) bei 950 K, der monokline Winkel sinkt dabei von 96.97(4) auf 95.55(3)8. An g-PdCl2 gelang die Strukturlsung mit hochaufgelsten Guinier-Rntgendiffraktogrammen mit CuKa1-Strahlung, die im Bereich zwischen 10 und 300 K aufgenommen wurden. g-PdCl2 kristallisiert in einem neuen Strukturtyp mit zwei Formeleinheiten pro Elementarzelle in der monoklinen Raumgruppe P21/c. Die kristallographischen Daten sind in Tabelle 3 zusammengestellt. Laut Patterson-Synthese[16, 17] und Rietveld-Verfeinerung[18] ist die Pd-Lage 2c (0,1/2,0) (Tabelle 3) zu 30 % um den Translationsvektor (0,1/2,0) fehlgeordnet. Die Cl-Lage weist dagegen keine solche Fehlordnung auf. Abbildung 5 zeigt drei Ansichten der Tieftemperaturphase g-PdCl2 : entlang der verkippten b-Achse und entlang der c-Achse mit eckenverknpften PdCl4-Quadraten (Abbildung 5 a). Auf diese Weise entstehen Schichten aus PdCl4Quadraten mit W-Wellung (Abbildung 5 b). Abbildung 5 c zeigt einen Blick entlang der b-Achse auf die Schichten von PdCl4-Quadraten. In g-PdCl2 liegt somit ein neuartiges Verknpfungsmuster der PdCl4-Quadrate vor. In a- und in dPdCl2 sind diese zu Bndern kanten-, in b-PdCl2 zu Clustern ecken- und in g-PdCl2 zu Schichten eckenverknpft. Dabei gibt es eine Anordnung der Cl-Quadrate, die mit Pd-Atomen auf (0,1/2,0) und (0,0,1/2) (Lage 2c) zentriert sind (70 %). Die gleiche Anordnung der Cl-Quadrate kann allerdings auch mit Pd-Atomen auf (0,0,0) und (0,1/2,1/2) (Lage 2a) zentriert sein (30 %). Daraus ergibt sich die Fehlordnung der Pd-Atome mit dem Vektor (0,1/2,0). Die Pd-Cl-Abstnde und Cl-Pd-Cl-Winkel innerhalb der PdCl4-Quadrate von g-PdCl2 betragen 2.30(1) und 2.32(1) (jeweils 2 ) bzw. 88.0(1) und 92.1(1)8 (jeweils 2 ). Die PdCl-Abstnde sind etwa so gro wie in a-PdCl2 (2.3016(7) 2.3081(7) bei 100400 K, Tabelle 2), aber krzer als in dPdCl2 (2.35(2) bei 520 8C). In b-PdCl2 liegen diese Abstnde zwischen 2.304(1) und 2.312(1) und die Winkel zwischen 89.18(3) und 90.26(9)8.[3] Fr die Umwandlung g !a mssen die Schichten eckenverknpfter PdCl4-Quadrate in Bnder kantenverknpfter PdCl4-Quadrate transformiert
Angew. Chem. 2010, 122, 5812 5817

Tabelle 3: Kristallographische Daten von d-PdCl2 bei 793 K und von gPdCl2 bei 300 K.[25] Phase T [K] Pearson-Symbol Kristallsystem Raumgruppe a [] b [] c [] a [8] b [8] g [8] V [3] Z 1exp. [g cm3] 1ber. [g cm3] Pd/Wyckoff Lage Cl/Wyckoff Lage d-PdCl2 793(10) mP6 monoklin P 1 1 2/m 4.012(1) 11.782(7) 3.288(1) 90 90 97.03(3) 154.3(1) 2 3.818(2) 1 Pd(1)/1b (0,0,1/2) 1 Pd(2)/1g (1/2,1/2,0) 2 Cl(1)/2m (x,y,0) (0.157(8),0.126(1),0) 2 Cl(2)/2n (x,y,1/2) (0.558(6),0.644(1),1/2) 0.097(3) 0.120(9) g-PdCl2 300(2) mP6 monoklin P 1 21/c 1 5.5496(3) 3.8608(2) 6.4105(3) 90 107.151(2) 90 131.24(2) 2 4.44(5) 4.487(1) 2 Pd/2c[a] (0,1/2,0) 4 Cl/4e (x,y,z) (0.2550(4),0.2573(7), 0.8141(7))

Cl/Wyckoff Lage UPd [2] UCl [2]

0.0083(4) 0.0170(6)

[a] Die Pd-Lage ist zu 30 % um (0,1/2,0) translatorisch fehlgeordnet.

Abbildung 4. Diamond-Abbildungen[10] von d-PdCl2 bei 520 8C. Ebene Bnder aus kantenverknpften PdCl4-Quadraten verlaufen parallel zu [001] durch die oberen und unteren Kanten und die Zellmitte. Die Bnder sind unsymmetrisch gegen die b-Achse verkippt (228, + 88). Die hohen isotropen Auslenkungsparameter (UPd = 0.097(3), UCl = 0.120(9) 2) sind der Guinier-Messung bei 520 8C (Tabelle 3) entnommen und entsprechen einer Aufenthaltswahrscheinlichkeit von 50 %.

5814

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
g-PdCl2 die PdCl4-Quadrate in Schichtrichtung angeordnet sind (Abbildung 5 a und c). Bei der Kantenverknpfung in aPdCl2 und in d-PdCl2 ist der NTE-Effekt allerdings erheblich strker ausgeprgt als bei der Eckenverknpfung in g-PdCl2, wie Abbildung 6 zu entnehmen ist, in der die prozentuale

Chemie

Abbildung 5. Diamond-Abbildungen[10] von g-PdCl2. a) Perspektivischer Blick entlang der a-Achse auf die monokline Elementarzelle. Es ergeben sich eckenverknpfte PdCl4-Quadrate, die um 698 gegeneinander verdreht sind. b) Blick entlang der c-Achse auf die monokline Elementarzelle. Es ergibt sich eine Anordnung aus Schichten mit W-Wellung, die auf Lcke gestapelt sind. c) Perspektivischer Blick entlang der bAchse auf diese PdCl4-Schichten.

Abbildung 6. Prozentuale nderung Drel des Volumens V und der Kristallachsen a, b und c als Funktion der Temperatur fr a) a- und d-PdCl2 und b) g-PdCl2. Bei a- und d-PdCl2 steigen V, a und b mit der Temperatur, und zwar um 17.0, 9.1 bzw. 10.3 % im Temperaturbereich 100 bis 959 K, whrend c den NTE-Effekt zeigt und kontrahiert (2.7 %); bei gPdCl2 sind die entsprechenden Werte + 4.1, + 1.3, + 2.8 und 0.3 % im Temperaturbereich 10 bis 674 K.

werden. Fr eine solche rekonstruktive Umwandlung gibt es daher keine Gruppe-Untergruppe-Beziehung wie bei der Umwandlung a !d. Tabelle 4 enthlt fr g-PdCl2 im Temperaturbereich 10 300 K die Gitterkonstanten a, b, c, b und das Zellvolumen V. Es zeigt sich, dass in g-PdCl2 wie in a-PdCl2 (Tabelle 1) und dPdCl2 (siehe Abbildung 6 b) eine negative thermische Ausdehnung der c-Achse vorliegt. Das ist die Richtung, in der in

Tabelle 4: Gitterkonstanten [], monokliner Winkel [8] und Zellvolumen [3] fr g-PdCl2 im Temperaturbereich 10-300 K, die aus Guinier-Diffraktogrammen mit CuKa1-Strahlung bei Rietveld-Auswertung[18] erhalten wurden. T [K] 10 50 100 150 200 250 300 a 5.5223(4) 5.5252(4) 5.5295(4) 5.5342(3) 5.5387(3) 5.5437(3) 5.5496(3) b 3.8224(2) 3.8259(2) 3.8321(2) 3.8394(2) 3.8465(2) 3.8534(2) 3.8608(2) c 6.4194(4) 6.4192(4) 6.4177(3) 6.4151(3) 6.4131(3) 6.4119(3) 6.4107(3) b 107.296(3) 107.282(3) 107.254(3) 107.224(3) 107.197(3) 107.169(3) 107.151(3) V 129.38(2) 129.57(2) 129.87(2) 130.20(2) 130.52(2) 130.87(2) 131.25(2)

nderung des Volumens V und der Achsen a, b, c als Funktion der Temperatur aufgetragen ist. Dabei wurde fr a-PdCl2 und fr d-PdCl2 (Abbildung 6 a) auf die Werte bei 100 K und fr g-PdCl2 (Abbildung 6 b) auf die bei 10 K normiert. Es ist deutlich zu erkennen, dass sowohl in a-PdCl2 als auch in dPdCl2 das Volumen und die Kristallachsen a und b mit steigender Temperatur grere Werte annehmen, whrend die cAchse wegen des NTE-Effekts kontrahiert (Abbildung 6 a). Um die Stabilittsbeziehungen zwischen a-, b-, g- und dPdCl2 zu klren, wurde fr eine Formeleinheit PdCl2 die Gesamtenergie dieser Phasen in Abhngigkeit vom Volumen mit dem Dichtefunktionalprogramm WIEN2k[19] berechnet. Die Ergebnisse sind in Abbildung 7[20] zusammengefasst. Am Schnittpunkt der Graphen sind fr die beiden Hochtemperaturphasen a und d (Sa-d, Abbildung 7) Volumen und Energie gleich. Bei kleinerem Volumen ist die a-Phase stabil, bei grerem die d-Phase. Deutlich niedrigere Energien als a und d haben die Phasen g und b, wobei letztere die niedrigste Energie aufweist. Entsprechend lassen sich Einkristalle von b-PdCl2 beispielsweise aus [Pd3(CH3COO)6] in aromatischen Lsungsmitteln durch Zusatz von Eisessig und Perchlorsure sowie Einleiten von CO erhalten[21] oder alternativ durch Zersetzen des Komplexes [Pd2Cl4(CO)2] in SOCl2.[3] Durch Eindampfen einer stark sauren Lsung nach Auflsen von Pd-Metall in Knigswasser und anschlieendes Trocknen bei 150 8C wird dagegen nur mikrokristallines g-PdCl2 erhalten.[7, 8] www.angewandte.de

Angew. Chem. 2010, 122, 5812 5817

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5815

Zuschriften
dem Ursprungsvektor sieben weitere interatomare Vektoren, die sich alle mit der Struktur von g-PdCl2 (Tabelle 3) deuten lieen. Deutungsprobleme bereitete zunchst der drittstrkste Vektor (0,1/2,0) mit 1.93 , da in g-PdCl2 Pd-Cl-Abstnde wenigstens 2.30 gro sein sollten. Schwchere Reflexe, die eine andere Indizierung erlaubt htten, wurden auch in den hochaufgelsten Guinier-Diffraktogrammen nicht gefunden. Der Vektor (0,1/2,0) wurde daher einer translatorischen Fehlordnung der Pd-Atome mit 30 % zugeordnet. Mit den Fhkl,beob.-Werten nach der Rietveld-Verfeinerung (R = 0.0584 und Rp = 0.0818) lie sich mit dem Programm SHELXL-97[22] fr gPdCl2 bei Besetzung mit den Pd-Lagen sowie der Cl-Lage aus Tabelle 3 ein R-Wert von 0.1142 fr 130 Fbeob. > 4s erzielen. Die nachfolgende Differenz-Fourier-Synthese zeigte schwchere Fehlordnungssignale an, die aber keine strukturchemisch plausible Interpretation ermglichten. Indiz fr eine Fehlordnung bei g-PdCl2 ist auch der hohe Untergrund fr die Reflexgruppe bei 27 bis 298 (2q) im Guinier-Diffraktogramm. Die Einkristalldaten von a-PdCl2 sind beim Fachinformationszentrum (FIZ) Karlsruhe hinterlegt und knnen von dort kostenlos erhalten werden.[9] Die Daten der Pulvermessungen an a-PdCl2 bei 480 8C, an d-PdCl2 bei 520 8C und an g-PdCl2 bei 300 K sind ebenfalls beim FIZ Karlsruhe hinterlegt.[25] Die thermoanalytischen Untersuchungen wurden in einer LINSEIS-Differentialthermoanalysen-Apparatur unter Argon mit PtRh-Thermofhlern durchgefhrt (140 mg kufliches g-PdCl2, abgeschmolzen in drei kurzen Quarzglasrhrchen mit 2.0 mm Durchmesser, Heizgeschwindigkeit 208C min1). Eingegangen am 4. Februar 2010, vernderte Fassung am 20. April 2010 Online verffentlicht am 2. Juli 2010

Abbildung 7. Energie fr eine Formeleinheit PdCl2 berechnet mit dem Programm WIEN2k[19, 20] als Funktion des Zellvolumens fr die vier polymorphen Phasen.

Experimentelles
Einkristalle von a-PdCl2 wurden durch Sublimation von ca. 500 mg kuflichem PdCl2 (STREM Chemicals, Nr. 461850) bei 670 8C in einer unter Vakuum abgeschmolzenen und zuvor ausgeheizten Quarzglasampulle (Lnge 10 cm, Durchmesser 1 cm) erhalten. Im Temperaturbereich von 500510 8C (Phasenumwandlung d !a bei 504 8C) wurde mit 28C h1 sehr langsam abgekhlt, von 470 8C auf Raumtemperatur dann innerhalb eines Tages. Fr die Einkristalluntersuchungen an a-PdCl2 bei 100, 200, 300 und 400 K wurde ein Oxford-XCalibur3-Diffraktometer mit Enhance-MoKa-Strahlenquelle genutzt. Die Absorptionskorrektur wurde mit dem Programm Scale3 Abspack (Spherical Harmonics) durchgefhrt, das in der Software des Oxford-Diffraktometers implementiert ist. Die Strukturen wurden mit SHELXL-97[22] nach der Methode der kleinsten Fehlerquadrate im Vollmatrixverfahren auf F2-Werten verfeinert.[9] Die Strukturuntersuchungen an PdCl2-Pulvern wurden an zwei verschiedenen Guinier-Diffraktometern (HUBER Diffraktionstechnik) durchgefhrt. Fr die Hochtemperaturmessungen (300960 K) wurde ein HUBER-G644-Diffraktometer mit Heizvorrichtung verwendet (monochromatische MoKa1-Strahlung, l = 0.7093 , 750 Messpunkte zwischen 6.00 und 36.008, 2q, abgeschmolzene Quarzglaskapillaren, 0.5 mm Durchmesser, mit Pd-Pulver als internem Standard[23]), fr die Tieftemperaturmessungen (10300 K) ein Guinier-Diffraktometer HUBER G670 mit der Tieftemperatureinrichtung G670.4 (monochromatische CuKa1-Strahlung, l = 1.54056 , 17200 Messpunkte zwischen 14.000 und 100.0008, 2q, Prparat aufgestreut zwischen zwei 6 mm dicken Polyacetatfolien[24]). Die Indizierung von 20 Reflexen der neuen Hochtemperaturphase d-PdCl2 mit dem Programm DICVOL[14] ergab eine monokline Elementarzelle mit a = 4.0514, b = 3.2849, c = 11.864 und b = 96.568 (Richtigkeitsquotient F20 = 25). Um den Vergleich mit a-PdCl2 zu erleichtern, wurde diese monokline Zelle in die Aufstellung mit c als monokliner Achse transformiert. Die Diffraktogramme der Tieftemperaturmessungen lassen sich mit dem Programm DICVOL mit hohen Richtigkeitsquotienten (M20 = 22) indizieren. Mit diesen Gitterparametern als Startwerten lieen sich die Rntgenpulverdaten von Soulen und Chapell[6] und von Thiele[7] phasenrein deuten. Eine automatische Indizierung der Daten des Guinier-Films von Klein[8] gelang nicht auf Anhieb, weil diese Messwerte auch Daten von vier Fremdreflexen enthalten. Die Auslschungen h0l fr l 6 2n und 0k0 fr k 6 2n legen fr g-PdCl2 die Raumgruppe P21/c fest. Die Strukturlsung wurde mit dem Programm FullProf[18] in Rietveld-Technik durchgefhrt. Die Pattern-Matching-Analyse des Guinier-Diffraktogramms mit CuKa1-Strahlung bei 300 K ergab mit der Metrik der DICVOL-Indizierung niedrige Richtigkeitsquotienten (R = 0.0434, Bragg-R = 0.0077) und fhrte zu den Strukturfaktoren Fhkl. Die Patterson-Synthese dieser Daten mit dem Programm SHELXS-97[16] ergab die interatomaren Vektoren[17] Pd-Pd, Pd-Cl und Cl-Cl. Bis zur Hhe von zwei Cl-Cl-Vektoren enthlt die Patterson-Synthese neben

Stichwrter: Dichtefunktionalrechnungen Palladium Phasenumwandlungen Rntgenbeugung Strukturaufklrung

[1] A. F. Wells, Z. Kristallogr. A 1938, 100, 189. [2] H. Schfer, U. Wiese, K. Rinke, K. Brendel, Angew. Chem. 1967, 79, 244; Angew. Chem. Int. Ed. Engl. 1967, 6, 253. [3] D. Belli DellAmico, F. Calderazzo, F. Machetti, S. Ramello, Angew. Chem. 1996, 108, 1430; Angew. Chem. Int. Ed. Engl. 1996, 35, 1331. [4] B. Krebs, C. Brendel, H. Schfer, Z. Anorg. Allg. Chem. 1988, 561, 119. [5] a) K. Brodersen, G. Thiele, H. G. von Schnering, Z. Anorg. Allg. Chem. 1965, 337, 120; b) G. Thiele, K. Brodersen, Fortschr. Chem. Forsch. 1968, 10, 631. [6] J. R. Soulen, W. H. Chapell, J. Phys. Chem. 1965, 69, 3669. [7] G. Thiele, Dissertation, Rheinisch-Westflische Technische Hochschule Aachen, 1964. [8] M. Klein, Dissertation, Universitt Mnster, 1969. [9] Weitere Einzelheiten zu den Kristallstrukturuntersuchungen knnen beim Fachinformationszentrum Karlsruhe, 76344 Eggenstein-Leopoldshafen (Fax: (+ 49) 7247-808-666; E-Mail: crysdata@fiz-karlsruhe.de), unter den Hinterlegungsnummern CSD-421213, -421214, -421215 und -421216 angefordert werden. [10] K. Brandenburg, Visual Crystal Structure Information System, Diamond2, Crystal Impact GbR, Bonn, 1999. [11] K. W. Chapman, P. J. Chupas, C. J. Kepert, J. Am. Chem. Soc. 2005, 127, 15630. [12] A. L. Goodwin, C. J. Kepert, Phys. Rev. B 2005, 71, 140301. [13] S. J. Hibble, A. C. Hannon, S. M. Cheyne, Inorg. Chem. 2003, 42, 4724. [14] A. Boultif, D. Louer, J. Appl. Crystallogr. 2004, 37, 724. [15] U. Mller, Z. Anorg. Allg. Chem. 2004, 630, 1519. [16] G. M. Sheldrick, SHELXS-97, Program for Crystal Structure Solution, Universitt Gttingen, 1997.
Angew. Chem. 2010, 122, 5812 5817

5816

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[17] Patterson-Synthese (berechnete Peak-Hhe Pd-Pd 392, Pd-Cl 145, Cl-Cl 56, bis 2 Cl-Cl): Nr. : Koordinaten X, Y, Z/Peak/ Vektor/Interpretation: Nr.1: 0.0000, 0.0000, 0.0000/999/0.00/Ursprung; Nr. 2 : 0.0000, 0.0000, 0.5000/670/3.20/Pd11-Pd22, Pd21Pd12,Cl11-Cl14, Cl12-Cl13 ; Nr.3 : 0.0000, 0.5000, 0.5000/601/3.74/ Pd11-Pd12, Pd21-Pd22 ; Nr.4 : 0.0000, 0.5000, 0.0000/395/1.93/Pd11Pd21, Pd12-Pd22 ; Nr.5 : 0.2725, 0.2524, 0.3181/350/2.35/Cl11-Pd12, Cl12-Pd21; Nr.6 : 0.2707, 0.2485, 0.8188/349/2.34/Cl12-Pd12, Cl13Pd21; Nr.7: 0.4756, 0.5000, 0.3717/140/3.54/Cl12-Cl14, Cl11-Cl13 ; Nr.8 : 0.4587, 0.5000, 0.8737/108/3.45/Cl11-Cl12, Cl13-Cl14 ; Koordinaten: Pd11: (0,1/2,0); Pd12 : (0,0,1/2); Pd21: (0,0,0); Pd22 : (0,1/2,1/ 2); Cl11: (0.255,0.257,0.814); Cl12 : (0.745,0.757,0.686); Cl13 : (0.745,0.743,0.186); Cl14 : (0.255,0.253,0.314). [18] J. R. Rodriguez-Carvajal, FullProf, A Program for Rietveld Refinement and Pattern Matching Analysis, Abstracts of the Satellite Meeting on Powder Diffraction of XV Congress of the IUCr, Toulouse, Frankreich, 1990 ; International Union of Crystallography, Chester, GB, 1990, S. 127. [19] P. Blaha, K. Schwarz, G. Madsen, D. Kvasnicka, J. Luitz, WIEN2k, An Augmented Plane Wave Plus Local Orbitals Program for Calculating Crystal Properties, Technische Universitt Wien, Institut fr Materialchemie, Austria, 2001. Auf die Ordinatenwerte in Abbildung 7 muss 23 875 Ryd aufaddiert werden. Mageblich fr die Stabilitt ist die Differenz der Gesamtenergien, wodurch sich dieser Summand herauskrzt. A. Yatsimirski, R. Ugo, Inorg. Chem. 1983, 22, 1395. G. M. Sheldrick, SHELXL-97, Program for Crystal Structure Refinement, Universitt, Gttingen, 1997. R. H. Schrder, N. Schmitz-Pranghe, R. Kohlhaas, Z. Metallk. 1972, 63, 12. S. Jakob, Dissertation, Ludwig-Maximilians-Universitt Mnchen, 2007. Weitere Einzelheiten zu den Kristallstrukturuntersuchungen knnen beim Fachinformationszentrum Karlsruhe, 76344 Eggenstein-Leopoldshafen (Fax: (+ 49) 7247-808-666; E-Mail: crysdata@fiz-karlsruhe.de), unter den Hinterlegungsnummern CSD-421219, -421220 und -421221) angefordert werden.

Chemie

[20]

[21] [22] [23] [24] [25]

Angew. Chem. 2010, 122, 5812 5817

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5817

Zuschriften
Heterogener Kollaps
DOI: 10.1002/ange.201001469

EPR-Spektroskopische Charakterisierung lokaler nanoskopischer Heterogenitten beim thermischen Kollaps thermoresponsiver dendronisierter Polymere**
Matthias J. N. Junk, Wen Li, A. Dieter Schlter, Gerhard Wegner, Hans W. Spiess, Afang Zhang* und Dariush Hinderberger*
Thermoresponsive Polymere sind von groem Interesse fr mgliche Anwendungen in der Aktorik, im Wirkstofftransport und fr Oberflchenmodifizierungen.[1] Seit der Entdeckung durch Wu und Mitarbeiter,[2] dass einzelne PNiPAAmKetten (Poly(N-Isopropylacrylamid)) nahe der unteren kritischen Lsungstemperatur (LCST) einen Knuel-Globulusbergang eingehen knnen, befassten sich viele Arbeiten mit der Aufklrung des Kollapsmechanismus, der zur Bildung der stabilen Mesoglobuli fhrt.[1, 3] Trotz aller Bemhungen konnten die Prozesse, die auf molekularer Ebene dazu fhren, dass thermoresponsive Polymere bei einer bestimmten Temperatur zu dehydratisieren beginnen, dann kollabieren und sich zu Mesokugeln anordnen, bisher nicht aufgeklrt werden. Zur gezielten Entwicklung neuer Materialien ist aber das molekulare Verstndnis dieser Prozesse von grundlegender Bedeutung. In Studien an dendronisierten Polymeren[4] konnten wir krzlich zeigen, dass Oligoethylenglycol(OEG)-Systeme einen schnellen, scharfen und vollstndig reversiblen Phasenbergang eingehen.[5] Die OEG-Polymere tragen terminale Ethoxygruppen und sind wasserlslich, und ihre LCST liegt im physiologisch interessanten Bereich zwischen 30 und 36 8C. Sie befinden sich damit im LCST-Bereich von Poly(ethylenoxid)- und langkettigen Ethylenoxid-Oligomeren, fr die der Einfluss hydrophober Endgruppen auf die LCST sowohl experimentell als auch theoretisch ausfhrlich untersucht wurde.[6] In Anbetracht ihres auergewhnlichen Ver[*] M. J. N. Junk,[+] Prof. Dr. G. Wegner, Prof. Dr. H. W. Spiess, Dr. D. Hinderberger Max-Planck-Institut fr Polymerforschung Ackermannweg 10, 55128 Mainz (Deutschland) Fax: (+ 49) 6131-379-100 E-Mail: dariush.hinderberger@mpip-mainz.mpg.de Dr. W. Li,[+] Prof. Dr. A. D. Schlter, Prof. Dr. A. Zhang[#] Institut fr Polymere, Department of Materials, ETH Zrich Wolfgang-Pauli-Strae 10, HCI G525, 8093 Zrich (Schweiz) Fax: (+ 41) 44-6331390 E-Mail: azhang@shu.edu.cn [#] Department of Polymer Materials, Shanghai University Chengzhong Street 20, Shanghai 201800 (China) [+] Diese Autoren haben gleichermaen zu dieser Arbeit beigetragen. [**] Wir danken Christian Bauer und Susan Pinnells fr technische Untersttzung. M.J.N.J. dankt dem Fonds der chemischen Industrie (FCI) und der Graduate School of Excellence Materials Science in Mainz (MAINZ) fr finanzielle Frderung. Hintergrundinformationen zu diesem Beitrag sind im WWW unter http://dx.doi.org/10.1002/ange.201001469 zu finden.

haltens erschienen uns diese Polymere als ideal geeignet, um ein tieferes Verstndnis der molekularen Prozesse beim bergang zu Globuli zu erlagen. Es sind zudem vielversprechende Trgermaterialien fr eine gezielte Wirkstoffabgabe, da ihre Fhigkeit zur Einlagerung von Gastmoleklen ber die Thermoresponsivitt gesteuert werden kann.[7] Es gibt Hinweise, dass solche thermischen bergnge ber die Bildung von Strukturinhomogenitten im Nanometerbereich ablaufen, allerdings sind diese Phnomene wenig verstanden. Tatschlich hat man diese Frage als eine der wichtigsten Herausforderungen im Bereich der makromolekularen Chemie der kommenden Jahre identifiziert.[8] Das Hauptziel unserer Arbeit ist es, ein besseres Verstndnis der Bildung, Struktur und Lebensdauer dieser lokalen Inhomogenitten zu erhalten. Darber hinaus untersuchen wir den Effekt der chemischen Struktur auf die physikalischen Vorgnge und den Einfluss der lokalen Heterogenitten auf die angestrebte Funktion (z. B. Wirkstofftransport). Das auergewhnliche Verhalten dieser Polymere resultiert daraus, dass sich die Systeme in einem Zustand fernab vom makroskopischen Gleichgewicht befinden. Diese Situation kann als ein Beispiel eines molekular kontrollierten Nichtgleichgewichts betrachtet werden. Die Natur nutzt viele solcher makromolekularen Prozesse fernab vom Gleichgewicht, z. B. in der DNA-Replikation, um hohe Spezifizitten in der verrauschten Umgebung einer Zelle zu erreichen. Studien hnlicher Konzepte in synthetischen Polymeren sind jedoch noch immer selten.[9, 10] Magnetresonanztechniken als intrinsisch lokale Methoden sind bestens dazu geeignet, strukturelle Inhomogenitten in funktionellen Makromoleklen[11] und dynamische Heterogenitten in Polymerschmelzen in der Umgebung des Glasbergangs zu untersuchen.[12] Fr die Erforschung biologischer und synthetischer Makromolekle haben sich hierbei vorwiegend NMR- und Puls-EPR-Methoden etabliert.[1015] Eine besonders einfache Technik, um die molekulare Umgebung von Systemen beim thermischen bergang zu untersuchen, ist die Continuous-Wave(CW)-EPR-Spektroskopie mit Nitroxidradikalen als paramagnetischen Tracermoleklen (Spinsonden). Spinsonden sprechen auf die lokale Viskositt an, die zu nderungen in der Rotationskorrelationszeit fhrt, sowie auf Effekte durch die lokale Polaritt/Hydrophilie.[11c, 14, 15] Die Polaritt beeinflusst die elektronische Struktur des Radikals und verndert damit spektrale Parameter, speziell den g-Faktor und die 14N-Hyperfeinkopplungskonstante. Das amphiphile Radikal 2,2,6,6Tetramethylpiperidin-1-oxyl (TEMPO) ist besonders dazu
Angew. Chem. 2010, 122, 5818 5823

5818

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
geeignet, um Informationen aus sowohl hydrophoben als auch hydrophilen Regionen zu erhalten. In jngster Zeit wurde TEMPO genutzt, um in thermoresponsiven PNiPAAm-Hydrogelen strukturelle Nanoinhomogenitten aufzudecken, die sich beim thermisch induzierten makroskopischen Kollaps bildeten und ber einen Zeitraum von mindestens zwei Stunden statisch waren.[15] Basierend auf diesen Ergebnissen sowie auf Vorabuntersuchungen mit TEMPO und dem hydrophileren Radikal TEMPOL (siehe Hintergrundinformationen) wurde TEMPO als Spinsonde der Wahl identifiziert. Wssrige Lsungen von TEMPO in dendronisierten Polymeren wurden durch CW-EPR-Spektroskopie vermessen. Auf diese Weise konnten Erkenntnisse ber die mit dem thermischen bergang assoziierten molekularen Prozesse gewonnen werden. In Abbildung 1 a sind reprsentative CW-EPR-Spektren von TEMPO in einer wssrigen Lsung von 10 Gew.-% PG1(ET) (Schema 1) ober- und unterhalb der kritischen Temperatur (TC) von 33 8C dargestellt. Whrend der Tieffeldund der mittlere Peak nahezu unbeeinflusst bleiben, ndert sich die Hochfeldlinie, die am empfindlichsten auf strukturelle und dynamische Effekte anspricht, betrchtlich. In Abbildung 1 b ist die Hochfeldlinie im Detail fr unterschiedliche Temperaturen dargestellt. Die klar zu erkennende Aufspaltung der Linie bei hheren Temperaturen ist auf das Vorhandensein von zwei Nitroxid-Spezies D1 und D2 zurckzufhren, die sich in lokalen Umgebungen unterschiedlicher Polaritt befinden und signifikant verschiedene isotrope Hyperfeinkopplungskonstanten aiso (sowie g-Werte giso) aufweisen. Zunchst wurde berprft, ob die kritischen Temperaturen Tc der Trbungsmessungen und der EPR-Spektroskopie bereinstimmten. Bei den hier betrachteten Polymeren handelt es sich um Polymethacrylate mit Seitenketten aus Triethylenoxid-Dendronen erster (PG1(ET); A), zweiter (PG2(ET); B) und dritter Generation (PG3(ET); B). Auerdem wurde ein dendronisiertes Polymethacrylat zweiter Generation untersucht, bei dem der Triethylenoxidkern durch eine hydrophobe Octaneinheit ersetzt war (PG2(ETalkyl); C, Schema 1). Die Trbungsmessungen spiegeln einen Phasentrennungsprozess scheinbar klassischer Natur wider, in dem sich Trpfchen einer konzentrierten Polymerlsung von der verdnnten Polymerlsung trennen (binodale Entmischung). Die Trpfchen der konzentrierten Phase konnten ebenfalls mittels Lichtmikroskopie abgebildet werden.[5a] Die Tc-Werte der EPR-Messung wurden durch Auftragung des spektralen Anteils von Nitroxid-Spezies D1 als Funktion der Temperatur bestimmt. Tc ist definiert als diejenige Temperatur, bei der der zuvor nahezu konstante spektrale Anteil der Nitroxid-Spezies D1 stark abfllt (Abbildung S3 in den Hintergrundinformationen). In der Tat wurden fr PG1(ET) (TC = 32 8C; Turbiditt: 33 8C), PG2(ET) (TC = 34 8C; 36 8C), PG3(ET) (TC = 34 8C; 34 8C) und PG2(ETalkyl) (TC = 30 8C; 31 8C) fast identische kritische Temperaturen ermittelt, unabhngig davon, ob sie durch Trbungsmessungen oder EPRMessungen bestimmt wurden. Die leicht niedrigeren EPRWerte sind durch die hheren Konzentrationen der Polymerlsungen zu erklren. Die mittels Trbungsmessungen bestimmte makroskopische Phasentrennung entsteht dadurch, dass Wasser mit steigender Temperatur ein zunehmend schlechteres Lsungsmittel fr Oxyethylensegmente wird. Dennoch ist die Gelphase, die sich im Gleichgewicht mit der verdnnten Phase befindet, zunchst noch immer hochgradig hydratisiert. Das Ziel unserer im Folgenden vorgestellten Studie war es, die Eigenschaften der Gelphase aus dem Blickwinkel der Gastmolekle, also der Spinsonden, zu analysieren. Die spektralen Parameter fr Komponente D1 stimmen mit denen von TEMPO in reinem Wasser (aD1 = 48.3 MHz) berein, d. h., diese Spinsonde befindet sich in einer stark hydratisierten, hydrophilen Umgebung. Die beobachtete Abnahme von aiso um 3.7 MHz fr Spezies D2 (bei 65 8C) (Abbildung 1 b) weist auf eine sehr viel hydrophobere und weniger hydratisierte Umgebung fr diese zweite Spinsondenart hin (diese lokalen Bedingungen sind vergleichbar mit denen von Chloroform oder tert-Butanol).[16] Bei Temperaturen unterhalb Tc wird nur die spektrale Komponente D1 in hydrophiler Umgebung beobachtet, da alle dendritischen Einheiten mit Wasser gequollen sind. Oberhalb der kritischen Temperatur von 33 8C nimmt der Anteil der spektralen Komponente D2 in hydrophober Umgebung mit steigender Temperatur zu. Die Dehydratisierung der dendritischen

Chemie

Abbildung 1. a) CW-EPR-Spektren (X-Band, Mikrowellenfrequenz 9.3 GHz) von 0.2 mm TEMPO in einer wssrigen Lsung von 10 Gew.% PG1(ET) bei 15 8C und 65 8C. b) Ausschnitt der Hochfeldlinie (mI = 1; in (a) durch das Rechteck markiert) bei unterschiedlichen Temperaturen. Der mit D2 bezeichnete Anteil am Hochfeldpeak bei 335.4 mT stammt von TEMPO-Moleklen in einer hydrophoben Umgebung, der mit D1 bezeichnete Anteil bei 335.65 mT stammt von TEMPO-Molekle in einer hydrophilen Umgebung. Die gestrichelten Linien an den ueren Extrema des Peaks dienen zur Orientierung.
Angew. Chem. 2010, 122, 5818 5823

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5819

Zuschriften

Schema 1. a) Thermoresponsive dendronisierte Polymere PG1(ET) (A), PG2(ET) (B, R = Et), PG3(ET) (B, R = {H(CH2CH2O)4}3Ph) und PG2(ETalkyl) (C) und die Spinsonde TEMPO (D). b) Synthese des PG2(ETalkyl)-Monomers: a) NaOH, TsCl, THF, H2O, 025 8C, 3 h (56 %); b) DHP, PPTS, 525 8C, 4.5 h (86 %); c) KI, [15]Krone-5, NaH, THF, RT, 12 h (96 %); d) PTSA, MeOH, RT, 2 h (90 %); e) TsCl, TEA, DMAP, DCM, 525 8C, 3 h (89 %); f) Methylgallat, K2CO3, KI, DMF, 80 8C, 24 h (83 %); g) LAH, THF, 525 8C, 2.5 h (95 %); h) MAC, DMAP, TEA, DCM, 525 8C, 3 h (84 %). DHP = 3,4-Dihydro-2H-pyran; PPTS = Pyridiniumtoluolsulfonat; PTSA = p-Toluolsulfonsure; LAH = Lithiumaluminiumhydrid; MAC = Methacrylsurechlorid; DMAP = N,N-Dimethylaminopyridin; TEA = Triethylamin.

Einheiten fhrt daher zu einer lokalen Phasentrennung, bei der hydrophobe Kavitten gebildet werden. Aufflligerweise ndert sich die Peakposition der spektralen Komponente D2 mit der Temperatur und erreicht ihre endgltige Position erst bei Temperaturen deutlich oberhalb Tc. Dies weist auf einen dynamischen Austausch von Spinsonden zwischen hydrophilen und hydrophoben Bereichen hin. Dieser Austausch fhrt zu einer mittleren Hyperfeinkopplungskonstante, die ein effektives, gewichtetes Mittel zwischen den beiden Extrema der hydrophilen und der (statischen) hydrophoben Bereiche (bei 65 8C) darstellt. Daher sind die Inhomogenitten, die sich whrend der Phasentrennung bilden, nicht statisch, sondern dynamisch und wirken sich stark auf die Form der EPR-Spektren aus. Der dynamische Austausch der Spinsonden kann von zwei Effekten herrhren: Zum einen knnen sich die Spinsonden zwischen den kollabierten und hydratisierten Regionen innerhalb der Polymeraggregate bewegen, oder die Aggregate knnen selbst fluktuieren. Letzteres kann als ein schnelles ffnen und Schlieen von hydrophoben Kavitten oder als ein schnelles Quellen und Kollabieren von Regionen in der Umgebung der Spinsonde aufgefasst werden. Die Gre der Inhomogenitten kann durch die Translationsbewegung von TEMPO in der Polymermatrix abgeschtzt werden, die durch hx2i = 6 DT tT ermittelt werden kann. Bei 34 8C betrgt die maximale Diffusionstranslation der Spinsonden hx2i1/2

5.1 nm, wobei die Diffusion durch Polymerfluktuationen untersttzt wird (Einzelheiten in den Hintergrundinformationen).[17, 18] Daraus kann man schlieen, dass leicht oberhalb von Tc die wenigen bis dahin gebildeten hydrophoben Bereiche immer noch klein sind, d. h. in der Grenordnung einiger nm. Die Bewegung der Spinsonde und/oder lokale Fluktuationen des Polymers bewirken einen dynamischen Austausch der Sondenmolekle zwischen den hydrophoben und hydrophilen Regionen auf der EPR-Zeitskala. Hydrophile Regionen sind immer noch zahlreich vorhanden (der Anteil der Spezies D1 betrgt immer noch ber 60 %, siehe Abbildung 2 b). Somit liefern die Spinsonden berwiegend Informationen ber die Grenzflche zwischen diesen zwei fundamental unterschiedlichen Regionen. Man beachte, dass wenige lokale dynamische Heterogenitten ausreichen, um einen (in Trbungsmessungen) makroskopisch erkennbaren bergang der Probe zu bewirken. Bemerkenswerterweise ist die aus beiden Methoden abgeleitete Temperatur dieses bergangs gleich, obwohl sie um mehr als zwei Grenordnungen unterschiedliche Lngenskalen charakterisieren. Das weist darauf hin, dass die kleinen, EPR-spektroskopisch detektierten, hydrophoben Bereiche als Vernetzungsregionen gedeutet werden knnen, die die Anordnung der dendronisierten Makromolekle ber mehrere Grenordnungen beeinflussen. Der scharfe makroskopische bergang kann daher als Beginn eines komplexen Dehydratationsprozesses
Angew. Chem. 2010, 122, 5818 5823

5820

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
gedeutet werden, der auf der molekularen Ebene sehr breit und keineswegs scharf verluft. Wir weisen darauf hin, dass schon frher die Bildung von Oligoethylenoxid-Clustern in Abhngigkeit von der Temperatur und der Konzentration untersucht wurde. Die Ursache der Clusterbildung wurde der ansteigenden Hydrophobie der Oxyethylensegmente mit steigender Temperatur zugeschrieben.[19] Mit steigender Temperatur erhht sich nicht nur der Anteil der hydrophoben Bereiche, sondern auch ihre Gre, sodass ein Austausch zwischen hydrophilen und hydrophoben Regionen unwahrscheinlicher wird. Die Spinsonden liefern nun Informationen ber das Innere der hydrophoben (und der verbleibenden hydrophilen) Regionen und nur noch in untergeordnetem Mae ber ihre Grenzflche. Durch das grere Volumen der Heterogenitten nehmen auch die Polymerfluktuationen ab, da beide Effekte miteinander gekoppelt sind. Bei hohen Temperaturen wird daher ein Endzustand mit auf der EPR-Zeitskala statischen hydrophoben und hydrophilen Regionen erreicht. Um die mit dem thermisch induzierten bergang verbundene Aggregation und den Kollaps zu quantifizieren, wurden die effektive Hyperfeinkopplungskonstante von TEMPO in hydrophoben Regionen (aD2) und der Anteil von TEMPO in hydrophilen Bereichen (yD1) in Abhngigkeit von der Temperatur bestimmt. Die beiden Parameter wurden durch Anpassung spektraler Simulationen an die EPRSpektren ermittelt (siehe Experimentelles und die Hintergrundinformationen).[20] Durch Auftragung dieser Parameter gegen die reduzierte Temperatur (TTc)/Tc kann berprft werden, ob der Kollaps von einem wohldefinierten Phasenbergang herrhrt. Wie aus Abbildung 2 ersichtlich, folgen beide Parameter nicht einer Geraden, wie man es fr einen einfachen Phasenbergang erwarten wrde, sondern zeigen starke Abweichungen von einer Linearitt.[21] Abbildung 2 a verdeutlicht, dass statische, nicht vom Austausch betroffene Hyperfeinkopplungen aD2 erst ca. 30 8C oberhalb der kritischen Temperatur erreicht werden. In diesem weiten Temperaturbereich findet eine komplexe Dehydratisierung statt, die nicht als ein klassischer Phasenbergang beschrieben werden kann, der auf einem einzigen Kollapsprozess basiert. Wie durch die unterschiedlichen Geraden verdeutlicht, knnen allen Polymeren mindestens zwei Dehydratisierungsprozesse zugeordnet werden. Der erste Prozess findet bei Temperaturen nur leicht oberhalb der kritischen Temperatur statt ((TTc)/Tc < 0.02), der zweite Prozess in einem Temperaturbereich weit oberhalb Tc. Extrapolationen der beiden Geraden schneiden sich bei (TTc)/Tc = 0.02 (ca. 7 8C oberhalb Tc) fr alle Polymere. Dies weist darauf hin, dass die beteiligten Kollapsprozesse in allen Fllen quivalent sind. Weiterhin deuten diese Resultate darauf hin, dass in diesem schmalen Temperaturbereich ein Groteil der Dehydratisierung stattfindet, da aD2 in diesem Intervall schon auf Werte abfllt, die nahe am finalen statischen Wert liegen. Ein weiterer Anstieg der Temperatur fhrt nur noch zu kleineren nderungen von aD2 aufgrund der Verdrngung verbliebener kleiner Wassermengen aus den kollabierten Polymerbereichen. Die Messpunkte der Polymere mit keinem (PG1(ET)) oder einem hydrophoben Dendrimerkern (PG2(ETalkyl))
Angew. Chem. 2010, 122, 5818 5823

Chemie

Abbildung 2. a) Auftragung der Hyperfeinkopplungskonstante der hydrophoben spektralen Komponente aD2 gegen die reduzierte Temperatur Tr = (TTc)/Tc fr 0.2 mm TEMPO in einer 10 Gew.-% wssrigen Lsungen von vier dendronisierten Polymeren, die sich in der Dendronengeneration (PG1(ET), PG2(ET) und PG3(ET)) und in der Struktur des Dendrimerkerns (PG2(ETalkyl)) unterscheiden. b) Vernderung des Anteils von TEMPO in hydrophiler Umgebung (yD1) mit steigender Temperatur in den zuvor genannten Polymerlsungen. Die zwei linearen Angleiche der Datenpunkte nahe und fernab der kritischen Temperatur weisen auf mindestens zwei verschiedene Dehydratisierungsprozesse hin. Daher kann der temperaturinduzierte Kollaps der untersuchten Polymere nicht als thermodynamischer Phasenbergang beschrieben werden. Die fr alle Polymere einheitliche reduzierte Temperatur, bei der sich die zwei Geraden schneiden, ist durch eine gestrichelte Linie verdeutlicht.

lassen sich gut mit linearen Angleichen fr zwei Prozesse beschreiben. Polymere mit einem hydrophilen Dendrimerkern (PG2(ET) und PG3(ET)) zeigen hingegen signifikante Abweichungen von linearen Angleichen fr zwei Prozesse. In diesen Fllen kann der Kollaps nur nherungsweise bzw. unvollstndig mit zwei wohldefinierten Prozessen beschrieben werden. Weiterhin lsst sich schlieen, dass der erste Prozess dann besonders effektiv ist, wenn die Dehydratisierung durch einen hydrophoben Kern untersttzt wird, wie im Falle von PG2(ETalkyl). Die Effektivitt verschlechtert sich, wenn der Kern Oxyethylengruppen enthlt, die Wasser binden knnen. Der Anteil von TEMPO in hydrophilen Regionen (yD1) zeigt das qualitativ gleiche temperaturabhngige Verhalten (Abbildung 2 b). Der Schnittpunkt beider Geraden ist fr alle Polymere bei der gleichen Temperatur angesiedelt. Weiterhin lsst sich in Abbildung 2 b die gleiche Abhngigkeit der Dehydratisierung von der chemischen Struktur der dendritiwww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5821

Zuschriften
schen Seitenketten finden, wie wir sie fr Abbildung 2 a beschrieben haben. Dennoch weisen die Graphen einen groen Unterschied auf. Bei hohen Temperaturen ist yD1 nur abhngig vom Volumenanteil des kollabierten Polymers und nhert sich daher dem Wert 0.3 fr alle Polymerlsungen. Demgegenber unterscheiden sich die (statischen) isotropen Hyperfeinkopplungen von TEMPO in hydrophoben Bereichen aD2 in Abhngigkeit von der Struktur des dendronisierten Polymers. PG2(ETalkyl) mit einem hydrophoben Kern bietet die hydrophobste Umgebung, gefolgt von PG1(ET) ohne Kern und PG2(ET) mit einem hydrophilen Ethylenoxid-Kern. Die am wenigsten hydrophobe Umgebung wird bei PG3(ET) gefunden, das einen ausgedehnten hydrophilen Kern aufweist. Die Unterschiede knnen dadurch erklrt werden, dass die hydrophilen Kerne mehr Restwasser speichern knnen. Dies steigert die effektive Hydrophilie der Umgebung der eingeschlossenen Spinsonde. Die Daten in Abbildung 2 sttzen darber hinaus das Bild von wenigen hydrophoben Stellen, die einen makroskopisch observierbaren bergang zu einem Gel auslsen. Dieses Gel ist immer noch stark hydratisiert und auerdem stark heterogen bezglich der lokalen Wasserkonzentration in den unterschiedlichen Regionen. Der erste Kollapsprozess kann mit dem zahlenmigen Anwachsen von kleinen, unkorrelierten hydrophoben Regionen gedeutet werden. Dieser Prozess dominiert, bis die Zahl hydrophober Regionen eine Konzentration und/oder einen Volumenanteil erreicht, der etwa dem der verbleibenden hydrophilen Regionen entspricht (daher der Knick bei yD1 % 0.5). Hier erreicht der Zuwachs an hydrophoben Bereichen einen Grenzwert, der als Perkolationspunkt interpretiert werden kann. Wenn die Anteile von D1 und D2 gleich werden, steigt die Wahrscheinlichkeit, dass zwei hydrophobe Bereiche (die bis zu diesem Punkt grtenteils unkorreliert waren) direkte Nachbarn werden. Daher verliert die Rolle der Grenzflchen an diesem Punkt an Relevanz.[22] Zusammenfassend konnte der Kollapsbergang von thermoresponsiven dendronisierten Polymeren mit verschiedenen Dendrimerkernen auf molekularer Ebene durch CWEPR-Spektroskopie charakterisiert werden. Bei einem Anstieg der Temperatur ber Tc leiten dynamische strukturelle Inhomogenitten von wenigen Nanometern Gre die Aggregation der gesamten Polymerprobe ein. In diesem Temperaturbereich findet ein schneller Austausch der Spinsonden zwischen groen hydrophilen und kleinen hydrophoben Regionen statt. Whrend makroskopische Trbungsmessungen einen scharfen Phasenbergang suggerieren, zeigt diese Studie, dass die Dehydratisierung des Polymers ber einen Temperaturbereich von mindestens 30 8C verluft. Dieser kann, anders als fr einen thermodynamischen Phasenbergang erwartet, nicht mit einem einzelnen Dehydratisierungsprozess erklrt werden. Die Dehydratisierung sollte eher als ein molekular kontrollierter Nichtgleichgewichtszustand betrachtet werden, der in zwei Schritten abluft. Hierbei nimmt die Gre der lokalen Heterogenitten zu, und die Polymerfluktuationen nehmen ab. Bei etwa 7 8C oberhalb Tc ist der Groteil der Dehydratisierung abgeschlossen, und die Perkolation des Anteils und des Volumens von hydrophoben Regionen ist erreicht. Eine weitere Temperaturerhhung fhrt nur zu einer zustzlichen Verdrngung von Restwasser aus dem kollabierten System. Whrend die Aggregationstemperatur vorwiegend von der ueren Hlle des Dendrons beeinflusst wird, ist die Dehydratisierungseffizienz eng verknpft mit der Hydrophobie des Kerns.
Eingegangen am 11. Mrz 2010, vernderte Fassung am 13. April 2010 Online verffentlicht am 2. Juli 2010

Stichwrter: EPR-Spektroskopie Nanostrukturen Nichtgleichgewichtsprozesse Phasenbergnge Polymere

[1] a) H. G. Schild, Prog. Polym. Sci. 1992, 17, 163 249; b) C. de Las Heras Alarcn, S. Pennadam, C. Alexander, Chem. Soc. Rev. 2005, 34, 276 285; c) R. Yerushalmi, A. Scherz, M. E. van der Boom, H.-B. Kraatz, J. Mater. Chem. 2005, 15, 4480 4487; d) Z. Jia, H. Chen, X. Zhu, D. Yan, J. Am. Chem. Soc. 2006, 128, 8144 8145; e) A. Kumar, A. Srivastava, I. Y. Galaev, B. Mattiasson, Prog. Polym. Sci. 2007, 32, 1205 1237; f) H. Chen, Z. Jia, D. Yan, X. Zhu, Macromol. Chem. Phys. 2007, 208, 1637 1645. [2] a) C. Wu, S. Q. Zhou, Macromolecules 1995, 28, 5388 5390; b) C. Wu, S. Q. Zhou, Macromolecules 1995, 28, 8381 8387; c) C. Wu, S. Q. Zhou, Phys. Rev. Lett. 1996, 77, 3053 3055; d) X. Wang, X. Qiu, C. Wu, Macromolecules 1998, 31, 2972 2976. [3] Beispiele: a) K. Van Durme, S. Verbrugghe, F. E. Du Prez, B. Van Mele, Macromolecules 2004, 37, 1054 1061; b) S. Luo, J. Xu, Z. Zhu, C. Wu, S. Liu, J. Phys. Chem. B 2006, 110, 9132 9138; c) Y. Ono, T. Shikata, J. Am. Chem. Soc. 2006, 128, 10030 10031; d) H. Cheng, L. Shen, C. Wu, Macromolecules 2006, 39, 2325 2329; e) K. Van Durme, G. Van Assche, V. Aseyev, J. Raula, H. Tenhu, B. Van Mele, Macromolecules 2007, 40, 3765 3772; f) Y. Ono, T. Shikata, J. Phys. Chem. B 2007, 111, 1511 1513; g) M. Keerl, V. Smirnovas, R. Winter, W. Richtering, Angew. Chem. 2008, 120, 344 347; Angew. Chem. Int. Ed. 2008, 47, 338 341; h) M. Keerl, J. S. Pedersen, W. Richtering, J. Am. Chem. Soc. 2009, 131, 3093 3097. [4] a) A. D. Schlter, J. P. Rabe, Angew. Chem. 2000, 112, 860 880; Angew. Chem. Int. Ed. 2000, 39, 864 883; b) A. Zhang, L. Shu, Z. Bo, A. D. Schlter, Macromol. Chem. Phys. 2003, 204, 328 339; c) A. D. Schlter, Top. Curr. Chem. 2005, 245, 151 191; d) H. Frauenrath, Prog. Polym. Sci. 2005, 30, 325 384; siehe auch: e) B. M. Rosen, C. J. Wilson, D. A. Wilson, M. Peterca, M. R. Imam, V. Percec, Chem. Rev. 2009, 109, 6275 6540. [5] a) W. Li, A. Zhang, K. Feldman, P. Walde, A. D. Schlter, Macromolecules 2008, 41, 3659 3667; b) W. Li, A. Zhang, A. D. Schlter, Chem. Commun. 2008, 5523 5525; c) W. Li, D. Wu, A. D. Schlter, A. Zhang, J. Polym. Sci. Part A 2009, 47, 6630 6640. [6] E. E. Dormidontova, Macromolecules 2004, 37, 7747 7761. [7] B. Helms, J. M. J. Frechet, Adv. Synth. Catal. 2006, 348, 1125 1148. [8] C. K. Ober, S. Z. D. Cheng, P. T. Hammond, M. Muthukumar, E. Reichmanis, K. L. Wooley, T. P. Lodge, Macromolecules 2009, 42, 465 471. [9] a) F. Cady, H. Qian, Phys. Biol. 2009, 6, 036011; b) D. Brutlag, A. Kornberg, J. Biol. Chem. 1972, 247, 241 248. [10] G. P. Drobny, J. R. Long, T. Karlsson, W. Shaw, J. Popham, N. Oyler, P. Bower, J. Stringer, D. Gregory, M. Mehta, P. S. Stayton, Annu. Rev. Phys. Chem. 2003, 54, 531 571. [11] a) K. Schmidt-Rohr, H. W. Spiess, Multidimensional Solid-State NMR and Polymers, Academic Press, London, 1994 ; b) K. Saalwchter, Prog. Nucl. Magn. Reson. Spectrosc. 2007, 51, 1
Angew. Chem. 2010, 122, 5818 5823

5822

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
35; c) S. Schlick, Advanced ESR Methods in Polymer Research, Wiley-Interscience, Hoboken, 2006. [12] a) K. Schmidt-Rohr, H. W. Spiess, Phys. Rev. Lett. 1991, 66, 3020 3023; b) A. Heuer, M. Wilhelm, H. Zimmermann, H. W. Spiess, Phys. Rev. Lett. 1995, 75, 2851 2854; c) U. Tracht, M. Wilhelm, A. Heuer, H. Feng, K. Schmidt-Rohr, H. W. Spiess, Phys. Rev. Lett. 1998, 81, 2727 2730. [13] a) M. R. Hansen, T. Schnitzler, W. Pisula, R. Graf, K. Mllen, H. W. Spiess, Angew. Chem. 2009, 121, 4691 4695; Angew. Chem. Int. Ed. 2009, 48, 4621 4624; b) S. Ruthstein, A. M. Raitsimring, R. Bitton, V. Frydman, A. Godt, D. Goldfarb, Phys. Chem. Chem. Phys. 2009, 11, 148 160; c) D. Hinderberger, H. W. Spiess, G. Jeschke, Appl. Magn. Reson. 2010, 37, 657 683; d) C. Dockter, A. Volkov, C. Bauer, Y. Polyhach, Z. Joly-Lopez, G. Jeschke, H. Paulsen, Proc. Natl. Acad. Sci. USA 2009, 106, 18485 18490. [14] a) D. Hinderberger, O. Schmelz, M. Rehahn, G. Jeschke, Angew. Chem. 2004, 116, 4716 4721; Angew. Chem. Int. Ed. 2004, 43, 4616 4621; b) R. Owenius, M. Engstrom, M. Lindgren, M. Huber, J. Phys. Chem. A 2001, 105, 10967 10977. [15] M. J. N. Junk, U. Jonas, D. Hinderberger, Small 2008, 4, 1485 1493. [16] B. R. Knauer, J. J. Napier, J. Am. Chem. Soc. 1976, 98, 4395 4400. [17] A. L. Kovarskii, A. M. Wasserman, A. L. Buchachenko, J. Magn. Reson. 1972, 7, 225 237. [18] N. M. Atherton, Principles of Electron Spin Resonance, Ellis Horwood, New York, 1993. [19] N. Derkaoui, S. Said, Y. Grohens, R. Olier, M. Privat, J. Colloid Interface Sci. 2007, 305, 330 338. [20] S. Stoll, A. Schweiger, J. Magn. Reson. 2006, 178, 42 55. [21] P. M. Chaikin, T. C. Lubensky, Principles of Condensed Matter Physics, Cambridge University Press, Cambridge, 1995. [22] Man beachte, dass bei der gewhlten Polymerkonzentration ca. 30 % der Spinsonden selbst bei hohen Temperaturen in hydrophilen Regionen verbleiben. Daher erscheint der vermutete Perkolationspunkt bei yD1 % 0.5, wenn (0.5/0.7 % 0.7) 70 % aller Spinsonden, die am Phasenbergang beteiligt sind, in hydrophoben Bereichen eingeschlossen sind.

Chemie

Angew. Chem. 2010, 122, 5818 5823

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5823

Zuschriften
Rare Earths Compounds
DOI: 10.1002/ange.201002338

Planar Fe6 Cluster Units in the Crystal Structure of RE15Fe8C25 (RE = Y, Dy, Ho, Er)**
Bambar Davaasuren, Horst Borrmann, Enkhtsetseg Dashjav, Guido Kreiner, Michael Widom, Walter Schnelle, Frank R. Wagner, and Rdiger Kniep*
Carbometalates represent a special class of ternary and higher m carbides containing complex anions n (n = 0, 1, 2, 1 Ty Cz 3) characterized by covalent bonds between the transition metals (T) and the highly polarizable (monoatomic) carbon species.[1] The negative charge of the carbo ligands (C4) together with the low oxidation states of the transition metals cause high negative charges on the complex carbometalate anions, which have to be balanced by cations bearing a high positive charge, as brought about by rare-earth elements (RE), and resulting in the general formula REx[TyCz]. Carbometalates as electron-precise compounds without a tendency to form perceptible homogeneity ranges and exclusively containing monoatomic carbo ligands are shown to exist in a range of atomic ratios given by the condition (x + y)/z 2.[1] In the systems REFeC, several ternary phases fulfilling this compositional condition have been reported. However, their crystal structures either contain C2 pairs as structural units instead of monoatomic carbo ligands, such as RE2[Fe(C2)4/2] (RE = Y, TbLu),[2] Sc3[Fe(C2)4/2],[3, 4] RE[FeC2] (RE = Sc, Sm, GdEr, Lu),[5, 6] and RE3.67[Fe(C2)3] (RE = LaNd, Sm)[7, 8]), or the crystal structures have not been determined (GdFeC, RE2Fe2C3, RE4Fe4C7 (RE = Ce, Gd)).[9, 10] Our continuous search for carboferrates exclusively containing monoatomic carbo ligands has been unsuccessful so far. Instead, we obtained a new series of isotypic compounds, RE15Fe8C25 (RE = Y, Dy, Ho, Er), containing the novel structural unit of a Fe6 cluster surrounded by C2 pairs and a monoatomic carbon species. Crystal structure and materials properties as well as the chemical bonding situation in these compounds are discussed in detail. The metallic-gray rare-earth iron carbides were prepared by a high-temperature route,[11] and their crystal structures
[*] B. Davaasuren, Dr. H. Borrmann, Dr. E. Dashjav, Dr. G. Kreiner, Dr. W. Schnelle, Dr. F. R. Wagner, Prof. Dr. R. Kniep Max-Planck-Institut fr Chemische Physik fester Stoffe Nthnitzer Strasse 40, 01187 Dresden (Germany) Fax: (+ 49) 351-4646-3002 E-mail: kniep@cpfs.mpg.de Prof. Dr. M. Widom Department of Physics, Carnegie Mellon University Pittsburgh, PA 15213 (USA) [**] We thank Dr. U. Burkhardt, T. Vogel, and M. Eckert for metallographic and WDXS investigations, Dr. Yu. Prots and S. Hckmann (Institute for X-ray diffraction measurements, and Dr. M. Mihalcovic of Physics, Slovak Academy of Sciences) for discussions on VASP. Funding by the Deutsche Forschungsgemeinschaft (SPP 1166) is gratefully acknowledged. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002338.

were determined from X-ray diffraction data (single crystals as well as powders).[12, 13] The crystal structure is exemplarily described for the Er compound. The striking feature of the crystal structure is an unusual planar group of six Fe atoms, which are arranged to form a triangle with Fe atoms at the vertices (Fe1) and at the midpoints of the edges (Fe2) as shown in Figure 1. The

Figure 1. Planar Fe6 cluster in the crystal structure of Er15Fe8C25 surrounded by 12 C2 pairs, 6 of which are also part of trigonal planar [Fe(C2)3] units. A monoatomic carbon ligand takes a position either above or below the Fe2 triangle.

triangle can be regarded as fragments of the crystal structures of g-Fe,[14] e-Fe3C,[15] and h-Fe2C.[16] The short FeFe distances in the ternary phase (Fe1Fe2 = 255.7(1) pm and Fe2Fe2 = 270.9(1) pm) fall between the respective distances in g-Fe (242.5 pm), e-Fe3C (275.4 pm), and h-Fe2C (260.6 pm and 277.8 pm). The Fe6 cluster is surrounded by one monoatomic carbon ligand (either above or below the small Fe2 triangle) and 12 carbon pairs bonded non-coplanar end on to the iron atoms of the cluster. Considering the coordination of iron atoms of the Fe6 triangles by carbon ligands only, distorted Fe1(C2)4 tetrahedra and trigonal pyramids Fe2C(C2)2 resemble the structural motifs commonly found in the crystal structures of carbometalates.[1, 17] By taking into consideration also the short FeFe contacts, the coordination polyhedra around Fe1 and Fe2 can be considered as strongly distorted octahedra
Angew. Chem. 2010, 122, 5824 5828

5824

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
(4 C + 2 Fe) and polyhedra formed by seven corners (3 C + 4 Fe), respectively. Fe3 atoms in the crystal structure serve as linkers between the Fe6 clusters. Interlinking is realized by bonding (end-on) of three C2-pairs (CC 134.7(3) pm) to Fe3 (FeC 186.6(2) pm) and formation of a trigonal-planar arrangement. The C2 units bonded to Fe2 (CC 137.8(3) pm, FeC 200.7(2) pm) do not participate in further linkages within the complex anion. The Fe6 clusters are connected to six neighboring clusters through six planar Fe3(C2)3 groups resulting in overall, infinite layers 2 1 Fe6 Fe2 C2 12 C. Because of the space-consuming ligands surrounding the clusters, and their linking through isolated structural units, the distance between neighboring clusters within a layer becomes very large (1186 pm between the centers of the clusters). The layers 2 1 Fe6 Fe2 C2 12 C are stacked along [001] as shown in Figure 2 a. Together with the presentation in Figbears a total charge of 45 by counting the RE species (in agreement with susceptibility data; see below) as RE3+ (resulting in RE15 = 45 + ). Further assumptions concern the charges of the mono- and diatomic carbon ligands based on the crystal-chemical concept of carbometalates[1] as well as on experimental values of CC distances in C2 pairs.[210] For the present compounds, these data allow one to count the monoatomic carbon as C4, and the diatomic species as C24. The iron clusters (Fe1, Fe2) in the crystal structure are interconnected by Fe3 in a trigonal-planar coordination arrangement by C2 pairs. Trigonal-planar [Fe(C2)3] groups are also known from the crystal structure of RE3.67[Fe(C2)3][7, 8] with the Fe atoms being assigned to the valence state of Fe1+. Altogether, the (ionic) chemical formula of the cluster compounds can be written as (RE3+)15[(Fe6)5+(Fe1+)2(C24)12C4], resulting in a mean valence state of the six iron atoms of the cluster unit of 0.83 + , which, in general, would be consistent with homoatomic bonding interactions within the clusters. The corrected magnetic susceptibilities ccorr(T) of RE15Fe8C25 (RE = Dy, Ho, Er) are in accordance with the presence of strongly paramagnetic RE3+ ions (meff = 38 41 mB f.u.1; f.u.: formula unit; see the Supporting Information). A discussion of the physical properties and calculations concerning the chemical bonding situation is given below for the Y compound. The temperature dependence of the corrected susceptibility ccorr of Y15Fe8C25 resembles a Curie Weiss law and a fit results in a weak paramagnetic moment meff = 6 1 mB f.u.1 A broad shoulder visible at around 30 K in ccorr(T) might be interpreted as a ferromagnetic ordering transition. In this case, the ordered moment would be mord % 0.8 mB f.u.1 The electrical resistivity 1(T) measured on compact pieces shows a metallike temperature dependence above 50 K (1(300 K) = 330 mW cm). The curve 1(T) shows a minimum around 38 K followed by a slight increase (+ 7 %) towards 4 K. The origin of this behavior remains unexplained, although the temperature of the minimum in 1(T) coincides with the shoulder in ccorr. Both features might indicate a magnetic ordering of the Fe units. DFT/PW91[18] total-energy calculations on Y15Fe8C25 reveal that magnetic phases with an ordered moment of about 6 mB f.u.1 are energetically favorable, lowering the total energy of the magnetic phase by about 0.2 eV f.u.1 with respect to the nonmagnetic one (see the Supporting Information). The results further indicate the presence of one-sided location of the monoatomic carbon atom above or below the Fe6 plane. Electronic band structure calculations using the TBLMTO-ASA method[19] within the local density approximation[20] reveals metallic character, which generally agrees with the resistivity measurements. The spin-polarized calculation with ferromagnetic ordering yields a total magnetic moment of about 5 mB f.u.1, which is consistent with the magnetic moments obtained from total energy calculations. The density-of-states (DOS) curves of the minority and majority spin channels are rather similar (see the Supporting Information). The total DOS (Figure 3 a) displays a characteristic structuring into separated parts from nominal diatomic (ss : A1, s*s : A2) and monoatomic carbon species (C(2s): B), as www.angewandte.de

Chemie

Figure 2. a) Stacking of layers in the crystal structure of Er15Fe8C25 viewed along the [010] direction. b) Crystal structure viewed along the [001] direction. See text for further details.

ure 2 b, it becomes clear that Er3 atoms are sandwiched between the Fe6 clusters of adjacent layers. The remaining Er atoms (Er1 and Er2) form tricapped trigonal-prismatic arrangements surrounding the Fe3(C2)3 units. These tricapped trigonal prisms form columns running along [001] by sharing common basal planes. The columns are arranged to form a honeycomb pattern with the Fe6 clusters (capped with additional Er3 atoms above and below the cluster plane) taking positions inside the large channels. For charge balancing, simple rules of electron counting based on ionic concepts can be used with the following strategy: the polymeric complex anion 2 1 Fe6 Fe2 C2 12 C
Angew. Chem. 2010, 122, 5824 5828

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5825

Zuschriften

Figure 3. a) Total DOS with regions A1, B, A2, AB, and C (see text) and b,c) spin-averaged COHP diagrams for interatomic interactions FeFe and FeY of Y15Fe8C25.

well as a common region of C(2p) states (AB), and a mainly metal-dominated part (C) starting below the Fermi level EF and extending further on, similar to that found for La7Os4C9.[21] Complementary chemical bonding analysis with a focus on metalmetal interactions was performed employing the COHP (crystal orbital Hamiltonian population) method[22] , as well as the electron localizability indicator (ELI-D),[23] and the QTAIM (quantum theory of atoms in molecules) method.[24] The COHP diagram (Figure 3 b) shows that some FeFe bonding orbital interactions already start to develop for the nominal carbon DOS parts. The maximum number of bonding interactions, however, is achieved within the nominal metal bands in the uppermost part of the DOS. Notably, all the bonding states are exhausted below EF, but at EF a small number of antibonding states are already occupied continuing further beyond. Almost the same situation is observed (Figure 3 c) for the FeY interactions with the slight difference that EF more clearly marks the boundary between all occupied bonding and all empty antibonding interactions. For Y15Fe8C25, the ratios of ICOHP(metalC)/ICOHP(metal metal) % 3 and ICOHP(FeC) @ ICOHP(YC) are within the range of values observed for carbometalates.[1] Further aspects of metalmetal bonding can be extracted from topological analysis of the ELI-D and the electron density. The Fe6 cluster bonding is characterized by a number of local maxima of ELI-D in the valence shells (i.e., 4th shell) of the Fe1 and Fe2 atoms. Owing to the high, but unsymmetrical coordination of the Fe atoms (Figure 4 a), there is no

Figure 4. a) Nearest neighbors of the Fe6 cluster, b) Fe6 cluster superbasin of ELI-D (gray) and Fe 3rd shell basins (red), and c) Fe6 cluster superbasin of ELI-D intersected by QTAIM atoms for Y15Fe8C25. Red: Fe, green: Y atoms.

clear-cut distinction between intracluster and external bonding basins. As a characteristic, all of these basins possess attractors located inside the Fe atomic basins of the electron density, i.e., within the QTAIM Fe1 and Fe2 atoms. As an adequate procedure, all of these Fe6 cluster ELI-D basins were united into one cluster superbasin, a general procedure proposed by Silvi.[25] The lone-pair-type basins of the carbon ligands establishing dative bonds to the Fe atoms are clearly separated from the cluster superbasin. The Fe6 cluster superbasin is depicted in gray in Figure 4 b. The separated Fe 3rd shell ELI-D basins marked in red are completely located inside the corresponding QTAIM Fe atom and touch the cluster superbasin (Figure 4 b). Integration of the electron density within the ELI-D cluster superbasin reveals a sizable electronic population of 8.2 e . Integration of the spin density
Angew. Chem. 2010, 122, 5824 5828

5826

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
within the ELI-D basins reveals only a small degree of spin polarization (0.1 e) within the cluster superbasin. As is to be expected, the highest spin polarization is found in the 3rd shell regions of the Fe atoms of the cluster (3.9 e in total). All these results give rise to the notion of a covalently bonded, magnetic Fe6 cluster stabilized by dative ligand-tometal bonds. However, this is not yet the complete picture. Recent investigations of novel organometallic complexes with unsupported RET bonds, for example, Cp2YReCp2,[26a] La(ReCp2)3,[26b] and exemplary analysis of RET interactions in La7Os4C9,[21] revealed the presence of polar covalent RET interactions. The picture is that of a dative bond between an electron-rich T atom and a coordinatively unsaturated RE metal involving a T lone pair created by the specific arrangement of strongly interacting electrondonor ligands. The present case can be considered an extension of this picture. The Fe atoms are rather electron-rich with effective QTAIM charges of 0.1 and + 0.2 for Fe1 and Fe2 cluster atoms, respectively. They are not only strongly interacting with the carbon ligands but also among each other, which gives rise to a sizable number of electrons (1.37 e per cluster Fe atom) in the valence region of the 3d transition metal. The formation of electron localizability maxima in the valence region of a T element forming a pure dd covalent interaction in a T2 dimer has been already exemplarily demonstrated.[27] Here, the Fe6 cluster superbasin also contains such regions. The whole superbasin serves as an electron-donor region for the attached RE atoms. The polarity of the interactions can be investigated applying the method of ELI-D/QTAIM basin intersection in analogy to the corresponding ELF/QTAIM intersection procedure.[28] The intersection of the ELI-D cluster superbasin with the QTAIM atomic basins of Fe and Y is shown in Figure 4 c, with most of the volume of the superbasin belonging to the QTAIM Fe atoms (red color) and only a minor part (green color) to the Y atoms. Integration of the electron density in the intersection parts reveals that 7.2 e (88 %) out of the total 8.2 e belong to the Fe6 cluster atoms and only 11 % to the attached Y atoms. The largest populations for the Y atom intersections are found above and below the Fe6 cluster plane, corresponding to the shortest Fe Y contacts (Fe1Y3 = 274 pm). Although this distance is the same above and below the plane, the intersections are not. The reason is the missing monoatomic carbon ligand below the plane leading to more extended superbasin regions on the bond-opposed side and to twice as large populations of the intersecting Y regions. From this point of view, the only onesided coordination of the Fe6 cluster by monoatomic carbon enhances the FeY bonding relative to two-sided coordination. In summary, the crystal structures of the isotypic compounds RE15Fe8C25 (RE = Y, Dy, Ho, Er) contain planar (magnetic) Fe6 clusters characterized by covalent FeFe bonding interactions. Besides one monoatomic carbon atom a total of 12 diatomic carbon ligands are attached to the clusters, thereby forming trigonal planar Fe(C2)3 units interconnecting the Fe6 groups to a complex polymeric anion 2 1 Fe6 Fe2 C2 12 C.The RE atoms surrounding the clusters along [001] reveal significant contributions to chemical
Angew. Chem. 2010, 122, 5824 5828

Chemie

bonding Fe !RE in the sense of polar dative interactions. RE species are assigned a RE3+ oxidation state. Fe atoms are present in low valence states with only small effective charges (QTAIM method) of 0.1 and + 0.2 for the cluster atoms (Fe1, Fe2) and + 0.15 for iron in trigonal planar coordination (Fe3). A rough estimation of the valence states of iron by simple electron counting leads to Fe(3)1+ and Fe(1,2)0.83+, which are significantly different from the effective charges, but reflect the general trend to low valence states. Besides our continuing Mssbauer investigations on the Fe6 cluster compounds, further work is focused on the stabilization of even larger clusters in the systems REFeC.
Received: April 20, 2010 Published online: July 6, 2010

Keywords: carbides cluster compounds density functional calculations iron rare earths

[1] E. Dashjav, G. Kreiner, W. Schnelle, F. R. Wagner, R. Kniep, W. Jeitschko, J. Solid State Chem. 2007, 180, 636 653. [2] M. H. Gerss, W. Jeitschko, L. Boonk, J. Nienstedt, J. Grobe, E. Mrsen, A. Leson, J. Solid State Chem. 1987, 70, 19 29. [3] R.-D. Hoffmann, R. Pttgen, W. Jeitschko, J. Solid State Chem. 1992, 99, 134 139. [4] B. Rohrmoser, G. Eickerling, M. Presnitz, W. Scherer, V. Eyert, R-D. Hoffmann, U. Ch. Rodewald, C. Voigt, R. Pttgen, J. Am. Chem. Soc. 2007, 129, 9356 9365. [5] R. Pttgen, W. Jeitschko, U. Wortmann, M. E. Danebrock, J. Mater. Chem. 1992, 2, 633 637. [6] W. Jeitschko, M. H. Gerss, J. Less-Common Met. 1986, 116, 147. [7] A. M. Witte, W. Jeitschko, Z. Naturforsch. B 1996, 51, 249 255. [8] B. Davaasuren, E. Dashjav, G. Kreiner, H. Borrmann, M. Mihalkovic, R. Kniep, J. Solid State Chem. 2009, 182, 1331 1335. [9] H. H. Stadelmeyer, H. K. Park, Z. Metallkd. 1982, 73, 399 402. [10] H. K. Park, H. H. Stadelmeyer, L. T. Jordan, Z. Metallkd. 1981, 72, 417 422. [11] Mixtures of the elements (RE: pieces, AMES, Fe: pieces, Alfa, and graphitic carbon: 99.95 %, Chempur) in the molar ratio 15:8:26 were pressed into pellets, arc-melted, and annealed at 1373 K in Ta ampoules jacketed in fused silica tubes for 500 h. All handlings were performed under Ar atmosphere. For further details, see the Supporting Information. [12] XRPD (38 < 2q < 1008, Huber Guinier camera 670, Co Ka1radiation, l = 178.8965 pm, transmission geometry, Ge monochromator, flat sample holder with mylar foil). Refinement of the lattice parameters: LaB6 as internal standard (SRM660a, a = 415.6916 pm); crystallographic data of Er15Fe8C26 : P321; Z = 6; a = 1186.02(2) pm, c = 508.85(1) pm; Rigaku RAXIS Spider, AgKa radiation; 295 K; 4.14 < q < 44.5; structure solution by direct methods; crystal size: 0.02 0.01 0.01 mm3 ; m = 29.21 cm1; 1 = 8.722 g cm3 ; the crystal was twinned (twin law 010 100 001, twin fraction = 0.33; R1 = 0.02 and wR2 = 0.03 for all 6330 reflections and 78 variables. Further details on the crystal structure investigations may be obtained from the Fachinformationszentrum Karlsruhe, 76344 Eggenstein-Leopoldshafen, Germany (fax: (+ 49) 7247-808-666; e-mail: crysdata@fiz-karlsruhe.de), on quoting the depository number CSD421364. See also the Supporting Information. [13] P321; Z = 1; Y15Fe8C25 : a = 1194.92(4) pm, c = 513.83(3) pm; Dy15Fe8C25 : a = 1192.63(2), c = 514.36(2) pm, Ho15Fe8C25 : a = 1189.11(7) pm, c = 511.26(5) pm, Further details on the crystal structure investigation may be obtained from the Fachinformationszentrum Karlsruhe, 76344 Eggenstein-Leopoldshafen, Ger-

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5827

Zuschriften
many (fax: (+ 49) 7247-808-666; e-mail: crysdata@fiz-karlsruhe. de), on quoting the depository numbers CSD-421364, CSD420018, and CSD-421467). J. Hglund, F. F. Guillermet, G. Grimvall, M. Korling, Phys. Rev. B 1993, 48, 11685 11691. H. L. Yakel, Int. Met. Rev. 1985, 30, 17 40. Z. Q. Lv, S. H. Sun, P. Jiang, B. Z. Wang, W. T. Fu, Comput. Mater. Sci. 2008, 42, 692 697. M. H. Gerdes, W. Jeitschko, K. H. Wachtmann, M. E. Danebrock, J. Mater. Chem. 1997, 7, 2427 2431. a) G. Kresse, J. Furthmller, Phys. Rev. B 1996, 54, 11169 11186; b) G. Kresse, J. Joubert, Phys. Rev. B 1999, 59, 1758 1775. O. Jepsen, A. Burkhard, O. K. Andersen, The Program TBLMTO-ASA, version 4.7, Max-Planck-Institut fr Festkrperforschung, Stuttgart, Germany, 1999. U. Barth, L. Hedin, J. Phys. C 1972, 5, 1629 1642. E. Dashjav, Yu. Prots, G. Kreiner, W. Schnelle, F. R. Wagner, R. Kniep, J. Solid State Chem. 2008, 181, 3121 3130. [22] R. Dronskowski, P. E. Blchl, J. Phys. Chem. 1993, 97, 8617 8624. [23] a) M. Kohout, Int. J. Quantum Chem. 2004, 97, 651 658; b) M. Kohout, K. Pernal, F. R. Wagner, Yu. Grin, Theor. Chem. Acc. 2004, 112, 453 459; c) M. Kohout, Faraday Discuss. 2007, 135, 43 54; d) M. Kohout, F. R. Wagner, Yu. Grin, Theor. Chem. Acc. 2008, 119, 413 420. [24] R. F. W. Bader, Atoms in Molecules: A Quantum Theory, Oxford University Press, Oxford, 1994. [25] B. Silvi, J. Mol. Struct. 2002, 614, 3 10. [26] a) M. V. Butovskii, O. L. Tok, F. R. Wagner, R. Kempe, Angew. Chem. 2008, 120, 6569 6572; Angew. Chem. Int. Ed. 2008, 47, 6469 6472; b) M. V. Butovskii, C. Dring, V. Bezugly, F. R. Wagner, Yu. Grin, R. Kempe, Nat. Chem. 2010, DOI: 10.1038/ nchem.718. [27] M. Kohout, F. R. Wagner, Yu. Grin, Theor. Chem. Acc. 2002, 108, 150 156. [28] G. Jansen, M. Schubart, B. Findeis, L. H. Gade, I. J. Scowen, M. McPartlin, J. Am. Chem. Soc. 1998, 120, 7239 7251.

[14] [15] [16] [17] [18]

[19]

[20] [21]

5828

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5824 5828

Angewandte
DOI: 10.1002/ange.201001026

Chemie

Antimalarial Agents

Identification of a 1,2,4,5-Tetraoxane Antimalarial Drug-Development Candidate (RKA 182) with Superior Properties to the Semisynthetic Artemisinins
Paul M. ONeill,* Richard K. Amewu, Gemma L. Nixon, Fatima Bousejra ElGarah, Mathirut Mungthin, James Chadwick, Alison E. Shone, Livia Vivas, Hollie Lander, Victoria Barton, Sant Muangnoicharoen, Patrick G. Bray, Jill Davies, B. Kevin Park, Sergio Wittlin, Reto Brun, Michael Preschel, Kesheng Zhang, and Stephen A. Ward
Artemisinin (1) is an extract of the Chinese wormwood Artemisia annua and has been used since ancient times to treat malaria.[1] Today, semisynthetic derivatives artesunate (2) and artemether (3) are used clinically in drug combinations (ACT; artemisinin-based combination therapy).[2] However, first-generation analogues (e.g. 2 and 3) have a limited availability,[3] high cost,[4] and poor oral bioavailability (Scheme 1 a).[5] In addition to these drawbacks there have been recent reports of high failure rates associated with ACTs suggesting the possibility of clinical artemisinin resistance along the ThaiCambodian border.[6] In the light of these observations there is an urgent need to develop alternative endoperoxide-based therapies.[7] The crucial structural functionality within artemisinin and synthetic 1,2,4-trioxanes[8] is the endoperoxide bridge. Recently a series of molecules based on an ozonide structure were developed from which the candidate OZ 277[9] was shown to have impressive antimalarial activity profiles in vitro and in rodent models of malaria. However, the recent
Scheme 1. a) Artemisinin and its semisynthetic analogues. b) Comparison of tetraoxanes with trioxolane-based antimalarials. [*] Prof. P. M. ONeill, Dr. R. K. Amewu, F. Bousejra ElGarah, Dr. J. Chadwick, Dr. V. Barton Department of Chemistry, University of Liverpool Liverpool, L69 7ZD (UK) E-mail: pmoneill@liverpool.ac.uk Prof. P. M. ONeill, Dr. J. Chadwick, Prof. B. K. Park MRC Centre for Drug Safety Science, Department of Pharmacology University of Liverpool, Liverpool (UK) M. Mungthin Department of Parasitology Phramongkutklao College of Medicine Bangkok (Thailand) Dr. G. L. Nixon, Dr. A. E. Shone, Dr. S. Muangnoicharoen, Dr. P. G. Bray, J. Davies, Prof. S. A. Ward Liverpool School of Tropical Medicine, Liverpool (UK) Dr. S. Wittlin, Prof. R. Brun Swiss Tropical and Public Health Institute, Parasite Chemotherapy Basel (Switzerland) Dr. L. Vivas, H. Lander Department of Infectious and Tropical Disease London School of Hygiene and Tropical Medicine, London (UK) Dr. M. Preschel, Dr. K. Zhang Carbogen AMCIS, Hunzenschwil (Switzerland) Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001026.
Angew. Chem. 2010, 122, 5829 5833

development of OZ 277 has been hampered as this molecule was found to be unstable in the plasma of malaria patients during a phase II dose-ranging study.[10a,b] In our hands, studies of endoperoxide stability have shown that 1,2,4,5-tetraoxanes[11a] (e.g. 6) have significantly higher stability[11b] than their 1,2,4-trioxolane (4) or 1,2,4-trioxane counterparts.[11b] To exemplify further the chemical and biological differences between these two heterocycles it has been noted that the simple dispiro-1,2,4-trioxolane 4 is antimalarially inactive and unstable whereas the close chemically stable tetraoxane analogue 6 expresses antimalarial activity in the nanomolar range (IC50 = 25 nm ) (Scheme 1 b). For good levels of antimalarial activity in the ozonide series, fusion of the 1,2,4-trioxolane ring system to an adamantane core (see for example 5, Scheme 1) was found to be essential.[9] Given the foregoing observations we reasoned that similar substitution of the cyclohexyl group in antimalarially active analogue 6 would generate a new series of molecules with improved stability profiles and improved oral and pharmacokinetic profiles through optimization of the side chain in the generic structure 7 (R = polar water-solubilizing

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5829

Zuschriften
group). Identification of the optimal, metabolically stable polar side chain to counterbalance the lipophilicity of the adamantane functional group was the primary focus of the medicinal chemistry optimization. In order to candidate-select a 1,2,4,5-tetraoxane we set a rigorous target product profile from the onset of our medicinal chemistry optimization, and for the candidate selection of RKA 182 (15) over 150 novel 1,2,4,5-tetraoxanes were synthesized and screened from two independent hit series (Scheme 2). After extensive in vitro, in vivo, and DMPK (drug metabolism and pharmacokinetics) studies on hit series 1 this template was selected over series 2 for lead optimization which ultimately led to the synthesis, profiling, and selection of RKA 182 (15 ; vide infra) as the development candidate. The synthesis of lead tetraoxanes (hit series 1) is depicted in Scheme 3. The synthetic route is high-yielding, comprises only five steps, and is divergent in the last step making expedient parallel synthesis possible (see the Supporting Information).[12a] In vitro and in vivo data of the most potent compounds synthesized in hit series 1 can be seen in Table 1. These molecules exhibit an IC50 of less than 6 nm against both chloroquine-sensitive 3D7 and chloroquine-resistant K1 strains of P. falciparum with the lowest IC50 being 0.8 nm (Table S1 in the Supporting Information).[14] Tetraoxane analogues also have ED50/ED90 values of less than 3.5/ 9.5 mg kg1, with the lowest values being ED50/ED90 = 0.99/

Scheme 2. Tetraoxane candidate development:[13] SAR trends of novel 1,2,4,5-tetraoxanes and candidate selection of RKA 182.

Scheme 3. Synthesis of polar tetraoxane derivatives 1218.

Table 1: In vitro and in vivo[15] data for tetraoxanes 1218 and pharmocokinetic parameters after a single intravenous (1 mg kg1) and single oral (10 mg kg1) administration in the rat. Compound 3D7 12 13 14 15 15 (tosylate salt) 16 17 18 artesunate artemether chloroquine[c] 1.4 0.1 5.2 0.5 2.5 0.2 4.9 1.21 0.8 0.2 6.0 1.2 1.2 1.0 1.2 0.8 1.8 0.6 7.8 0.9 12.5 5.6 IC50 [nm] K1 0.9 0.2 0.8 0.3 2.8 1.2 1.9 1.9 1.1 0.8 1.5 1.0 0.9 0.7 0.9 0.4 1.6 0.8 3.2 2.3 250.0 20.2 100 100 99.7 100 100 100 100 100 100 100 100 3.47 3.18 3.02 1.82 1.33 2.23 0.99 1.60 3.96 3.80 2 5.40 3.88 9.25 8.38 4.18 5.12 1.41 2.91 11.72 12.24 4.5 1.64 0.34 5.89 1.12 1.72 0.76 3.53 1.12 2.38 0.90 NC 1.08 0.33 1.23 0.45 NC ND 9 11 9 24 38 (42)[d] 36 9 23 NC 1.4[c] % Inhibition 30 mg kg1[a] ED50 [mg kg1] ED90 [mg kg1] 10 mg kg1 (po) t1/2 [h] F[b] [%]

[a] Parasitemia was determined by microscopic examination of Giemsa stained blood films taken on day 4. Microscopic counts of blood films from each mouse were processed using spreadsheet (Microsoft Corp.) and expressed as percentage of inhibition from the arithmetic mean parasitemias of each group in relation to the untreated group. [b] Indicates F (oral bioavailability in rat) calculated using AUC0t and actual doses (see the Supporting Information). [c] Data taken from Vennerstrom et al.[9] NC = not calculable; ND = not determined. [d] Oral bioavailability (8 mg kg1 oral/1 mg kg1 iv) in mouse (average of two experiments).

5830

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5829 5833

Angewandte
1.41 mg kg1 (tetraoxane 17) when tested in mice infected with the P. berghei ANKA parasite. The activity of 17, in terms of ED50 and ED90 in the four-day test,[15] surpasses that of any synthetic endoperoxide reported in the literature to date after oral administration. Piperidinyl piperazine-functionalized tetraoxane 15, when formulated as a tosylate salt, has outstanding in vitro activity (< 1 nm ) and in vivo activity with an ED50/ED90 of 1.33/4.18 mg kg1 which is superior to artemether and artesunate and comparable to artemisone, the leading next-generation semisynthetic artemisinin which is currently undergoing phase II clinical trials.[16] In studies conducted on mouse survival, mice treated at 3 10 mg kg1 per day with 15 survived 22 days in comparison with only 9 days for artesunate (see the Supporting Information). Pharmacokinetic parameters and oral bioavailability were determined after intravenous (1 mg kg1) and oral administration (10 mg kg1) in SpragueDawley rats (Table 1). The most significant observation from this study is that tetraoxanes 15, 16, and 18 have oral bioavailabilities of greater than 20 % (Tables S2 and S3 in the Supporting Information). Taking this information together with the antimalarial activity data it was clear that although the activity of 12 and 17 in the four-day test was very good, the poor bioavailability of 17s and 12s complicated in vivo metabolic profile meant that these molecules were not considered further. Compounds 13 and 18 were ruled out at this point due to relatively poor bioavailability for the former and a very short half-life predicted for the latter tetraoxane. Although 16 was more potent in the mouse survival studies this tetraoxane was also ruled out due to lower maximum tolerated dose (MTD) in rats (100 mg kg1 for 16 versus 400 mg kg1 for 15) and lower overall exposure (AUC) than 15 in rat pharmacokinetic studies. Based on the outstanding in vitro and in vivo antimalarial activity and pharmacokinetic profile 15 was selected as the lead candidate. Formulation work on 15 delivered the compound as a ditosylate salt which had improved oral bioavailability of 38 % in the rat (42 % in the mouse; Table 1 and Table S4 in the Supporting Infomration). Having selected 15 as the drug candidate a scalable, industrial synthesis was sought. The industrial synthesis (Carbogen AMCIS) of 15 comprises only four steps (due to the synthesis of 8 in one step from direct hydrogenation of phenol ester 19) involving a single chromatography step and has a projected low cost of goods (Scheme 4). The key step in the scale-up of this potentially hazardous chemistry involved the in situ generation of the keto ester 10 without isolation of the gem-dihydroperoxide 9 followed by hydrolysis (of the ester function) to provide the acid 11 in acceptable yields on a 1.2 kg scale. The application of the Dussault procedure (employing Re2O7 as a mild Lewis acid)[12b] for the key tetraoxane ring-forming step was also crucial to the scale-up of this chemistry. As a part of our preclinical development 15 was also tested against eleven different southeast asian isolates from patients who had failed ACT combination chemotherapy (Figure 1), and RKA 182 (15) clearly demonstrated superiority over mefloquine, artesunate, and artemisinin with all measured IC50 values below 5 nm . (Whilst the five- to tenfold increase in potency versus artemisinins for 15 is reassuring,
Angew. Chem. 2010, 122, 5829 5833

Chemie

Scheme 4. Industrial synthesis of tetraoxane 15 (RKA 182).

Figure 1. IC50 data against CambodiaThai patient isolates for 15 compared with other antimalarials. Blue: mefloquine; red: artesunate; green: artemisinin; purple: RKA 182.

the true test of activity versus artemisinin-resistant strains can only be assessed in a dynamic human model of malaria due to lack of stable inherent resistance phenotype in vitro.) To assess the speed of action a single oral dose of 30 mg kg1 15 was administered to mice infected with 4 106 P. berghei ANKA infected red cells two days postinfection (Figure 2). Parasitemias rapidly decreased to undetectable levels 24 h after treatment with 15, whereas treatment with the same dose of artesunate (ASN) reduced parasitemias up to 5 % 8 h posttreatment increasing rapidly thereafter. To demonstrate the remarkable stability of tetraoxane 15 in both noninfected and infected red blood cells, in vitro studies were carried out to assess the percentage recovery of drug at set time points in noninfected and infected blood (Figure 3). It can be seen from this data that OZ 277 rapidly degrades in infected blood cells giving no recovery of drug after only 35 min. In sharp contrast, RKA 182 (15) shows 79 % recovery after 4 h in infected blood. In vivo pharmacokinetic analysis was also performed to demonstrate the impact of www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5831

Zuschriften

Figure 2. Speed of action of 15 (RKA 182) following a single oral dose of 30 mg kg1. Red: no drug; green: ASN 30 mg kg1; blue: RKA182 30 mg kg1.

Scheme 5. TEMPO spin-trapping of C-radical intermediates generated following 12FeII activation. R = N(CH2CH2)2NCH2iPr.

Figure 3. a) Stability of 15 in noninfected and infected red blood cells in comparison with OZ 277; blue diamonds: RKA 182 noninfected RBC; red squares: RKA 182 2 % infected RBC; light gray : OZ 277 noninfected RBC; green triangles: OZ 277 1 % infected RBC. b) Pharmacokinetic parameters in infected versus noninfected mice.

infection on the exposure profile of 15 and the data (Figure 3 b) clearly demonstrates equivalent exposure (AUC) in both infected and noninfected mice. Taken together, these data suggests 15 is more stable than OZ 277 in which malaria infection was associated with a significant reduction in drug plasma concentrations in phase II trials.[17] In order to characterize the potential mediators of the antimalarial activity of RKA 182 we performed mechanistic studies with iron(II) bromide in THF in the presence of the spin-trapping agent 2,2,6,6-tetramethyl-1-piperidine-1-oxyl (TEMPO). From these studies, we were able to intercept both the primary and secondary carbon centered radicals to produce two TEMPO adducts A and B (Scheme 5). The behavior of the tetraoxanes reported here is distinct from 1,2,4-trioxolanes since only the secondary carbon centered radical species has been characterized from OZ 277 and other 1,2,4-trioxolanes.[9] Since heme alkylation is believed to play a vital role in the mechanism of action of

Scheme 6. Heme alkylation by tetraoxane 12.

endoperoxide antimalarials[17] (Scheme 6) we examined the reactivity of 12 with ferrous heme. LCMS analysis confirmed an m/z 782.3 Da for three adducts (maximum absorption of the Soret band at 430 nm) that result from the covalent bonding of the tetraoxane-derived secondary carbon centered radical and the heme porphyrin. This process may play an important role in the molecular mechanism of action of these derivatives. In conclusion, we have identified the first water-soluble 1,2,4,5-tetraoxane drug candidate that has outstanding antimalarial activity, stability, low toxicity (see the Supporting
Angew. Chem. 2010, 122, 5829 5833

5832

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Information), and ADME properties (absorption, distribution, metabolism, and excretion) that overcome most of the problems encountered previously with the synthetic and semisynthetic antimalarial endoperoxide drugs that have progressed into preclinical development. This work firmly establishes the potential of the tetraoxane pharmacophore to provide the next generation of synthetic drugs for deployment in the control and eradication of malaria as a component of combination chemotherapy.
Received: February 18, 2010 Revised: April 7, 2010 Published online: July 13, 2010 K. McIntosh, M. Padmanilayam, J. Santo Tomas, C. Scheurer, B. Scorneaux, Y. Tang, H. Urwyler, S. Wittlin, W. N. Charman, Nature 2004, 430, 900. a) P. Olliaro, T. N. C. Wells, Clin. Pharmacol. Ther. 2009, 85, 584K; b) a second-generation 1,2,4-trioxolane OZ 439 is under development with the MMV; see http://www.mmv.org/article.php3?id_article = 528. For details of amide and amine 1,2,4,5-tetraoxacyclohexanes and steroidal tetraoxanes with antimalarial and exceptional anticancer activity see: a) I. Opsenica, D. Opsenica, K. S. Smith, olaja, J. Med. Chem. 2008, 51, 2261; W. K. Milhous, B. A. S b) G. L. Ellis, R. Amewu, S. Sabbani, P. A. Stocks, A. E. Shone, D. Stanford, P. Gibbons, J. Davies, L. Vivas, S. Charnaud, E. Bongard, C. Hall, K. Rimmer, S. L. Mara Jess, D. Gargallo, S. A. Ward, P. M. ONeill, J. Med. Chem. 2008, 51, 2170. a) R. Amewu, A. V. Stachulski, S. A. Ward, N. G. Berry, P. G. Bray, J. Davies, G. Labat, L. Vivas, P. M. ONeill, Org. Biomol. Chem. 2006, 4, 4431; b) P. Ghorai, P. H. Dussault, Org. Lett. 2009, 11, 213. G. M. Sheldrick, Acta. Crystallogr. Sect. A 2008, 64, 112. M. Smilkstein, N. Sriwilaijaroen, J. X. Kelly, P. Wilairat, M. Riscoe, Antimicrob. Agents Chemother. 2004, 48, 1803. W. Peters, S. L. Fleck, B. L. Robinson, L. B. Stewart, C. W. Jefford, Ann. Trop. Med. Parasitol. 2002, 96, 559. R. K. Haynes, B. Fugmann, J. Stetter, K. Rieckmann, H. D. Heilmann, H. W. Chan, M. K. Cheung, W. L. Lam, H. N. Wong, S. L. Croft, L. Vivas, L. Rattray, L. Stewart, W. Peters, B. L. Robinson, M. D. Edstein, B. Kotecka, D. E. Kyle, B. Beckermann, M. Gerisch, M. Radtke, G. Schmuck, W. Steinke, U. Wollborn, K. Schmeer, A. Romer, Angew. Chem. 2006, 118, 2136; Angew. Chem. Int. Ed. 2006, 45, 2082. A. Robert, J. Cazelles, B. Meunier, Angew. Chem. 2001, 113, 2008; Angew. Chem. Int. Ed. 2001, 40, 1954.

Chemie

[10]

[11]

Keywords: antimalarial agents drug development endoperoxides medicinal chemistry tetraoxanes

[12]

[1] P. M. ONeill, G. H. Posner, J. Med. Chem. 2004, 47, 2945. [2] Report of a WHO Informal Consultation, Geneva, World Health Organization, 2001 (WHO/CDS/RBM/2001.33). [3] T. K. Mutabingwa, Acta Trop. 2005, 95, 305. [4] B. M. Greenwood, K. Bojang, C. J. M. Whitty, G. A. T. Targett, Lancet 2005, 365, 1487. [5] R. K. Haynes, Curr. Opin. Infect. Dis. 2001, 14, 719. [6] A. M. Dondorp, F. Nosten, N. J. White, N. Engl. J. Med. 2009, 361, 1808. [7] a) N. J. White, J. Clin. Invest. 2004, 113, 1084; b) J. Wiesner, R. Ortmann, H. Jomaa, M. Schlitzer, Angew. Chem. 2003, 115, 5432; Angew. Chem. Int. Ed. 2003, 42, 5274. [8] C. W. Jefford, Drug Discovery Today Z 2007, 12, 487. [9] J. L. Vennerstrom, S. Arbe-Barnes, R. Brun, S. A. Charman, F. C. Chiu, J. Chollet, Y. Dong, A. Dorn, D. Hunziker, H. Matile,

[13] [14] [15] [16]

[17]

Angew. Chem. 2010, 122, 5829 5833

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5833

Zuschriften
Cellular Signaling
DOI: 10.1002/ange.201001149

Artificial Control of Cell Signaling and Growth by Magnetic Nanoparticles**


Jae-Hyun Lee, Eun Sook Kim, Mi Hyeon Cho, Mina Son, Soo-In Yeon, Jeon-Soo Shin,* and Jinwoo Cheon*
In memory of Chi Sun Hahn Mechanical stresses on biological objects can lead to changes in a wide range of cellular properties, such as cell shape, cytoskeletal organization, and cell fate, by means of physical stimulations using dielectricity, optical trapping, and magnetic cytometry.[18] In particular, micrometer-sized magnetic beads have been useful since their first utilization by Crick and Hughes to draw mechanical stresses on biological objects by developing techniques such as magnetic twisting, pulling, and cell-stretching cytometry.[58] With the use of such magnetic stimulations, the roles of mechanical stresses for cell characteristics have been studied, which include cytoplasmic viscosity, cytoskeletal mechanotransduction, and mechanical calcium responses.[510] Further scientific breakthroughs in this research field have depended on molecular-level understanding of mechanobiological processes and the induction of changes in cellular functions and/or cytoskeletal structures. The goal is to bring about single-cell or subcellular-level imaging and actuation of biological objects with high target specificity. Nanoscale probes and actuators are important because of their small sizes, which are comparable to those of many biologically meaningful molecules such as DNAs and proteins. In addition, their ability to attach multivalence func[*] J.-H. Lee,[+] M. H. Cho, Prof. J. Cheon Department of Chemistry, Yonsei University Seoul 120-749 (Korea) Fax: (+ 82) 2-364-7050 E-mail: jcheon@yonsei.ac.kr E. S. Kim,[+] M. Son, S.-I. Yeon, Prof. J.-S. Shin Department of Microbiology Institute for Immunology and Immunological Diseases College of Medicine, Yonsei University Seoul 120-752 (Korea) Fax: (+ 82) 2-392-7088 E-mail: jsshin6203@yuhs.ac [+] These authors contributed equally to this work. [**] We thank Prof. Gou Young Koh (KAIST) for recombinant Ang2 and his kind support. This research was supported by the NRL (M10600000255), Creative Research Institute (2010-0018286), WCU program, NBIT (Grant K20716000001-07A0400-00110), Nanomedical NCRC (R15-2004-024-00000-0), LG Yonam Foundation, 2nd stage BK21 for Chemistry and Medical Sciences of Yonsei University, the Korean Health 21 R&D Project (A050260) of the Ministry of Health & Welfare, the KRF Grant (KRF-2007-2-E00154), and Mid-career Researcher Program (2009-0081001) through NRF by the MEST. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001149.

tional groups would be another advantage. By employing nanoparticles, difficult challenges associated with currently used micrometer-scale magnetic particles, such as probing and manipulation of a single receptor without disturbing any other rheological or cytoskeletal properties of the entire cell, can be overcome. Recently, the groups of Ingber and Dobson have independently demonstrated that activation of ion channels is possible by using nanoscale magnetic particles.[1113] These efforts have demonstrated that FceRI, a cellular membrane receptor, can be magnetically agglomerated to activate the Ca2+ signal.[11] On the other hand, TREK-1, a membrane protein for the K+ ion channel, is specifically activated by magnetic nanoparticles with size as small as 130 nm.[13] While these two pioneering works focused on ion-channel activations, new conceptual advances and other applications of nanoscale magneto-activated cellular signaling (N-MACS) are widely open to exploration. Herein, we demonstrate for the first time that receptormediated artificial triggering of cell growth in the preangiogenesis stage is possible by the N-MACS approach. Angiogenesis is a vital process both for the growth and development of blood vessels and for tumor metastasis.[14] Conventionally, this process is initiated by several interactions that take place between specific receptors and ligands on the cell surface.[15, 16] The Tie2/angiopoietin (Ang) pair, in which one Ang molecule binds to clusterize three to five Tie2 receptors, is regarded as one of the important receptorligand interactions.[1719] This cluster formation is critical to activate multiple signaling steps and eventually participates in the angiogenic processes.[1820] Instead of using such ligands, in our study a TiMo214 monoclonal antibody (mAb)-conjugated Zn2+-doped ferrite magnetic nanoparticle (Ab-Zn-MNP) is employed to target and magnetically manipulate Tie2 receptors through the steps in Figure 1 ac. To achieve this result, two permanent NdFeB magnets are positioned to exert an external magnetic field of about 0.15 T, with horizontal magnetic field lines that are oriented in the manner shown in Figure 1 d. At this magnetic field strength, magnetization of Ab-Zn-MNPs can be saturated in plane (Figure 1 e), which induces strong attractive forces between the dipoles of neighboring nanoparticles. This phenomenon results in the aggregation of Ab-Zn-MNPs. For successful magnetic manipulation under mild external magnetic field conditions, we utilized a high-performance 15 nm Zn2+-doped ferrite magnetic nanoparticle (Zn-MNP) instead of a conventional magnetic nanoparticle, since it exhibits a very high saturation magnetization (Figure 1 e,f)
Angew. Chem. 2010, 122, 5834 5838

5834

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte

Chemie

Figure 1. ac) Targeting and magnetic manipulation of Ab-Zn-MNPs. a,b) Ab-Zn-MNPs selectively bind to the specific cell-surface Tie2 receptors. c) In the presence of an external magnetic field, the Ab-ZnMNPs are magnetized to form nanoparticle aggregates, which then induce the clustering of receptors to trigger intracellular signaling. d) Magnet setup and the simulated magnetic field. The inset shows magnetized nanoparticles on the cell surface. e) MH curve of ZnMNPs measured by using a superconducting quantum interference device (SQUID); M in emu per g magnetic atom. Zn-MNPs have a strong saturation magnetization value (ca. 160 emu per g magnetic atom) and high magnetic susceptibility (cm = 6.53 102) which saturates at low magnetic fields below 0.1 T. f) Transmission electron microscopy (TEM) image of Zn-MNPs.

superior to that of conventional nanoparticles, such as Feridex (ca. 80 emu per g magnetic atom).[21] Also, Zn-MNP has a strong magnetic susceptibility that enables fast saturation of magnetization under a magnetic field strength of about 0.1 T (Figure 1 e). The magnitude of its tensional force is calculated to be around 1017 N, which is adequate to induce only receptor clusterization, but small enough not to alter the cell shape or cytoskeletal organization.[10, 11] The Ab-Zn-MNP conjugate (4 mg) was used to treat 4 106 293-hTie2 cells,[22] modified to overexpress Tie2 from the HEK293 cell line, in a petri dish at room temperature. After 30 min, unbound nanoparticles were removed by washing and the dish was placed in a magnetic field (ca. 0.15 T) for 1 h.
Angew. Chem. 2010, 122, 5834 5838

Figure 2. Magnetism-induced aggregation of Ab-Zn-MNPs on the 293hTie2 cell surface. a) SEM images of the nanoparticles. The inset in the image on the right shows EDX spot analysis on the aggregate, which indicates a high Fe content (y in atom %) of Ab-Zn-MNPs. Nanoparticles in the SEM images are false-colored as yellow for clear visibility. b) TEM images of the nanoparticles. Nanoparticles are indicated by arrows. c) Fluorescence confocal microscopy images of nanoparticles before and after application of a magnetic field. d) Tie2 receptor-bound nanoparticles before and after application of the magnetic field.

Most of the nanoparticles were on the cell surface at this stage. The evenly dispersed Ab-Zn-MNPs on the cell surface aggregated after application of the magnetic field, as seen by scanning electron microscopy (SEM) and TEM (Figure 2 a,b). Energy-dispersive X-ray (EDX) spot analysis of the aggregates showed that there was a high content of atomic Fe, thus confirming that the aggregates are indeed magnetic nanoparticles (Figure 2 a, inset). www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5835

Zuschriften
Ab-Zn-MNP was also used as a fluorescence imaging probe after labeling with fluorescein. Application of the magnetic field to cells containing Ab-Zn-MNP/fluorescein resulted in a change of fluorescence distribution on the cell surface, from a weak and evenly dispersed green fluorescence to several bright, strongly fluorescent clumps (Figure 2 c), which suggests that clustering of both Ab-Zn-MNPs and Tie2 receptors occurs. Clustering of Tie2 receptors can induce intracellular signaling processes that lead to angiogenesis. This takes place through several downstream signaling gateways, including phosphorylation of Tie2 and further propagation to phosphorylation of Akt, Fak, RhoA, Rac1, and ERK1/2, and the formation of endothelial nitric oxide synthase (eNOS) and reactive oxygen species (ROS) (Figure 2 d, right picture).[18, 20] The formation of phosphorylated Tie2 (p-Tie2), which is the first gateway for signaling, is promoted only when cells are treated with Ab-Zn-MNPs followed by application of a magnetic field (Figure 3 ac). Western blots (Figure 3 b) show that a strong band for p-Tie2 is present only in lanes 5, 7, and 9 (boxed), which corresponds to the cells that are first treated with Ab-Zn-MNPs and then subjected to a magnetic field. In contrast, other cells, which are treated with Zn-MNP (lane 2), Ab (lane 3), and Ab-Zn-MNP but are not subjected to a magnetic field (lanes 4, 6, and 8), exhibit negligibly weak bands for p-Tie2. In the presence of a magnetic field, the relative expression of p-Tie2 is dependent on the amount of Ab-Zn-MNP used to treat the cells, and increases from 3.3 to 4.1 and 4.5 as the amount of Ab-Zn-MNP increases from 2 to 4 and 8 mg. In contrast, the expression of p-Tie2 remains almost constant when a magnetic field is not applied (Figure 3 c; also see lanes 4, 6, and 8 of Figure 3 b). Here, the ratio of Ab to Zn-MNP is strictly controlled as 1:1, to avoid multiple binding of one nanoparticle to several receptors (see the Supporting Information, Figure S4). Magnetic-field-induced downstream signaling associated with phosphorylation of Akt (p-Akt) is confirmed by using fluorescence confocal microscopy on immunofluorescentstained cells (Figure 3 df). In this procedure, Ab-Zn-MNP labeled with green-fluorescent fluorescein is used. In addition, the resulting p-Akt is labeled to emit red fluorescence by using anti-p-Akt immunoglobulin G (IgG) and its secondary antibody, Alexa 594-labeled anti-rabbit IgG. Upon application of a magnetic field, Ab-Zn-MNPs aggregate and appear as bright green fluorescing clumps (Figure 3 e, 1) and the red fluorescence indicates the phosphorylation of Akt (Figure 3 e, 2). The areas of green fluorescence overlaps nicely with areas exhibiting p-Akt red fluorescence, where the overlapped regions appear yellow (Figure 3 e, 3). This result indicates that p-Akt is abundant in the regions where Ab-Zn-MNP aggregates are present. In contrast, when a magnetic field is not applied, the aggregation of Ab-Zn-MNPs or p-Akt is not observed (Figure 3 f). In addition, the formation of ROS, another signaling product, is also observed by using fluorescence confocal microscopy only when the external magnetic field is applied (Supporting Information, Figure S5). The combined results provide strong evidence that aggregation of magnetic nanoparticles takes place when an external mag-

Figure 3. Intracellular signaling propagations induced by N-MACS. a) Phosphorylation of Tie2 (p-Tie2). b) Western blot analysis of 293-hTie2 cells which are stained with antibodies specific for p-Tie2 and Tie2; lane 1: control (293-hTie2 cell only), lane 2: bare Zn-MNP treated, lane 3: antibodyonly treated, lanes 49: Ab-Zn-MNP treated without a magnetic field () or with a magnetic field (+). c) Relative expression of p-Tie2 versus the amount of Ab-Zn-MNP with or without application of an external magnetic field (three measurements; error bar: standard deviation). d) Phosphorylation of Akt (p-Akt). Fluorescence confocal microscopy images of cell cytoplasm after application of a magnetic field (e) and in the absence of a magnetic field (f), in which 1) Ab-Zn-MNP is labeled with fluorescein and 2) p-Akt is immunostained with anti-p-Akt IgG and antirabbit IgGAlexa 594.

5836

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5834 5838

Angewandte

Chemie

Figure 4. N-MACS on tubulogenesis of HUVECs at different time points after treatment with Ab-Zn-MNPs and application of a magnetic field (a d) or without application of a magnetic field (eh). Insets are magnified images of HUVECs, which are colored according to cell height from the bottom. i) Tube formation length of HUVECs with/without an external magnetic field (three measurements; error bar: standard deviation). Relative changes of tube length are shown in arbitrary units (*: P < 0.0001).

netic field is applied and that this process induces clustering of Tie2 receptors, which then triggers phosphorylation of Tie2 and further propagation of downstream signaling processes. The study was extended to explore whether Tie2 receptor clusterization can initiate angiogenesis in the human umbilical vein endothelial cell (HUVEC), which is the main component comprising blood vessels that are known to possess a significant amount of Tie2 receptors.[23] The AbZn-MNP (8 mg) was applied to HUVECs for 1 h at room temperature. After washing to remove unbound nanoparticles, a magnetic field of 0.15 T was applied in the same manner as in the 293-hTie2 cell experiments. The change of cellular morphology was examined by using differential interference contrast (DIC) microscopy for different times (0, 6, 9, and 12 h). Initially, the cells have polygonal shapes and adhere to one another (Figure 4 a,e, insets). When the cells are exposed to a magnetic field for 1 h, their shapes begin to progressively change to capillary-like tubular structures, which become abundant after 9 h of magnetic field application (Figure 4 a d). The shape transformation that takes place in HUVECs is commonly called tubulogenesis, which represents the preangiogenic stage eventually leading to blood vessel formation. In contrast, when a magnetic field is not applied, the shape change of the HUVECs is much slower (Figure 4 eh). This observation is quantified by measuring the length of tubes where the relative length to the initial cell size changes from 0 to 15.4, 23.3, and 28.7 as time increases (Figure 4 i). These results clearly indicate that Tie2 signaling pathways in HUVECs are triggered by N-MACS and artificial angiogenesis is possible. While some natural ligands such as angiopoietins can also induce similar effects, the N-MACS technique has unique advantages associated with the fact that it can be initiated
Angew. Chem. 2010, 122, 5834 5838

remotely, noninvasively, and with temporal control. In addition, the methodology can be universally applied to various biological signaling processes.
Received: February 25, 2010 Published online: July 6, 2010

Keywords: angiogenesis cellular signaling magnetic properties nanoparticles receptors

[1] P. Fromherz, A. Offenhausser, T. Vetter, J. Weis, Science 1991, 252, 1290 1293. [2] T. H. Young, C. R. Chen, Biomaterials 2006, 27, 3361 3367. [3] J. Dai, M. P. Sheetz, Biophys. J. 1995, 68, 988 996. [4] C. S. Chen, M. Mrksich, S. Huang, G. M. Whitesides, D. E. Ingber, Biotechnol. Prog. 1998, 14, 356 363. [5] F. H. C. Crick, A. F. W. Hughes, Exp. Cell Res. 1950, 1, 37 80. [6] P. A. Valberg, H. A. Feldman, Biophys. J. 1987, 52, 551 569. [7] N. Wang, J. P. Butler, D. E. Ingber, Science 1993, 260, 1124 1177. [8] M. Glogauer, J. Ferrier, C. A. McCulloch, Am. J. Physiol. Cell Physiol. 1995, 269, C1093 C1104. [9] A. R. Bausch, W. Moller, E. Sackmann, Biophys. J. 1999, 76, 573 579. [10] S. Na, O. Collin, F. Chowdhury, B. Tay, M. Ouyang, Y. Wang, N. Wang, Proc. Natl. Acad. Sci. USA 2008, 105, 6626 6631. [11] R. J. Mannix, S. Kumar, F. Cassiola, M. Montoya-Zavala, E. Feinstein, M. Prentiss, D. E. Ingber, Nat. Nanotechnol. 2008, 3, 139 143. [12] J. Dobson, Nat. Nanotechnol. 2008, 3, 139 143. [13] S. Hughes, S. McBain, J. Dobson, A. J. El Haj, J. R. Soc. Interface 2008, 5, 855 863 [14] L. Coultas, K. Chawengsaksophak, J. Rossant, Nature 2005, 438, 937 945. [15] P. Carmeliet, Nature 2005, 438, 932 936. [16] G. D. Yancopoulos, S. Davis, N. W. Gale, J. S. Rudge, S. J. Wiegand, J. Holash, Nature 2000, 407, 242 248.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5837

Zuschriften
[17] P. C. Maisonpierre, C. Suri, P. F. Jones, S. Bartunkova, S. J. Wiegand, C. Radziejewski, D. Compton, J. McClain, T. H. Aldrich, N. Papadopoulos, T. J. Daly, S. Davis, T. N. Sato, G. D. Yancopoulos, Science 1997, 277, 55 60. [18] L. Eklund, B. R. Olsen, Exp. Cell Res. 2006, 312, 630 641. [19] W. A. Barton, D. Tzvetkova-Robev, E. P. Miranda, M. V. Kolev, K. R. Rajashankar, J. P. Himanen, D. B. Nikolov, Nat. Struct. Mol. Biol. 2006, 13, 524 532. [20] R. Harfouche, N. A. Malak, R. P. Brandes, A. Karsan, K. Irani, S. N. A. Hussain, FASEB J. 2005, 19, 1728 1730. [21] J.-t. Jang, H. Nah, J.-H. Lee, S. H. Moon, M. G. Kim, J. Cheon, Angew. Chem. 2009, 121, 1260 1264; Angew. Chem. Int. Ed. 2009, 48, 1234 1238. [22] R. R. White, S. Shan, C. P. Rusconi, G. Shetty, M. W. Dewhirst, C. D. Kontos, B. A. Sullenger, Proc. Natl. Acad. Sci. USA 2003, 100, 5028 5033. [23] C. William, P. Koehne, J. S. Jrgensen, M. Grfe, K. D. Wagner, S. Bachmann, U. Frei, K.-U. Eckardt, Circ. Res. 2000, 87, 370 377.

5838

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5834 5838

Angewandte
DOI: 10.1002/ange.201001332

Chemie

DNA Unwinding

A Graphene-Based Platform for the Assay of Duplex-DNA Unwinding by Helicase**


Hongje Jang, Young-Kwan Kim, Hyun-Mi Kwon, Woon-Seok Yeo, Dong-Eun Kim, and Dal-Hee Min*
Helicases are an important class of enzymes that unwind double-stranded nucleic acids into single-stranded ones using energy from nucleoside triphosphate (NTP) hydrolysis.[1] They have been implicated in both virus replication and cellular processes that require single-stranded nucleic acids, including DNA replication, repair, and transcription.[2] Because of their critical role in viral replication and proliferation, helicases have been targeted for therapy in many viral diseases.[3] In fact, viral helicase inhibitors have been shown to be successful drug candidates in the treatment of hepatitis C and herpes simplex virus infection.[4] Therefore, the development of a simple, fast, and cost-effective platform is important for the assay of the nucleic acid unwinding activity of helicases. A conventional method for assessing the DNA or RNA unwinding activity of helicase involves substrates that are double-stranded nucleic acids, one of which is radiolabeled with 32P. The degree of substrate unwinding by helicase can be estimated by using polyacrylamide gel electrophoresis (PAGE) and subsequent visualization of the radioisotope.[5] However, the conventional assay is time-consuming and inefficient because of the lengthy preparation time for radiolabeled substrates, which have limited shelf life, and for running PAGE. In addition, the assay method assumes that unwound single-stranded DNA (ssDNA) will not undergo reannealing to the complementary strand and that any reannealed double-stranded DNA (dsDNA), which consists of trap DNA and previously unwound complementary DNA, will not participate in the helicase reaction as substrate.[6] Overall, the conventional assay method is not adequate for multiple-turnover helicase reactions or parallel activity screenings. To date, several other strategies for the assay of helicase activity have been developed, based on enzymelinked immunosorbent assay (ELISA),[7] fluorescence resonance energy transfer (FRET),[8] or chemiluminescence.[9] These newer approaches partly overcome the limitations of the conventional assay but still possess undesirable features, such as high cost and laborious procedure, which prohibit their routine implementation. Herein, we report a platform for the assay of helicase unwinding activity that relies on the preferential binding of graphene oxide (GO) to ssDNA over dsDNA, thereby quenching the fluorescence of dyes that are conjugated to ssDNA. Previously, GO was reported to interact strongly with nucleotides through p-stacking interaction between the ring structures in the nucleobases and the hexagonal cells of GO, whereas dsDNA cannot be stably adsorbed onto the GO surface because of efficient shielding of nucleobases within the negatively charged phosphate backbone of dsDNA.[10] In addition, GO is known to efficiently quench the fluorescence of nearby organic dyes.[11] The helicase assay based on GO starts with the preparation of a dsDNA substrate containing a fluorescent dye at the end of one strand. To initiate the helicase reaction, helicase is added to a mixture of dsDNA and GO in which the dsDNA exhibits intense fluorescence. As the helicase-induced unwinding of dsDNA proceeds, the fluorescence decreases because of strong interaction of GO with unwound ssDNA, which results in fluorescence quenching by GO (Figure 1).

[*] H. Jang, Y.-K. Kim, Prof. Dr. D.-H. Min Department of Chemistry, Institute for the BioCentury Korea Advanced Institute of Science and Technology (KAIST) 373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701 (Korea) Fax: (+ 82)-42-350-2810 E-mail: dalheemin@kaist.ac.kr H.-M. Kwon, Prof. Dr. W.-S. Yeo, Prof. Dr. D.-E. Kim Department of Bioscience and Biotechnology Konkuk University Seoul 143-701 (Korea) [**] This work was supported by the Basic Science Research Program and Mid-career Researcher Program through the National Research Foundation of Korea (NRF) funded by the Korean government (the Ministry of Education, Science, and Technology, MEST; grant nos. 313-2008-2-C00538, 2008-0062074, and 2009-0071058), by the Nano R&D program (2008-2004457) and WCU Project (R3310128), and by the National Honor Scientist Program. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001332.
Angew. Chem. 2010, 122, 5839 5843

Figure 1. GO-based system for the assay of helicase unwinding activity.

To demonstrate our strategy, we used severe acute respiratory syndrome coronavirus (SARS-CoV, SCV) helicase nsP13.[12] SARS is a fatal infectious disease that develops flulike symptoms and has a high mortality rate. SCV helicase has been recognized as a potential target for the development of antiviral drugs against SARS.[13] A dsDNA substrate of SCV helicase was designed based on a previous report.[14]

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5839

Zuschriften
We first prepared GO according to a modified Hummers method.[15] To confirm the successful formation of a singlelayered GO sheet, the prepared GO was analyzed by atomic force microscopy (AFM). The sheet width and thickness (height) of GO were approximately 0.13 mm (with a few sheets larger than 4 mm) and 1.4 nm, respectively (Figure 2 a,b).[16] The chemical structure of GO was characterized

Figure 3. FAM fluorescence quenching by GO. a) Fluorescence spectra of F-dsDNA (c) and F-ssDNA (b) after incubation with GO for 10 min. A high degree of fluorescence quenching was observed in FssDNA, compared to F-dsDNA, in the presence of GO. b) Fluorescence intensities of F-ssDNA (*) and F-dsDNA (*) in the presence of GO measured at 520 nm at various time intervals. Quenching of fluorescence occurred over time and ca. 92 % of the quenching was achieved within the first 10 min. Figures S1 and S2 in the Supporting Information show the results of experiments that were performed to find the optimum concentrations of GO and F-dsDNA.

Figure 2. Characterization of GO. a) AFM image and b) height profile of GO showing the dimensions of prepared GO as 0.13 mm in width and ca. 1.4 nm in height. c) IR and d) Raman spectra of GO, which present characteristic peaks corresponding to oxygen-containing functional groups and disordered sp2 structures in GO, respectively.

by both IR and Raman spectroscopy. Several characteristic peaks of functional groups containing oxygen were observed in the IR spectrum of GO, including peaks at 1716 and 1079 cm1 that resulted from C=O and CO stretching, respectively (Figure 2 c). Strong D-band absorption at 1350 cm1 appeared in the Raman spectrum of GO (Figure 2 d). Taken together, these data support the premise that single-layered GO sheets were successfully prepared. We next used the dye fluorescein amidite (FAM) attached to ssDNA (F-ssDNA) and demonstrated that fluorescence quenching occurs upon binding of F-ssDNA to the GO surface. Separate mixtures containing GO (0.5 mg mL1) and either annealed F-dsDNA or F-ssDNA were prepared in helicase reaction buffer (pH 8.0 buffer containing 50 mm Tris HCl, 50 mm NaCl, 0.25 mm ethylenediaminetetraacetic acid (EDTA), 0.65 mm MgCl2, and 10 % glycerol), and the fluorescence emission spectra of the mixtures were then measured over time. The F-dsDNA showed strong fluorescence around 520 nm, regardless of the presence of GO. However, a mixture of F-ssDNA and GO showed up to % 92 % quenching of fluorescence after 10 minutes at room temperature, as a result of the interaction of GO with ssDNA (Figure 3 a). The dsDNA is expected to have repulsive interaction with GO because of the negative charges on GO (zeta potential of GO: 24.89 mV) and the negatively charged phosphate backbone of DNA. Quenching of fluores-

cence did take place over time in the F-dsDNA mixture, but the fluorescence reached a plateau at a relatively high level after 10 minutes (Figure 3 b). In contrast, GO quenched nearly all of the fluorescence of F-ssDNA because of its selective interaction with ssDNA as compared to dsDNA under the experimental conditions employed. We then measured SCV helicase activity using F-dsDNA as a substrate in the presence of GO, with various concentrations of the helicase. Mixtures of F-dsDNA, GO, and SCV helicase in reaction buffer containing adenosine 5-triphosphate (ATP, 10 mm ) were prepared and incubated at 37 8C. The fluorescence emission at 520 nm was measured at various time intervals. As expected, the degree of F-dsDNA unwinding by helicase depended on the helicase concentration (Figure 4 a). To confirm that the fluorescence quenching resulted from F-dsDNA unwinding by helicase, the concentration of ATPan energy source for helicase activitywas varied, while the concentration of helicase was kept constant

Figure 4. F-dsDNA unwinding activity assays were performed with various concentrations of a) SCV helicase and b) ATP. a) [Helicase] (in nm): * 0; * 0.625; ! 1.25; ~ 2.5; & 5; & 10. b) [ATP] (in mm): * 0; * 0.1; ! 0.5; ~ 1; & 2; & 5; ^ 10. Unwinding activity was dependent on the concentrations of helicase and ATP, as expected. The GO-based platform made feasible quantitative measurements of helicase reactions with excess amounts of substrate (100 nm). Fluorescence spectra corresponding to all the data points are shown in Figures S3 and S4 in the Supporting Information.
Angew. Chem. 2010, 122, 5839 5843

5840

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
at 10 nm . Helicase activity did indeed increase as the ATP concentration was raised (Figure 4 b). Next, we performed assays of helicase inhibition to demonstrate that the present method is quantitative and robust enough for general applications, including inhibitor assays. Two compounds, 5-adenylimidodiphosphate (AMPPNP) and doxorubicin (also known as hydroxydaunorubicin), were chosen as model inhibitors of helicase. AMP-PNP, a nonhydrolyzable ATP analogue, was previously reported to inhibit helicase activity by competing for the ATP binding site.[17] Doxorubicin, an anticancer agent, intercalates with duplex DNA, thereby slowing down the unwinding of dsDNA.[18] We began with reaction mixtures containing helicase (10 nm ), F-dsDNA (100 nm ), GO (1 mg mL1), ATP (10 mm ), and various concentrations of the inhibitors in helicase reaction buffer. In the case of doxorubicin, mixtures of F-dsDNA and doxorubicin were prepared and incubated for 20 minutes at room temperature, prior to mixing with the other reagents, to ensure the intercalation of doxorubicin with F-dsDNA without interference from the other components. The change in fluorescence intensity at 520 nm was then measured for 30 minutes at 37 8C for each of the reaction mixtures. The half maximal inhibitory concentration (IC50) values of AMP-PNP and doxorubicin were found to be 480.9 and 31.3 mm , respectively (Figure 5 a,b). To perform highthroughput screening of inhibitors, it would be efficient to be able to measure helicase activities from fluorescence images of multiwell plates containing multiple reaction mixtures. To demonstrate the feasibility of parallel assays, the inhibition assays were carried out in a 96-well plate for 30 minutes at 37 8C, and fluorescence images were obtained from the reaction mixtures in the plate using an IVIS imaging system (Xenogen, Alameda, CA, USA). The inhibition of helicase activity by AMP-PNP and doxorubicin was clearly visualized, and dose dependency was distinctly observable in the fluorescence images (Figure 5 c). Finally, we performed a conventional helicase assay using 32 P-labeled dsDNA for direct comparison with the present assay. The 32P-labeled dsDNA substrate was first prepared using [g-32P]ATP and T4 polynucleotide kinase, followed by annealing, according to established procedure. The reaction mixture containing 32P-labeled dsDNA (10 nm ), helicase (100 nm ), and trap DNA (10 mm ) was prepared in a reaction buffer. Trap DNA (unlabeled bottom-strand DNA) was required in excess to prevent the reannealing of the unwound, labeled DNA products. Aliquots were taken after 10 and 30 minutes, quenched by adding the quench buffer (100 mm EDTA at pH 8.0, 0.4 % sodium dodecyl sulfate, 20 % (v/v) glycerol, and 1 % bromophenol blue) and analyzed immediately by electrophoresis in nondenaturing 10 % polyacrylamide gel (Figure 6 a, top). As a control, heat-denatured DNA was prepared in the presence of trap DNA and included in the gel. The gel image obtained by a phosphorimager gives the relative amounts of dsDNA and ssDNA in each sample. Basically, the gel-based assay is an endpoint assay that can be analyzed only after the reaction is terminated. This feature makes the gel-based assay inappropriate for real-time kinetics studies. The data also illustrate the requirement for trap DNA

Chemie

Figure 5. Dose-dependent inhibition of helicase reactions was carried out using the GO-based method. a,b) Inhibition of helicase by a) AMPPNP (nonhydrolyzable ATP derivative) and b) doxorubicin (anthracycline anticancer agent) was observed and IC50 values were obtained. c) Fluorescence images of the reaction mixtures of helicase, F-dsDNA, and GO were obtained in the absence and presence of the inhibitors. The image in the first row shows that duplex-DNA unwinding is dependent on the helicase concentration. Quantitative inhibition assays were also performed with AMP-PNP and doxorubicin using a fluorescence imager, and demonstrated that a high-throughput assay is readily feasible (second and third rows).
Angew. Chem. 2010, 122, 5839 5843

Figure 6. Comparison of a conventional 32P-based helicase assay and the GO-based assay. a) Native-gel shift assay of helicase unwinding of dsDNA substrate was performed by resolving unwound DNA on a native PAGE and visualizing with a phosphorimager. Lane 1: substrate dsDNA; lane 2: heat-denatured control; lanes 3 and 5: unwinding reaction for 10 min; lanes 4 and 6: unwinding reaction for 30 min. The data illustrate the requirement for trap DNA in the conventional assay. The PAGE-based assay is a kind of endpoint assay, whereas the GObased assay is performed in real time. Top: GO-based assay of helicase unwinding of dsDNA substrate was performed for comparison with conventional assay. Bottom: Fluorescence was completely quenched within 10 min. b) Inhibition of helicase by AMP-PNP was quantitatively measured as the helicase concentration changed. The GO-based assay made helicase inhibition kinetics straightforward, since this assay is based on quantitative and real-time measurements.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5841

Zuschriften
because equal time periods of unwinding did not exhibit the same amount of unwound product (ssDNA) in the presence, versus the absence, of trap DNA. In contrast, the present GObased method (Figure 6 a, bottom) shows that unwinding of dsDNA was completed within 10 minutes under similar conditions even in the absence of trap DNA. This result indicates that the GO-based method substantiates a condition for preventing reannealing of the unwound ssDNA by capturing the displaced ssDNA efficiently. Reannealing of the unwound ssDNA causes less accumulation of ssDNA products at a given time than that performed in the presence of an appropriate trap molecule. Thus, the absence of trap DNA is not adequate to reflect accumulation of ssDNA products. More importantly, the conventional gel-based DNA unwinding assay is simply an all-or-none method that reports only the completely unwound ssDNA product, whereas the GO method can report progress of dsDNA unwinding in real time. Because an excess of trap DNA is needed for precise measurement in the conventional assay method, the cost of the assay is increased substantially, thus hampering the use of parallel assays and multiple samples. In contrast, the present method is a fluorescence-based assay, which can be monitored in real time under various reaction conditions. To illustrate the power of this method, the kinetics of helicase inhibition, with AMP-PNP as inhibitor, was measured by following the fluorescence intensity, as a function of time, of reaction mixtures containing various concentrations of helicase and AMP-PNP. Based on our assay method, the relative rates of unwinding of dsDNA by helicase could be calculated (Figure 6 b). The GO-based assay platform allows quantitative measurement of helicase activity in real time, thus making it more applicable to studies of helicase inhibition kinetics than the conventional gel-based assay. In conclusion, we have developed a new GO-based platform for the assay of duplex-DNA unwinding activity. To the best of our knowledge, this work is the first to utilize GO for an enzyme activity assay. The GO-based platform has several advantages over the conventional method. First, the helicase activity can be monitored in real time by following the change in fluorescence, without requiring any additional steps or reagents. Second, the GO-based assay is costeffective compared to the conventional assay, which demands expensive isotope labeling and trap DNA. The GO, a critical component in the present method, can be prepared in large quantities from graphite available at very low cost. Third, the prepared GO has a much longer shelf life than 32P, which has a half-life of only 14 days. Under ambient conditions, GO can be stored for months in the form of a suspended aqueous solution, or considerably longer in powder form. Fourth, the present method makes high-throughput screening feasible. As shown in Figure 5, fluorescence imaging of multiple samples makes possible parallel assays, without the need for any further purification or resolving steps. Therefore, this platform can be easily applied to any high-throughput analysis system. We expect that this method will be readily applicable to any research involving duplex-DNA unwinding, and to the screening of helicase inhibitors as drug candidates in antivirus therapy. Such studies will benefit from the methods quantitativeness, cost-effectiveness, and technical simplicity.

Experimental Section
The GO sheets were prepared according to previously reported methods.[15] SARS-CoV helicase was overexpressed in Escherichia coli and purified as described previously.[19] Then upper-strand DNA (12 mL, 10 mm ; 5-TTT TTT TTT TTT TTT GAG CGG ATT ACT ATA CTA CAT TAG AAT TCC-3, Genotech, Seoul, Korea) and fluorescent-dye-conjugated bottom-strand DNA (6 mL, 10 mm ; 5FAM-GGA ATT CTA ATG TAG TAT AGT AAT CCG CTC-3, Genotech) were mixed and annealed in pH 8.0 buffer containing 50 mm TrisHCl and 50 mm NaCl (1 buffer). Substrate solution was prepared by mixing annealed substrate (0.2 mm ), EDTA (0.5 mm ; BioRad, Hercules, CA, USA), ATP disodium (20 mm ; SigmaAldrich, St. Louis, MO, USA), and MgCl2 (1.3 mm ; Junsei, Tokyo, Japan) in 1 buffer containing 10 % glycerol solution. GO solution was prepared in 1 buffer (1 mg mL1); the substrate solution (30 mL) and GO solution (30 mL) were mixed, and then the helicase reaction was initiated by addition of various amounts of helicase stock solution (200 nm ). After the addition of helicase, the fluorescence intensity was measured by using a Synergy Mx fluorometer (BioTek, Potton, UK) at 520 nm for 30 min. Received: March 5, 2010 Revised: April 19, 2010 Published online: July 7, 2010

Keywords: biosensors DNA fluorescence spectroscopy graphene viruses

[1] a) A. J. van Brabant, R. Stan, N. A. Ellis, Annu. Rev. Genomics Hum. Genet. 2000, 1, 409; b) S. S. Velankar, P. Soultanas, M. S. Dillingham, H. S. Subramanya, D. B. Wigley, Cell 1999, 97, 75; c) D. E. Kim, M. Narayan, S. S. Patel, J. Mol. Biol. 2002, 321, 807; d) M. R. Singleton, M. R. Sawaya, T. Ellenberger, D. B. Wigley, Cell 2000, 101, 589. [2] a) W. L. de Laat, N. G. Jaspers, J. H. Hoeijmakers, Genes Dev. 1999, 13, 768; b) T. Lindahl, R. T. Wood, Science 1999, 286, 1897. [3] a) A. D. Kwong, B. G. Rao, K. T. Jeang, Nat. Rev. Drug Discovery 2005, 4, 845; b) C. S. Crumpacker, P. A. Schaffer, Nat. Med. 2002, 8, 327; c) P. S. Jones, Antiviral Chem. Chemother. 1998, 9, 283; d) D. N. Frick, Drug News Perspect. 2003, 16, 355; e) X. G. Xi, Curr. Med. Chem. 2007, 14, 883. [4] a) G. Kleymann, R. Fischer, U. A. K. Betz, M. Hendrix, W. Bender, U. Schneider, G. Handke, P. Eckenberg, G. Hewlett, V. Pevzner, J. Baumeister, O. Weber, K. Henniger, J. Keldenich, A. Jensen, J. Kolb, U. Bach, A. Popp, J. Maben, I. Frappa, D. Haebich, O. Lockhoff, H. Rubsamen-Waigmann, Nat. Med. 2002, 8, 392; b) J. J. Crute, C. A. Grygon, K. D. Hargrave, B. Simoneau, A. M. Faucher, G. Bolger, P. Kibler, M. Liuzzi, M. G. Cordingley, Nat. Med. 2002, 8, 386. [5] P. Borowski, A. Niebuhr, O. Mueller, M. Bretner, K. Felczak, T. Kulikowski, H. Schmitz, J. Virol. 2001, 75, 3220. [6] The trap DNA is a ssDNA lacking any fluorescent or radioisotope label, which is complementary to the displaced strand of DNA. Trap DNA is generally added in excess to the helicase reaction mixture to prevent reannealing of unwound, labeled DNA, which would result in going back to substrate dsDNA. See R. L. Eoff, K. D. Raney, Nat. Struct. Mol. Biol. 2006, 13, 242. [7] a) C. C. Hsu, L. H. Hwang, Y. W. Huang, W. K. Chi, Y. D. Chu, D. S. Chen, Biochem. Biophys. Res. Commun. 1998, 253, 594; b) O. Artsaenko, K. Tessmann, M. Sack, D. Haussinger, T. Heintges, J. Gen. Virol. 2003, 84, 2323. [8] I. Rasnik, S. Myong, T. Ha, Nucleic Acids Res. 2006, 34, 4225. [9] a) K. D. Raney, L. C. Sowers, D. P. Millar, S. J. Benkovic, Proc. Natl. Acad. Sci. USA 1994, 91, 6644; b) L. T. Zhang, G. Schwartz, M. ODonnell, R. K. Marrison, Anal. Biochem. 2001, 293, 31.
Angew. Chem. 2010, 122, 5839 5843

5842

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[10] S. He, B. Song, D. Li, C. Zhu, W. Qi, Y. Wen, L. Wang, S. Song, H. Fang, C. Fan, Adv. Funct. Mater. 2010, 20, 453. [11] a) N. Varghese, U. Mogera, A. Govindaraj, A. Das, P. K. Maiti, A. K. Sood, C. N. R. Rao, ChemPhysChem 2009, 10, 206; b) Z. Liu, J. T. Robinson, X. Sun, H. Dai, J. Am. Chem. Soc. 2008, 130, 10876; c) R. S. Swathi, K. L. Sebastian, J. Chem. Phys. 2008, 129, 054703; d) R. S. Swathi, K. L. Sebastian, J. Chem. Phys. 2009, 130, 086101. [12] a) A. Bernini, O. Spiga, V. Venditti, F. Prischi, L. Bracci, J. D. Huang, J. A. Tanner, N. Niccolai, Biochem. Biophys. Res. Commun. 2006, 343, 1101; b) V. Thiel, K. A. Ivanov, A. Putics, T. Hertzig, B. Schelle, S. Bayer, B. Weissbrich, E. J. Snijder, H. Rabenau, H. W. Doerr, A. E. Gorbalenya, J. Ziebuhr, J. Gen. Virol. 2003, 84, 2305; c) J. A. Tanner, R. M. Watt, Y. B. Chai, L. Y. Lu, M. C. Lin, J. S. M. Peiris, L. L. M. Poon, H. F. Kung, J. D. Huang, J. Biol. Chem. 2003, 278, 39578. [13] a) J. D. Huang, B. J. Zheng, H. Z. Sun, Hong Kong Med. J. 2008, 14, 36; b) N. Yang, J. A. Tanner, Z. Wang, J. D. Huang, B. J. Zheng, N. Y. Zhu, H. Z. Sun, Chem. Commun. 2007, 4413. [14] Y. J. Jeong, M. K. Levin, S. S. Patel, Proc. Natl. Acad. Sci. USA 2004, 101, 7264. [15] L. J. Cote, F. Kim, J. X. Huang, J. Am. Chem. Soc. 2009, 131, 1043. [16] a) Z. Luo, Y. Lu, L. A. Somers, A. T. C. Johnson, J. Am. Chem. Soc. 2009, 131, 898; b) S. Gilje, S. Han, M. Wang, K. L. Wang, R. B. Kaner, Nano Lett. 2007, 7, 3394; c) N. I. Kovtyukhova, P. J. Ollivier, B. R. Martin, T. E. Mallouk, S. A. Chizhik, E. V. Buzaneva, A. D. Gorchinskiy, Chem. Mater. 1999, 11, 771; d) H. C. Schniepp, J. L. Li, M. J. McAllister, H. Sai, M. H. Alonso, D. H. Adamson, R. K. Prudhomme, R. Car, D. A. Saville, I. A. Aksay, J. Phys. Chem. B 2006, 110, 8535. [17] a) M. Minczuk, J. Piwowarski, M. A. Papworth, K. Awiszus, S. Schalinski, A. Dziembowski, A. Dmochowska, E. Bartnik, K. Tokatlidis, P. P. Stepien, P. Borowski, Nucleic Acids Res. 2002, 30, 5074; b) K. A. Ivanov, V. Thiel, J. C. Dobbe, Y. V. D. Meer, E. J. Snijder, J. Ziebuhr, J. Virol. 2004, 78, 5619. [18] N. R. Bachur, F. Yu, R. Johnson, R. Hickey, Y. Wu, L. Malkas, Mol. Pharm. 1992, 41, 993. [19] K. J. Jang, N. R. Lee, W. S. Yeo, Y. J. Jeong, D. E. Kim, Biochem. Biophys. Res. Commun. 2008, 366, 738.

Chemie

Angew. Chem. 2010, 122, 5839 5843

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5843

Zuschriften
Biosensors
DOI: 10.1002/ange.201001428

A Graphene Oxide Based Immuno-biosensor for Pathogen Detection**


Jae Hwan Jung, Doo Sung Cheon, Fei Liu, Kang Bum Lee, and Tae Seok Seo*
The development of novel biosensors for highly sensitive, selective, and rapid pathogen detection is of paramount importance for medical diagnostics, food safety screening, and environmental pollution monitoring. Graphene oxide (GO), which is well known as a promising precursor for graphene, has great potential for use in biosensors because of its unique characteristics such as facile surface modification,[1] high mechanical strength,[2] good water dispersibility,[3] and photoluminescence.[4] Recently, Lu et al., and Liu et al. demonstrated the usefulness of the fluorescence quenching properties of GO in DNA biosensing.[5] Gold nanoparticles (AuNPs) have been shown to be excellent quenchers for organic fluorescent tags,[6] semiconductor nanocrystals,[7] and oxidized carbon nanotubes.[8] Herein, we demonstrate a GO-based immuno-biosensor for detecting a rotavirus as a pathogen model. The detection occurs with high sensitivity and selectivity by GO photoluminescence quenching induced by fluorescence resonance energy transfer (FRET) between GO sheets and AuNPs. A GO-based immuno-biosensor system is shown in Figure 1. GO, which was synthesized by a modified Hummers method, was deposited on an amino-modified glass surface.[9] The disruption of the sp2 structure of graphene crystals during the oxidation process results in the recombination of electronhole pairs localized within small sp2 carbon domains that are embedded in an sp3 matrix, thus resulting in photoluminescence with a quantum yield of 70.3 % relative to the fluorescein dye.[10] A homogenous solution of GO shows a broad fluorescence emission peak around 547 nm upon excitation at 400 nm (Figure S1a, b in the Supporting Information). Since the GO has negatively charged functional groups such as carboxylic acids, hydroxy groups, and epoxides,[11] the GO sheets are bound to the positive surface through an electrostatic interaction, which is strong enough to ensure that the GO sheets are retained during a washing step.
[*] J. H. Jung, F. Liu, Prof. T. S. Seo Department of Chemical and Biomolecular Engineering Korea Advanced Institute of Science and Technology (KAIST) 373-1, Guseong-dong, Yuseong-gu Daejeon, 305-701 (Republic of Korea) Fax: (+ 82) 42-350-3910 E-mail: seots@kaist.ac.kr Dr. D. S. Cheon, K. B. Lee Division of Enteric and Hepatitis Viruses Korea Centers for Disease Control and Prevention (KCDC) 5, Nokbun-dong, Eunpyung-gu, Seoul, 122-701 (Republic of Korea) [**] This work was supported by Korean Ministry of Environment as The Eco-Technopia 21 project. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001428.

Figure 1. Illustration of a GO-based immuno-biosensor.

The antibodies for rotavirus are immobilized on the GO array by a carbodiimide-assisted amidation reaction, and the rotavirus cell is captured by specific antigenantibody interaction (Figure 1). The capture of a target cell was verified by observing the fluorescence quenching of GO by FRET between the GO and AuNPs. To realize such a novel GO immuno-biosensor, we first synthesized AuNP-linked antibodies (Ab-DNA-AuNP complexes; Figure S2 in the Supporting Information) which were bridged with 100-mer singlestranded DNA molecules. The DNA molecule was used as a mediator as the synthetic method, which is based on phosphoramidite chemistry, provides facile control of distance between Ab and AuNPs, so the AuNPs are placed close to the GO surface. The high affinity of amino functional groups of the DNA nucleotides for multiple AuNPs leads to an enhancement of the quenching efficiency of GO.[12] When the Ab-DNA-AuNP complexes were selectively bound to the target cells that were attached to the GO arrays, a reduction in the fluorescence emission of GO by quenching was detected, thus enabling the identification of pathogenic target cells. AFM analysis was performed to obtain the topographical profile for each step during the fabrication of GO immunobiosensor (Figure 2). GO sheets ranging from 500 nm to 2 mm in lateral dimension (Figure S1b in the Supporting Information) were dispersed uniformly as mono- and bilayers, which were determined by measuring the height (1.1 nm) between the two black marks in Figure 2 a. The antibody-linked GO array shows brighter spots, particularly at the edges, and also folded structures, which contain many carboxylic acid groups.[11] The measured height of 11.9 nm corresponds to the theoretical value of an antibody (1015 nm) and approximately 15.3 % area per spot was linked by antibodies.[13] Once the target rotavirus was captured, the height of the complexes increased to approximately 81 nm. Considering that the size
Angew. Chem. 2010, 122, 5844 5847

5844

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
fluorescence intensities of quadruplicate spots were reduced as the molar ratio of Ab to AuNPs increased (Figure 3 a), whereas the bright fluorescence emission signal is that of the pristine GO. The negatively charged GO surface and the immobilized Ab assisted in preventing any associated nonspecific binding of Ab-DNA-AuNP complexes. When the

Chemie

Figure 2. AFM images (top) and height profile (taken along the white line in the AFM images; bottom) of the GO based immunoassay: a) Pristine GO sheets; b) Ab-immobilized GO sheets; c) Abrotavirus linked GO sheets; and d) Ab-DNA-AuNP complexes linked to the target cells on the GO sheets.

of a rotavirus ranges from 70 to 100 nm, the height profile in Figure 2 c confirms the specific cell capture on the GO array. When the Ab-DNA-AuNP complex was synthesized with an Ab/AuNP molar ratio of 150:30, the size of the Ab-DNAAuNP conjugates ranged from 150 to 200 nm, which resulted from the aggregation of 15 nm AuNPs through the DNA molecules (Figure S3 in the Supporting Information). When the exposed antibodies of Ab-DNA-AuNPs were reacted with the target cells, the final complexes on the GO array had heights of approximately 142 nm and 103.7 nm (Figure 2 d), thus confirming that the AuNPs are sufficiently close to the GO surface for FRET to occur. The fluorescence quenching efficiency of the GO array is affected by several factors such as the concentration of immobilized Ab, the area of the GO sheets, and the number of AuNP quenchers. Ideally, in order for maximum quenching to occur, a large number of AuNPs should interact with a very small area of GO sheets. To this end, three kinds of Ab-DNA-AuNP complexes were prepared by reacting Ab (600 pmol) with AuNP solutions with concentrations of 4 pmol, 40 pmol, or 120 pmol. As the AuNP concentration was increased to 120 pmol, more AuNPs were covalently bound to the amino group of bases in the DNA, thus resulting in an AuNP assembly with an average diameter of 180 nm. Use of a 4 pmol AuNP solution resulted in AuNP aggregates with an average diameter of 80 nm. The quenching efficiencies of the three Ab-DNA-AuNP conjugates were compared with a negative control (NC) experiment in which the procedure shown in Figure 1 was followed except that the cell incubation step was omitted. The
Angew. Chem. 2010, 122, 5844 5847

Figure 3. a) Fluorescence scanning images of a GO immunoarray depend on the number of AuNPs in the Ab-DNA-AuNP complexes, which were synthesized with AuNP/Ab molar ratios of 1:150, 10:150, and 30:150. b) Relative fluorescence emission intensity (F) compared to the fluorescence intensity of the pristine GO (F0) when treated with three different Ab-DNA-AuNP complexes. The average quenching efficiencies were 0.41 for Au/Ab = 1:150, 0.61 for Au/Ab = 10:150, and 0.76 for Au/Ab = 30:150.

average fluorescence intensity of the pristine GO array was normalized to 1, the average quenching efficiencies of GO were calculated as 41 %, 61 %, and 76 % with the Ab-DNAAuNP complexes synthesized with an Ab/AuNP molar ratio of 150:1, 150:10, and 150:30, respectively (Figure 3 b). Thus, the Ab-DNA-AuNPs that bear more AuNPs lead to drastic fluorescence reduction of GO, thus allowing a sensitive rotavirus detection. We subsequently performed a limit-of-detection (LOD) study by varying the concentration of rotavirus from 103 pfu ml1 to 105 pfu ml1 (Figure 4; pfu = plaque-forming unit). As a quencher we employed the Ab-DNA-AuNP conjugate synthesized with a molar ratio of 150:30, which showed the highest quenching efficiency in Figure 3. The GO quenching effect was enhanced in proportion to the input cell number relative to the fluorescence intensity of the pristine GO array. Although the fluorescence difference is not significant between the negative control and the cell concentration of 103 pfu mL1, use of cell solutions with concentrations of 104 and 105 pfu mL1 resulted in distinguishable fluorescence intensity reductions of 44 and 76 %, respectively. The input cell concentration of 105 pfu mL1 results in the maximized GO quenching efficiency of up to 85 %. If we assume that the threshold of quenching efficiency should be more than 70 % to recognize the target rotavirus, 105 pfu mL1 is a LOD under our experimental conditions, and is comwww.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5845

Zuschriften
virus detection, and this platform can be expanded to a GO microarray format for multiple pathogen analysis. The unique fluorescence emission property and facile fabrication method of GO sheets from cheap graphite resources provide great potential of GO to be applied for biosensors as well as molecular diagnostics as a novel fluorescent tag.

Experimental Section
GO sheets were synthesized by a modified Hummers method.[9] Rotavirus, poliovirus, and variola virus were kindly donated by Korea Centers for Disease Control and Prevention (KCDC). Rotavirus monoclonal antibodies were purchased from Fitzgerald Industries International. Oligonucleotides were synthesized by Bioneer, Korea, and Au nanoparticles were synthesized following the method reported by Grabar et al.[15] Amino-modified glass slides were purchased from Nuricell, Korea. Immobilization of antibodies: 1 mL of GO solution (0.3 mg mL1) was deposited on the amino modified glass by electrostatic force and dried in a humid chamber. After washing with distilled water, 0.5 mL of 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide (EDC; 0.5 mm ) and N-hydroxysulfo-succinimide (sulfo-NHS; 1.0 mm) were added, and incubated for 30 min at 37 8C. A solution of rotavirus antibodies (1 mL, 1 mg mL1) was incubated on the same spot for 3 h to enable the covalent linkage on the GO surface. Pathogen detection: Rotavirus solution (1 mL) was added to the antibody-immobilized GO array and bound by a specific antigen antibody interaction. The rotavirus concentration ranged from 103 pfu mL1 to 105 pfu mL1. After incubation for 1 h at 37 8C, 1 mL of an engineered Ab-DNA-AuNP conjugate (0.5 mg mL1) was added and incubated for 3 h to allow Ab-DNA-AuNP complexes to be linked to the captured target cell and place the AuNPs close to the GO surface. After gentle washing with distilled water, the fluorescence signal of the GO array was measured by a GenePix 4000 A scanner (Axon Instruments, Inc., US) with 532 nm excitation wavelength (PMT detector voltage = 800 V). Characterization of the GO surface: AFM images of the modified GO array were obtained with a tapping mode at a 300 kHz scan rate and a 256 256 pixel resolution (Veeco Instruments Inc., USA), and analyzed by a Nanoscope (R) III software (Veeco Instruments Inc., USA). Received: March 10, 2010 Published online: July 2, 2010

Figure 4. LOD study of the GO immunosensor for pathogen detection. The fluorescence quenching efficiency relative to the pristine GO was dependent on the input cell concentration, which ranged from 103 to 105 pfu mL1. The fluorescence quenching efficiency was 0.26 for 103 pfu mL1, 0.44 for 104 pfu mL1, and 0.76 for 105 pfu ml1.

parable to the LOD value of a conventional ELISA technology.[14] To demonstrate the specificity for detecting pathogens on a GO immunoassay, we performed the cell incubation with poliovirus and variola virus following the same procedure as above (105 pfu mL1 input cell concentration), and then compared the resulting fluorescence image with that of the rotavirus (Figure 5). Since the GO array was initially linked to the rotavirus-specific antibody, the unmatched poliovirus and variola virus did not cause the fluorescence quenching eventually by showing a similar level of fluorescence intensities to the negative control. In the case of the rotavirus, however, a quenching enhancement in excess of 15-fold was observed compared with other viruses. The significant difference of fluorescence intensities clearly suggests that the GO based immuno-biosensor can perform a specific pathogenic virus detection. In conclusion, we have developed a novel GO-based immuno-biosensor for highly sensitive, selective, and rapid

Keywords: biosensors fluorescence FRET graphene nanoparticles

Figure 5. Specificity of the GO-based immuno-biosensor. While the GO array incubated with poliovirus and variola virus shows a bright fluorescence signal similar to the NC (a), the target rotavirus causes a fluorescence quenching effect that is 15 times higher by FRET from GO (b).

[1] a) N. Mohanty, V. Berry, Nano Lett. 2008, 8, 4469 4476; b) M. Zhou, Y. Zhai, S. Dong, Anal. Chem. 2009, 81, 5603 5613; c) J.F. Wu, M.-Q. Xu, G.-C. Zhao, Electrochem. Commun. 2010, 12, 175 177; d) X. Zuo, S. He, D. Li, C. Peng, Q. Huang, S. Song, C. Fan, Langmuir 2010, 26, 1936 1939; e) Z. Wang, X. Zhou, J. Zhang, F. Boey, H. Zhang, J. Phys. Chem. C 2009, 113, 14071 14075. [2] D. A. Dikin, S. Stankovich, E. J. Zimney, R. D. Piner, G. H. B. Dommett, G. Evmenenko, S. T. Nguyen, R. S. Ruoff, Nature 2007, 448, 457 460. [3] Z. Liu, J. T. Robinson, X. Sun, H. Dai, J. Am. Chem. Soc. 2008, 130, 10876 10877. [4] X. Sun, Z. Liu, K. Welsher, J. T. Robinson, A. Goodwin, S. Zaric, H. Dai, Nano Res. 2008, 1, 203 212. [5] a) C.-H. Lu, H.-H. Yang, C.-L. Zhu, X. Chen, G.-N. Chen, Angew. Chem. 2009, 121, 4879 4881; Angew. Chem. Int. Ed.
Angew. Chem. 2010, 122, 5844 5847

5846

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
2009, 48, 4785 4787; b) F. Liu, T. S. Seo, Biosens. Bioelectron. 2010, 25, 2361 2365. B. Dubertret, M. Calame, A. J. Libchaber, Nat. Biotechnol. 2001, 19, 365 370. a) T. Pons, I. L. Medintz, K. E. Sapsford, S. Higashiya, A. F. Grimes, D. S. English, H. Mattoussi, Nano Lett. 2007, 7, 3157 3164; b) R. Gill, I. Willner, I. Shweky, U. Banin, J. Phys. Chem. B 2005, 109, 23715 23719. a) Y.-Y. Ou, M. H. Huang, J. Phys. Chem. B 2006, 110, 2031 2036; b) L. Liu, T. Wang, J. Li, Z.-X. Guo, L. Dai, D. Zhang, D. Zhu, Chem. Phys. Lett. 2003, 367, 747 752. a) W. S. Hummers, R. E. Offeman, J. Am. Chem. Soc. 1958, 80, 1339 1339; b) Y. Xu, Z. Liu, X. Zhang, Y. Wang, J. Tian, Y. Huang, Y. Ma, X. Zhang, Y. Chen, Adv. Mater. 2009, 21, 1275 1279. a) G. Eda, Y.-Y. Lin, C. Mattevi, H. Yamaguchi, H.-A. Chen, I-S. Chen, C.-W. Chen, M. Chhowalla, Adv. Mater. 2010, 22, 505 509; b) J. H. Brannon, D. Magde, J. Phys. Chem. 1978, 82, 705 709. S. Stankovich, D. A. Dikin, R. D. Piner, K. A. Kohlhaas, A. Kleinhammes, Y. Jia, Y. Wu, S. T. Nguyen, R. S. Ruoff, Carbon 2007, 45, 1558 1565. M. Crdenas, J. Barauskas, K. Schillen, J. L. Brennan, M. Brust, T. Nylander, Langmuir 2006, 22, 3294 3299. a) K. Maehashi, T. Katsura, K. Kerman, Y. Takamura, K. Matsumoto, E. Tamiya, Anal. Chem. 2007, 79, 782 787; b) A. S. Paulo, R. Garcia, Biophys. J. 2000, 78, 1599 1605. S. S. R. Ajjampur, P. Rajendran, S. Ramani, I. Banerjee, B. Monica, P. Sankaran, V. Rosario, R. Arumugam, R. Sarkar, H. Ward, G. Kang, J. Med. Microbiol. 2008, 57, 1364 1368. K. C. Grabar, R. G. Freeman, M. B. Hommer, M. J. Natan, Anal. Chem. 1995, 67, 735 743.

Chemie

[6] [7]

[11]

[12] [13]

[8]

[14]

[9]

[15]

[10]

Angew. Chem. 2010, 122, 5844 5847

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5847

Zuschriften
Nanorod Synthesis
DOI: 10.1002/ange.201001822

Palladium Nanoparticle Catalyzed Conversion of Iron Nanoparticles into Diameter- and Length-Controlled Fe2P Nanorods**
Heonjo Kim, Youngjoo Chae, Duck Hyun Lee, Minsik Kim, Jiyoung Huh, Youngki Kim, Hyunjin Kim, Hyun Jung Kim, Sang Ouk Kim,* Hionsuck Baik, Kihang Choi, Jong Seung Kim, Gi-Ra Yi, and Kwangyeol Lee*
Nanoparticles and their composites hold great promise for advances in bio-, energy-, and environment-related fields. The properties of nanoparticles depend on composition, phase, dimension, and exposed crystal facets, and thus control over these parameters is crucial for nanoparticles to have desired properties. The process of nanoparticle formation is affected by various kinetic and thermodynamic parameters, which are determined by the intricate interplay of precursors, surfactants, and reaction temperature.[13] While variation of surfactant and reaction temperature has been a preferred approach for synthesis of new nanoparticles, more exotic methods, namely, elemental exchange,[4] doping-assisted kinetic control,[5] surface-stabilization by nonsurfactants,[6] epitaxial growth,[7] and etching,[8] are being developed to fine-tune nanocrystal growth and to overcome the dearth of precursors. While all of these ingenuous approaches enhance our understanding of nanocrystal growth and afford new nanomaterials, efforts to find new precursors should be continued for further advances in nanoscience. We previously reported that soluble Pd0 species, derived from [Pd(acac)2] (acac = acetylacetonate), can catalyze etch[*] H. Kim, Y. Chae, M. Kim, J. Huh, Y. Kim, H. Kim, H. J. Kim, Prof. K. Choi, Prof. J. S. Kim, Prof. K. Lee Department of Chemistry, Korea University Seoul 136-701 (Korea) E-mail: kylee1@korea.ac.kr Homepage: http://nanolab.korea.ac.kr D. H. Lee, Prof. S. O. Kim Department of Material Science and Engineering, Korea Advanced Institute of Science and Technology Daejon, 305-701 (Korea) E-mail: sangouk.kim@kaist.ac.kr Dr. H. Baik Korea Basic Science Institute (KBSI) Seoul 136-713 (Korea) Prof. G.-R. Yi Department of Industrial Engineering Chemistry, Chungbuk University Cheongju, 361-763 (Korea) [**] This work was supported by MEST (NRF 2009-0090897, KRF-2008314-C00234, NRF 2010-0014807) and MIHWAF (the Korea Health 21 R&D Project: A085136) to K.L., by the NRL program (R0A-2008000-20057-0) to S.O.K., and by NRF 2009-0082451 to G.R.Y. We thank KBSI for allowing the usage of their HRTEM, SQUID, GC-MS (operator: Yun Gyong Ahn) instruments and Prof. Sang-Won Lee at Korea Univ for MS measurements. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001822.

ing of Fe3O4 nanoparticles to form soluble Fe species.[9] Thus, nanoparticles, although generally considered to be stable, can be disintegrated under suitable conditions to form hithertounknown precursors and, ultimately, novel nanostructures. We further investigated this possibility of utilizing nanoparticles as a source of new precursors, and discovered that catalytic Pd nanoparticles could transform Fe nanoparticles into magnetic Fe2P nanorods. Synthetic routes to magnetic metal phosphides have been actively pursued in recent years due to their ferromagnetism, magnetoresistance, and magnetocaloric effects.[10] Surprisingly, the diameter and length of Fe2P nanorods in our study are determined by the Pd nanoparticle diameter and Pd/Fe ratio, respectively. No dimensional similarity between the diameters of the Fe2P nanorods and the precursor Fe nanoparticles was observed. Herein we report a completely unexpected dual role of the Pd nanoparticle as a catalyst for formation of an Fe precursor by destabilizing Fe nanoparticles and as a dimension-controlling catalytic center for Fe2P nanorod growth. In a typical synthesis, a sonicated slurry of Fe nanoparticles[11] (ca. 14 nm, 25 mg) in oleylamine (OA, 7 mL) and trioctylphosphine (TOP, 1 mL) was prepared in a 100 mL Schlenk tube equipped with a bubbler. A slurry of Pd nanoparticles[12] (3.5, 4.2, or 4.9 nm in diameter; 2 and 0.5 mg for formation of short and long Fe2P nanorods, respectively) in OA (2 mL) was added to the above slurry, and the reaction mixture was placed under vacuum for 2 h. The Schlenk tube was purged with Ar (99.999 %) for 30 min, and then heated at 317 8C in an oil bath for 14 h under an Ar blanket (passage to the bubbler is shut off, and a balloon containing Ar is attached). Following the separation procedure described in the Supporting Information, the product was analyzed by means of the powder X-ray diffraction (XRD) pattern, which matched that of hexagonal Fe2P (JCPDS card no. 85-1725; see Supporting Information, Figure S1). The absence of XRD peaks from metallic Fe indicated complete disappearance of the Fe phase. In addition, we could not observe the catalyst Pd phase by XRD. The products were analyzed by transmission electron microscopy (TEM) and high-resolution TEM (HRTEM), as shown in Figure 1. Strikingly different Fe2P nanorod products with different diameters and lengths could be obtained by varying only the diameter and the amount of employed Pd nanoparticles; other reaction parameters, namely, amount of Fe nanoparticle precursor and surfactants, reaction temperature, and solvent volume, were kept constant. Short nanorods (Figure 1 a, c, and e) are obtained with a large Pd/Fe
Angew. Chem. 2010, 122, 5848 5852

5848

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
content (see Supporting Information, Figures S2 and S3 for TEM images showing the presence of a shell, as well as the shell composition). The diameters of the crystalline Fe2P part in short nanorods (Figure 1 a, c, and e) are 3.7 0.2, 4.4 0.3, and 5.1 0.3 nm, respectively, while the corresponding values for long nanorods (Figure 1 b, d, and f) are 4.2 0.4, 4.7 0.4, and 5.3 0.3 nm, respectively (see Supporting Information, Table S1). The strong correlation between nanorod diameter and the Pd nanoparticle diameter is evident. This firmly supports that Pd nanoparticle acted as a catalytic center for Fe2P nanorod growth. Such diameter control has been previously observed in vaporliquidsolid (VLS)[13] and solutionliquidsolid (SLS)[14] methods, in which a catalytic nanoparticle is melted under the employed conditions and is found at the tip of the 1D nanostructure after the reaction. The Pd metal used in this study, however, has a high melting point of 1445 8C. Furthermore, a Pd nanoparticle was not observed on the tip of the formed Fe2P nanorod despite the evident role of a Pd nanoparticle in determining the diameter of the nanorod. Close examination of a fully grown 9.9 103.2 nm Fe2P nanorod by an energy-dispersive X-ray spectroscopic (EDS) profile analysis revealed that Pd is found over the entire nanorod length, while the central part of the nanorod contains the most Pd (see Supporting Information, Figure S4). Localization of Pd content was not observed in this case, that is, the reaction mechanism is drastically different from those of typical VLS or SLS methods with an intact catalyst part. Thus, to fully understand the role of Pd nanoparticles in controlling Fe2P nanorod dimensions, we obtained temporal TEM images of the reaction mixture and analyzed the elemental contents in various parts of growing nanorods (Supporting Information, Figure S5). Initially, core/shell nanoparticles with the Pd content confined to the core part are produced (Supporting Information, Figure S5a). Disappearence of all Fe nanoparticles even at this early stage indicates accelerated decomposition of the Fe phase by Pd nanoparticle based catalysis. The Pd-rich core now contains a significant amount of Fe and P, and the shell, richer in P than the core, is completely devoid of Pd. The diameter of the core is larger than that of the employed Pd nanoparticles diameter due to incorporation of Fe and P, which may also be responsible for the slightly larger diameter (core part) of Fe2P nanorods compared to the used Pd nanoparticles. The ability of Pd to dissolve Fe was previously demonstrated by formation of FePd alloy nanoparticle systems with various compositions, such as FePd, FePd2, FePd3, and FePd4.[15] Thus, dissolution of Fe species in Pd nanoparticles to give an FePd alloy in our study can be understood. The FePd alloy with the highest Fe content appears to be FePd, because FePd coexists with Fe when the Fe content is in excess.[15b] When excess Fe precursors are dissolved into the alloy system, the Fe phase can precipitate from the supersaturated FePd alloy, reminiscent of a VLS mechanism. The precipitated Fe phase would rapidly react with P-donating species such as PH3 formed in situ (vide infra) to form Fe2P. Consistent with this mechanistic view, the core/shell nanoparticles, initially with an ellipsoidal shape, initiate preferential growth along the nanorod axis (see Supporting www.angewandte.de

Chemie

Figure 1. TEM images of a) (5.7 36.5) (0.7 3.5) nm, b) (6.6 66.2) (1.0 10.1) nm, c) (6.2 43.8) (0.5 4.2) nm, d) (7.7 90.2) (1.0 8.2) nm, e) (7.4 49.4) (1.5 5.6) nm, and f) (9.6 106.6) (1.9 12.2) nm Fe2P nanorods. (Inset: TEM images of 3.5 0.3, 4.2 0.3, and 4.9 0.3 nm Pd nanoparticles used as catalysts). g) High-resolution TEM image and accompanying fast Fourier transform image (inset) of a Fe2P nanorod in (e) along h110i.

ratio, and long nanorods (Figure 1 b,d, and f) with a small Pd/ Fe ratio. This suggests that the number of formed nanorods is proportional to the number of employed Pd nanoparticles, not the number of Fe nanoparticles. Notably, the Fe2P nanorod diameter is uniform within a batch and it is similar to the diameter of the employed Pd nanoparticles. The nanorods exhibit a core/shell-like structure in which a crystalline Fe2P core with h002i growth direction (Figure 1 g) is covered by an amorphous shell with high phosphorus
Angew. Chem. 2010, 122, 5848 5852

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5849

Zuschriften
Information, Figure S5b). Once nanorod growth starts, the diameter of the nanorod does not change significantly. The most striking feature of Fe2P nanorod growth is that the Pd content is found throughout the nanorod structure, even when a nanorod grows longer (see Supporting Information, Figure S4). This clearly indicates that the core FePd system is slowly disintegrated, and the released Pd content is assimilated into the growing iron phosphide phase. Because Pd can also form various palladium phosphide phases, mixing of the Pd content, likely in the form of palladium phosphide, with the Fe2P phase is not unexpected. The different reactivities of Pd and Fe toward P, as well as the relative abundance of Fe, seem to direct faster reaction between elemental Fe and P and thus fast outgrowth of Fe2P nanorods. The slow disintegration of the Pd-rich alloy system in the middle of growing nanorods ensures the persistent presence of a catalytically active Pdrich alloy in the middle of a growing nanorod throughout the reaction, continued intake of Fe content, precipitation of supersaturated Fe, and subsequent (or simultaneous) formation of the Fe2P phase. It appears that the Pd-rich part in the middle of a growing nanorod could serve as a catalytically active growth center even with a much reduced Pd content until the later stage of reaction, because morphologies of nanorods obtained in our study are very homogeneous; if other competing pathways of nanorod formation are also operating in the later stage, irregularly shaped nanoparticles or nanorods would also appear, which is not the case in our study. While all nanorod samples shown in Figure 1 exhibit XRD patterns typical of Fe2P, short nanorods have a lower Fe/P ratio than long nanorods. For example, 6.2 43.8 nm nanorods with a core diameter of 4.4 nm (Figure 1 c) and 7.7 90.2 nm nanorods with core diameter of 4.7 nm (Figure 1 d), both formed in a reaction catalyzed by 4.2 nm Pd nanoparticles, exhibit Fe/P ratios of 1.6 and 2.4, respectively, as determined by electron-probe micro-analysis (see Supporting Information, Table S2, and also Figure S6 for EDS results). Short nanorods have a higher Pd content (2 vs. 0.25 atom % in long nanorods), and this results in significant differences in the final Fe and P contents in the nanorod structures. X-ray photoelectron spectroscopic analysis also suggests the presence of a P-rich phase such as FeP in the short nanorods with higher Pd content (see Supporting Information, Figure S7). Pd seems to take up more P than Fe, which prefers the formation of low-P phases like Fe2P under the reaction conditions (note the initial ellipsoidal nanoparticle with a very high P content). In the early stage of nanorod formation from an FePd alloy with high Pd content, the Fe/P ratio is inevitably much lower than the expected value of 2. On the other hand, the composition of the core Fe2P nanorods should exhibit a higher Fe/P ratio than the above measured values, because the formed nanorods are covered by an amorphous layer rich in P. Phases with a higher Fe content such as Fe or Fe3P, even if unidentifiable through TEM or XRD analysis, might result in higher blocking temperatures of Fe2P nanorods than expected for a pure Fe2P phase (see Supporting Information, Figure S8 for magnetism measurements). Usage of Pd nanoparticles with diameters over 5.5 nm led to the competitive formation of platelike Fe2P nanostructures besides nanorods (Supporting Information, Figure S9). The preferential growth of Fe2P nanorods along h002i obviously is not entirely viable with larger Pd nanoparticles. Under the same reaction conditions but without Pd nanoparticles, Fe nanoparticles reacted with TOP to form an uncontrolled mixture of nanoparticles and nanorods with Fe, FeP, and Fe2P phases (Supporting Information, Figure S10). Obviously, Pd nanoparticles are essential for fast consumption of Fe nanoparticles in an early stage and ensuing formation of size- and composition-controlled Fe2P nanorods. In our previous study, we suggested that soluble Pd0 species can catalyze the reduction of Fe cations to form soluble iron species.[9] Thus we attempted the formation of Fe2P nanorods with Fe3O4 nanoparticles as starting material. As expected, Pd nanoparticles could convert Fe3O4 nanoparticles to sizecontrolled Fe2P nanorods. In this case, however, hollow spheres were also observed as side products (Supporting Information, Figure S11). Once an insoluble amorphous {Fe, P} layer is formed on a crystalline Fe3O4 nanoparticle, it cannot be assimilated into a Pd nanoparticle. This precludes its conversion to Fe2P, and thus the amorphous shell remains stable under the reaction conditions. In the case of Fe nanoparticle as a precursor, the surface Fe atoms can also be easily oxidized (see Supporting Information, Figure S12). The oxide phase on a Fe nanoparticle, however, is not crystalline, and thus dissolution of this amorphous oxide phase is too fast to support the formation of an amorphous {Fe, P} layer. Due to this stability difference between crystalline and amorphous iron oxide phases, we observe no hollow spheres as side products with Fe nanoparticle precursors. We noticed that the amount of OA in the reaction mixture decreases (GC-MS analysis; Supporting Information, Figure S10) with formation of C54H97N (Supporting Information, Figures S13 and S14) during Fe2P nanorod formation; a drastic decrease of OA was observed only under conditions in which Fe2P nanorods are successfully prepared. We could not detect the presence of non-amine functional groups such as CN in NMR and IR spectroscopic data for C54H97N. Thus, we carried out a series of amine tests[16] and ruled out the possibility of this C54H97N species being a primary or secondary amine, leaving a tertiary amine with unsaturated hydrocarbon chains as the most likely candidate structure for C54H97N (see Supporting Information, Figure 15). Without Fe nanoparticles, a Pd nanoparticle alone could not form this C54H97N compound. In addition, Fe2P nanorods obtained from our study could not catalyze the formation of tertiary amine species under the reaction conditions. Interestingly, formation of C54H97N is also accompanied by formation of NH3. It has been shown that OA can be decomposed to form NH3 in the presence of cobalt species.[17] Thus, iron species generated in situ may have catalyzed the formation of C54H97N by decomposition of OA with concomitant formation of NH3. The complete absence of Ar flow was crucial for the formation of Fe2P nanorods from Fe or Fe3O4 nanoparticles. Even with an Ar flow rate of 10 cm3 min1, no Fe2P nanorods could be synthesized (see Supporting Information, Figure S10). Because an Ar stream can easily deplete in situ generated volatile species such as NH3 and PH3, which were
Angew. Chem. 2010, 122, 5848 5852

5850

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
detected by a gas sensor, from the reaction mixture, the role of volatile species was probed by a series of reactions (see Supporting Information, Figure S16). With an NH3 stream of 10 cm3 min1, volatile components other than NH3 would be removed from the reaction mixture. No Fe2P nanorod could be obtained under these conditions. We then investigated the role of PH3, formed by decomposition of TOP (likely following elimination of octene), in the formation of Fe2P nanorods. Again, no Fe2P nanorod was obtained with a PH3 flow (10 cm3 min1, 5 vol % in Ar), in which NH3 in situ generated would be removed from the reaction mixture. Under these conditions, large iron nanoparticles disappeared following Fe nanoparticle dissolution, and small wormlike nanoparticles of FeP formed by attachment of small FeP nanoparticles were observed; clearly, Pd nanoparticles did not serve as catalytic centers for fast growth of Fe2P nanorods in this case. Only when both NH3 and PH3 (5 % v/v in Ar) gases were introduced simultaneously at respective flow rates of 7 and 15 cm3 min1 could nanorods of Fe2P be obtained. Thus, it seems that PH3 formed in situ is necessary for conversion of Fe to Fe2P, and NH3 for activation of the Pd nanoparticle catalyst. Since excess PH3 can deactivate the Pd nanoparticle by binding strongly to its surface, a large amount of weakly binding NH3 may, by competing with the PH3 ligands, allow influx of soluble Fe species into the Pd matrix. The presence of a large amount of O2 was detrimental to the formation of Fe2P nanorods; no Fe2P nanorod formation was observed when the reaction mixture was blanketed by 10 vol % O2 in Ar (1 atm, balloon; see Supporting Information, Figure S16). Oxygen may interfere with Fe2P formation by effectively removing pyrophoric PH3 from the reaction mixture. Thus, the additional role of PH3 in the Fe2P nanorod synthesis may lie in maintaining the reducing environment by effectively removing traces of oxygen, which could be introduced by diffusion, from the reaction mixture. The total absence of Ar flow and presence of pyrophoric PH3 provide a completely oxygen-free environment, which might be essential for Fe2P nanorod growth. To further substantiate the catalytic role of a Pd nanoparticle in the growth of a Fe2P nanorod, we prepared an ordered 2D array of approximately 7 nm Pd nanoparticles on an Si substrate,[18] and attempted the growth of Fe2P nanorods thereon (see Supporting Information for experimental details, and Figures S17 and S18). Consistent with our prediction, we could grow Fe2P nanorods from Pd nanoparticles supported on an Si substrate (Figure 2). The diameter of the Fe2P nanorods is slightly larger than that of the Pd nanoparticles (1015 nm, see Figure 2 d; note that the top view Figure 2 b selectively shows only thicker nanorods), consistent with solution-based results. On the other hand, Fe2P nanorods could not grow on a clean Si substrate without Pd, in further corroboration of the crucial role of Pd as catalytic center for Fe2P nanorod growth. The overall Fe2P nanorod growth process is depicted in Figure 3. In summary, we have reported a novel Pd nanoparticle catalyzed synthesis of diameter-specific and length-controlled Fe2P nanorods from Fe nanoparticles. The diameter and length of Fe2P nanorods could be finely controlled by adjusting the size of the catalytic Pd nanoparticles and the
Angew. Chem. 2010, 122, 5848 5852

Chemie

Figure 2. Fe2P nanorod growth on an Si-supported Pd substrate. SEM images of a) an array of approximately 7 nm Pd nanoparticles on Si. b) Fe2P nanorods grown on an Si substrate at a reaction time of 5 h (top view). c) Side view of swollen Pd nanoparticles due to solidsolution formation and short nanorods (indicated with arrows) at a reaction time of 3 h. d) Side view of Fe2P nanorods grown vertically on an Si substrate.

Figure 3. Fe2P nanorod growth process.

Fe/Pd ratio, respectively, and this in turn allows magnetic properties to be fine-tuned. Such controllable magnetic properties could be useful in future magnetic-device applications. The Pd nanoparticles perform a dual role as catalyst destabilizing the Fe phase and catalytic center for Fe2P nanorod growth. The Fe nanoparticles are completely disintegrated under the employed reaction conditions to form a new Fe precursor, unavailable via other routes, which is ultimately converted to Fe2P nanorods. The excess Fe content, likely to have precipitated from a supersaturated FePd alloy system, combines with P from active P sources such as PH3, formed in situ, to form Fe2P. We are currently investigating the possible transformation of existing nanomaterials into hitherto-unknown precursors catalyzed by Pd or other noble metals. Our approach would eventually provide a number of novel nanomaterials with better dimensional control and reproducible material properties.

Received: March 27, 2010 Revised: May 20, 2010 Published online: July 2, 2010

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5851

Zuschriften

Keywords: crystal growth iron nanoparticles nanostructures palladium

[1] a) A. R. Tao, S. Habas, P. Yang, Small 2008, 4, 310 325; b) Y. Yin, A. P. Alivisatos, Nature 2005, 437, 664 670. [2] a) J. Maynadi, A. Salant, A. Falqui, M. Respaud, E. Shaviv, U. Banin, K. Soulantica, B. Chaudret, Angew. Chem. 2009, 121, 1846 1849; Angew. Chem. Int. Ed. 2009, 48, 1814 1817; b) K. H. Park, K. Jang, H. J. Kim, S. U. Son, Angew. Chem. 2007, 119, 1170 1173; Angew. Chem. Int. Ed. 2007, 46, 1152 1155; c) J. Park, K. An, Y. Hwang, J.-G. Park, H.-J. Noh, J.-Y. Kim, J.-H. Park, N.-M. Hwang, T. Hyeon, Nat. Mater. 2004, 3, 891 895. [3] a) S. Sapra, J. Poppe, A. Eychmller, Small 2007, 3, 1886 1888; b) G. Wang, W. Lu, J. Li, J. Choi, Y. Jeong, S.-Y. Choi, J.-B. Park, M. K. Ryu, K. Lee, Small 2006, 2, 1436 1439; c) C. H. Lee, M. Kim, T. Kim, A. Kim, J. Paek, J. W. Lee, S.-Y. Choi, K. Kim, J.-B. Park, K. Lee, J. Am. Chem. Soc. 2006, 128, 9326 9327; d) K. Lee, W. S. Seo, J. T. Park, J. Am. Chem. Soc. 2003, 125, 3408 3409; e) Y.-W. Jun, S.-M. Lee, N.-J. Kang, J. Cheon, J. Am. Chem. Soc. 2001, 123, 5150 5151. [4] a) B. Sadtler, D. O. Demchenko, H. Zheng, S. M. Hughes, M. G. Merkle, U. Dahmen, L.-W. Wang, A. P. Alivisatos, J. Am. Chem. Soc. 2009, 131, 5285 5293; b) R. D. Robinson, B. Sadtler, D. O. Demchenko, C. K. Erdonmez, L.-W. Wang, A. P. Alivisatos, Science 2007, 317, 355 358; c) P. H. C. Camargo, Y. H. Lee, U. Jeong, Z. Zou, Y. Xia, Langmuir 2007, 23, 2985 2992; d) D. H. Son, S. M. Hughes, Y. Yin, A. P. Alivisatos, Science 2004, 306, 1009 1012. [5] a) C. Wang, H. Daimon, T. Onodera, T. Koda, S. Sun, Angew. Chem. 2008, 120, 3644 3647; Angew. Chem. Int. Ed. 2008, 47, 3588 3591; b) D. Seo, J. C. Park, H. Song, J. Am. Chem. Soc. 2006, 128, 14863 14870. [6] a) H. G. Yang, C. H. Sun, S. Z. Qiao, J. Zou, G. Liu, S. C. Smith, H. M. Cheng, G. Q. Lu, Nature 2008, 453, 638 641; b) F. Tao, M. E. Grass, Y. Zhang, D. R. Butcher, J. R. Renzas, Z. Liu, J. Y. Chung, B. S. Mun, M. Salmeron, G. A. Somorjai, Science 2008, 322, 932 934; c) P. Nolte, A. Stierle, N. Y. Jin-Phillipp, N. Kasper, T. U. Schulli, H. Dosch, Science 2008, 321, 1654 1658. [7] a) B. Lim, M. Jiang, P. H. C. Camargo, E. C. Cho, J. Tao, X. Lu, Y. Zhu, Y. Xia, Science 2009, 324, 1302 1305; b) B. Lim, J. Wang, P. H. C. Camargo, M. Jiang, M. J. Kim, Y. Xia, Nano Lett. 2008, 8, 2535 2540; c) D. Seo, C. I. Yoo, J. Jung, H. Song, J. Am. Chem. Soc. 2008, 130, 2940 2941; d) S. E. Habas, H. Lee, V. Radmilovic, G. A. Somorjai, P. Yang, Nat. Mater. 2007, 6, 692 697.

[8] a) M. Schrinner, M. Ballauff, Y. Talmon, Y. Kauffmann, J. Thun, M. Mller, J. Breu, Science 2009, 323, 617 620; b) B. Lim, X. Lu, M. Jiang, P. H. C. Camargo, E. C. Cho, E. P. Lee, Y. Xia, Nano Lett. 2008, 8, 4043 4047; c) N. Tian, Z.-Y. Zhou, S.-G. Sun, Y. Ding, Z. L. Wang, Science 2007, 316, 732 735; d) X. Lu, L. Au, J. McLellan, Z.-Y. Li, M. Marquez, Y. Xia, Nano Lett. 2007, 7, 1764 1769; e) D. Kim, J. Park, K. An, N.-K. Yang, J.-G. Park, T. Hyeon, J. Am. Chem. Soc. 2007, 129, 5812 5813. [9] H. Kim, M. Lee, Y. Kim, J. Huh, H. Kim, M. Kim, T. Kim, V. N. Phan, Y.-B. Lee, G.-R. Yi, S. Haam, K. Lee, Angew. Chem. 2009, 121, 5231 5235; Angew. Chem. Int. Ed. 2009, 48, 5129 5133. [10] a) E. Muthuswamy, P. R. Kharel, G. Lawes, S. L. Brock, ACS Nano 2009, 3, 2383 2393; b) A. T. Kelly, I. Rusakova, T. OuldEly, C. Hofmann, A. Lttge, K. H. Whitmire, Nano Lett. 2007, 7, 2920 2925; c) J. Park, B. Koo, K. Y. Yoon, Y. Hwang, M. Kang, J.-G. Park, T. Hyeon, J. Am. Chem. Soc. 2005, 127, 8433 8440; d) C. Qian, F. Kim, L. Ma, F. Tsui, P. Yang, J. Liu, J. Am. Chem. Soc. 2004, 126, 1195 1198; e) J. Park, B. Koo, Y. Hwang, C. Bae, K. An, J.-G. Park, H. M. Park, T. Hyeon, Angew. Chem. 2004, 116, 2332 2335; Angew. Chem. Int. Ed. 2004, 43, 2282 2285. [11] a) S. Peng, S. Sun, Angew. Chem. 2007, 119, 4233 4236; Angew. Chem. Int. Ed. 2007, 46, 4155 4158; b) S. Peng, C. Wang, J. Xie, S. Sun, J. Am. Chem. Soc. 2006, 128, 10676 10677. [12] S.-W. Kim, J. Park, Y. Jang, Y. Chung, S. Hwang, T. Hyeon, Nano Lett. 2003, 3, 1289 1291. [13] J. Hu, T. W. Odom, C. M. Lieber, Acc. Chem. Res. 1999, 32, 435 445. ic , A. Miedaner, C. J. Curtis, J. M. [14] a) S. P. Ahrenkiel, O. I. Mic , A. J. Nozik, Nano Lett. 2003, 3, 833 837; b) S. Kan, Nedeljkovic T. Mokari, E. Rothenberg, U. Banin, Nat. Mater. 2003, 2, 155 158; c) T. J. Trentler, S. C. Goel, K. M. Hickman, A. M. Viano, M. Y. Chiang, A. M. Beatty, P. C. Gibbons, W. E. Buhro, J. Am. Chem. Soc. 1997, 119, 2172 2181. [15] a) M.-H. Shao, K. Sasaki, R. R. Adzic, J. Am. Chem. Soc. 2006, 128, 3526 3527; b) T. Teranishi, A. Wachi, M. Kanehara, T. Shoji, N. Sakuma, M. Nakaya, J. Am. Chem. Soc. 2008, 130, 4210 4211. [16] J. S. Kim, S. J. Lee, J. H. Jung, I.-C. Hwang, N. J. Singh, S. K. Kim, S. H. Lee, H. J. Kim, C. S. Keum, J. W. Lee, K. S. Kim, Chem. Eur. J. 2007, 13, 3082 3088. [17] K. M. Nam, J. H. Shim, H. Ki, S.-I. Choi, G. Lee, J. K. Jang, Y. Jo, M.-H. Jung, H. Song, J. T. Park, Angew. Chem. 2008, 120, 9646 9650; Angew. Chem. Int. Ed. 2008, 47, 9504 9508. [18] a) D. H. Lee, W. J. Lee, S. O. Kim, Nano Lett. 2009, 9, 1427 1432; b) D. H. Lee, D. O. Shin, W. J. Lee, S. O. Kim, Adv. Mater. 2008, 20, 2480 2485.

5852

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5848 5852

Angewandte
DOI: 10.1002/ange.201001850

Chemie

CH Bond Activation

Analysis of Reaction Channels for Alkane Hydroxylation by Nonheme Iron(IV)Oxo Complexes**


Caiyun Geng, Shengfa Ye, and Frank Neese*
Ever since the discovery of xenobiotic degradation by cytochrome P450,[1] the functionalization of unactivated CH bonds has been a focal point of experimental and theoretical research. Except for the well-accepted iron(IV) oxo intermediate, which presumably is the active species in cytochrome P450 as well as in some nonheme iron enzymes,[12] iron(V)oxo[2c, 3] or iron(III)hydroperoxo[4] intermediates might also be involved in CH bond hydroxylation reactions. Such open-shell transition metals in high oxidation states display fascinating and highly complex reactivity patterns. The pioneering work by Shaik, Schwarz, and co-workers on the gas-phase reaction of FeO+ with H2 has laid out the concept of two-state reactivity as an important motif in transition-metal oxidation chemistry.[5] It has been shown that reaction barriers may differ dramatically on potential energy surfaces that are characterized by different spin multiplicities, and that the system may employ more than one such surface during the reaction.[6] Much progress has been made in the synthetic modeling of iron(IV)oxo species.[2c, 7] Moreover, quantum chemical studies by Solomon,[4b, 8] Thiel,[9] Shaik,[6, 10] Siegbahn,[11] Baerends,[12] de Visser[13] and their co-workers have provided a framework for the mechanistic analysis of CH bond hydroxylation by both heme and nonheme iron(IV)oxo complexes. A detailed mechanistic understanding of the reactivity displayed by iron(IV)oxo centers is a prerequisite for the rational design of low molecular weight catalysts. The pioneering proposal by Groves and McClusky suggests that the alkane hydroxylation reaction using iron(IV)oxo intermediates follows a rebound mechanism.[14] The overall mechanism in rebound chemistry is characterized by two steps: 1) hydrogen-atom abstraction from the substrate RH via transition state TSH that leads to a iron(III) hydroxyl species that is weakly bound to an alkyl radical RC
[*] C. Geng, Dr. S. Ye, Prof. Dr. F. Neese Institut fr Physikalische und Theoretische Chemie University of Bonn Wegelerstrasse 12, 53115 Bonn (Germany) Fax: (+ 49) 228-73-9064 E-mail: neese@thch.uni-bonn.de Homepage: http://www.thch.uni-bonn.de/tc/ C. Geng State Key Laboratory of Theoretical and Computational Chemistry Institute of Theoretical Chemistry, Jilin University Changchun 130023 (China) [**] This work was supported by the China Scholarship Council (CSC) (C.Y.G.). S.Y. and F.N. gratefully acknowledge a grant from the German Science Foundation (NE 690/7-1). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001850.
Angew. Chem. 2010, 122, 5853 5856

(intermediate I), and 2) hydroxyl back-transfer to the radical RC via transition state TSRe to yield an iron(II) centre and the hydroxylated product, ROH. However, there are two additional layers of complexity. First, iron(IV)oxo sites are known to exist either in triplet or quintet ground states. The majority of model complexes prefer the former,[7] whereas all of the identified nonheme iron enzyme active sites[2b] feature the latter. More recently, model complexes with an S = 2 ground state have been synthesized.[15] From density functional theory (DFT) calculations, the reactivity of quintet iron(IV)oxo intermediates towards CH bond hydroxylation is suggested to be much higher than the corresponding triplet species.[6b, 10a,d, 16] The second layer of complexity stems from the geometry of the substrate approach. The cleaving CH bond may attack the iron(IV)oxo unit either from the top (thus leading to an essentially linear Fe-O-H arrangement), or from an equatorial position (thus leading to a bent Fe-O-H geometry). Both types of reaction geometries lead to different electronic structures in the transition states and hence to different reaction pathways. The initial step of hydrogen-atom abstraction involves the transfer of one electron from the substrate into the metal 3dblock. This step is already electronically complicated because it has been established that a preparatory step is neededin which the system switches from an iron(IV)oxo to an iron(III)oxyl species on its way towards the transition state.[16] Obviously, depending on the ground state multiplicity

Scheme 1. The feasible reaction channels for the hydrogen-atom abstraction by iron(IV)oxo complexes.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5853

Zuschriften
and the geometry of the CH bond approach, several of the semi-occupied or unoccupied iron-based molecular orbitals could serve as electron acceptors. In the quintet channel (Scheme 1, bottom right panel), the electron of the substrate is transferred into the s*(FeO) antibonding orbital (s-mechanism). The upwards pointing lobe of the O pz orbital requires a vertical approach of the substrate and hence 5TSHs features a nearly collinear Fe-O-H arrangement. In the triplet pathway (Scheme 1, top left panel), the p*(FeO) orbital accepts the electron from the substrate CH bond (p-mechanism). The corresponding transition state 3TSHp is characterized by a bent Fe-O-H unit to accomplish maximum orbital overlap between the electron-donor and -acceptor orbitals. In the rebound step, the CO bond formation is accompanied by a simultaneous electron transfer from the substrate into the Fe dxz/yz and the vacant Fe dz2 orbitals, respectively. Thus, the rebound step appears to follow a p-mechanism on the quintet surface and a s-mechanism on the triplet surface. Despite this already detailed understanding that has been reached through intense experimental and theoretical studies, the picture is not yet complete. A recent study by Solomon and co-workers[17] on the benzylic hydroxylation of (4-hydroxy)mandelate synthase (HmaS) revealed a new reaction pathway on the quintet surface (Scheme 1, bottom left panel). Here, the benzylic hydrogen atom approaches the electrophilic FeO moiety in a horizontal fashion. This approach leads to the transfer of a b- rather than an a-spin electron into the p*(FeO) orbital, similar to what is commonly observed for the triplet p-pathway discussed above. Thus, this study is the first one to propose a p-mechanism for hydrogen-atom transfer to an iron(IV)oxo center on the quintet surface. However, this new channel might be regarded as a special case. First, the substrate is directly coordinated to the iron active site and hence steric encumbrance restricts it to a horizontal approach. Second, the reaction involves the abstraction of a benzylic hydrogen atom that is much weaker than the aliphatic CH bonds activated by cytochrome P450 or other nonheme iron centers. We are therefore interested in the question of whether the quintet p-pathway is a generally competitive reaction channel for alkane hydroxylation and whether a s-pathway is also possible on the triplet surface (Scheme 1, top right panel). To this end, we have studied all four possible reaction channels with the aid of DFT calculations as well as with high-level coupled cluster theory with single, double, and triple excitations (CCSD(T); see the Supporting Information for computational details). The chosen models resembled those previously investigated for property correlations among high-valent iron centers: [FeIV(O)(NH3)5]2+ (a), IV + [Fe (O)(OH)(axial)(NH3)4] (b), [FeIV(O)(OH)2(eq)(NH3)3] (c). The calculated geometric parameters of the transition states of the [FeIV(O)(NH3)5]2+ system (Table 1) agree well with previous results of the same pathways.[10a,c, 12b, 18] We first discuss the hydroxylation reactions based on the DFT calculations. Figure 1 shows the potential energy profiles of the ethane CH bond hydroxylation by model system a. The processes that proceed through 3TSHp and 5TSHs represent the established pathways on the triplet and quintet surfaces. The reactions proceeding via 3TSHs and 5TSHp are the
Table 1: Geometric parameters of the transition states of the [FeIV(O)(NH3)5]2+ system calculated at the B3LYP/TZVP level of theory. Transition states
3 3

FeO [] 1.78 1.78 1.74 1.76 1.91 1.84

OH [] 1.21 1.16 1.27 1.21 0.97 0.97

CH [] 1.33 1.37 1.26 1.33

CO [] 2.27 2.79

]FeOH [8] 118.9 174.9 175.8 123.1

]FeOC [8] 160.0 174.7

TSHp TSHs 5 TSHs 5 TSHp 3 TSRes 5 TSRep 5 TSRes

Figure 1. Schematic Gibbs free energy (DG) surfaces for ethane hydroxylation by the [FeIV(O)(NH3)5]2+ system: A) B3LYP/def2-TZVPP// B3LYP/TZVP, B) CCSD(T) (def2-TZVP for Fe, N, O, and def2-SV(P) for H atoms)//B3LYP/TZVP.

nonclassical reactions. The triplet and quintet iron(IV)oxo reactants have very similar energies, which is consistent with previous studies.[10a,c, 13b] Comparison of the calculated energy barriers for hydrogen-atom abstraction demonstrates that the quintet s-pathway encounters by far the lowest barrier among the four alternatives. In contrast, the p-pathways on the triplet and quintet surfaces have comparable energy barriers. The barrier of the triplet s-pathway, which could only be located for model system a, is much higher in energy. For the rebound step, the triplet pathway involves a higher energy barrier than the quintet pathway. Hence, it is clear that the hydroxylation reactivity decreases in the order 5s > 5p > 3p > 3s. Apart from the nonclassical channels discussed here, our results are in agreement with previous studies[11, 12d, 13a] that demonstrate that the quintet iron(IV)oxo species is more reactive than the corresponding triplet species. As the electron-transfer steps in the established triplet (pmechanism) and quintet (s-mechanism) reaction pathways have been well studied, our discussion will mainly focus on the p-mechanism on the quintet state surface and the spathway on the triplet state. For simplicity, we focus the discussion on model system a and have collected the analoAngew. Chem. 2010, 122, 5853 5856

5854

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
gous results for model systems b and c in the Supporting Information. Figure 2 shows the schematic molecular orbital (MO) diagrams for the two nonclassical pathways. It becomes evident that in 5TSHp a b-electron from the substrate is shifted towards the Fe-dxz based orbital, which is consistent with a horizontal approach of the ethane molecule towards the FeO moiety. The key geometric parameters of 5TSHp closely resemble those found in 3TSHp (Table 1), that is, a nearly collinear O-H-C moiety, comparable CH and OH bond lengths and a significantly bent Fe-O-H angle. These findings may be rationalized by reference to the electronic configuration of 5TSHp. As the substrate approaches the iron(IV) oxo unit, the FeO bond gradually elongates and an electron hole is generated in the orbital based on O px[17] (thus leading to the formation of a ferricoxyl species), which finally serves as the true electron acceptor. To assure the best orbital interactions between the CH s-bond and the O px orbital, the substrates must approach the FeO core horizontally with a Fe-O-H angle of 908 ; however, this orientation is only possible at the expense of a much larger Pauli repulsion than in the s-type attack geometry.[12c] Consequently, the opposing requirements of optimal orbital overlap and increasing Pauli repulsion lead to bent geometries in 5TSHp with a Fe-O-H angle close to 1208. Compared to the decreased Pauli repulsion and the optimum orbital interaction of the vertical approach in the quintet s-mechanism, one may readily appreciate why 5TSHs features the smallest barrier of the three pathways (5TSHs, 5TSHp, and 3TSHp). Unlike 5Is, which contains a high-spin ferric ion (SFe = 5/2) that is antiferromagnetically coupled to an alkyl radical (SC=1/2), the hydrogen-atom abstraction process through the p-mechanism finally leads to an intermediate (5Ip) containing an intermediate spin iron(III)hydroxo complex (SFe = 3/2) ferromagnetically coupled to an ethylic radical. The vertical approach of ethane towards the FeO moiety in 3TSHs leads to an a-electron transfer from the substrate to the s*(FeO) antibonding orbital. Although the nearly collinear arrangement of Fe-O-H-C features the best orbital interactions and smallest Pauli repulsions, the LUMO + 1 acceptor orbital s*(FeO) is much higher in energy compared to the corresponding orbital in 5TSHs owing to the greatly reduced spin polarization.[8] The high activation energy of 3 TSHs is also in agreement with the geometric parameters that indicate a rather late transition state. The electronic structure of 3Is features antiferromagnetic coupling between an intermediate spin ferric (SFe = 3/2) and an alkyl radical (SC = 1/2). The energies of these four intermediates of varying spin multiplicities decrease in the order 5Is (SFe = 5/2) > 5Ip (SFe = 3/2) ! 3Ip (SFe = 1/2) > 3Is (SFe = 3/2), which is consistent with the weak ligand fields arising from typical nonheme ligand frameworks. Starting from 5Ip, the rebound step follows a s-mechanism through 5TSRes like in the triplet p-channel. In either case, the remaining a-electron of the substrate radical is transferred to the strongly s-antibonding Fe dz2 orbital (a schematic MO diagram of a post-5TSRes geometry with a CO bond length of 2.5 is shown in Figure 2 C). As the electron is shifted along the FeO axis, an almost linear Fe-O-C angle of 174.78 is calculated in 5TSRes. Comparison of the rebound pathways reveals that the two channels on the quintet state surface[19]

Chemie

Figure 2. Schematic MO diagram of 5TSHp (A), 3TSHs (B), and 5TSRes (C) for [FeIV(O)(NH3)5]2+. C yellow, Fe orange, N blue, O red.
Angew. Chem. 2010, 122, 5853 5856  2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5855

Zuschriften
have a very similar energy barrier, while the triplet smechanism process encounters the highest energy barrier. This trend may be ascribed to two factors: 1) the nature of the electron-acceptor orbital, and 2) the spin polarization induced by the singly occupied orbitals in the metal d-block. Given the comparatively weak p-antibonding nature of the t2g-derived orbitals compared to the strongly s-antibonding nature of the orbital based on Fe dz2 together with the large spin-polarization of the quintet state, it becomes understandable why 5TSRep corresponds to the lowest energy rebound step on the three surfaces. The situation on the triplet surface is exactly opposite. Here the acceptor orbital is the strongly santibonding Fe dz2 orbital and the triplet state spin-polarization is much less effective compared to the quintet state. An intermediate situation exists in 5TSRes. The CCSD(T) level energies based on B3LYP optimized geometries predict larger tripletquintet splitting patterns, which are again consistent with other studies (see the Supporting Information).[20] The CCSD(T) results are slightly biased in favor of the high-spin state of iron(IV)oxo complexes. The same behavior is also found in the spectroscopic oriented configuration interaction (SORCI) calculations.[21] However, it is clear that there is a very large basis set dependence[22] and the basis set limit is difficult to reach with CCSD(T) calculations for systems of the present size. The activation energies obtained from CCSD(T) calculations for triplet and quintet pathways show a similar trend. In particular, the energy of 5TSHs, which involves a high-spin ferric iron (SFe = 5/2), is greatly decreased. For the pathways involving intermediate-spin iron centers (SFe = 3/2), similar energy barriers as predicted by B3LYP calculations are obtained. This bias may disappear at the basis set limit, which is, unfortunately, not approachable with presently available computational resources. A detailed discussion of how to best obtain accurate spin-state energy gaps for transition metal complexes is beyond the scope of the present work. Nevertheless, the CCSD(T) results are broadly consistent with the B3LYP numbers for the hydrogen-atom abstraction steps, and further corroborate that the quintet spathway is the most feasible channel. The CCSD(T) results also confirm that the quintet p-pathway is highly competitive. In conclusion, this is the first time that all viable pathways have been identified in the same system, which allows us to compare their relative reactivities. The triplet s-pathway is higher in energy such that it may not ever be involved in actual CH bond hydroxylation reactions. However, the reactivity of the quintet p-channel is comparable or even higher than the classical triplet channel (3p), although it is slightly higher in energy than the established quintet channel (5s). The existence of at least three energetically feasible pathways may offer, however, a new element of specificity control in CH bond activation reactions by iron(IV)oxo species. The choice of s- or p-pathways could be controlled at least in partby steric hindrance in model systems or by the restrictions of the protein pocket in metalloenzymes.[8]
Received: March 29, 2010 Revised: May 11, 2010 Published online: July 13, 2010

Keywords: CH activation density functional calculations ironoxo species reaction mechanisms

[1] Cytochrome P450: Structure, Mechanism and Biochemistry, 3rd ed. (Ed.: P. R. Ortiz de Montellano), Kluwer Academic/Plenum, New York, 2004. [2] a) E. I. Solomon, T. C. Brunold, M. I. Davis, J. N. Kemsley, S. K. Lee, N. Lehnert, F. Neese, A. J. Skulan, Y. S. Yang, J. Zhou, Chem. Rev. 2000, 100, 235; b) C. Krebs, D. G. Fujimori, C. T. Walsh, J. M. Bollinger, Jr., Acc. Chem. Res. 2007, 40, 484; c) M. Costas, M. P. Mehn, M. P. Jensen, L. Que Jr. , Chem. Rev. 2004, 104, 939. [3] a) P. Comba, M. Maurer, P. Vadivelu, J. Phys. Chem. A 2008, 112, 13028; b) A. Bassan, M. R. A. Blomberg, P. E. M. Siegbalm, L. Que, Jr., Chem. Eur. J. 2005, 11, 692; c) K. Chen, L. Que, Jr., J. Am. Chem. Soc. 2001, 123, 6327; d) E. G. Kovaleva, J. D. Lipscomb, Nat. Chem. Biol. 2008, 4, 186. [4] a) A. Decker, M. S. Chow, J. N. Kemsley, N. Lehnert, E. I. Solomon, J. Am. Chem. Soc. 2006, 128, 4719; b) E. I. Solomon, S. D. Wong, L. V. Liu, A. Decker, M. S. Chow, Curr. Opin. Chem. Biol. 2009, 13, 99. [5] a) S. Shaik, M. Filatov, D. Schroder, H. Schwarz, Chem. Eur. J. 1998, 4, 193; b) D. Danovich, S. Shaik, J. Am. Chem. Soc. 1997, 119, 1773. [6] a) S. Shaik, D. Kumar, S. P. de Visser, A. Altun, W. Thiel, Chem. Rev. 2005, 105, 2279; b) S. Shaik, H. Hirao, D. Kumar, Acc. Chem. Res. 2007, 40, 532. [7] a) L. Que, Jr., Acc. Chem. Res. 2007, 40, 493; b) W. Nam, Acc. Chem. Res. 2007, 40, 522. [8] A. Decker, J. Rohde, E. J. Klinker, S. D. Wong, L. Que, Jr., E. I. Solomon, J. Am. Chem. Soc. 2007, 129, 15983. [9] J. C. Schneboom, S. Cohen, H. Lin, S. Shaik, W. Thiel, J. Am. Chem. Soc. 2004, 126, 4017. [10] a) H. Hirao, D. Kumar, L. Que, Jr., S. Shaik, J. Am. Chem. Soc. 2006, 128, 8590; b) S. Shaik, D. Kumar, S. P. de Visser, J. Am. Chem. Soc. 2008, 130, 10128; c) H. Hirao, L. Que, Jr., W. Nam, S. Shaik, Chem. Eur. J. 2008, 14, 1740; d) D. Kumar, H. Hirao, L. Que, Jr., S. Shaik, J. Am. Chem. Soc. 2005, 127, 8026. [11] P. E. M. Siegbahn, T. Borowski, Acc. Chem. Res. 2006, 39, 729. [12] a) L. Bernasconi, E. J. Baerends, Eur. J. Inorg. Chem. 2008, 1672; b) L. Bernasconi, M. J. Louwerse, E. J. Baerends, Eur. J. Inorg. Chem. 2007, 3023; c) C. Michel, E. J. Baerends, Inorg. Chem. 2009, 48, 3628; d) B. Ensing, F. Buda, M. C. M. Gribnau, E. J. Baerends, J. Am. Chem. Soc. 2004, 126, 4355. [13] a) S. P. de Visser, J. Am. Chem. Soc. 2006, 128, 9813; b) S. P. de Visser, J. Am. Chem. Soc. 2006, 128, 15809; c) R. Latifi, M. Bagherzadeh, S. P. de Visser, Chem. Eur. J. 2009, 15, 6651. [14] J. T. Groves, G. A. McClusky, J. Am. Chem. Soc. 1976, 98, 859. [15] a) O. Pestovsky, S. Stoian, E. L. Bominaar, X. P. Shan, E. Munck, L. Que, Jr., A. Bakac, Angew. Chem. 2005, 117, 7031; Angew. Chem. Int. Ed. 2005, 44, 6871; b) J. England, M. Martinho, E. R. Farquhar, J. R. Frisch, E. L. Bominaar, E. Mnck, L. Que, Jr., Angew. Chem. 2009, 121, 3676; Angew. Chem. Int. Ed. 2009, 48, 3622. [16] S. Ye, F. Neese, Curr. Opin. Chem. Biol. 2009, 13, 89. [17] M. L. Neidig, A. Decker, O. W. Choroba, F. Huang, M. Kavana, G. R. Moran, J. B. Spencer, E. I. Solomon, Proc. Natl. Acad. Sci. USA 2006, 103, 12966. [18] J. F. Berry, S. Debeer. George, F. Neese, Phys. Chem. Chem. Phys. 2008, 10, 4361. [19] S. Shaik, S. Cohen, S. P. de Visser, P. K. Sharma, D. Kumar, S. Kozuch, F. Ogliaro, D. Danovich, Eur. J. Inorg. Chem. 2004, 207. [20] A. Ghosh, E. Tangen, H. Ryeng, P. R. Taylor, Eur. J. Inorg. Chem. 2004, 4555. [21] F. Neese, J. Inorg. Biochem. 2006, 100, 716. [22] a) N. Strickland, J. N. Harvey, J. Phys. Chem. B 2007, 111, 841; b) J. Olh, J. N. Harvey, J. Phys. Chem. A 2009, 113, 7338.
Angew. Chem. 2010, 122, 5853 5856

5856

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
DOI: 10.1002/ange.200907254

Chemie

Combinatorial Chemistry

A Fragment-Based In Situ Combinatorial Approach To Identify HighAffinity Ligands for Unknown Binding Sites**
Sachin V. Shelke, Brian Cutting, Xiaohua Jiang, Hendrik Koliwer-Brandl, Daniel S. Strasser, Oliver Schwardt, Soerge Kelm, and Beat Ernst*
Dedicated to Professor Robert E. Ireland With his publication On the attribution and additivity of binding energies in 1981, Jencks[1] launched a new area in medicinal chemistry, that is, the so-called fragment-based drug discovery (FBDD).[2] When fragments are linked, their individual binding energies are additive. In addition, because of the reduction of translational and rigid body rotational degrees of freedom, the entropy barrier is markedly lowered.[3] Thus, by linking two low-affinity fragments, a new ligand with a substantially improved affinity for the target can be generated. However, this intriguing concept resulted in only a few scattered applications[4, 5] and had no immediate impact on drug discovery. For a practical application of this strategy two problems remained to be solved; firstly, how suitable fragments that bind to proximal binding sites (socalled first- and second-site fragments) can be identified, and secondly, how these fragments can be linked without distortions of their individual binding modes. The rapid development of this promising area[6] was initiated in 1996, when a conclusive practical demonstration of FBDD, called structureaffinity relationship by NMR (SAR-by-NMR) was reported.[7] With this novel approach, antagonists with nanomolar affinities were rapidly identified by tethering two fragments that were individually optimized by NMR spectroscopy. However, the implementation range of this technique was limited by the requirement for labeled proteins (13C and 15N) and for structural information on the binding site in order to design the linker. Subsequently, a broad array of innovative strategies for screening fragments were reported, for example, the needle approach[5] or tethering techniques detected by mass spectrometry.[8] Furthermore, the problem of the linker design was addressed by, for
[*] Dr. S. V. Shelke, Dr. B. Cutting, Dr. X. Jiang, Dr. D. S. Strasser, Dr. O. Schwardt, Prof. Dr. B. Ernst Institute of Molecular Pharmacy, University of Basel Klingelbergstrasse 50, 4056 Basel (Switzerland) Fax: (+ 41) 61-267-1552 E-mail: beat.ernst@unibas.ch H. Koliwer-Brandl, Prof. Dr. S. Kelm Department of Physiological Biochemistry, University of Bremen 28334 Bremen (Germany) [**] We would like to thank the Volkswagen Foundation, the Swiss National Science Foundation, the German Federal Ministry for Education and Research (BMBF, project 031632A) and the TnjesVagt Foundation (project XXI) for their support of this work. We are indebted to Jonas Egger for the graphic artwork (Figure 1). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.200907254.
Angew. Chem. 2010, 122, 5857 5861

example, Sharpless and co-workers,[9] who used the target itself as an atomic-scale reaction vessel for creating its own inhibitor or by applying a shape-modulating linker design.[10] Herein we present a novel fragment-based approach that does not require any spatial information on the binding site and can be conducted with modest amounts of unlabeled protein. Our target is the myelin-associated glycoprotein (MAG, Siglec-4), a sialic acid binding immunoglobulin-like lectin (Siglec),[11] which inhibits as one of several myelin components axonal regrowth after injury.[12] The recently reported use of monovalent glycosides[13] to reverse MAGmediated blocking of axonal regeneration encouraged the search for high-affinity ligands. Oligo- and monosaccharide derivatives based on the ganglioside GQ1ba,[14] which was the hitherto best reported natural MAG antagonist, exhibit only micromolar affinities.[15] Therefore, an alternative approach to identify high-affinity ligands was required. Because the crystal structure of MAG is not yet available, a homology model[16] based on the crystal structure of sialoadhesin (Siglec-1),[17] another member of the Siglec family, was investigated. This model revealed a shallow, unstructured binding site, which does not provide any obvious additional interaction sites and therefore little prospect for success by a structure-based approach. This result prompted us to develop a novel, three-step fragment-based in situ combinatorial approach, which is especially suited if little or no structural information on the binding site is available.[18] A first-site ligand with a moderate, that is, micromolar affinity, either based on a physiological ligand or identified by random screening, serves as starting point. In order to search for second-site ligands, members of a fragment library, which bind to the target protein, are identified by an NMR experiment that is based on the change of their transverse magnetization decay upon binding (Figure 1 a).[19] From these hits, fragments that bind to a second site located adjacent to the first site are identified by their enhanced paramagnetic relaxation caused by the spin-labeled first-site ligand (Figure 1 b). Successful applications of spin labels for ligand screening[20ac] as well as the characterization of binding sites[20d] have already been reported. Because the paramagnetic relaxation is distance-dependent, not only fragments that bind at a proximal subsite, but also their spatial orientation and hence the correct linking point can be elucidated.[20e] Finally, the target protein is incubated with a library of first- and second-site fragments functionalized with azido or acetylene groups at the end of flexible methylene chains of variable length (Figure 1 c). Only in the case of an

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5857

Zuschriften

Figure 1. Fragment-based in situ combinatorial approach for the identification of ligands for an unknown binding site. a) Identification of second-site ligands based on their transverse magnetization decay upon binding; b) selection of second-site ligands binding adjacent to the spin-labeled first-site ligand; c) incubation of the target protein with libraries of first- and second-site ligands; d) a high-affinity ligand is generated by receptor-mediated triazole formation. The receptor is shown in green.

optimal spatial orientation, which results from the binding of two compatible fragments to MAG, is a high-affinity ligand generated by a receptor-mediated triazole formation (Figure 1 d).[9] For our investigations, recombinant MAG, which consists of the three N-terminal domains of MAG and the Fc fragment of human antibody immunoglobulin G (IgG; MAGd1-3-Fc) was expressed in chinese hamster ovary (CHO) cells and affinity purified on protein A agarose.[21] As a first-site ligand, the sialic acid derivative 1 with 137 mm MAG affinity[15c] was selected (Figure 2). Our fragment library for the identification of second-site ligands was composed of 80 low-molecular-weight (Mw < 300), moderately lipophilic (c logP < 3; P = partition coefficient octanol/water) and highly soluble organic molecules. Whereas the limitations of Mw and logP for fragments are well documented (Rule of Three),[22] water solubility is a prerequisite for the success of the planned NMR spectroscopic screens. The fragment library was divided into sublibraries, each of which contained 6 to 10 compounds. The sublibraries were composed according to two criteria: 1) the members of a sublibrary do not interact with each other and 2) each component shows at least one isolated resonance in the 1 H NMR spectrum of the sublibrary. Members of the sublibraries that bind to MAGd1-3-Fc were identified based on the change of their transverse magnetization decay, which occurs upon complex formation.[23] The magnetization decay is molecular-weight-dependent and therefore allows a differentiation between small ligands, that is, fragments in solution, and large molecules, that is, fragments that are bound to the receptor. When the 1H NMR spectra of the sublibraries were recorded at relaxation times of 10 and 200 ms, the low-molecular-weight fragments of the sublibrary experienced only small magnetization decays. When MAGd1-3-Fc was added, those fragments that bind to the protein, that is, those that formed a fragmentprotein complex, behaved as large molecules and therefore suffered

Figure 2. Principle of second-site screening. a) 1H NMR resonance of H-C(4) of 5-nitroindole 4 ; b) decay of transverse magnetization caused by binding of 4 to MAGd13-Fc; c) paramagnetic relaxation enhancement on 4 caused by the spin-labeled first-site ligand 2*; d) recovery of the paramagnetic relaxation enhancement by the addition of ascorbic acid, which reduced 2* to 3.

from large magnetization decays. A number of fragments of the various sublibraries were identified to bind on the surface of the target protein. However, their exact binding site was still not known. For the identification of the hits that bound adjacent to the binding site of 1, spinspin relaxation NMR experiments reported by Jahnke et al.[20a] were applied. Spinspin relaxation rates are proportional to the product of the squares of the gyromagnetic ratio g of the involved spin. Although it is the second highest among all isotopes, the g value of protons and hence also the spinspin relaxation rate are small. However, for the detection of ligand binding, the spinspin relaxation rates should be as large as possible. Because the g value of an unpaired electron is 658 times larger than that of a proton, the spinspin relaxation rates caused by an unpaired electron on protons (known as paramagnetic relaxation enhancement) are dramatically larger than the effect of a nuclearnuclear interaction.[24] Therefore, the spin-labeled first-site ligand 2*,
Angew. Chem. 2010, 122, 5857 5861

5858

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
which contains an unpaired electron, was synthesized (Figure 2; for the synthesis see the Supporting Information). Compound 2* is a conjugate of first-site ligand 1 and the TEMPO (2,2,6,6-tetramethylpiperidin-1-oxyl) spin label. Compound 1 and the N-hydroxy derivative 3, which is the reduced form of TEMPO derivative 2*, exhibited similar affinities (1: 137 mm ; 3 : 96 mm ) in surface plasmon resonance (SPR) experiments[15c] as well as comparable transfer of magnetization from MAG in saturation transfer difference NMR (STD NMR).[25] It was therefore assumed that the TEMPO spin label does not substantially alter the binding mode of the first-site ligand. The sequence of NMR experiments required for the identification of a second-site ligand binding adjacent to the first-site ligand is shown for the second-site ligand 5-nitroindole 4 in Figure 2. When the 1H NMR spectrum was recorded at two relaxation times, 10 and 200 ms, only a minimal decay of magnetizationas exemplified for H-C(4) of 4was observed (Figure 2 a). Addition of MAGd1-3-Fc led to a pronounced decay of transverse magnetization, thus indicating binding of 4 (Figure 2 b). When the spin-labeled first-site ligand 2* was added, a further enhancement of paramagnetic relaxation was observed, therefore suggesting simultaneous binding of 2* and 4 at neighboring binding sites (Figure 2 c).[20a] Finally, when the spin label was reduced by adding ascorbic acid to the NMR sample, the effect was cancelled, thus attributing the paramagnetic relaxation effect unambiguously to the spin label (Figure 2 d). Because the paramagnetic relaxation enhancement caused by the spin label is distance-dependent and is therefore potentially different for each proton of the second-site ligand,[24] the spatial orientation of 4 could be determined. The effect is largest for H-C(2), thus indicating that this proton is facing the spin label. Therefore, the carbon atoms of the pyrrole ring of 5-nitroindol 4 represent the optimal linking positions (see the Supporting Information). For the linking of an appropriate first- and second-site ligand, the in situ click chemistry approach reported by Sharpless and co-workers[9] was applied. In this approach, the triazole formation does not result from copper catalysis but from the receptor-mediated preorganization of azide and acetylene to enable the [3+2] cycloaddition. For libraries of first- (5 ad) and second-site ligands (6 ac ; Scheme 1, for synthetic details see the Supporting Information), two requirements had to be met. Firstly, flexible spacer arms should guarantee that the two terminal functionalities, that is, the acetylene and the azido groups attached to the first- and second-site ligand, can adopt the optimal spatial orientation to undergo a [3+2] Huisgen cycloaddition reaction.[26] Secondly, the entropic penalties associated with rotatable bonds should be kept low by the short spacers.[27] This requirement is in agreement with the reach of the spin label of about 10 .[24] In previous in situ click chemistry studies,[9ad] building blocks with nano- to low micromolar affinity for the target have been utilized. Because our ligands exhibit affinities in the range of 100 mm to millimolar as estimated by SPR[15c] and the fluorescent hapten binding assay,[21] their receptor-mediated linking represents a borderline case similar to that already discussed by Fokin et al.[9e]
Angew. Chem. 2010, 122, 5857 5861

Chemie

Scheme 1. The library of first-site ligands consisted of four members, 5 ad, the library of second-site ligands of three, 6 ac. In total, 24 different triazoles, 12 anti-triazoles and 12 syn-triazoles could be formed.

For the in situ click experiment, MAGd13-Fc[21] (6.47 mm ) was incubated with a mixture of the four first-site ligands 5 ad (each 330 mm ) and the three second-site ligands 6 ac (each 660 mm ) in phosphate buffer (pH 7.4) at 37 8C for 3 days, thus in principle permitting the formation of 12 syn-substituted and 12 anti-substituted triazoles. The differing concentrations of the first- and second-site ligands were used to compensate for their different affinities for MAG (see above). The analysis of the supernatant by LCMS in selected ion mode (SIM) after 3 days showed one major new molecular ion of m/z 694.2, which fits for three syn- and three antisubstituted triazoles, formed by [3+2]cycloaddition of 5 a and 6 c, 5 b and 6 b, and 5 c and 6 a, respectively. In addition, the other possible molecular ions were also present in low, but still detectable amounts. A control experiment carried out in the absence of MAG showed that the cycloaddition products were formed at comparable rates, which can be attributed to uncatalyzed background reactions. The differentiation between the three syn/anti pairs with the same molecular weight but different spacer patterns was possible by using mass spectrometry (Scheme 2 and the Supporting Information). In the MSMS mode with negative ionization, only two major fragments, with m/z 300.1 and m/z 393.1, could be detected beside the molecular ion (m/z 694.2). These species are formed by fragmentation of the glycosidic bond. Although the collision energy was varied from 5 to 50 V, fragments originating from exocyclic a fragmentation of the triazole could not be identified. However, a fragment m/z 492.2 was identified by SIM; this fragment can only be obtained by a fragmentation of the syn- and antitriazoles 7 formed from 5 a and 6 c (see the Supporting www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5859

Zuschriften

Scheme 2. As differentiation between anti-7 and syn-7 was not possible by spectroscopic means, they were both synthesized (see the Supporting Information) and biologically evaluated. Differentiation can be unambiguously made between the three possible syn/anti pairs with a molecular weight of 694.2 according to the fragments obtained by a fragmentation.

Information). As a further differentiation between the syn and anti product was not possible, syn-7 and anti-7 were synthesized under thermal conditions (see the Supporting Information) and biologically tested. In an SPR experiment with MAGd1-3-Fc immobilized on a protein A modified chip surface,[15c] KD values of 190 nm for anti-7 and 2 mm for syn-7 were obtained (Scheme 2). This result leads to the assumption that anti-7 was formed in the in situ click experiment, although the formation of both, anti-7 and syn-7 can not yet be excluded. An MAG antagonist that exhibits a 1000-fold improved affinity relative to the tetrasaccharide epitope of GQ1ba (KD : 180 mm [15b]) was identified for anti-7. STD NMR[25] experiments showed large contributions to binding from both terminal aromatic groups, the benzamide and the 5-nitroindole moiety (Figure 3). In addition, the triazole linking the first-site ligand 5 a and the second-site ligand 6 c also contributes to the interaction with MAG. This observation is consistent with previous experiments where the replacement of the methyl aglycon in sialoside 1 by a benzyl substituent led to an affinity enhancement that was approximately 10-fold.[15h] In summary, the identification of a second-site ligand by NMR screening using a spin-labeled first-site ligand[20a] followed by a receptor-mediated linking of first- and second-site ligand[9] yielded a nanomolar MAG antagonist, which is currently under further biological evaluation. The synthetic effort is substantially reduced compared to a conventional approach. Beside the composition of the second-site library and the synthesis of the first-site ligand substituted with TEMPO, only seven compounds had to be synthesized to successfully identify a high-affinity antagonist. A particular strength of this approach is that no structural information of the target protein is required. The identification of a nanomolar mimetic of the physiological ligand is extremely tedious, especially for the shallow binding sites of various lectins such as the sLex-E-selectin interaction. In many cases the approach is only partially

Figure 3. The binding epitope of anti-7 was mapped through STD NMR experiments. The percentages shown in the structure indicate the level of transfer of magnetization to a particular hydrogen atom relative to transfer of magnetization received by the N-acetyl methyl group. The large percentages on the benzamide hydrogens are consistent with previously reported SAR studies.[15d] In addition, large percentages were identified on the nitroindole, thus rationalizing the enhanced affinity of anti-7.

successful, for example, for the trimannoside-DC-SIGN interaction.[15a] When applied to these proteins, the presented fragment-based in situ combinatorial approach could be valuable in supporting the identification of high-affinity glycomimetics and could develop into a useful tool in drug discovery.
Received: December 23, 2009 Revised: May 3, 2010 Published online: July 7, 2010

Keywords: in situ click chemistry fragment-based in situ combinatorial approach drug discovery glycoproteins NMR spectroscopy

[1] W. P. Jencks, Proc. Natl. Acad. Sci. USA 1981, 78, 4046 4050. [2] For recent reviews, see: a) P. J. Hajduk, J. Greer, Nat. Rev. Drug Discovery 2007, 6, 211 219; b) G. Chessari, A. J. Woodhead, Drug Discovery Today 2009, 14, 668 675; c) C. W. Murray, D. C. Rees, Nat. Chem. 2009, 1, 187 192. [3] A. V. Finkelstein, J. Janin, Protein Eng. 1989, 3, 1 3. [4] C. L. M. J. Verlinde, G. Rudenko, W. G. J. Hol, J. Comput.-Aided Mol. Des. 1992, 6, 131 147. [5] H. J. Boehm, M. Boehringer, D. Bur, H. Gmuender, W. Huber, W. Klaus, D. Kostrewa, H. Kuehne, T. Luebbers, N. MeunierKeller, F. Mueller, J. Med. Chem. 2000, 43, 2664 2674. [6] Fragment-based Approaches in Drug Discovery (Eds: W. Jahnke, D. A. Erlanson), Wiley-VCH, Weinheim, 2006. [7] S. B. Shuker, P. J. Hajduc, R. P. Meadows, S. W. Fesik, Science 1996, 274, 1531 1534.
Angew. Chem. 2010, 122, 5857 5861

5860

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[8] D. A. Erlanson, A. C. Braisted, D. R. Raphael, M. Randal, R. M. Stroud, E. M. Gordon, J. A. Wells, Proc. Natl. Acad. Sci. USA 2000, 97, 9367 9372. [9] a) W. G. Lewis, L. G. Green, F. Grynszpan, Z. Radic, P. R. Carlier, P. Taylor, M. G. Finn, K. B. Sharpless, Angew. Chem. 2002, 114, 1095 1099; Angew. Chem. Int. Ed. 2002, 41, 1053 1057; b) R. Manetsch, A. Krasinski, Z. Radic, J. Raushel, P. Taylor, K. B. Sharpless, H. C. Kolb, J. Am. Chem. Soc. 2004, 126, 12809 12818; c) V. P. Mocharla, B. Colasson, L. V. Lee, S. Roeper, K. B. Sharpless, C.-H. Wong, H. C. Kolb, Angew. Chem. 2005, 117, 118 122; Angew. Chem. Int. Ed. 2005, 44, 116 120; d) A. Krasinski, Z. Radic, R. Manetsch, J. Raushel, P. Taylor, K. B. Sharpless, H. C. Kolb, J. Am. Chem. Soc. 2005, 127, 6686 6692; e) M. Whiting, J. Muldoon, Y.-C. Lin, S. M. Silverman, W. Lindstrom, A. J. Olson, H. C. Kolb, M. G. Finn, K. B. Sharpless, J. H. Elder, V. V. Fokin, Angew. Chem. 2006, 118, 1463 1467; Angew. Chem. Int. Ed. 2006, 45, 1435 1439. [10] C. Palomo, J. M. Aizpurua, E. Balentov, I. Azecune, J. I. Santos, J. Jimnez-Barbero, J. C. Canada, J. I. Miranda, Org. Lett. 2008, 10, 2227 2300. [11] a) G. Mukhopadhyay, P. Doherty, F. S. Walsh, P. R. Crocker, M. T. Filbin, Neuron 1994, 13, 757 767; b) R. H. Quarles, J. Neurochem. 2007, 100, 1431 1448. [12] R. H. Quarles, Neurochem. Res. 2009, 34, 79 86. [13] A. A. Vyas, O. Blixt, J. C. Paulson, R. L. Schnaar, J. Biol. Chem. 2005, 280, 16305 16310. [14] L. J.-S. Yang, C. B. Zeller, N. L. Shaper, M. Kiso, A. Hasegawa, R. E. Shapiro, R. L. Schnaar, Proc. Natl. Acad. Sci. USA 1996, 93, 814 818. [15] a) B. Ernst, J. L. Magnani, Nat. Rev. Drug Discovery 2009, 8, 661 677; b) S.-Y. Shin, H. Gthje, O. Schwardt, G.-P. Gao, B. Ernst, S. Kelm, B. Meyer, ChemBioChem 2008, 9, 2946 2949; c) O. Schwardt, H. Gthje, G.-P. Gao, S. Mesch, J. von Orelli, M. Spreafico, A. Vedani, S. Kelm, B. Ernst, J. Med. Chem. 2009, 52, 989 1004; d) S. V. Shelke, G.-P. Gao, S. Mesch, H. Gthje, S. Kelm, O. Schwardt, B. Ernst, Bioorg. Med. Chem. 2007, 15, 4951 4965; e) G.-P. Gao, M. Smiesko, O. Schwardt, H. Gthje, S. Kelm, A. Vedani, B. Ernst, Bioorg. Med. Chem. 2007, 15, 7459 7469; f) D. Schwizer, H. Gthje, S. Kelm, M. Porro, O. Schwardt, B. Ernst, Bioorg. Med. Chem. 2006, 14, 4944 4957; g) O. Blixt, K. Allin, L. Pereira, A. Datta, J. C. Paulson, J. Am. Chem. Soc. 2002, 124, 5739 5746; h) S. Kelm, R. Brossmer, R. Isecke, H.-J. Gross, K. Strenge, R. Schauer, Eur. J. Biochem. 1998, 255, 663 672. A. Bhunia, O. Schwardt, H. Gthje, G.-P. Gao, S. Kelm, A. J. Benie, M. Hricovini, T. Peters, B. Ernst, ChemBioChem 2008, 9, 2941 2945. A. P. May, R. C. Robinson, M. Vinson, P. R. Crocker, E. Y. Jones, Mol. Cell 1998, 1, 719 728; Brookhaven protein data bank acquisition code 1QFO. B. Ernst, B. Cutting, S. V. Shelke, PCT/WO2007/105094A1, 2006. G. Otting, Curr. Opin. Struct. Biol. 1993, 3, 760 768. a) W. Jahnke, L. B. Perez, C. G. Paris, A. Strauss, G. Fendrich, C. M. Nalin, J. Am. Chem. Soc. 2000, 122, 7394 7395; b) W. Jahnke, S. Rdisser, M. Zurini, J. Am. Chem. Soc. 2001, 123, 3149 3150; c) J. Vazquez, L. Tautz, J. J. Ryan, K. Vuori, T. Mustelin, M. Pellecchia, J. Med. Chem. 2007, 50, 2137 2143; d) N. U. Jain, A. Venot, K. Umemoto, H. Leffler, J. H. Prestegard, Protein Sci. 2001, 10, 2393 2400; e) I. Bertini, M. Fragai, Y.-M. Lee, C. Luchinat, B. Terni, Angew. Chem. 2004, 116, 2304 2306; Angew. Chem. Int. Ed. 2004, 43, 2254 2256. N. Bock, S. Kelm in Methods in Molecular Biology, Vol. 347 (Ed.: I. Brockhausen), Humana Press, Totowa, NJ, 2006, pp. 359 376. M. Congreve, R. Carr, C. Murray, H. Jhoti, Drug Discovery Today 2003, 8, 876 877. P. J. Hajduk, E. T. Olejniczak, S. W. Fesik, J. Am. Chem. Soc. 1997, 119, 12257 12261. I. Bertini, C. Luchinat, G. Parigi, R. Pierattelli, ChemBioChem 2005, 6, 1536 1549. a) M. Mayer, B. Meyer, Angew. Chem. 1999, 111, 1902 1906; Angew. Chem. Int. Ed. 1999, 38, 1784 1788; b) M. Mayer, B. Meyer, J. Am. Chem. Soc. 2001, 123, 6108 6117. a) R. Huisgen, G. Szeimies, L. Moebius, Chem. Ber. 1967, 100, 2494 2507; b) R. Huisgen in 1,3-Dipolar Cycloaddition Chemistry, Vol. 1 (Ed.: A. Padwa), Wiley, New York, 1984, pp. 1 176. F. Mammen, E. I. Shakhnovich, G. M. Whitesides, J. Org. Chem. 1998, 63, 3168 3175.

Chemie

[16]

[17]

[18] [19] [20]

[21] [22] [23] [24] [25]

[26]

[27]

Angew. Chem. 2010, 122, 5857 5861

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5861

Zuschriften
Natural Products
DOI: 10.1002/ange.201000032

Biochemical and Structural Characterization of the Tautomycetin Thioesterase: Analysis of a Stereoselective Polyketide Hydrolase**
Jamie B. Scaglione, David L. Akey, Rachel Sullivan, Jeffrey D. Kittendorf, Christopher M. Rath, Eung-Soo Kim, Janet L. Smith, and David H. Sherman*
Tautomycetin (TMC) is a polyketide metabolite produced by Streptomyces sp. CK4412 and Streptomyces griseochromogenes.[1] This intriguing molecule was previously shown to possess activated T-cell-specific immunosuppressive activity with a novel mode of pharmacological action, both in vivo and in vitro.[2] More recent studies have also revealed promising anticancer activity in a variety of models.[35] The biosynthesis of complex polyketide compounds in bacteria often occurs by an assembly-line type mechanism that is catalyzed by type I modular polyketide synthases (PKSs). In a key final step, the characteristic macrolactone scaffold is generated for the macrolide antibiotics erythromycin and pikromycin.[6] This termination process is catalyzed by a thioesterase (TE) domain that is located at the carboxyterminus of the final PKS elongation module. The activity of this domain results in cleavage of the acyl chain from the adjacent ACP, followed (typically) by macrocyclization.[7, 8] The macrolactone is often modified further to give the final bioactive compound.[9] The structure of TMC is highly unusual;[10] it is one of the few known examples of a polyketide natural product that bears a terminal alkene group (Figure 1). The TMC biosynthetic gene cluster (tmc) has recently been characterized, revealing two putative type I PKSs (TmcA and TmcB), along with 16 additional gene products that are presumably

Figure 1. TMC, produced by Streptomyces sp. CK4412.

[*] Dr. J. B. Scaglione, Dr. D. L. Akey, R. Sullivan, Dr. J. D. Kittendorf, C. M. Rath, Prof. Dr. J. L. Smith, Prof. Dr. D. H. Sherman Life Sciences Institute, University of Michigan Ann Arbor, MI 48109 (USA) E-mail: davidhs@umich.edu Prof. Dr. D. H. Sherman Department of Medicinal Chemistry, Department of Chemistry Department of Microbiology and Immunology, University of Michigan Ann Arbor, MI 48109 (USA) Prof. Dr. J. L. Smith Department of Biological Chemistry, University of Michigan (USA) Prof. Dr. E.-S. Kim Department of Biological Engineering, Inha University (Korea) [**] This work was supported by the NIH (grant GM076477) and the Hans W. Vahlteich Professorship (D.H.S.), UL1RR024986 (J.B.S), by NIH grant DK042303 (J.L.S.), and by KOSEF grant (MEST 20090078663; E.-S.K.) GM/CA CAT is supported by the NIH National Institute of General Medical Sciences and the National Cancer Institute at the APS, which is supported by the US Department of Energy Office of Science. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201000032.

involved in chain construction, tailoring, and regulation (Figure 2).[11, 12] Based on pathway annotation and biosynthetic principles, we hypothesized that the TMC TE catalyzes termination of chain assembly through generation of the free acid, as it contains the highly conserved sequence GxSxG and GdH motifs, as well as the Ser-His-Asp catalytic triad, characteristic of the a,b-hydrolase class of serine hydrolases. Installation of the terminal olefin is presumed to occur through decarboxylative dehydration during the post-PKS maturation of the polyketide to form the final TMC product. DNAsequence analysis of open reading frames downstream of TMC reveals several potential candidate enzymes for catalyzing this transformation: two putative decarboxylases and a dehydratase.[11, 12] These biosynthetic steps remain unclear, thus motivating us to elucidate the biochemical details of this process. Based on our efforts to understand chain termination and terminal alkene formation in the biosynthesis of TMC, we report herein the cloning, biochemical characterization, and the 2.0 crystal structure of the TE domain for this pathway; the first high-resolution structural analysis of a linear chainterminating TE. The TMC TE was amplified from cosmid pTMC2290 and inserted into the vector pMCSG7 (see the Supporting Information).[11] To assess enzyme function, two short-chain enantiomerically pure TMC substrate mimics were synthesized in two steps (Scheme 1).[13, 14] We first evaluated the hydrolysis of model substrates 4 and 5 by the TMC TE. After overnight incubation and LCMS analysis, we found that the enzyme was greater than 350 times more active toward the (R)-isomer 4 than the (S)-isomer 5 (Figure 3). This observation was surprising, as previously characterized TEs from macrolactone-forming PKSs exhibit a high degree of substrate and stereochemical tolerance.[15, 16] However, this selectivity is consistent with the predicted stereochemistry of the bhydroxy group (eliminated during decarboxylative dehydration) based on sequence analysis of the preceding module 9 KR domain (see the Supporting Information, Figure S2).[17] Mutation of the TMC TE active site Ser132 to Ala completely abrogated hydrolysis of the substrate (not shown) and confirmed its key role in catalysis.
Angew. Chem. 2010, 122, 5862 5866

5862

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte

Chemie

Figure 2. Proposed steps in the TMC biosynthetic pathway. KS = ketosynthase, AT = acyltransferase, ACP = acyl carrier protein, DH = dehydratase, KR = ketoreductase, ER = enoylreductase, TE = thioesterase. Domains predicted to be inactive are crossed out. Domains that are active but not utilized are indicated with a star. The ordering of post-PKS tailoring reactions is unknown. KSQ = malonyl-ACP decarboxylase.

Scheme 1. Synthesis of N-acetylcysteamine (NAC) short chain TMC analogues. Reagents and conditions: a) trans-2-ethyl-2-hexenal, tin triflate, N-ethylpiperidine, CH2Cl2, 78 8C, 70 %; b) NAC, imidazole (3 equiv), CH2Cl2, 85 %; c) LiOH, H2O2, 10 % aq. THF, 90 %.
Angew. Chem. 2010, 122, 5862 5866

Steady-state kinetic analysis of the TMC TE was performed with compound 4 using a discontinuous coupled fluorescence-based assay.[19] The TE was found to have a catalytic efficiency of (22 2) m1 s1, with a kcat of (2.2 0.2) min1 and a Km of (1.7 0.3) mm , based on the nonlinear regression fit to the MichaelisMenten equation (R2 = 0.85; see the Supporting Information, Figure S3). Whilst relatively slow against 4, this efficiency is comparable to previously described kinetic parameters for the pikromycin and erythromycin TEs using model diketide substrates.[20] Interestingly, the data fit equally well to the allosteric kinetic model (R2 = 0.88), yielding similar kinetic constants as the previous fit (see the Supporting Information, Figure S3). Moreover, the Hill coefficient that was calculated from this fit (1.7) is consistent with possible enzyme cooperativity. If true, this finding, to the best of our knowlege, represents the first report of allosterism demonstrated by a thioesterase; however, these results should be interpreted with care given that www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5863

Zuschriften
surrounded by five a helices (Figure 4 a). Canonical a/bhydrolase domains include a helix between b6 and b7 which is lacking in the macrolactone-forming Pik and DEBS TEs. This helix (a4) is present in TMC TE and is proposed to impact the processing of the product, thus directing hydrolysis as opposed to cyclization (see below). The lid domain consists of four a helices, two (aL1 and aL2) from the N-terminal thirty-three residues, and two (aL3 and aL4) from a forty-five residue region between b5 and b6. As with Pik and DEBS TEs, the dimer interface is mediated exclusively through the

Figure 3. Hydrolysis by the TMC TE. a) 4 or 5, no enzyme; b) 4 with TE; c) 5 with TE; d) pikromycin hexaketide, no enzyme; e) pikromycin hexaketide with TE. All substrates were at 5 mm concentrations and incubated overnight with 1 mm enzyme before analysis by LCMS. All masses were as expected and, for traces (b) and (c), the retention time of the acid matched that of the standard 6 (see the Supporting Information, Figure S1). Comparison of the shape and size of the active site tunnel in TMC TE, relative to the homologous Pik and DEBS TEs revealed why the enzyme forms a linear hydrolysis product as opposed to a macrolactone. The bulky side chains of Tyr161, Phe163, and Leu205 constrict the exit side of the substrate tunnel, leaving only enough space for an extended acyl chain (Figure 4 c).

the recombinant TE domain was removed from its native polypeptide context for this study. No hydrolysis of the corresponding (S)-isomer 5 was observed at these concentrations over this time period. Next, we examined the ability of the TMC TE to catalyze the intramolecular cyclization of the linear pikromycin hexaketide intermediate to form the 12-membered ring, macrolactone 10-deoxymethynolide.[18] This substrate possesses the (R)-b-hydroxy stereochemistry that is preferred by the TMC TE. Although cyclization of the hexaketide did not occur, partial hydrolysis to the linear carboxylic acid was observed after overnight incubation with the enzyme (Figure 3). This hydrolysis revealed some substrate flexibility of the TMC TE as its native substrate (final chain elongation intermediate, Figure 2) lacks an a-methyl group, and the distal portions of the two compounds differ considerably. To understand the basis for this unique selectivity further, we pursued structural analysis of the TMC TE protein, which is a dimeric member of the a/b-hydrolase family that has a fold similar to other type I PKS TEs.[15, 19] The protein structure consists of two discrete motifs, an a/b-hydrolase core capped by an a-helix lid domain. The a/b-hydrolase core fold is a seven-stranded, predominantly parallel b-sheet

Figure 4. Structure of TMC TE. a) Stereodiagram of TMC TE monomer, rainbow colored from the N-terminus (blue) to the C-terminus (red). The active site triad is shown as spheres. Lid and a/b-hydrolase core domains are indicated. The pointer (red rod) indicates the direction of entry into the substrate tunnel. b) TMC TE dimer interactions are mediated by the lid domains (yellow). The substrate tunnel (shown for one monomer) passes through the protein with the active site (spheres) in the center. The dimer axis is vertical in this view. The pointer (red rod) is the same as for (a). c) Stereodiagram of the active site, looking from the entrance (along the red rod in part a). Pik TE (grey) is superimposed on TMC TE (blue) with TMC TE substrate channel (yellow surface). The catalytic triad and residues that constrict the active site relative to Pik TE are labeled. Equivalent residues are labeled with the TMC TE designation above the Pik TE designation. Helix a4 is present only in the TMC TE structure. Figure S7 (see the Supporting Information) shows comparison with the Pik TE substrate tunnel.
Angew. Chem. 2010, 122, 5862 5866

5864

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
two N-terminal helices (aL1 and aL2) that form the top of the lid domain (Figure 4 b). In accord with other type I TEs, the active site triad (Ser132, Asp159, and His255) is located on loops at the Cterminal edge of the core b-sheet after b4, b5, and b7. Ser132 is positioned in a classic nucleophilic elbow within the signature sequence Gly130-His131-Ser132-Xaa-Gly134. The oxyanion hole is formed from the backbone amide groups from Ser133 and Thr66. As observed previously with Pik TE and DEBS TE,[8, 15, 19] the active site is located at the center of an elongated substrate tunnel, which is open at both ends, that spans the width of the enzyme (Figure 4 b). Compared to Pik and DEBS TEs, the TMC TE substrate tunnel is relatively narrow and constricted in the region containing the polyketide intermediate during hydrolysis. Despite these insights, a structural rationale for the observed chiral preference of TMC TE for (R)-b-OH is not readily apparent. We surmise that in the free-enzyme structure, the Ser133 side-chain (adjacent to the catalytic Ser132) blocks the presumed oxyanion hole by hydrogen bonding with the backbone NH of Thr66. The Ser133 sidechain CaCb bond must rotate in order for the substrate thioester oxygen to occupy the oxyanion hole. However, substrate modeling into the active site suggests that, owing to the restricted dimensions of the chamber, only the (R)-b-OH can be accommodated with the Ser133 side-chain rotated to either of the available alternative rotamer positions. Based on previous work that revealed a strategy for converting the rat FAS type II TE from a hydrolase into an acyltransferase by double mutation of the active site Ser132 to Cys and His255 to Arg,[20] we were motivated to determine whether the corresponding mutations in the TMC TE would provide both an acyl-enzyme intermediate for use in further structural studies, as well as a valuable acyltransferase for generating new acyl-CoA (CoA = coenzyme A) species. The double mutant was obtained and incubated overnight with either thioester 4 or 5 to form an acyl-enzyme intermediate that was observed by low-resolution mass spectrometry (see the Supporting Information, Figure S4), with no evidence of hydrolysis of the thioesters to the carboxylic acids (not shown). High-resolution Fourier-transform ion cyclotron resonance mass spectrometry (FT-ICR MS) analysis revealed that the intact protein was labeled in a 2.5:1 ratio (see the Supporting Information, Figure S5). Trypsin digestion of the acylated TMC TE protein followed by high-resolution MS confirmed that loading occurred at the Cys132 residue (see the Supporting Information, Table S2). In contrast, no labeling of wild-type TMC TE (see the Supporting Information, Figure S4) nor the S132C or H255R single mutants were observed (not shown). Efforts to crystallize the acyl-enzyme species are ongoing. After observation of an acyl-enzyme intermediate, we attempted to displace the acyl group with free CoA to create a new CoA thioester. This method would be useful for the formation of synthetically challenging CoA substrates and the conversion of off-loaded biosynthetic intermediates into CoAs for use in chemoenzymatic synthesis. The reaction was attempted using two different methods, but formation of a new CoA species was only observed with method 2 (see the
Angew. Chem. 2010, 122, 5862 5866

Chemie

Supporting Information). However, this formation was nonenzymatic, as the new compound was observed in the presence and absence of enzyme (see the Supporting Information, Figure S6), thereby suggesting a chemical transthioesterification at high pH values. Whilst this result was surprising, we expect that this method will be generally applicable for the synthesis of small quantities of novel CoA compounds when the starting thioester is not sensitive to high pH levels. The TE Ser132Cys and His255Arg double mutant also provides a general strategy for affinity labeling of thioesterase enzymes with a range of natural and unnatural substrates. In summary, the TMC TE is a polyketide hydrolase that exhibits a high degree of stereoselectivity at the b-hydroxy position. X-ray crystallography has provided the first highresolution structure of a linear polyketide-chain-terminating TE, which shows the enzyme to have a constrained substrate chamber relative to macrolactone-forming TEs. Although the basis for relatively low substrate tolerance remains unclear, it is now possible to assess the role of specific amino acid residues that might be important in the observed stereoselectivity toward acyl-(R)-b-OH. Moreover, construction of a double mutant form of select TMC TE active site residues has provided a new method for affinity labeling of the enzyme active site that should be applicable to other members of the b-hydrolase family of TEs. Finally, this work provides a path to explore a process for polyketide termination that involves initial release of the polyketide chain followed by decarboxylative elimination. This represents a unique mechanism compared to the recently elucidated curacin TE that catalyzes concomitant hydrolysis and decarboxylative elimination of sulfate leading to a terminal olefin as a final step in the pathway.[21]
Received: January 4, 2010 Published online: July 9, 2010

Keywords: acyltransferases polyketides structure elucidation tautomycetin thioesterases

[1] X. C. Cheng, T. Kihara, X. Ying, M. Uramoto, H. Osada, H. Kusakabe, B. N. Wang, Y. Kobayashi, K. Ko, I. Yamaguchi, Y.-C. Shen, K. Isono, J. Antibiot. 1989, 42, 141. [2] J. H. Shim, H. K. Lee, E. J. Chang, W. J. Chae, J. H. Han, D. J. Han, T. Morio, J. J. Yang, A. Bothwell, S. K. Lee, Proc. Natl. Acad. Sci. USA 2002, 99, 10617. [3] J. T. Adler, M. Cook, Y. Luo, S. C. Pitt, J. Ju, W. Li, B. Shen, M. Kunnimalaiyaan, H. Chen, Mol. Cancer Ther. 2009, 8, 914. [4] S. Mitsuhashi, H. Shima, Y. Li, N. Tanuma, T. Okamoto, K. Kikuchi, M. Ubukata, Int. J. Oncol. 2008, 33, 1027. [5] J. H. Lee, J. S. Lee, S. E. Kim, B. S. Moon, Y. C. Kim, S. K. Lee, K. Y. Choi, Mol. Cancer Ther. 2006, 5, 3222. [6] B. Wilkinson, J. Micklefield, Nat. Chem. Biol. 2007, 3, 379. [7] J. W. Giraldes, D. L. Akey, J. D. Kittendorf, D. H. Sherman, J. L. Smith, R. A. Fecik, Nat. Chem. Biol. 2006, 2, 531. [8] D. L. Akey, J. D. Kittendorf, J. W. Giraldes, R. A. Fecik, D. H. Sherman, J. L. Smith, Nat. Chem. Biol. 2006, 2, 537. [9] C. T. Walsh, Science 2004, 303, 1805. [10] X. C. Cheng, M. Ubukata, K. Isono, J. Antibiot. 1990, 43, 890. [11] S. S. Choi, Y. A. Hur, D. H. Sherman, E. S. Kim, Microbiology 2007, 153, 1095.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5865

Zuschriften
[12] W. Li, Y. Luo, J. Ju, S. R. Rajski, H. Osada, B. Shen, J. Nat. Prod. 2009, 72, 450. [13] Y. Nagao, W. M. Dai, M. Ochiai, S. Tsukagoshi, E. Fujita, J. Org. Chem. 1990, 55, 1148. [14] M. B. Hodge, H. F. Olivo, Tetrahedron 2004, 60, 9397. [15] S. C. Tsai, H. Lu, D. E. Cane, C. Khosla, R. M. Stroud, Biochemistry 2002, 41, 12598. [16] J. D. Kittendorf, B. J. Beck, T. J. Buchholz, W. Seufert, D. H. Sherman, Chem. Biol. 2007, 14, 944. [17] P. Caffrey, Chembiochem 2003, 4, 654. [18] J. D. Kittendorf, D. H. Sherman, Bioorg. Med. Chem. 2009, 17, 2137. [19] S. C. Tsai, L. J. Miercke, J. Krucinski, R. Gokhale, J. C. Chen, P. G. Foster, D. E. Cane, C. Khosla, R. M. Stroud, Proc. Natl. Acad. Sci. USA 2001, 98, 14808. [20] A. Witkowski, H. Witkowska, S. Smith, J. Biol. Chem. 1994, 269, 379. [21] L. Gu, B. Wang, A. Kulkarni, J. J. Gehret, K. R. Lloyd, L. Gerwick, W. H. Gerwick, P. Wipf, K. Hkansson, J. L. Smith, D. H. Sherman, J. Am. Chem. Soc. 2009, 131, 16033.

5866

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5862 5866

Angewandte
DOI: 10.1002/ange.201000814

Chemie

RNA Dynamics

RNA Dynamics by Design: Biasing Ensembles Towards the LigandBound State**


Andrew C. Stelzer, Jeremy D. Kratz, Qi Zhang, and Hashim M. Al-Hashimi*
A major goal in structural biology and biophysics is to rationally design biomolecules that have specific characteristics at the atomic level. There have been significant advances in the design of proteins that fold into predetermined three-dimensional conformations.[1] However, biomolecular structures also undergo dynamic excursions about their native conformation and transiently access conformational substates that play critical roles in folding, catalysis, recognition, and signal transduction.[15] The rational design of such dynamics is a formidable challenge given the broad energy landscape that has to be considered and the complex spatiotemporal dependence of dynamics on sequence and structure, particularly for highly flexible molecules such as RNA.[6, 7] We recently showed, using NMR spectroscopy,[8, 9] that the transactivation response element (TAR) RNA from HIV-I[10] codes for a broad dynamic structure ensemble and that various ligands bind distinct conformers within the ensemble by conformational selection. In unbound TAR, the two helices are on average highly bent relative to one another (ca. 288) and undergo large-amplitude rigid-body global motions about a flexible pivot point consisting of spacer bulge residues C24 and U25 and the junctional A22-U40 base pair, which does not form the expected WatsonCrick hydrogen bond alignment (Figure 1 a).[8, 9, 11] Binding of the ligand argininamide (ARG), which is widely used as a mimic of the TAR cognate viral protein, the transactivator Tat, results in coaxial stacking of helices, a stable A22-U40 canonical base pair, a U23A27-U38 base triple, and an increase in the local flexibility of bulge residues C24 and U25, which adopt a looped-out conformation (Figure 1 a).[810, 12] We redesigned the TAR sequence to bias its dynamic structure ensemble towards the ARG-bound state without losing its ability to bind ARG. Our approach was to introduce mutations that do not disrupt ARG binding but that promote interactions uniquely observed in the TAR-ARG state. We replaced the flexible A22-U40 base pair, which is a confluence
[*] A. C. Stelzer,[+] J. D. Kratz,[+] Q. Zhang, Prof. H. M. Al-Hashimi Department of Chemistry and Biophysics University of Michigan 930 North University, Ann Arbor, MI 48109 (USA) E-mail: hashimi@umich.edu [+] These authors contributed equally to this work. [**] The authors acknowledge the Michigan Economic Development Cooperation and the Michigan Technology Tri-Corridor for the support of the purchase of a 600 MHz spectrometer. This work was supported by the NIH (R01 AI066975-01) and the National Science Foundation Graduate Research Fellowship Program (ACS). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201000814.
Angew. Chem. 2010, 122, 5867 5869

Figure 1. Biasing the TAR dynamic structure ensemble toward an ARGbound state. a) Design of the TARGC sequence based on the structural dynamics of the TAR and TAR-ARG complexes. X-Y base pairs denote alternating A-U/U-A or G-C/C-G base pairs used in the elongation.[8, 9] Residues undergoing the largest chemical shift perturbations due to the G-C mutation are highlighted in orange on the TARGC secondary structure. b) Representative 2D CH HSQC spectra of TAR (black), TARGC (orange), and TAR-ARG (purple). Inset: 2D C,H HSQC C5-H5 spectra. c,d) Correlation plots. Red: residues in helix I, green: helix II, orange: in the bulge. R = correlation coefficients. & C2-H2, ! C8-H8, ~ C6-H6, * C5-H5, ^ C1-H1, 3 N1/3-H1/3. c) Correlation plots between RDCs measured in non-elongated TAR, TARGC, and TAR-ARG complexes. d) Correlation plots between normalized resonance intensities measured in EI-TAR, EI-TARGC, and EI-TAR-ARG.

point for local and global dynamics and is not involved in any sequence-specific contacts with ARG, with a stronger hydrogen-bond-forming G-C base pair (Figure 1 a). The goal of this modification was to promote a canonical G-C base-pair and co-axial helical stacking due to improved G26-C39/G22-C40 stacking of about 1.2 kcal mol1.[13]

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5867

Zuschriften
We used NMR spectroscopy to site-specifically characterize the structural dynamics and ligand-binding properties of the TAR mutant (TARGC) in which A22-U40 is replaced with G22-C40 (Figure 1 a). The spectrum of the imino region of TARGC immediately revealed a signal that could unambiguously be assigned to G22 (Supporting Information, Figure S1), confirming that unlike A22-U40 in unbound TAR, G22-C40 forms the expected WatsonCrick hydrogen bond alignment in TARGC. The A-U to G-C mutation also resulted in large changes in 2D C,H HSQC spectra of TAR, indicating that the mutation affects structural dynamics across a variety of sites (Figure 1 b; Supporting Information, S1). Interestingly, the largest differences were observed for many residues that experience large chemical shift perturbations on binding to ARG, including the three bulge residues and the G26-C39 base pair above the bulge. A closer analysis revealed that many of the perturbations induced by the G-C mutation were along directions similar to those observed with ARG binding. For example, the downfield U23 carbon chemical shift perturbations are consistent with unstacking and coaxial stacking of helices.[14] To further investigate the structural dynamics of TARGC, we measured residual dipolar couplings (RDCs)[15, 16] between directly bonded CH and NH bonds and compared values with those previously reported for TAR[17] and TAR-ARG[12] (Figure 1 c; Supporting Information, Table S1). RDCs probe the orientation dynamics of bond vector relative to a molecule-fixed order tensor frame and are sensitive to internal motions occurring over a broad range of timescales (up to milliseconds). The RDCs measured at various sites in TARGC differed significantly from those measured in TAR but were in strikingly good agreement with those measured in TAR-ARG (Figure 1 c). Thus, the G-C mutation significantly alters the TAR structural dynamics and specifically biases it, on a site-by-site basis, towards the ARG-bound state. To quantitatively characterize the structural dynamics of TARGC, we used domain elongation[8, 9] (Supporting Information, Figure S2) to broaden the timescale sensitivity of spin relaxation measurements and to reduce couplings between internal motions from overall reorientation, which is key for quantitatively interpreting RDCs. Ignoring chemical exchange, the resonance intensities measured in 2D C,H HSQC spectra of elongated RNAs report the net dynamics of a given site relative to the applied magnetic field occurring at picosecondnanosecond timescales. In unbound domain I elongated TAR (EI-TAR), elevated intensities were observed for domain II owing to collective interhelical motions, and A22, U40, C24, and U25 owing to elevated local mobility (Supporting Information, Figure S3).[9] Binding of ARG arrests interhelical motions and local fluctuations involving A22 and U40, but leads to a dramatic increase in the dynamics of C24 and U25, which adopt a looped-out conformation.[9] Although the EI-TARGC resonance intensities differ significantly from those of EI-TAR (R = 0.73), they were in very good agreement with those of EI-TAR-ARG (R = 0.94) (Figure 1 d; Supporting Information, S3); the only exception was U23, which is more flexible in TARGC. Thus, whilst U23 adopts a looped-out conformation in TARGC, it does not form the U23A27-U38 base triple observed in TAR-ARG. Therefore, the G-C mutation biases the local and global picosecondnanosecond dynamical properties of TAR towards the ARG-bound state. To characterize the TARGC dynamic structure ensemble over longer timescales, we measured RDCs in EI-TARGC and subjected values measured in each helical domain to a modelfree order tensor analysis (Supporting Information, Table S2), as described previously for EI-TAR and EI-TAR-ARG.[8] In this analysis, RDCs and an idealized A-form helix geometry are used to determine five order tensor elements that describe ordering of each helix relative to the internal elongated helix axis. An excellent RDC fit to the idealized A-form geometry was obtained for each helix (Supporting Information, Table S2), confirming that they adopt a standard canonical geometry as reported previously for TAR.[8] The analysis yielded a TARGC global interhelical conformation in which the helices undergo very limited interhelical motions (fint = fshort/felongated % 1.02 0.1 and ranges between 0 and 1 for maximum and minimum motions) about a nearly coaxially stacked (bend angle ca. 12 78) conformation (Figure 2). This

Figure 2. Interhelical structural dynamics of EI-TAR, EI-TARG22C40, and EI-TAR-ARG from order tensor analysis of RDCs measured in helix I elongated constructs. There are no constraints on rotations around the elongated axis.

conformation differs considerably from the previously reported[8] highly bent (ca. 28 38) and flexible (qint % 0.45 0.1) EI-TAR conformation, but it is in very good agreement with the coaxial (ca. 8 48) and globally rigid (qint % 1.09 0.1) TAR-ARG complex (Figure 2). The EI-TARGC bulge RDCs are near zero, which is consistent with a looped-out highly flexible conformation (Supporting Information, Table S1). Our results suggest that despite having reduced and distinct structural dynamics, TARGC can dynamically sample the TAR ARG-bound state (Figure 2). We therefore examined whether TARGC can bind ARG. Strikingly, the NMR spectra (Figure 3 a; Supporting Information, S4) and also RDCs (Figure 3 b) measured in TARGC bound to ARG were in excellent agreement with counterparts measured in the TAR-ARG complex. Thus, despite large differences in their unbound structural dynamics, TAR and TARGC converge to a common ARG-bound conformation. The RDCs reveal that ARG binding only induces minor conformational changes in TARGC, which are centered on residue U23, and which most
Angew. Chem. 2010, 122, 5867 5869

5868

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
In summary, the dynamics of unbound RNA can be used to tune ligand binding affinities without altering the ligandbound RNA conformation. Our results also suggest that the sequence of WatsonCrick base pairs flanking interhelical junctions are important determinants of local and global RNA dynamics and that these effects can be predicted in part based on simple thermodynamic considerations. This, together with sequence-independent topological constraints imposed by length and asymmetry of junctions,[19, 22] provide a framework for rationally designing RNA structures with specific dynamic and functional properties.
Received: February 10, 2010 Published online: June 25, 2010

Chemie

Keywords: molecular dynamics molecular modeling NMR spectroscopy nucleic acids RNA

[1] [2] [3] [4] [5]

Figure 3. TAR and TARGC converge to a common ARG-bound conformation. a) Representative 2D C,H HSQC spectra of TAR-ARG (green) and TARGC-ARG (purple). Inset: 2D HSQC C5-H5 spectra. b) Correlation plots between RDCs measured in TARGC, TARGC-ARG, and TARARG. For symbol and color key, see Figure 1 c. c) Representative ARG titration curves for TAR (purple) and TARGC (green) as a function of total ARG concentration. Individual Kd values: top: G22 (TARGC) 96.6 16.1 mm, A22 (TAR) 141 13.2 mm ; middle: U23 (TARGC) 31.3 3.24 mm, U23 (TAR) 116 16.1 mm ; bottom: G28 (TARGC) 311 65.1 mm, G28 (TAR) 414 10.3 mm. Global Kd values: TARGC 47.7 9.3 mm, TAR 140 9.0 mm. d) TAR and TARGC adopt distinct unbound dynamic structure ensembles that converge to a common ARG-bound state. e) Representative 2D C,H HSQC spectra of TARNEOB (red) and TARGC-NEOB (blue) with the chemical structure of NEOB shown.

[6] [7] [8] [9] [10] [11] [12] [13] [14]

likely involve formation of the U23A27-U38 base triple (Figure 3 c). ARG binds TARGC with slightly higher (threefold) affinity as compared to TAR, which is consistent with it having a lower free-energy cost associated with the RNA conformational change in the pre-organized TARGC. Additional kinetic experiments will be required to determine how the mutation impacts the rates of complex formation and dissociation.[18] As an inverse experiment, we compared the binding of the aminoglycoside neomycin B (NEOB), which binds a more bent (ca. 308) TAR conformation[19, 20] that is likely less accessible to TARGC. Unlike ARG, NEOB induces entirely different chemical shift perturbations in TAR and TARGC (Figure 3 e). This result is consistent with the expectation that NEOB is less effective at binding/stabilizing the bent conformation observed with TAR when interacting with TARGC and that instead it binds an alternate structure, possibly using a different NEOB conformation.[21]

[15] [16] [17] [18] [19] [20] [21]

[22]

R. Das, D. Baker, Annu. Rev. Biochem. 2008, 77, 363 382. A. J. Baldwin, L. E. Kay, Nat. Chem. Biol. 2009, 5, 808 814. K. Henzler-Wildman, D. Kern, Nature 2007, 450, 964 972. D. D. Boehr, R. Nussinov, P. E. Wright, Nat. Chem. Biol. 2009, 5, 789 796. H. Schwalbe, J. Buck, B. Furtig, J. Noeske, J. Wohnert, Angew. Chem. 2007, 119, 1232 1240; Angew. Chem. Int. Ed. 2007, 46, 1212 1219. H. M. Al-Hashimi, N. G. Walter, Curr. Opin. Struct. Biol. 2008, 18, 321 329. B. Frtig, J. Buck, V. Manoharan, W. Bermel, A. Jschke, P. Wenter, S. Pitsch, H. Schwalbe, Biopolymers 2007, 86, 360 383. Q. Zhang, A. C. Stelzer, C. K. Fisher, H. M. Al-Hashimi, Nature 2007, 450, 1263 1267. Q. Zhang, X. Sun, E. D. Watt, H. M. Al-Hashimi, Science 2006, 311, 653 656. J. D. Puglisi, R. Tan, B. J. Calnan, A. D. Frankel, J. R. Williamson, Science 1992, 257, 76 80. F. Aboul-ela, J. Karn, G. Varani, Nucleic Acids Res. 1996, 24, 3974 3981. S. W. Pitt, A. Majumdar, A. Serganov, D. J. Patel, H. M. AlHashimi, J. Mol. Biol. 2004, 338, 7 16. D. H. Turner, N. Sugimoto, S. M. Freier, Annu. Rev. Biophys. Biophys. Chem. 1988, 17, 167 192. H. M. Al-Hashimi, S. W. Pitt, A. Majumdar, W. Xu, D. J. Patel, J. Mol. Biol. 2003, 329, 867 873. N. Tjandra, A. Bax, Science 1997, 278, 1111 1114. J. R. Tolman, J. M. Flanagan, M. A. Kennedy, J. H. Prestegard, Proc. Natl. Acad. Sci. USA 1995, 92, 9279 9283. H. M. Al-Hashimi, Y. Gossera, A. Gorina, W. Hua, A. Majumdara, D. J. Patel, J. Mol. Biol. 2002, 315, 95 102. F. M. Jucker, R. M. Rhillips, S. A. McCallum, A. Pardi, Biochemistry 2003, 42, 2560 2567. M. H. Bailor, X. Sun, H. M. Al-Hashimi, Science 2010, 327, 202 206. C. Faber, H. Sticht, K. Schweimer, P. Rosch, J. Biol. Chem. 2000, 275, 20660 20666. A. T. Namanja, X. J. Wang, B. Xu, A. Y. Mercedes-Camacho, B. D. Wilson, K. A. Wilson, F. A. Etzkorn, J. W. Peng, J. Am. Chem. Soc. 2010, 132, 5607 5609. V. B. Chu, J. Lipfert, Y. Bai, V. S. Pande, S. Doniach, D. Herschlag, NAR 2009, 15, 2195 2192.

Angew. Chem. 2010, 122, 5867 5869

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5869

Zuschriften
Plasmons
DOI: 10.1002/ange.201000972

Response of Molecular Junctions to Surface Plasmon Polaritons**


Gilad Noy, Ayelet Ophir, and Yoram Selzer*
Surface plasmons are coherent oscillations of conductive electrons that occur in a skin layer of metal and are capable of producing strong local electromagnetic fields in the near-field region.[1] Plasmons are imperative in surface-enhanced Raman[25] and fluorescence spectroscopy[6] as they significantly boost the sensitivity of these methods for the detection of dilute concentrations of analyte molecules. Plasmons can be coupled to molecular resonances,[7, 8] or molecules can be exploited to control the properties of plasmons and the optical properties of nanoscale metal structures upon irradiation.[9] These studies, as well as several theoretical results,[10] suggest that plasmons should also affect the transport properties of molecular junctions. Several recently reported experimental approaches towards this goal are based on the average effect from a large number of junctions formed in ordered arrays of metal nanoparticles interlinked with molecules.[11] Herein we report the current response of individual well-defined molecular junctions to surface plasmons. The observed enhancement of current is explained by a photon-assisted tunneling mechanism. Suspended-wire molecular junctions (SWMJs) were fabricated by trapping Au or Ag nanowires, which were capped with a self-assembled monolayer of either 1,9-nonanedithiol (C9) or decanethiol (C10) onto lithographically defined Au leads by using a dielectrophoresis technique (see Figure 1 and the Supporting Information). Figure 1 a shows representative IV curves of junctions based on the two molecules. Transition voltage spectroscopy (TVS) and inelastic electron tunneling spectroscopy (IETS) measurements were taken in order to confirm the molecular nature of the junctions. TVS measurements are interpreted with a Fowler Nordheim analysis, that is, plots of ln(I/V2) versus 1/V, which reveal minimum points at transition-voltage (VT) values that are characteristic of the molecules under investigation.[12] Figure 1 b shows typical TVS curves of junctions with C9 molecules. An average value of VT = (1.1 0.07) V was calculated from all (C9 + C10) junctions. IETS measurements were taken at 5 K using a standard lock-in technique (Figure 1 c), which revealed typical alkane vibrations in both bias polarities.[13] The agreement of measured VT values with
[*] G. Noy,[+] A. Ophir,[+] Dr. Y. Selzer School of Chemistry, Tel Aviv University Ramat Aviv, Tel Aviv 69978 (Israel) Fax: (+ 972) 3-640-7362 E-mail: selzer@post.tau.ac.il [+] These authors contributed equally to this work. [**] Support by the Israel Science Foundation through grant numbers 1507/09 and 1274/09 and through a Converging Technologies fellowship to G.N. is gratefully acknowledged. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201000972.

Figure 1. a) Representation of a suspended-wire molecular junction and typical IV curves of the molecules used in this study. Inset: SEM image of a suspended nanowire. b) Transition voltage spectroscopy of three different C9 junctions. c) Representative IETS measurements of a C9 junction measured at 5 K, showing characteristic peaks of alkyl chains (C10 junctions have similar peaks).

previous results,[14] and the lack of shift in the IETS peaks (within an error of 2 mV) prove that there is no potential divider in the suspended structures, that is, although the nanowires that are completely covered with a molecular layer could potentially form two molecular junctions in each SWMJ, only one junction per suspended nanowire (and a metal to metal contact on the other end) is formed. Laser irradiation of selected junctions under ambient conditions was carried out by using a microscope with maximum intensity of approximately 6 mW mm2 and laser polarization parallel to the nanowires. Two wavelengths were used (see below): 781 nm (1.58 eV) and 658 nm (1.88 eV). We estimate the temperature increment under the lasers, which operated at maximum intensity, to be not more than DT = 5 K. This estimate is based on the resistance change of the suspended-wire structures with bare metal nanowires; we observed ohmic behavior that changes as a function of temperature according to R = R0(1+bDT), where b is the temperature coefficient of the metal and R and R0 are the resistances with and without irradiation, respectively. The SWMJ showed a maximum current increase of two times over a bath temperature range of 300400 K. Upon a temperature change of 5 K, which arose from the laser irradiation, the current change was negligible (see the Supporting Information). We discarded all data that showed conductivity changes below twofold upon irradiation, thus leaving a substantial margin in terms of the exact effective temperature of the conducting junctions. Only one end of the junction in the suspended structure was found to be responsive to irradiation. Finite-difference time-domain (FDTD) simulations provided a better insight into the role of plasmons in the SWMJs (Figure 2). PropagatAngew. Chem. 2010, 122, 5870 5872

5870

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte

Chemie

Figure 2. a) SEM side view of a SWMJ. b) FDTD simulation of the field intensity in a SWMJ, calculated for l = 781 nm. The spatial scales in the z and x directions are different. The color scale of the field intensity is in arbitrary units. Laser light impinges on the left side of the nanowire, where the junction is located (marked by a red rectangle). The electric field is enhanced in the junction. A plasmon propagates along the nanowire to the other side of the structure. c) Geometry and characteristic tangential (between metals, M) electric-field (Ez) profile for the junction (note the different coordination system relative to (b). The Ez is enhanced at the entrance by a factor of ca. 100, fluctuates with a characteristic plasmon wavelength of ca. 50 nm, and is attenuated to zero after propagating ca. 1 mm in the x direction (see also the red color all along the junction in b).

Figure 3. Measured Ilight/Idark ratio for a AuC9Au junction as a function of laser power, using two wavelengths 658 nm (blue circles), and 781 nm (red rectangles). The continuous green lines are a guide. Inset: Calculated transmission probability G through the junction as a function of energy. The arrows show that G(Ef 1.58 eV) % 5 G(Ef ) and that G(Ef 1.88 eV) % 100 G(Ef ).

" w by interacting with the oscillating (plasmon) field. h According to this model, the energy-dependent transmission rate across a junction under the effect of an oscillatory potential becomes:
G E X
n 2 eVw G E n" hw Jn hw "

ing surface plasmons can be launched in a nanowire only when the excitation laser is incident on the end of the nanowire.[15] The dispersion curves of metalinsulatormetal structures, with insulator thicknesses and dielectric parameters similar to the molecules used in this study, were recently calculated.[16] These results show that propagating plasmons can be launched into the junctions by only a limited range of photon energy values. The 781 nm and 658 nm wavelengths fall within this range, and result in propagating plasmons in the junctions with characteristic wavelengths of approximately 50 nm and propagation length of several hundreds of nanometers. Thus, a substantial length of each junction (which is typically less than 1 mm, see Figures 1 and 2) is affected by the plasmons. The main results for a AuC9Au junction are summarized in Figure 3, which shows the ratio between the optically induced current Ilight and the current without irradiation Idark as a function of laser intensity for two wavelengths at a bias value of 1 mV (see the Supporting Information for details on the distribution of results and how each point was measured and calculated). Two main observations are apparent: the ratio Ilight/Idark increases linearly with laser intensity and has a higher value for l = 658 nm. The distribution of results from the different junctions is within 50 % (error bars are not shown for clarity). The experimental observations can be explained semiquantitatively by a photon-assisted tunneling mechanism[10b,j] using an analytical expression from the treatment of Tien and Gordon.[17] According to this model, in addition to the applied dc bias, there is also a time-varying potential across the gap, induced in this case by the propagating plasmons (see Figure 2 c). Under these conditions a certain fraction of the tunneling charges undergo inelastic tunneling events in which they either emit (n < 0) or absorb (n > 0) photons with energy
Angew. Chem. 2010, 122, 5870 5872

where G(E) and G(E+n h " w) are the transmission rate with and without irradiation, respectively, and Jn(a) is an n order Bessel function with a = eVw/" hw where Vw is the effective amplitude of the oscillating potential formed by the plasmon in the junction. The calculated electric profile along the cross section of the junctions (between the metal nanowires and gold leads) is shown in Figure 2 c. The plasmonic enhancement of the electric field on the molecules is in the order of approximately 100 times. Considering the laser intensities used in these experiments, the vacuum propagating electric field is in the order of 2 mV nm1. After enhancement, the field is Ez % 200 mV nm1 inside the junctions. Deep inside the metal, within an order of few skin depths, which for Au at 781 nm and 658 nm is approximately 25 nm, the field is zero. Any electron that is within the metal and moves towards the interface within a distance of a mean free path (taken here as l = 10 nm) contributes to the tunneling process and is also influenced by the oscillating field. Therefore, Vw (= E l) is approximately 2 V. This value can be used to estimate a value of a for the two wavelengths: a658 % 1.06, a781 % 1.25. With the laser intensities used in these experiments, the contribution of multi-photon processes is negligible, and therefore we need to consider only the J0 and J1 Bessel functions in Equation (1). The transmission probability through molecular junctions based on thiolated alkyl chains, and also their density of states have been theoretically calculated by several research groups.[18] We used this data to estimate G(Ef" hw), where Ef is the Fermi energy (Figure 3, inset). The highest occupied molecular orbital (HOMO) level in the alkyl chains is closer www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5871

Zuschriften
to Ef than the lowest unoccupied molecular orbital (LUMO). Therefore, as a first approximation for the wavelengths used here G(Ef) % G(Ef+1.58 eV) % G(Ef+1.88 eV), while G(Ef1.58 eV) is higher than G(Ef) by an order of magnitude, and G(Ef1.88 eV) by two orders of magnitude. Use of the transmission enhancement and the above a values in Equation (1) gives a Ilight/Idark ratio (at maximum intensity) of 5 and 40 for l = 781 nm and l = 658 mn, respectively. These values are consistent with the experimental results. We note that without molecules (C9 and C10), that is, if the barrier for tunneling is approximately the work function of the metal, current enhancement by plasmons requires photons with energies of approximately 5 eV. These photons are expected to be absorbed by the metal as their energy is beyond the plasma energy (ca. 2.4 eV). In conclusion, we have demonstrated the effect of plasmons on the conductivity of molecular junctions by using SWMJs, which are a new type of molecular junction. The observed current enhancement is in semiquantitative agreement with a photon-assisted tunneling mechanism and numerical simulations of the plasmon-induced enhancement of the electromagnetic field between the metal leads of the junctions. Further work to elucidate the effect of attributes such as molecular structure and potential bias is underway.
Received: February 16, 2010 Published online: July 6, 2010 [6] A. Kinkhabwala, Z. Yu, S. Fan, Y. Avlasevich, K. Mullen, W. E. Moerner, Nat. Photonics 2009, 3, 654 657. [7] A. Salomon, C. Genet, T. W. Ebbesen, Angew. Chem. 2009, 121, 8904 8907; Angew. Chem. Int. Ed. 2009, 48, 8748 8751. [8] W. Ni, T. Ambjrnsson, S. P. Apell, H. Chen, J. Wang, Nano Lett. 2010, 10, 77 84. [9] a) D. Neuhauser, K. Lopata, J. Chem. Phys. 2007, 127, 154715 154725; b) A. Mayer, G. Schatz, J. Phys. Condens. Matter 2009, 21, 325301; c) S. J. Park, R. E. Palmer, Phys. Rev. Lett. 2009, 102, 216805. [10] a) G. Q. Li, M. Schreiber, U. Kleinekathfer, Eur. Phys. Lett. 2007, 79, 27006; b) J. K. Viljas, F. Pauly, J. C. Cuevas, Phys. Rev. B 2008, 77, 155119; c) J. Lehmann J, S. Camalet, S. Kohler, P. Hnggi, Chem. Phys. Lett. 2003, 368, 282; d) J. Lehmann J, S. Kohler, P. Hnggi P, A. Nitzan, Phys. Rev. Lett. 2002, 88, 228305; e) M. Galperin, A. Nitzan, Phys. Rev. Lett. 2005, 95, 206802; f) M. Galperin, A. Nitzan, M. A. Ratner, Phys. Rev. Lett. 2006, 96, 166803; g) A. Keller, O. Atabek, M. A. Ratner, V. Mujica, J. Phys. B 2002, 35, 4981; h) I. Urdaneta, A. Keller, O. Atabek, V. Mujica, Int. J. Quantum Chem. 2004, 99, 460; i) A. Tikhonov, R. D. Coalson, Y. Dahnovsky, J. Chem. Phys. 2002, 117, 567; j) I. Urdaneta, A. Keller, O. Atabek, V. Mujica, J. Chem. Phys. 2007, 127, 154110. [11] a) H. Nakanishi, K. J. M. Bishop, B. Kowalczyk, A. Nitzan, E. A. Weiss, K. V. Tretiakov, M. M. Apocada, R. Klajn, J. F. Stoddart, B. A. Grzybowski, Nature 2009, 460, 371 375; b) S. J. Van der Molen, J. Liao, T. Kudernac, J. S. Agustsson, L. Bernard, M. Calame, B. J. Van Wees, B. L. Feringa, C. Schnenberger, Nano Lett. 2009, 9, 76 80; c) M. A. Mangold, C. Weiss, M. Calame, A. W. Holleitner, Appl. Phys. Lett. 2009, 94, 161104; d) P. Banerjee, D. Conklin, S. Nanayakkara, T. H. Park, M. J. Therien, D. A. Bonnell, ACS Nano 2010, 4, 1019. [12] J. M. Beebe, B. Kim, J. W. Gadzuk, C. D. Frisbie, J. G. Kushmerick, Phys. Rev. Lett. 2006, 97, 026801. [13] N. Okabayashi, Y. Konda, T. Komeda, Phys. Rev. Lett. 2008, 100, 217801. [14] J. M. Beebe, B. Kim, C. D. Frisbie, J. G. Kushmerick, ACS Nano 2008, 2, 827. [15] A. W. Sanders, D. A. Routenberg, B. J. Wiley, Y. Xia, E. R. Dufresne, M. A. Reed, Nano Lett. 2006, 6, 1822. [16] H. T. Miyazaki, Y. Kurokawa, Phys. Rev. Lett. 2006, 96, 097401; H. T. Miyazaki, Y. Kurokawa, Phys. Rev. B 2007, 75, 035411. [17] P. Tien, J. Gordon, Phys. Rev. 1963, 129, 647. [18] a) W. Haiss, S. Martin, L. E. Scullion, L. Bouffier, S. J. Higgins, R. J. Nichols, Phys. Chem. Chem. Phys. 2009, 11, 10831 10838; b) J. M. Seminario, L. Yan, Int. J. Quantum Chem. 2005, 102, 711; c) G. C. Solomon, D. Q. Andrews, R. P. Van Duyne, M. A. Ratner, J. Am. Chem. Soc. 2008, 130, 7788 7789.

Keywords: molecular junctions nanostructures plasmons tunneling

[1] a) S. A. Maier, H. A. Atwater, J. Appl. Phys. 2005, 98, 011101; b) W. L. Barnes, A. Dereux, T. W. Ebbesen, Nature 2003, 424, 824 830. [2] a) M. Moskovits, Rev. Mod. Phys. 1985, 57, 783; b) K. A. Willets, R. P. Van Duyne, Annu. Rev. Phys. Chem. 2007, 58, 267. [3] X. Chen, A. B. Braunschweig, M. J. Wiester, S. Yeganeh, M. A. Ratner, C. A. Mirkin, Angew. Chem. 2009, 121, 5280 5283; Angew. Chem. Int. Ed. 2009, 48, 5178 5181. [4] T. Shamai, Z. Ioffe, A. Ophir, G. Noy, I. Yutsis, K. Kfir, O. Cheshnovsky, Y. Selzer, Nat. Nanotechnol. 2008, 3, 727 732. [5] D. R. Ward, N. K. Grady, C. S. Levin, N. J. Halas, Y. Wu, P. Nordlander, D. Natelson, Nano Lett. 2007, 7, 1396 1400.

5872

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5870 5872

Angewandte
DOI: 10.1002/ange.201002295

Chemie

Nanotechnology

Nanoparticle Supracrystals and Layered Supracrystals as Chemical Amplifiers**


Bartlomiej Kowalczyk, David A. Walker, Siowling Soh, and Bartosz A. Grzybowski*
One of the main applications of metal nanoparticles (NPs) is in the detection of biologically important[1] or toxic substances,[2] usually by the spectral or surface plasmon resonance (SPR) changes[3] accompanying particle aggregation[4] or dispersion[2c, 5] in the presence of an analyte. With the exception of highly sensitive DNA-based methods,[6] however, most reported colorimetric detection schemes require large excesses of analyte molecules per one NP (on the order of one thousand,[2c, 5] see the Supporting Information, Section 1) to affect even small shifts in the nanoparticles SPR bands.[7] Improving the existing detection limits therefore requires amplification of the assembly/disassembly process. Unfortunately, the repertoire of amplification procedures compatible with nanoparticle-based assays is currently limited to the catalytic deposition of silver on surface-immobilized AuNPs.[8] Herein, we show that NP supracrystals and previously unreported coreshell (CS) supracrystals (Figure 1) stabilized by analyte-specific cross-linkers can enhance dramatically (by over two orders of magnitude compared to noncrystalline NP aggregates) the sensitivity of NP-based detection. The cross-linked crystals are insoluble in water and, owing to NP aggregation, do not exhibit SPR in the visible regime. When, however, an analyte (an anion, a small molecule, or an enzyme) is present, it cuts the cross-linkers so that each crystal liberates, like a pinched balloon (Figure 2, Figure 3), millions of individual NPs absorbing strongly in the visible regime and effectively amplifying the molecular-scale cutting events into pronounced color changes visible to a naked eye (Figure 4). Moreover, in the CS supracrystals, the shell and the core regions have different NP compositions and are stabilized with different cross-linkers; consequently, these crystals can dissolve in a step-wise fashion under the action of two different analytes (Figure 5). This property allows for spatially distributed sensing, whereby the
[*] Dr. B. Kowalczyk, D. A. Walker, S. Soh, Prof. B. A. Grzybowski Department of Chemical and Biological Engineering Northwestern University 2145 Sheridan Rd., Evanston, IL 60208 (USA) Fax: (+ 1) 847-491-3728 E-mail: grzybor@northwestern.edu Homepage: http://dysa.northwestern.edu Dr. B. Kowalczyk, Prof. B. A. Grzybowski Department of Chemistry, Northwestern University 2145 Sheridan Rd., Evanston, IL 60208 (USA) [**] This work was supported by the Non-equilibrium Energy Research Center (NERC), which is an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences under Award Number DE-SC0000989. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002295.
Angew. Chem. 2010, 122, 5873 5877

crystals release their cargo only if they travel through specific concentration landscapes of the analytes. We used AuNPs with an approximate diameter of (5.6 0.5) nm and AgNPs of diameter (5.6 1.2) nm coated with self-assembled monolayers (SAMs) of either positively charged N,N,N-trimethyl(11-mercaptoundecyl)ammonium chloride (HS(CH2)11N(CH3)3+, TMA, ProChimia, Poland) or negatively charged, deprotonated mercaptoundecanoic acid (HS(CH2)10COO , MUA, ProChimia; Figure 1 a). The AuNPs had a strong surface plasmon resonance (SPR) band with maximum at lmax = 520 nm, and their aqueous solutions appeared bright red; for AgNPs, lmax % 420 nm and particle solutions appeared yellow. Supracrystals (henceforth, simply crystals) were grown by slow evaporation of water from DMSO/water mixtures containing equal numbers of oppositely charged NPs (see Ref. [9] and the Supporting Information, Section 2 for details). The 12 mm crystals (Figure 1 b) thus assembled (ca. 2.2 107 crystals per mL) were held together by electrostatic interactions between the NPs, comprised several million nanoparticles each (ca. 2.5 106 NPs as determined by SEM imaging), and were soluble in water. Upon exposure to alkane dithiols that cross-linked the nearby NPs, however, the crystals became stable in water (Figure 2 a) and could be used as seeds or cores to epitaxially deposit an additional shell of NPs. These shell NPs were again deposited from an aqueous solution of oppositely charged particles,[10] the material properties of which could be different from those in the crystal core. In this way, coreshell crystals (each up to ca. 2.5 mm across, Figure 1 c, shell thickness ca. 200300 nm, Figure 5) were assembled and could be stabilized and made insoluble in water by additional dithiol cross-links. The presence of the coreshell architecture was confirmed directly by EDX (energy dispersive X-ray spectroscopy) scans of the crystals composition (Figure 1 c and Figure 5) and indirectly by the fact that the shell regions could be dissolved without destroying the crystalline core (see Figure 5). Both the regular and the CS crystals slowly (within hours) sedimented from solution and appeared as a dark gray powder. The crux of the amplified detection (Figure 2 a) was to prepare crystals stabilized by dithiols incorporating groups that can be cleaved by desired analytes. We considered three such dithiols (Figure 2 b; see the Supporting Information, Section 2 for synthetic details): 11-mercaptoundecyl-11-mercaptoundecanoate (1) containing an ester moiety prone to base hydrolysis; 11-mercapto-N-(pyridin-2-yl)undecanamide held together by coordination of CuII to two pyridine and two carbonyl groups (2), which cleaves upon addition of a stronger chelating agent such as ethylenediaminetetraacetic acid (EDTA), and N-(6-amino-1-(11-mercaptoundecylamino)-1-

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5873

Zuschriften

Figure 1. Nanoparticles, crystals, and coreshell crystals. a) Scheme of Au and Ag nanoparticles and of the charged MUA and TMA ligands coating them. Arrows indicate the pairs of oppositely charged NPs that can form supracrystals. b) Scheme of a NP supracrystal (here made of AuTMA and AuMUA NPs); gray-black arcs indicate dithiol cross-links bridging proximal NPs at the crystals surface. The SEM image shows a typical crystal composed of AuTMA and AuMUA NPs (scale bar = 500 nm); the inset shows individual, ordered NPs on the crystals surface (scale bar = 20 nm). The two rightmost images have compositional maps of an AuTMA/AuMUA crystal recorded on STEM (scanning transmission electron microscope) equipped with dual Thermo-Scientific EDS (energy dispersive X-ray spectroscopy) detectors (color coding: Au = red; Ag = yellow). These maps confirm that the crystal is composed solely of Au particles. c) A scheme, SEM image, and compositional maps of a coreshell crystal. Here, the core of the crystal is made from AuTMA and AuMUA NPs and is stabilized with cross-linker 3 (gray-black arcs). A mixture of AgTMA and AuMUA NPs is then deposited onto this cross-linked core, and the entire layered structure is stabilized with cross-linker 1 (also see Figure 5).

Figure 2. Amplified chemical sensing using nanoparticle supracrystals. a) Crystals, each containing several million NPs, self-assemble from oppositely charged NPs (i) and are soluble in water (ii). These crystals gain permanence and become water-insoluble when they are cross-linked with dithiols containing cleavable groups (iii). When a specific analyte is added, the cross-links are chemically cut, and the crystals disintegrate into individual nanoparticles (iv). Scale bars are 250 nm in the SEM images of crystals and 20 nm in the TEM images of free NPs. b) Chemical structures of the dithiol cross-linkers 13 and the analytes that cut them.

oxohexan-2-yl)-11-mercaptoundecanamide (3), incorporating a lysine amino acid and cleaving in the presence of proteases such as trypsin or proteinase K (but not papain). In all cases, the stability of NP crystals in water increased with increasing dithiol concentration CDT (see Figure S1a in the Supporting Information). On the other hand, if too much dithiol was used, the tightly knit crystals were hard to dissolve upon exposure to dithiol-cutting analytes, and the sensitivity of detection was poor. Consequently, the crystals we used were cross-linked with the minimal concentration of min dithiols (CDT % 2 mm , 68 h soaking) necessary to stabilize these crystals in water such that no individual NPs dissolved in solution could be detected by either UV/Vis spectroscopy, DLS (dynamic light scattering), or TEM (transmission electron microscopy). Reaction-diffusion modeling accounting for the diffusion of the dithiols into the nanometer-sized[9a] pores of the crystals and for the displacement of the TMA/MUA thiols from the NPs estimates the thickness of the cross-linked layer to
Angew. Chem. 2010, 122, 5873 5877

5874

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
be on the order of L % 1530 nm from the crystals surface (see the Supporting Information, Section 4 for details). In other words, only the skin of the crystals is cross-linked, and when it is ruptured, the crystals should liberate large numbers of the interior, un-cross-linked NPs. This, indeed, is what was observed in experiments. We first discuss the results for the regular (i.e., not CS) crystals. When an analyte specific to the cleavable dithiols was added, the crystals dissolved, thus coloring the solution brightly (Figure 3 a). SEM imaging (Figure 3 b) indicates that crystals lowest analyte concentrations usedgave mostly individual NPs rather than nanoparticle clusters in solution. This behavior was in sharp contrast to that observed in control experiments, where we studied the dissolution of cross-linked but disordered NP aggregates (Figure 3 c, violet and gray histograms). Such aggregates not only required a much higher min concentration of dithiols to be stable in water (CDT @ 10 mm ) but also dissolved slowly and graduallyfirst into smaller, colorless aggregates and only then into individual NPs. As a result, the sensitivity of detection was much lower upon the dissolution of disordered aggregates than NP crystals. These trends are quantified in Figure 4 ac, which plots the solutions absorbance Abs (proportional to the concentration of dissolved NPs) as a function of the concentration of the added analyte CA (here, EDTA cutting cross-links of 2).

Chemie

Figure 3. Dissolution of cross-linked crystals. a) Optical images illustrating dissolution of the crystals (here, cross-linked with 1) upon addition of (CH3)4N+OH base (10 mm, 5 mL). b) Gradual dissolution of the crystals from (a) monitored using SEM. The concentrations of the base added are indicated in the upper-right corners of the images. The hazy regions around the crystal in the left image (indicated by white arrows) correspond to individual NPs spilling out (see the Supporting Information, Section 3 for high-resolution images). Scale bars = 1 mm. c) Particle size distributions recorded by DLS on a Malvern ZetaSizer Nano-ZS instrument (see the Supporting Information, Section 2.2). Black: undissolved NP crystals cross-linked with 1. Red: particles from the dissolution of the crystals (upon addition of 10 mL 10 mm (CH3)4N+OH). Gray: cross-linked, disordered NPs (cross-linker 1). Violet: aggregates from the dissolution of the disordered aggregates (after 24 h; cutting agent: 10 mL 50 mm (CH3)4N+OH).

dissolved from one or few locations on their surfaces. These locations were usually along crystals edges or near its vertices, where the surface NPs were the least stable (i.e., corresponding to the highest free energies).[11] Once a small hole was pinched in the crystals cross-linked skin, large numbers of individual NPs spilled from the crystals interior into the solution. DLS measurements (Figure 3 c, black and red histograms) confirmed that this processeven for the
Angew. Chem. 2010, 122, 5873 5877

Figure 4. Dissolution of NP crystals and of disordered NP aggregates. a) UV/Vis spectra indicate dissolution of crystals (stabilized by 2) upon gradual addition of EDTA. The corresponding images in the right column illustrate the changes in the solution color; the red color is due to individual AuNPs from the dissolved crystals. b) Control experiment in which EDTA is added to disordered, cross-linked aggregate. Even for high concentrations of EDTA, only a small fraction of the aggregates dissolves into free NPs, and the solutions are barely colored. c) Comparison of the two experiments quantified by absorbance at lmax % 530 nm. For a given concentration of EDTA, the colorimetric response of the crystals is approximately 100 times stronger than that of disordered aggregates. d) Kinetics of dissolution of crystals cross-linked with 3 upon addition of trypsin (red) and proteinase K (yellow), both at the same 5 mm enzyme concentration, at T = 37 8C for trypsin and 50 8C for proteinase K. Crystals are stable against papain (violet), which does not cleave the cross-linker 3.

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5875

Zuschriften
For a given value of CA, Abs measured for the crystals was approximately 100 times greater than the absorbance from dissolving disordered aggregates (Figure 4 c). In other words, the use of cross-linked crystals offered an approximately twoorders-of-magnitude improvement in sensitivity compared to cross-linked but disordered NPs. The dissolution of crystals was also much more rapid. A typical crystal sample (ca. 8.8 107 crystals or 2.2 1014 NPs in 4 mL solvent) exposed to an analyte of concentration CA % 1 mm dissolved completely within 60 s; for a disordered NP aggregate exposed to a tenfold higher analyte concentration, the time to see even a bleak color was on the order of tens of minutes. Lastly, for the crystals, the smallest change in the solutions color discernible to a naked eye (Abs % 0.30.4 in a 10 mm cuvette) was 14 EDTA molecules per one AuTMA/MUA nanoparticle. This result compares favorably with conventional NP-based colorimetric methods,[2b, 4a, 5] which require approximately 1000 or more analyte molecules to effect even minute spectral shifts or changes detectable only using spectroscopic methods. Qualitatively similar trends to those for 2/EDTA were observed for the dithiol 1/OH analyte pair, for which the smallest visually detectable change corresponded to 43 analyte molecules per NP, and dissolution time was approximately 90 s. In both cases, the crystals were not dissolved by analytes not specific to the dithiol cross-linkers. Crystals stabilized with dithiols containing enzyme-specific motifs were also used as selective enzymatic sensors. For instance, crystals cross-linked with lysine-containing 3 were dissolved readily by CA % 5 mm solutions of serine proteases such as trypsin or proteinase K (Figure 4 d), the active centers

Figure 5. Sensing by coreshell crystals. When the coreshell crystals (middle column) are exposed first to the solution of an analyte cutting the outer crosslinks (here OH cutting 1) and are then transferred into the solution containing analytes cutting the inner cross-links (here proteinase K cutting 3), both the core and the shell dissolve completely into individual NPs (rightmost column). When, however, the crystals are first exposed to the enzyme and only then to the base, only the shell dissolves, thus leaving behind intact crystal cores (leftmost column). The specific crystals used here have cores composed of AuTMA and AuMUA NPs and shells made of AgTMA and AuMUA NPs. The second row from the top shows typical SEM images of the crystals (scale bars = 500 nm; 100 nm in the rightmost image). The third row shows the UV/Vis spectra and optical images of the solutions. Solutions are colorless if crystals are not dissolved, orange if only the shells are dissolved, and dark red if both the shells and the cores are dissolved. The bottom row has typical EDS composition scans across individual crystals. Intact coreshell crystals contain cAu % 78 % Au and cAg % 22 % Ag (composition averaged over scan length); when the shell is dissolved, the composition of the core is pure Au. Note that near the ends of the scan of intact CS crystals, the composition of Ag increases to approximately 50 %, as predominantly the crystals Au/Ag shell is probed by the beam. Shell thickness xsh can be estimated from the elemental composition near the middle of the crystal, cAu % 85 %, where the beam passes through two Au/Ag shells (each of thickness xsh ; Au metal content 50 %) and the Au/Au core (thickness xcore ; Au content 100 %). For 2 mm crystals, the equations (100 % xcore + 2 50 % xsh)/(xcore+2 xsh) = 0.85 and (xcore + 2 xsh) = 2 mm give an estimated xsh % 300 nm.

5876

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5873 5877

Angewandte
of which contain the serine-histidine-aspartate catalytic triad.[12a] The smallest change in the solution color detectable by a naked eye corresponded to 56 molecules of trypsin or proteinase K per one liberated nanoparticle. In contrast, the same crystals remained stable in the presence of even high (CA > 0.1 mm ) concentrations of the protease papain (violet curve in Figure 4 d), whose catalytic triad is cysteine-histidineasparagine[12b] and which has low affinity to 3.[12c] Interestingly, the rates of crystal dissolution were similar for trypsin and for proteinase K, despite the fact that the rates of proteolytic cleavage of free 3 by these enzymes are quite different (tens of minutes for trypsin[13a] and a few minutes for proteinase K[13b]). This observation suggests that crystal dissolution is limited by the slow diffusion of large enzymes into the nanoscopic pores of the crystals cross-linked skin layer. This limited accessibility of the cross-linkers cleavable group can also rationalize why the dissolution of the crystals was markedly slower (1530 min to reach Abs % 0.30.4) than in the previously discussed 2/EDTA or 1/OH systems. Still, these times are commensurate with those for commercial proteinase assays (typically, tens of minutes to hours[14]). The coreshell crystals (see Figure 1 c) enable additional modes for amplified sensing, especially when the core and shell regions are made of different NPs and are stabilized by cross-linkers specific to different analytes. Under such conditions, it is possible to dissolve the core and the shell selectively and to liberate the NPs that compose these regions sequentially. While in homogeneous solutions such sequential sensing is probably of little advantage (one can always use two types of regular crystals, each stabilized with different cross-links), it can be of use in stratified media in which different regions contain different types of analytes. This situation is illustrated in Figure 5 for CS crystals comprising Au cores stabilized with 3 and Au/Ag shells stabilized with 1. When these crystals are first exposed to a medium containing OH analyte (cutting the outer 1 cross-links), the shell dissolves; subsequent passage through a medium containing proteinase K (cutting inner 3 cross-links) dissolves the crystals core. Importantly, when the same crystals are passed through the same media but in reverse order, only shells dissolve, but the cores remain intact. In other words, the crystals perform spatially distributed sensing, whereby they report the path they traveled (note that this cannot be achieved with mixtures of regular crystals of different types stabilized by different cross-linkers). We suggest that this property can be even more relevant to nanoparticle-based delivery systems, whereby appropriately structured and crosslinked CS crystals traveling through chemically stratified media release their cargo sequentially in desired locations. In summary, nanoparticle crystals of different internal architectures, including unprecedented coreshell NP crystals, and stabilized with chemically cleavable cross-links effectively amplify the presence of cross-link-specific analytes into pronounced color changes. This mode of sensing can be generalized to different cross-link/analyte combinations. An exciting opportunity for future research would be to use supracrystals of medically relevant nanoparticles (e.g., antibacterial AgNPs, antifungal CuNPs, anticancer arsenic NPs, MRI contrast-enhancing magnetite NPs) in biodelivery applications, where the crystals, especially the CS ones, could dissolve and liberate their contents sequentially upon reaching specific intracellular targets.
Received: April 18, 2010 Published online: July 13, 2010

Chemie

Keywords: amplification nanoparticles self-assembly sensors

[1] a) T. A. Taton, C. A. Mirkin, R. L. Letsinger, Science 2000, 289, 1757; b) C. A. Mirkin, R. L. Letsinger, R. C. Mucic, J. J. Storhoff, Nature 1996, 382, 607. [2] a) Y. J. Kim, R. C. Johnson, J. T. Hupp, Nano Lett. 2001, 1, 165; b) J. W. Liu, Y. Lu, J. Am. Chem. Soc. 2003, 125, 6642. [3] a) S. Link, M. A. El-Sayed, Int. Rev. Phys. Chem. 2000, 19, 409; b) A. O. Pinchuk, A. M. Kalsin, B. Kowalczyk, G. C. Schatz, B. A. Grzybowski, J. Phys. Chem. C 2007, 111, 11816. [4] a) R. Chakrabarti, A. M. Klibanov, J. Am. Chem. Soc. 2003, 125, 12531; b) A. Charrier, N. Candoni, F. Thibaudau, J. Phys. Chem. B 2006, 110, 12896; c) K. Sato, K. Hosokawa, M. Maeda, J. Am. Chem. Soc. 2003, 125, 8102. [5] a) J. H. Lee, Z. D. Wang, J. W. Liu, Y. Lu, J. Am. Chem. Soc. 2008, 130, 14217; b) J. W. Liu, Y. Lu, Angew. Chem. 2006, 118, 96; Angew. Chem. Int. Ed. 2006, 45, 90. [6] a) J. J. Storhoff, A. D. Lucas, V. Garimella, Y. P. Bao, U. R. Muller, Nat. Biotechnol. 2004, 22, 883; b) C. S. Thaxton, D. G. Georganopoulou, C. A. Mirkin, Clin. Chim. Acta 2006, 363, 120. [7] a) J. N. Anker, W. P. Hall, O. Lyandres, N. C. Shah, J. Zhao, R. P. Van Duyne, Nat. Mater. 2008, 7, 442; b) C. L. Schofield, A. H. Haines, R. A. Field, D. A. Russell, Langmuir 2006, 22, 6707. [8] a) Y. Y. Li, C. Zhang, B. S. Li, L. F. Zhao, X. B. Li, W. J. Yang, S. Q. Xu, Clin. Chem. 2007, 53, 1061; b) A. Virel, L. Saa, V. Pavlov, Anal. Chem. 2009, 81, 268. [9] a) A. M. Kalsin, M. Fialkowski, M. Paszewski, S. K. Smoukov, K. J. M. Bishop, B. A. Grzybowski, Science 2006, 312, 420; b) B. Kowalczyk, A. M. Kalsin, R. Orlik, K. J. M. Bishop, A. Z. Patashinski, A. Mitus, B. A. Grzybowski, Chem. Eur. J. 2009, 15, 2032. [10] We emphasize that cross-linking of the seed NP crystals was essential for the deposition of any additional NPs in water; without being cross-linked, the seeds simply dissolved into individual NPs. [11] a) L. Brecevic, D. Kralj, Interfacial Dynamics, CRC, Boca Raton, FL, 2000, p. 435; b) R. Hacquart, J. Jupille, Chem. Phys. Lett. 2007, 439, 91; c) R. C. Snyder, M. F. Doherty, AIChE J. 2007, 53, 1337. [12] a) P. A. Frey, S. A. Whitt, J. B. Tobin, Science 1994, 264, 1927; b) T. Vernet, D. C. Tessier, J. Chatellier, C. Plouffe, T. S. Lee, D. Y. Thomas, A. C. Storer, R. Menard, J. Biol. Chem. 1995, 270, 16 645; c) A. Berger, I. Schechter, Philos. Trans. R. Soc. London Ser. B 1970, 257, 249. [13] a) J. Lough, D. S. Wrenn, H. M. Miziorko, H. E. Auer, Int. J. Biochem. 1985, 17, 309; b) W. Ebeling, N. Hennrich, M. Klockow, H. Metz, H. D. Orth, H. Lang, Eur. J. Biochem. 1974, 47, 91. [14] Examples of times needed to observe color change in different commercial protease assays include QuantiCleave protease assay kit: within 1 h, protease assay kit from G Biosciences: 2.5 h, EnzChek peptidase/protease assay kit from Invitrogen: 1 h.

Angew. Chem. 2010, 122, 5873 5877

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5877

Zuschriften
Drug Delivery
DOI: 10.1002/ange.201002221

Polyacrylate Dendrimer Nanoparticles: A Self-Adjuvanting Vaccine Delivery System**


Mariusz Skwarczynski, Mehfuz Zaman, Carl N. Urbani, I-Chun Lin, Zhongfan Jia, Michael R. Batzloff, Michael F. Good, Michael J. Monteiro,* and Istvan Toth*
Infection with group A streptococci (Streptococcus pyogenes, GAS), which is one of the most common and widespread human pathogens, can result in a broad range of diseases, including pharyngitis, with the potential of acute and postinfectious rheumatic fever (ARF) and rheumatic heart disease (RHD).[1] It is estimated that GAS infection is responsible for over half a million deaths per year worldwide.[2] The inability to effectively control GAS infections with antibiotics[3] has prompted extensive research into the development of a vaccine against this infection. However, to date, no prophylactic GAS vaccine is available on the market. Immunity to GAS relies on the production of opsonic antibodies specific to the hypervariable N-terminal and conserved C-terminal regions of the coiled-coil a-helical surface M protein, which is the major virulent factor in GAS.[1, 4] The development of an effective vaccine for GAS has been challenged by induced autoimmunity from epitopes derived from the C-terminal regions.[5] The minimal B-cell epitopes are believed to be safe but showed little or no immunogenicity.[6] It was recently hypothesized that self-assembled amphiphilic polymers can serve as nanoscale delivery systems for subunit vaccines, but no proof of concept has been demonstrated.[7] We report herein a polymer-based vaccine delivery system that offers several potential advantages over previously reported strategies. It was expected that 1) an amphiphilic structure can self-assemble to produce particles with the desired size, 2) the hydrophobic polymer ensures presentation of the peptide epitope on the surface of the nanoparticles, and 3) the dendritic structure and dense packing of epitopes on the surface of the nanoparticles induce native conformation of antigen which is essential for B-cell recognition. We have synthesized a dendritic structure consisting of a polyacrylate core and a peripheral generation of the minimal B-cell epitope (J14, KQAEDKVKASREAKKQVEKALEQLEDKVK;[8] Figure 1 a and Scheme S1 in the Supporting Information). The dendrimer structure, which contains the antigen peptides, resulted in a self-assembled nanoparticle of 20 nm diameter in water. We chose the hydrophobic poly(tert-butyl acrylate) as the dendritic core as it had little or no toxicity, was shown to posses adjuvant properties when simply mixed with inactivated viral antigens,[9, 10] and has a high affinity for self-assembly into nanoparticles when the peripheral outer layer is hydrophilic.[11] The a-helical 20-mer epitope p145 (LRRDLDASREAKKQVEKALE), which is a peptide from the C-repeat region of the M protein, can elicit a protective antibody immune response when administered with an adjuvant or incorporated into the lipid core of a murine model.[8, 12] However, p145 was not a suitable vaccine candidate as T-cells specific to p145 were found to be crossreactive with human heart tissue,[5] and may prompt the development of autoimmune disease (RHD).[8] Therefore, the J14 epitope used in this work was the minimal B-cell epitope (J14i, ASREAKKQVEKALE; derived from p145) incorporated between two helix-promoting sequences from the yeast GCN4 protein to induce a native conformation. J14i alone had no native secondary helical conformation and produced little or no immunogenicity.[6] The J14 epitope was found to induce protective responses without stimulating cross-reactive antibodies but only when mixed with the toxic complete Freunds adjuvant (CFA).[13] Previous work using J14 peptides covalently attached to linear polymers (with a broad molecular-weight distribution) generated an antibody response only when coadministered with CFA.[14] Such an imprecise and heterogeneous antigen display combined with CFA makes their mechanistic understanding and regulatory approval challenging. The dendrimer structures described in this work are well-defined (Figure 1). The alkyne-functionalized four-arm star 1 was synthesized by successive atom-transfer radical polymerization (ATRP)[15] and copper-catalyzed alkyneazide 1,3-dipolar cycloaddition (CuAAC) click reaction (Scheme S1 in the Supporting Information).[16] The living radical polymerization allowed us to obtain a core with a very narrow molecular-weight distribution (polydispersity index of less than 1.09). Unprotected J14 epitopes possessing an N-terminus azide moiety
Angew. Chem. 2010, 122, 5878 5881

[*] Dr. M. Skwarczynski, M. Zaman, I-C. Lin, Prof. I. Toth School of Chemistry and Molecular Biosciences The University of Queensland, Brisbane QLD 4072 (Australia) Fax: (+ 61) 7-336-54273 E-mail: i.toth@uq.edu.au Dr. C. N. Urbani, Dr. Z. Jia, Prof. M. J. Monteiro Australian Institute for Bioengineering and Nanotechnology (AIBN) The University of Queensland, Brisbane QLD 4072 (Australia) Fax: (+ 61) 7-3346-3973 E-mail: m.monteiro@uq.edu.au Dr. M. R. Batzloff, Prof. M. F. Good The Queensland Institute of Medical Research, Brisbane (Australia) Prof. I. Toth School of Pharmacy The University of Queensland, Brisbane QLD 4072 (Australia) [**] This work was supported by the National Health and Medical Research Council. We thank George Blazak at the University of Queensland, Australia, for performing elemental analysis, and Dr. M. Georgousakis from QIMR for providing us with IgG J14 antibody. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002221.

5878

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
the conjugation of five peptide epitopes (N/C = 0.15) to a dendritic core. The particle size distribution was narrow, with a particle diameter of 21 nm, based on the volume particle size distribution (> 95 %) of the dendrimer structure (Figure S1 A in the Supporting Information). TEM measurements showed a good correlation with the dynamic light scattering results (Figure 1 b). The size of the produced nanoparticles was optimal for vaccine purposes since nanoparticles close to 20 nm in diameter were able to traffic, localize, and maintain a strong presence in lymph nodes, thus allowing the greatest exposure to dendritic cells.[18] Peptide J14 alone showed a conformation that was more random than helical when measured in water (Figure S2 in the Supporting Information). Under the same conditions, a typical ahelix curve in CD spectra was observed for the dendritic molecule 2. This result suggests that the conformation of J14 epitopes changed from random to an a-helix on the surface of the nanoparticles (CD spectra of the dendrimer itself were not recorded because of its insolubility in aqueous solvents). The conformation change of the J14 Figure 1. a) Synthesis of dendrimers that contain multiple copies of the J14 epitope (2). Yellow ribbons epitope on the nanoparticles represent the J14 peptide epitope. TEM images of b) 2 and c) immuno-gold-labeled 2 nanoparticles (scale bar: 200 nm). was supported by the change in surface charge as measured by the zeta potential, which ranged from 20 mV for the free epitopes to 16 mV for were further clicked onto 1 (Figure 1 a and the Supporting the nanoparticles (Figure S1b in the Supporting Information). Information). We used copper wire instead of the typically To confirm that the J14 epitopes on the surface of the copper/ligand catalyst system in order to reduce copper and nanoparticles were indeed active and presented in the correct ligand impurities, and allow ease of purification by simply conformation, the nanoparticles were labeled with immunoremoving the wire from the reaction medium.[17] globulin G (IgG; which is specific to J14) and reacted with The self-adjuvanting vaccine nanoparticle was formed by gold-labeled goat anti-mouse antibody. The TEM micrograph dialysis of a solution of the dendrimer in DMF against water. (Figure 1 c) showed the agglomeration between nanoparticles Dialysis also allowed the removal of any remaining peptide, and gold (black dot) through antibody recognition, thus residual copper species from the click reaction, and DMF. indicating the presence of active J14 epitopes on the nanoThe attachment of peptide molecules to produce the dendriparticle surface. mer was confirmed by elemental analysis, which showed a We measured antibody titers in mice sera following significant increase in the nitrogen/carbon ratio to 0.15 subcutaneous immunization. The nanoparticles produced compared to that of 1 (N/C = 0.02). These data suggested
Angew. Chem. 2010, 122, 5878 5881  2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Chemie

www.angewandte.de

5879

Zuschriften
high levels of systemic J14-specific IgG antibody similar to that observed with the injection of J14 epitope with CFA as a positive control. Significantly higher antibody titers were observed for the nanoparticles conjugated with J14 epitopes (2) in comparison with a physical mixture of J14 with dendrimer 1, thus suggesting that chemical conjugation of epitopes with a polymer core was essential to elicit an immune response (Figure 2). This observation is in contrast to for the non-self-adjuvanting vaccine candidate that is based on the diphtheria toxoid and acts against GAS.[19] As J14 was a chimera of the streptococcal M protein derived peptide and yeast GCN4-protein sequences, the assessment of whether the antibody response elicited by nanoparticles was indeed directed to the M protein derived sequences was essential.[20] Therefore, we evaluated the ability of the antibodies generated above to bind to a-helical 20-mer epitope p145 and found significant levels of p145specific antibodies after subcutaneous immunization with 2 (Figure 2 b). This observation implies that antibodies elicited by the nanoparticles should be able to recognize the GAS M protein. The strategy developed here offers an attractive alternative to conventional vaccine approaches. The resulting nanoparticles consist of a peripheral antigenic epitope layer conjugated to a polymer core, and are both self-adjuvanting and produce a strong immune response to the GAS M protein. The nanoparticles formed through the self-assembly of well-defined J14polymer dendrimers was of a size (20 nm) that allowed possible maximum exposure to the immune system. Our dendrimernanoparticles vaccine approach should be readily acquiescent to other pathogenic organisms apart from GAS, and may prove particularly useful for the design of vaccines against infectious diseases known to stimulate an autoimmune response in a host.
Received: April 15, 2010 Published online: July 7, 2010

Keywords: amphiphiles dendrimers drug delivery nanoparticles self-assembly

Figure 2. a) J14-specific serum IgG titers and b) p145-specific serum IgG titers at the final bleed (day 37) after subcutaneous immunization for each individual mouse. Mean specific serum IgG antibody titers are represented as a bar. Statistical analysis was performed using a one-way analysis of variance (ANOVA) followed by the Tukey post hoc test (ns p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001).

previously reported data, where a physical mixture of antigens with a linear polyacrylate gave significant antibody responses (the difference was that inactivated viruses were used as antigen).[9] IgG subclass Ab responses were determined after immunization with the nanoparticles. Significant levels of IgG1, IgG2b, and IgG3 were detected and the lack of IgG2a reflected only type 2 helper T cells (Th2) responses (Figure S3 in the Supporting Information). Antibody IgG1 generation is usually associated with Th2 responses, whereas high level of IgG2a, are thought to reflect Th1 responses. Th2 response mediates cellular immunity to viruses or intracellular bacteria. A similar response pattern has been found

[1] M. R. Batzloff, K. S. Sriprakash, M. F. Good, Curr. Drug Targets 2004, 5, 57 69. [2] J. R. Carapetis, A. C. Steer, E. K. Mulholland, M. Weber, Lancet Infect. Dis. 2005, 5, 685 694. [3] C. Olive, M. R. Batzloff, I. Toth, Expert Rev. Vaccines 2004, 3, 43 58. [4] A. C. Steer, J. R. Carapetis, Nat. Rev. Cardiol. 2009, 6, 689 698. [5] S. Pruksakorn, B. Currie, E. Brandt, C. Phornphutkul, S. Hunsakunachai, A. Manmontri, J. H. Robinson, M. A. Kehoe, A. Galbraith, M. F. Good, Int. Immunol. 1994, 6, 1235 1244. [6] W. A. Hayman, E. R. Brandt, W. A. Relf, J. Cooper, A. Saul, M. F. Good, Int. Immunol. 1997, 9, 1723 1733. [7] T. Akagi, M. Baba, M. Akashi, Polymer 2007, 48, 6729 6747; H. Kakwere, C. K. Y. Chun, K. A. Jolliffe, R. J. Payne, S. Perrier, Chem. Commun. 2010, 46, 2188 2190. [8] C. Olive, P. M. Moyle, I. Toth, Curr. Med. Chem. 2007, 14, 2976 2988. [9] L. A. T. Hilgers, I. Nicolas, G. Lejeune, E. Dewil, M. Strebelle, B. Boon, Vaccine 1998, 16, 1575 1581. [10] L. A. T. Hilgers, L. Ghenne, I. Nicolas, M. Fochesato, G. Lejeune, B. Boon, Vaccine 2000, 18, 3319 3325. [11] C. N. Urbani, C. A. Bell, D. Lonsdale, M. R. Whittaker, M. J. Monteiro, Macromolecules 2008, 41, 76 86. [12] W. Zhong, M. Skwarczynski, I. Toth, Aust. J. Chem. 2009, 62, 956 967. [13] M. S. Shaila, R. Nayak, S. S. Prakash, M. Georgousakis, E. Brandt, D. J. McMillan, M. R. Batzloff, S. Pruksakorn, M. F. Good, K. S. Sriprakash, Vaccine 2007, 25, 3567 3573.
Angew. Chem. 2010, 122, 5878 5881

5880

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[14] E. R. Brandt, K. S. Sriprakash, R. I. Hobb, W. A. Hayman, W. G. Zeng, M. R. Batzloff, D. C. Jackson, M. F. Good, Nat. Med. 2000, 6, 455 459. [15] K. Matyjaszewski, P. J. Miller, J. Pyun, G. Kickelbick, S. Diamanti, Macromolecules 1999, 32, 6526 6535. [16] H. C. Kolb, K. B. Sharpless, Drug Discovery Today 2003, 8, 1128 1137. [17] C. N. Urbani, C. A. Bell, M. R. Whittaker, M. J. Monteiro, Macromolecules 2008, 41, 1057 1060. [18] S. T. Reddy, A. J. van der Vlies, E. Simeoni, V. Angeli, G. J. Randolph, C. P. ONeill, L. K. Lee, M. A. Swartz, J. A. Hubbell, Nat. Biotechnol. 2007, 25, 1159 1164; S. T. Reddy, A. Rehor, H. G. Schmoekel, J. A. Hubbell, M. A. Swartz, J. Controlled Release 2006, 112, 26 34; K. S. Jones, Biotechnol. Prog. 2008, 24, 807 814. [19] K. Schulze, C. Olive, T. Ebensen, C. A. Guzman, Vaccine 2006, 24, 6088 6095. [20] M. M. Georgousakis, A. Hofmann, M. R. Batzloff, D. J. McMillan, K. S. Sriprakash, Vaccine 2009, 27, 6799 6806.

Chemie

Angew. Chem. 2010, 122, 5878 5881

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5881

Zuschriften
Metal-Catalyzed Reactions
DOI: 10.1002/ange.201002117

Regiodivergent Ligand-Controlled Rhodium-Catalyzed [(2+2)+2] Carbocyclization Reactions with Alkyl Substituted Methyl Propiolates**
P. Andrew Evans,* James R. Sawyer, and Phillip A. Inglesby
Dedicated to Professor Jack R. Norton on the occasion of his 65th birthday The importance of transition metal-catalyzed reactions may be attributed, at least in part, to the manner in which they can control the formation of a specific product using ancillary ligands on the metal center.[1] In this context, metal-catalyzed [2+2+2] carbocyclization reactions present a formidable challenge with respect to controlling chemo-, regio-, and various aspects of stereoselectivity.[24] A fundamental objective in this area is the ability to predict and control the outcome of a specific transformation without recourse to extensive experimentation.[5] In a program directed towards the development and understanding of this type of transformation, we described the first regio- and enantioselective rhodium-catalyzed [(2+2)+2] carbocyclization of 1,6-enynes 1 with aryl substituted methyl propiolates 2 for the construction of bicyclohexa-1,3-dienes 3 (Scheme 1).[4, 6] As a consequence of this study, we were intrigued by the factors that control regioselectivity and whether the ancillary ligands could be modified to switch the regioselective outcome to provide selective access to both regioisomers.[7] Herein, we now describe the regiodivergent rhodiumcatalyzed [(2+2)+2] carbocyclization of 1,6-enynes 1 with alkyl substituted methyl propiolates 2 for the construction of the bicyclohexa-1,3-dienes 3 and 4 (Scheme 1).[8, 9] Furthermore, these studies provide another example of the detrimental role that silver salts have on selectivity in a metalcatalyzed reaction, which has important implications for development and rationalization of related higher-order carbocyclization reactions.[10] Table 1 outlines the preliminary studies to probe the feasibility of the regiodivergent carbocyclization reaction. Treatment of the 1,6-enyne 1 a (X = NTs) and methyl 2Table 1: Optimization of the regioselective rhodium-catalyzed [(2+2)+2] carbocyclization reaction (Scheme 1; 1 a X = NTs, 2 a R = Me, E = CO2Me).[a] Entry 1 2 3 4 5 6 7 8 9[f ] Rhodium complex [Rh(PPh3)3Cl] [Rh(cod)2]OTf [Rh(cod)2]OTf [Rh(cod)2]OTf [Rh(PPh3)3Cl] [Rh(PPh3)3Cl] [Rh(cod)2]OTf [Rh(cod)2]OTf [Rh(cod)2]OTf Ligand PPh3 PPh3 PPh3 cod PPh3 PPh3 Xyl-binap Ratio of Rh:L 1:1 1:2 1:3 1:2 1:3 1:3 1:1.5 AgX[b] OTf OTf[e] OTf Cl OTf Yield [%][c] 90 57 63 75 90 42 60 45 91 Ratio of 4 a :3 a[d] 7:1 1:1 15:1 ! 19:1 7:1 5:1 6:1 7:1 1:19

Scheme 1. Regiodivergent rhodium-catalyzed [(2+2)+2] carbocyclization reactions.

[*] Prof. Dr. P. A. Evans, P. A. Inglesby Department of Chemistry, The University of Liverpool Liverpool, L69 7ZD (UK) Fax: (+ 44) 151-794-1377 E-mail: andrew.evans@liverpool.ac.uk Homepage: http://osxs.ch.liv.ac.uk/ J. R. Sawyer Department of Chemistry, Indiana University Bloomington, IN 47405 (USA) [**] We thank the National Institutes of Health (GM54623) for generous financial support. We also thank the Royal Society for a Wolfson Research Merit Award (P.A.E.), Eli Lilly for a Graduate Fellowship (J.R.S.) and AstraZeneca (Alderley Park) for a studentship (P.A.I.) through the EPSRCPharma Managed Programme for (Synthetic) Organic Chemistry. We also acknowledge Dr. Sam Butterworth (AZ) for his support and helpful discussions. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002117.

[a] All reactions were carried out on a 0.25 mmol reaction scale utilizing 5 mol % of the rhodium catalyst in benzene at 60 8C. [b] 5 mol %. [c] Yields of isolated products. [d] Ratios determined by 500 MHz 1 H NMR on the crude reaction mixture. [e] The insoluble silver salts were filtered through a 13 mm syringe filter with a 0.2 mm PTFE membrane prior to the introduction of 1 a and 2 a. [f] Reaction performed in tetrahydrofuran for solubility of the ligand.[13]

butynoate 2 a (R = Me, E = CO2Me) with silver triflate modified Wilkinsons catalyst in benzene, furnished the bicyclohexa-1,3-dienes 4 a and 3 a in 90 % yield, with 7:1 regioselectivity favoring 4 a (Table 1, entry 1). Although the selectivity was modest, the reaction provides the opposite regioselectivity to that obtained with an axially chiral phosphine ligand (see below).[4b] In order to further improve the selectivity we elected to examine the reaction under saltfree conditions using the cationic rhodium complex, [RhAngew. Chem. 2010, 122, 5882 5885

5882

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
(cod)2]OTf (cod = cyclooctadiene), which obviates the need for the counterion exchange and thereby allows the reconstitution of the cationic version of Wilkinsons catalyst in the absence of silver salts.[10] Interestingly, this study clearly demonstrated the importance of the ligand stoichiometry (Table 1, entries 24) and the detrimental effect of the silver salts on regioselectivity. For example, the optimal reaction conditions provide the bicyclohexa-1,3-diene 4 a in 75 % yield with ! 19:1 regioselectivity (Table 1, entry 4 vs. 1).[11] Although these conditions should provide the same active pre-catalyst, the absence of the residual silver salt clearly has an impact on the level of regiocontrol. Additional control experiments indicate that the partial solubility of both silver chloride and triflate are sufficient to provide lower selectivity (Table 1, entries 58).[10] Having established optimal reaction conditions for the formation of 4 a, we elected to reexamine the axially chiral phosphine ligands for the formation of 3 a, which had previously proven suboptimal.[4b, 6] Gratifyingly, Xyl-binap (2,2-bis[di(3,5-xylyl)phosphanyl]-1,1-binaphthyl) proved to be the optimal ligand for the formation of bicyclohexa-1,3-diene 3 a, which was obtained in 91 % yield with ! 19:1 regioselectivity (Table 1, entry 9), to provide a selective protocol for the more challenging alkyl substituted methyl propiolates.[12] Table 2 summarizes the application of the optimized reaction conditions (Table 1, entry 4) to various tethers and substituted methyl propiolates to determine the scope and
Table 2: Scope of the intermolecular rhodium-catalyzed [(2+2)+2] carbocyclization reaction (Scheme 1; E = CO2Me).[a] Entry 1 2 3 4 5 6 7 8 9 10 11 12 1,6-Enyne 1 X= NTs NTs NTs NTs C(CO2Me)2 C(CO2Me)2 C(CO2Me)2 C(CO2Me)2 O O O O a a a a b b b b c c c c Alkyne 2 R= Me iPr c-Pr CH2OBn Me iPr c-Pr CH2OBn Me iPr c-Pr CH2OBn a b c d a b c d a b c d Yield of 4 [%][b] 75 79 82 83 77 74 71 78 71 84 69 69 a b c d e f g h i j k l Ratio of 4:3[c] ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1 ! 19:1

Chemie

gent metal-catalyzed [(2+2)+2] carbocyclization reaction for the construction of novel bicyclohexa-1,3-dienes, which provide useful synthons for target directed synthesis.[24] Additional studies focused on further enhancing the scope through the examination of the combined regio- and diastereoselective reaction. The phenyl-substituted 1,6-enyne 5 was selected to facilitate the direct comparison with prior investigations in related higher-order carbocyclization reactions. Whereas the silver salt modified Wilkinsons catalyst furnished the bicyclohexa-1,3-dienes 6 a and 6 b with poor regioand stereocontrol, the salt-free conditions afforded 6 a in 83 % yield with ! 19:1 regio- and diastereoselectivity [Eq. (1)].[14] X-ray crystallographic analysis of 6 a confirmed the regio- and stereochemical assignment, which is consistent with our related studies.

Outlined in Scheme 2 is a plausible mechanistic hypothesis for the regiodivergent behavior, which occurs as the result of switching the ancillary ligands. As illustrated, the

Scheme 2. Proposed catalytic cycles for the regiodivergent rhodiumcatalyzed [(2+2)+2] carbocyclization reaction.

[a] All reactions were carried out on a 0.25 mmol reaction scale using 5 mol % of [Rh(cod)2]OTf, modified with 15 mol % PPh3 in benzene at 60 8C under argon. [b] Yields of isolated products. [c] Ratios determined by 400 MHz 1H NMR on crude reaction mixtures.

limitations of this transformation. This study demonstrates that nitrogen, carbon, and oxygen containing tethered enynes 1 ac undergo the carbocyclization with exquisite regiocontrol with an array of straight chain and branched alkyl, including benzyl-protected hydroxymethyl-substituted methyl propiolates 2 ad, to furnish the corresponding bicyclohexa-1,3dienes 4 al in good to excellent yield. X-ray crystallographic analysis of the cycloadducts 4 a and 4 d allowed the correlation of the NMR spectra to confirm the regiochemical assignment in each case. Overall, this work provides the first regiodiverAngew. Chem. 2010, 122, 5882 5885

first step in each of these processes is the formation of the metallabicyclopentene b and e from the oxidative addition of the metal into the 1,6-enyne 1.[15] The divergence occurs for the preferential migratory insertion of the metalalkyl bond in b to provide metallabicycloheptadiene c (cycle A), versus the metalvinyl bond in e to provide the metallabicycloheptadiene f (cycle B).[16, 17] Reductive elimination of the isomeric metallacycles provides the bicyclohexa-1,3-dienes 3 and 4, respectively. The preferential migration of the metalalkyl versus metalvinyl bond is presumably the consequence of the axially chiral bidentate ligand preventing the necessary cis-alignment with the vinyl group in b, which promotes the generally less-favorable alkyl migration.[16, 18] In conclusion, we have described the regio- and diastereoselective intermolecular rhodium-catalyzed [(2+2)+2] www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5883

Zuschriften
carbocyclization of carbon- and heteroatom tethered terminal 1,6-enyne derivatives with a range of alkyl substituted methyl propiolates. A key feature of this study is an intriguing mechanistic dichotomy that provides the ability to control the formation of either regioisomer through the judicious choice of the ancillary ligand. Central to this accomplishment was the realization that residual silver salts from the salt metathesis of the neutral complex have a detrimental effect on regio- and diastereoselectivity. We anticipate the ability to reverse the regiocontrol in this manner in conjunction with the elimination of unnecessary silver salts, provide fundamentally important considerations for future developments in this important area.
Jiao, Y. Liang, D. Yang, S. Zhang, P. A. Wender, Z.-X. Yu, J. Am. Chem. Soc. 2007, 129, 10060; b) H. Wang, J. R. Sawyer, P. A. Evans, M.-H. Baik, Angew. Chem. 2008, 120, 348; Angew. Chem. Int. Ed. 2008, 47, 342. Although the aryl substituted methyl propiolates undergo selective carbocyclization with axially chiral bidentate phosphines, the alkyl-substituted derivatives only proceed with modest regiocontrol. For example, the analogous enantioselective carbocyclization of 1 a with 2 a using the chiral complex derived from [{Rh(cod)Cl}2] and (S)-Xyl-P-Phos modified with AgBF4, afforded 3 a/4 a with 4:1 regioselectivity favoring 3 a with excellent enantioselectivity (90 % ee).[4b] For a recent example of ligand-controlled carbocyclization reactions, see: P. Maulen, R. M. Zeldin, A. Z. Gonzlez, F. D. Toste, J. Am. Chem. Soc. 2009, 131, 6348. The term regiodivergent, adapted from Ngrdis definition of stereoconvergence, refers to the formation of two isomeric products from the same starting material(s). M. Ngrdi in Stereoselective Synthesis, VCH, New York, 1996. Although Oh et al. have reported the ability to switch the regiochemistry in the rhodium-catalyzed dimerization of 1,6enynes, we have recently demonstrated that these reaction conditions provide the same regioisomer as originally reported by Grigg and co-workers, namely the formation of 7. This misassignment by Oh is presumably the result of the analysis of the cycloadducts in [D1]chloroform rather than [D6]benzene.[3d]

[6]

[7]

[8]

Experimental Section
[Rh(cod)2]OTf (5.9 mg, 0.0125 mmol) and triphenylphosphine (9.8 mg, 0.0375 mmol) were suspended in benzene (5 mL) under an atmosphere of argon. The catalyst mixture was warmed to 60 8C using a preheated oil bath and the mixture stirred for approximately 30 min to afford a homogeneous solution. Methyl-2-butynoate (2 a ; 73.5 mg, 0.75 mmol) was added through a tared microliter syringe, followed by the syringe pump addition of the 1,6-enyne 1 a (62.3 mg, 0.25 mmol) in benzene (1 mL) over approximately 2 h. The reaction was allowed to stir at 60 8C for an additional approximately 2 h (t.l.c. control), cooled to room temperature, and evaporated in vacuo to afford a crude oil. Purification by flash chromatography (eluting with a gradient of 10 30 % ethyl acetate/hexanes) furnished the bicyclohexa-1,3-diene 4 a (65.4 mg, 75 %) as a white crystalline solid. Received: April 9, 2010 Published online: July 13, 2010 [9]

Keywords: carbocyclization diastereoselective metallacycle regiodivergent reactions rhodium

[1] a) P. W. N. M. van Leeuwen, P. C. J. Kamer, J. N. H. Reek, P. Dierkes, Chem. Rev. 2000, 100, 2741; b) P. W. N. M. van Leeuwen in Homogeneous Catalysis: Understanding the Art, Kluwer, Dordrecht, 2004, pp. 10 25. [2] For excellent reviews on metal-catalyzed [2+2+2] carbocyclizations involving 1,6-enynes, see: a) M. Malacria, C. Aubert, J. L. Renaud in Science of Synthesis: Houben-Weyl Methods for Molecular Transformations, Vol. 1 (Eds.: M. Lautens, B. M. Trost), Thieme, New York, 2001, pp. 439 530; b) P. A. Inglesby, P. A. Evans, Chem. Soc. Rev. 2010, 39, DOI: 10.1039/b913110h. [3] For examples of metal-catalyzed and metal-mediated intermolecular [(2+2)+2] carbocyclizations of tethered 1,6-enynes with alkynes, see: a) Co : C.-A. Chang, J. A. King, Jr., K. P. C. Vollhardt, J. Chem. Soc. Chem. Commun. 1981, 53; b) Ir : S. Kezuka, T. Okado, E. Niou, R. Takeuchi, Org. Lett. 2005, 7, 1711; c) Pd : B. M. Trost, G. J. Tanoury, J. Am. Chem. Soc. 1987, 109, 4753; Y. Yamamoto, S. Kuwabara, Y. Ando, H. Nagata, H. Nishiyama, K. Itoh, J. Org. Chem. 2004, 69, 6697; d) Rh : R. Grigg, R. Scott, P. Stevenson, J. Chem. Soc. Perkin Trans. 1 1988, 1365; C. H. Oh, H. R. Sung, S. H. Jung, Y. M. Lim, Tetrahedron Lett. 2001, 42, 5493; T. Shibata, Y. Arai, Y.-k. Tahara, Org. Lett. 2005, 7, 4955. [4] a) P. A. Evans, J. R. Sawyer, K. W. Lai, J. C. Huffman, Chem. Commun. 2005, 3971; b) P. A. Evans, K. W. Lai, J. R. Sawyer, J. Am. Chem. Soc. 2005, 127, 12466. [5] For recent examples of DFT predicted metal-catalyzed carbocyclization reactions, see: a) Y. Wang, J. Wang, J. Su, F. Huang, L.

[10] For other transition metal-catalyzed reactions that have implicated the silver salt for poor selectivity, see: a) F. Miyazaki, K. Uotsu, M. Shibasaki, Tetrahedron 1998, 54, 13073; b) T. M. Schmid, G. Consiglio, Chem. Commun. 2004, 2318; c) K. C. Nicolaou, A. Li, D. J. Edmonds, G. S. Tria, S. P. Ellery, J. Am. Chem. Soc. 2009, 131, 16905. [11] The monodentate ligands also switch the regioselectivity for the aryl-substituted methyl propiolates that were originally investigated.[4b] For example, treatment of enyne 1 b with methyl phenyl propiolate 2 e (R = Ph) under the optimal conditions, furnished the bicyclohexa-1,3-diene 4 m in 52 % yield and with ! 19:1 regioselectivity. [12] Interestingly, the salt-free conditions dramatically improve the regioselective formation of the bicyclohexa-1,3-diene 3 a (X = NTs, R = Me), which is significantly lower in the presence of silver salts (r.s. = 4:1).[4b,6] [13] The analogous carbocyclization reaction (Table 1, entry 1) in tetrahydrofuran furnished the bicyclohexa-1,3-diene 4 a in 76 % yield as the major regioisomer (r.s. = 4:1), which indicates the solvent is not playing a major role on the reversal of the regioselection. [14] The origin of diastereocontrol is consistent with our previous studies and a related iridium-catalyzed [(2+2)+2] carbocyclization with a symmetrical alkyne.[2b, 3b] [15] For examples of selective formation of metallacyclopentenes in the presence of both alkynes and alkenes, see: M. Jeganmohan, C.-H. Cheng, Chem. Eur. J. 2008, 14, 10876. [16] For selected examples of metalvinyl versus metalalkyl migratory insertion, see: a) Y. Wakatsuki, K. Aoki, H. Yamazaki, J. Am. Chem. Soc. 1979, 101, 1123; b) K. M. Doxsee, J. K. M.

5884

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5882 5885

Angewandte
Mouser, Organometallics 1990, 9, 3012; c) T. Shibata, Y.-k. Tahara, K. Tamura, K. Endo, J. Am. Chem. Soc. 2008, 130, 3451. [17] For a recent example of the regioselective insertion of polarized alkynes to form metallacycles in which the electron-withdrawing group is adjacent to the metal, see: M. Paneque, C. M. Posadas, M. L. Poveda, N. Rendn, E. lvarez, K. Mereiter, Chem. Eur. J. 2007, 13, 5160. [18] For the rationalization of the geometry of metallacycles analogous to b and e, see: a) cycle A : C. E. Dean, R. D. W. Kemmitt, D. R. Russell, M. D. Schilling, J. Organomet. Chem. 1980, 187, C1; b) cycle B : J. B. Bleeke, W.-J. Peng, Y.-F. Xie, M. Y. Chiang, Organometallics 1990, 9, 1113, and references therein.

Chemie

Angew. Chem. 2010, 122, 5882 5885

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5885

Zuschriften
Crystal Engineering
DOI: 10.1002/ange.201002053

The Reaction of Organozinc Compounds with an Aldehyde within a Crystalline Molecular Flask**
Koki Ikemoto, Yasuhide Inokuma, and Makoto Fujita*
When bulky substrates and reagents exhibit pseudo solutionstate mobility and reactivity within porous coordination networks,[1] the networks can be employed as crystalline molecular flasks.[24] The robust crystallinity of the networks facilitates the use of X-ray crystallography, the ultimate method of structural determination, for the in-situ observation of various organic transformations.[2] Unstable products and even a transient reaction intermediate were protected within the crystalline flasks and were directly observed by Xray crystallography.[2d] Until now, reactions have been limited to mild conditions (typically, neutral pH at room temperature), but herein we show that crystalline flasks can tolerate the inclusion of reactive organozinc reagents and that the subsequent reaction with an embedded aromatic aldehyde showed enhanced reactivity and selectivity. Recently, the addition of organozinc reagents to aldehydes in organic solvents was catalyzed in the presence of a binaphtholcontaining porous network,[5] but it was unclear where the reaction occurred. In contrast, direct X-ray analysis of crystalline flasks revealed the precise reaction location[2] and underscores the potential applications of crystalline flasks toward organometallic transformations.[6] Our porous network crystallized from ZnI2, tris(4-pyridyl)triazine (2) and 2-formyltriphenylene (3) in nitrobenzenemethanol solvent mixture (Scheme 1). Elemental analysis elucidated the molecular formula of {[(ZnI2)3(2)2(3)] x(solvent)}n (1), with nitrobenzene as cocrystallized solvent (x = 4.5). Triphenylene guest 3 is an integral part of the network structure, which tolerates a variety of functional groups. Analogous networks containing 3 have been reported,[7, 2c] but herein, the procedure was scaled up and network complex 1 prepared in large quantities (205 mg) in 21 % yield (see the Supporting Information). The porous structure 1, determined by X-ray crystallographic analysis, exhibits two pores, A and B, which are characteristic of this type of coordination network (Figure 1 a). Guest 3 is embedded in columnar stacks of ligand 2,
[*] K. Ikemoto, Dr. Y. Inokuma, Prof. Dr. M. Fujita Department of Applied Chemistry, School of Engineering The University of Tokyo Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan) Fax: (+ 81) 3-5841-7257 E-mail: mfujita@appchem.t.u-tokyo.ac.jp [**] This research was supported by the CREST project of the Japan Science and Technology Agency (JST), for which M.F. is the principal investigator, and also in part by KAKENHI (20044006), JSPS, and Global COE Program (Chemistry Innovation through Cooperation of Science and Engineering), MEXT (Japan). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002053.

Scheme 1. a) Preparation of the network 1, and b) addition reaction of organozinc compounds to 3 within crystals of 1.

Figure 1. a) Network structure of 1 after the reaction with dimethylzinc. b, c) View of the columnar stack and triphenylene guest (ORTEP; ellipsoids set at 30 % probability) in 1 b) before and c) after the reaction. In (b), only the formyl group in pore A (47 % occupancy) is represented.
Angew. Chem. 2010, 122, 5886 5888

5886

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
which coordinate three ZnI2 centers and generate the infinite network. The formyl group of 3 in the as-synthesized network 1 is located in pore B, and disordered nitrobenzene molecules fill both pores. As nitrobenzene can react with organozinc reagents, the included nitrobenzene was replaced with inert toluene after immersion for 2 d. Complete solvent exchange was confirmed by X-ray analysis. Pores A and B contained only toluene molecules, but now the formyl group of 3 was found in the both pores A and B with 47 and 53 % occupancies, respectively (Figure 1 b; see also the Supporting Information). The addition of organozinc reagents to aldehyde 3 trapped within the crystalline flask was examined on large scale. Crystals of 1 (205 mg) were immersed in a toluene solution of dimethylzinc (2.0 m , 3.0 mL) for 24 h at room temperature. Excess dimethylzinc toluene solution was removed by decantation and the crystals decomposed with 5.0 m hydrochloric acid. The product was extracted with CH2Cl2 and purified by column chromatography to give methyl adduct 4 a in 85 % yield. Independently, multiple small-scale reactions were quenched at various time intervals, extracted, and analyzed by NMR. Plotting the conversion ratio versus time revealed that the reaction is essentially complete in fewer than 12 h. Diethylzinc also reacted with aldehyde 3 in network 1 (77 mg) and gave the ethyl adduct 4 b in 90 % isolated yield. Microscopic FT-IR spectroscopy of a single crystal of reacted 1 showed the disappearance of the strong C=O stretching vibration of the formyl group at 1697 cm1 and corroborated that the reaction did indeed occur inside the crystals. Despite the lack of an activating Lewis base, such as amines or alcohols, the addition of alkylzinc reagents to aldehydes trapped within the pores led to enhanced reactivity and selectivity. Outside the crystalline flasks, the reactivity of 3 and dimethylzinc in toluene solution was negligible (5 % yield) and the addition of ZnI2 and/or ligand 2 to the toluene reaction mixture made little difference (68 % yield). The reaction did proceed with diethylzinc (98 % conversion) but a 4:6 mixture of 4 b and the reduced alcohol (ArCH2OH) was obtained. The enhanced reactivity and selectivity are presumably ascribed to high local concentrations and decreased mobility of the substrate/reagent, respectively, within the crystal. Furthermore, when diphenylzinc was employed as an organozinc reagent, aldehyde 3 was quantitatively recovered. This reagent selectivity can be ascribed to steric repulsion between bulky zinc reagent and the framework of 1. X-ray crystallographic analysis of the crystals immediately following the reaction revealed the robust network framework, but the final product structure was not fully solved because of strong residual electron densities in the pore; presumably from unreacted dimethylzinc, the unquenched zinc alkoxide, and partially hydrolyzed alcohol. The postreaction crystals were immersed in toluene (not anhydrous) to wash away excess zinc reagent and byproduct and to quench the zinc alkoxide. X-ray analysis of the washed crystals was successful and the structure of 4 a fully solved (Figure 1 c). Washing the crystals with toluene removed the excessive residual electron density from the pores, and the 1-hydroxyethyl group of 4 a was clearly observed in pore A. The methyl adduct is quite large, yet enough space remained within pore
Angew. Chem. 2010, 122, 5886 5888

Chemie

A and several solvent molecules were also present. Despite the Lewis acidic character and reactivity of alkylzinc reagents, the framework of 1 was not damaged. The ZnI2 atoms incorporated into the framework remained intact even though disproportionation between R2Zn and ZnI2 rapidly occurs in solution.[8] We next attempted the one-pot transformation of 3 into acetate 5 a.[9] Crystals containing in situ formed 4 a were transferred to an acetic anhydride/toluene (1:1) solution. After immersion for 24 h at room temperature, a single C=O stretching vibration at 1734 cm1 was observed by microscopic FTIR and assigned to the acylated product 5 a. The crystallinity of the robust network persisted and was confirmed by visual observation (Figure 2) and by X-ray dif-

Figure 2. The one-pot transformation of aldehyde 3 into acetate 5 a within crystals of 1. a) The reaction. bd) Microscope images of crystals of 1 b) before the reaction, c) after treatment with dimethylzinc, and d) after subsequent reaction with acetic anhydride.

fraction. The crystals containing 5 a were decomposed with acid and extracted, and acetate 5 a was confirmed by 1H NMR (> 95 % conversion). In a similar manner, two-step reaction with diethylzinc and acetic anhydride gave (1-acetoxy)propyl analogue 5 b in 93 % yield (see the Supporting Information). In summary, we demonstrated that even organometallic reactions proceed smoothly in a single-crystal-to-single-crystal fashion within the pores of porous coordination networks. These crystalline molecular flasks can tolerate highly reactive organometallic reagents while enhancing both the reactivity and selectivity. Furthermore, we envision the applications of crystalline flasks for the design of new reactions and the detailed structural and mechanistic examination of organometallic transformations through in situ crystallography.
Received: April 7, 2010 Revised: May 28, 2010 Published online: July 13, 2010

Keywords: metalorganic frameworks organozinc compounds porous networks single-crystal modifications X-ray diffraction www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5887

Zuschriften
[1] For reviews on coordination networks, see: a) S. R. Batten, R. Robson, Angew. Chem. 1998, 110, 1558 1595; Angew. Chem. Int. Ed. 1998, 37, 1460 1494; b) M. Eddaoudi, D. B. Moler, H. Li, B. Chen, T. M. Reineke, M. OKeeffe, O. M. Yaghi, Acc. Chem. Res. 2001, 34, 319 330; c) B. Moulton, M. J. Zaworotko, Chem. Rev. 2001, 101, 1629 1658; d) O. M. Yaghi, M. OKeeffe, N. W. Ockwig, H. K. Chae, M. Eddaoudi, J. Kim, Nature 2003, 423, 705 714; e) S. Kitagawa, R. Kitaura, S. Noro, Angew. Chem. 2004, 116, 2388 2430; Angew. Chem. Int. Ed. 2004, 43, 2334 2375; f) M. Kawano, M. Fujita, Coord. Chem. Rev. 2007, 151, 2592 2605; g) G. Frey, Chem. Soc. Rev. 2008, 37, 191 214. [2] a) T. Haneda, M. Kawano, T. Kojima, M. Fujita, Angew. Chem. 2007, 119, 6763 6765; Angew. Chem. Int. Ed. 2007, 46, 6643 6645; b) T. Haneda, M. Kawano, T. Kawamichi, M. Fujita, J. Am. Chem. Soc. 2008, 130, 1578 1579; c) T. Kawamichi, T. Kodama, M. Kawano, M. Fujita, Angew. Chem. 2008, 120, 8150 8152; Angew. Chem. Int. Ed. 2008, 47, 8030 8032; d) T. Kawamichi, T. Haneda, M. Kawano, M. Fujita, Nature 2009, 461, 633 635; e) T. Kawamichi, Y. Inokuma, M. Kawano, M. Fujita, Angew. Chem. 2010, 122, 2425 2427; Angew. Chem. Int. Ed. 2010, 49, 2375 2377. [3] a) J. S. Seo, D. Whang, H. Lee, S. I. Jun, J. Oh, Y. J. Jeon, K. Kim, Nature 2000, 404, 982 985; b) Z. Wang, S. M. Cohen, J. Am. Chem. Soc. 2007, 129, 12368 12369; c) K. K. Tanabe, Z. Wang, S. M. Cohen, J. Am. Chem. Soc. 2008, 130, 8508 8517; d) W. Morris, C. J. Doonan, H. Furukawa, R. Banerjee, O. M. Yaghi, J. Am. Chem. Soc. 2008, 130, 12 626 12 627; e) J. S. Costa, P. [4] Gamez, C. A. Black, O. Roubeau, S. J. Teat, J. Reedijk, Eur. J. Inorg. Chem. 2008, 1551 1554. For reviews on reactions in porous networks, see: a) Z. Wang, S. M. Cohen, Chem. Soc. Rev. 2009, 38, 1315 1329; b) J. Y. Lee, O. K. Farha, J. Roberts, K. A. Scheidt, S. B. T. Nguyen, J. T. Hupp, Chem. Soc. Rev. 2009, 38, 1450 1459; c) D. Farrusseng, S. Aguado, C. Pinel, Angew. Chem. 2009, 121, 7638 7649; Angew. Chem. Int. Ed. 2009, 48, 7502 7513. C.-D. Wu, A. Hu, L. Zhang, W. Lin, J. Am. Chem. Soc. 2005, 127, 8940 8941. Introduction of organometallic subunits for porous networks: a) S. Hermes, M.-K. Schrter, R. Schmid, L. Khodeir, M. Muhler, A. Tissler, R. W. Fischer, R. A. Fischer, Angew. Chem. 2005, 117, 6394 6397; Angew. Chem. Int. Ed. 2005, 44, 6237 6241; b) S. S. Kaye, J. R. Long, J. Am. Chem. Soc. 2008, 130, 806 807; c) M. Meilikhov, K. Yusenko, R. A. Fischer, J. Am. Chem. Soc. 2009, 131, 9644 9645. M. Kawano, T. Kawamichi, T. Haneda, T. Kojima, M. Fujita, J. Am. Chem. Soc. 2007, 129, 15 418 15 419. J. Boersma, J. G. Noltes, Tetrahedron Lett. 1966, 7, 1521 1525. For one-pot multistep reactions in a crystal, see: a) Z. Wang, S. M. Cohen, Angew. Chem. 2008, 120, 4777 4780; Angew. Chem. Int. Ed. 2008, 47, 4699 4702; b) M. J. Ingleson, J. P. Barrio, J.-B. Guilbaud, Y. Z. Khimyak, M. J. Rosseinsky, Chem. Commun. 2008, 2680 2682; c) C. J. Doonan, W. Morris, H. Furukawa, O. M. Yaghi, J. Am. Chem. Soc. 2009, 131, 9492 9493; d) T. Gadzikwa, O. K. Farha, C. D. Malliakas, M. G. Kanatzidis, J. T. Hupp, S. T. Nguyen, J. Am. Chem. Soc. 2009, 131, 13613 13615.

[5] [6]

[7] [8] [9]

5888

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5886 5888

Angewandte
DOI: 10.1002/ange.201002802

Chemie

Fullerenes

Glycosidase Inhibition with Fullerene Iminosugar Balls: A Dramatic Multivalent Effect**


Philippe Compain,* Camille Decroocq, Julien Iehl, Michel Holler, Damien Hazelard, Teresa Mena Barragn, Carmen Ortiz Mellet,* and Jean-Franois Nierengarten*
The electronic and structural properties of fullerene derivatives make them very attractive candidates for the construction of nanostructures that are potentially useful for applications in materials science and biological chemistry.[1] In particular, the C60 hexakis adducts with a Th-symmetrical octahedral addition pattern initially developed by Hirsch and co-workers[2] are unique organic molecules with an appealing compact spherical scaffold for the construction of multifunctional nanomaterials.[3] However, the synthesis of functionalized fullerene hexakis adducts from malonates and C60 is difficult.[3, 4] This major problem limits the applications of such systems and has been recently solved by the development of synthetic methodologies based on the postfunctionalization of easily accessible building blocks of fullerene hexakis adducts.[5, 6] It has been shown that fullerene hexakis adducts that bear 12 peripheral carbohydrate moieties can be prepared in excellent yields by grafting unprotected sugar derivatives onto the fullerene core.[7] Although these fullerene sugar balls are obviously perfectly suited for applica[*] Prof. P. Compain, C. Decroocq, Dr. D. Hazelard Laboratoire de Synthse Organique et Molcules Bioactives Universit de Strasbourg et CNRS (UMR 7509) Ecole Europenne de Chimie, Polymres et Matriaux 25 rue Becquerel, 67087 Strasbourg (France) Fax: (+ 33) 3-6885-2754 E-mail: philippe.compain@unistra.fr J. Iehl, Dr. M. Holler, Prof. J.-F. Nierengarten Laboratoire de Chimie des Matriaux Molculaires Universit de Strasbourg et CNRS (UMR 7509) Ecole Europenne de Chimie Polymres et Matriaux 25 rue Becquerel, 67087 Strasbourg (France) Fax: (+ 33) 3-6885-2774 E-mail: nierengarten@chimie.u-strasbg.fr T. Mena Barragn, Prof. C. Ortiz Mellet Departamento de Qumica Orgnica, Facultad de Qumica Universidad de Sevilla Profesor Garca Gonzlez 1, 41012 Sevilla (Spain) E-mail: mellet@us.es [**] This work was supported by the CNRS (UMR 7509), the Centre International de Recherche aux Frontires de la Chimie (FRC), the Agence National de la Recherche (ANR, grant number 08JC-009401), the Spanish Ministerio de Ciencia e Innovacin (contract numbers CTQ2007-61180/PPQ), the Fundacin Ramn Areces and the Junta de Andaluca, and doctoral fellowships from the French Department of Research to C.D. and J.I. We further thank A. Schifrin and I. Pfeifer for assistance with synthetic work, Dr. D. RodriguezLucena for helpful comments, and M. Schmitt for NMR measurements. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002802.
Angew. Chem. 2010, 122, 5889 5892

tions in the field of carbohydratelectin interactions,[8] the evaluation of carbohydrate-processing enzyme inhibition with such multivalent derivatives is less obvious. Indeed, among the possible strategies to attain specific potent glycosidase inhibition, the concept of multivalent design has been clearly overlooked.[9] Most enzymes actually have a single, deep active site that is usually less accessible than the shallow binding pockets or grooves on the lectin surfaces.[10] Consequently, a limited number of binding mechanisms, including statistical rebinding, are possible, whereas multivalent ligands may interact with multiple receptors by additional mechanistic options (e.g., the chelate effect, receptor clustering).[9, 11] It is likely that these factors may have hampered interest in projects directed towards the design of multivalent glycosidase inhibitors. In addition, the experimental results obtained to date were not particularly encouraging.[12] Di- to tetravalent analogues of 1-deoxynojirimycin, which is a well-known glycosidase inhibitor,[13] generally displayed comparable if not decreased inhibition compared with their monomeric counterparts. The best result reported to date was found for a trivalent iminosugar that showed a sixfold affinity enhancement towards Jack bean a-mannosidase.[14] Herein we report the synthesis of a fullerene hexakis adduct decorated with 12 iminosugar residues. The inhibition profile of this fullerene iminosugar ball has been systematically evaluated against various glycosidases,[15] and dramatic multivalent effects have been observed for the first time. In order to explore the potential of multivalency on glycosidase inhibition with a globular polytopic ligand constructed around the fullerene scaffold, an N-alkyl analogue of 1-deoxynojirimycin was selected as the peripheral ligand. This class of compounds is indeed poorly selective and displays modest to good glycosidase inhibition.[13] It was thus anticipated that these compounds could be excellent models for the examination of the influence of multivalency on inhibition selectivity over a large range of glycosidases. In addition, the alkyl chain on the endocyclic nitrogen atom of the iminosugar is an ideal spacer that may allow for easy grafting onto the central C60 core by means of a cycloaddition reaction.[16] The synthesis of the azide building block is based on the optimization of a strategy reported independently by Overkleeft et al.[17] and Vasella and co-workers.[18] As shown in Scheme 1, the d-hydroxy amide 2 was obtained directly from commercially available tetra-O-benzyl d -glucopyranose (1) in 78 % yield by oxidative amidation with iodine in 30 % aqueous ammonia (30 %).[19] The main advantage of this onepot process is that aldehyde oxidation and CN bond formation are performed in a single synthetic step. Oxidation of the hydroxy group at C5 followed by intramolecular

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5889

Zuschriften

Scheme 1. a) aq NH3 (30 %), I2, THF, 16 h, 78 %; b) DMSO, Ac2O; c) NaBH3CN, HCOOH, MeCN, 80 8C, 60 % over two steps; d) LAH, THF, reflux, 90 %; e) Br(CH2)6N3, Et3N, 4-dimethylaminopyridine (DMAP), DMF, 120 8C, 38 % (51 % based on recovered starting material); f) BCl3, CH2Cl2, 60 8C !0 8C, 77 %. g) Pent-1-yne, sodium ascorbate, CuSO45H2O, DMF/H2O (1:1), 61 %.

reductive amination afforded the expected lactam 3. Reduction with lithium aluminium hydride (LAH) and subsequent alkylation of the corresponding amine by using 1-azido-6bromo-hexane afforded the O-benzylated iminosugar 4. Selective cleavage of the benzyl protecting groups of 4 without interfering with the azide moiety was performed successfully by treatment with an excess of BCl3 in CH2Cl2 at low temperatures (60 08C).[20] Reaction of the resulting compound 5[21] with 1-pentyne in the presence of CuSO45 H2O and sodium ascorbate gave the derivative 6, which was used as the monovalent model compound in the inhibition assay. The synthesis of fullerene iminosugar ball 8 is shown in Scheme 2. Compound 7[6] was desilylated in situ with tetra-nbutylammonium fluoride (TBAF) to form the corresponding hexaadduct bearing 12 terminal alkyne units, with which the azide precursor 5 was subsequently reacted. The functionalized fullerene 8 was thus obtained in 83 % yield. The chemical structure of compound 8 was confirmed by its 1H and 13 C NMR spectra, which show the expected signals for the 12 equivalent peripheral iminosugar residues as well as the characteristic features of the fullerene hexakis-adduct core (see the Supporting Information). To further confirm the structure of compound 8, mass spectra (MALDI-TOF and ESI-MS) were recorded under different conditions. However, as already observed in the case of related fullerene sugar balls,[7] a high level of fragmentation prevented the observation of the expected molecular ion peak. This difficulty prompted us to prepare compound 9 by reaction of the fullerene derivative 7 with the benzylated iminosugar 4 (Scheme 2). The 1H and 13C NMR spectra of compound 9 show the same characteristic features that were observed for unprotected compound 8 (see the Supporting Information). MALDI-TOF mass spectrometry also confirmed the structure of fullerene derivative 9. The level of fragmentation was less dramatic in this case and the molecular ion peak could be clearly observed at m/z 9911.02 ([M + H]+, calculated for C618H659N48O72 : 9911.12). Finally, the UV/Vis spectra of

Scheme 2. a) 5, TBAF, sodium ascorbate, CuSO45 H2O, DMF/H2O (1:1), 83 %; b) 4, TBAF, sodium ascorbate, CuSO45 H2O, CH2Cl2/H2O (1:1), 78 %.

compounds 8 and 9 show the characteristic features of fullerene hexaadducts.[5] Fullerene iminosugar 8 and its monovalent analogue 6 were tested against a range of commercially available glycosidases and their inhibition constants (Ki) were evaluated (Table 1). The biological results may be divided unevenly into three categories with regard to inhibition: decreased, unaffected, and increased by multivalency. Only one example of a significant affinity decrease (ninefold) compared to the monovalent iminosugar was observed for sweet almond b-glucosidase. For two other glucosidases (amyloglucosidase and bovine liver b-glucosidase), the multivalent and monovalent iminosugars showed similar Ki values.
Angew. Chem. 2010, 122, 5889 5892

5890

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Table 1: Glycosidase inhibitory activities Ki.[a] Enzyme b-galactosidase Bovine liver a-galactosidase Aspergillus niger Green coffee Monovalent Multivalent Relative inhibition iminosugar 6 iminosugar 8 potency of 8 over 6[b] 262 34 7.7 (0.64)

Chemie

NI[c] NI[c]

NI[c] 84

> 23 (> 1.9)

b-glucosidase Almonds (pH 7.3) 11 Bovine liver 482 a-glucosidase Amyloglucosidase 0.71 (Asp. Niger) Bakers yeast 152 Isomaltase 943 (Bakers yeast) Naringinase Penicillium decumbens b-mannosidase Helix pomatia a-mannosidase Jack Bean

95 247

0.1 (0.01) 1.9 (0.16)

0.69 18 10.5

1.0 (0.08) 8.7 (0.72) 89.8 (7.48)

of mannojirimycin show little if any inhibition of mannosidases.[13] Further research will certainly be needed for the rationalization of the significant binding enhancements observed for glycosidase inhibition with multivalent inhibitors. When considered on an inhibitor residue basis, our results unequivocally evidence the existence of a multivalent effect beyond the expected statistical rebinding and local concentration effect. A sliding mechanism of the iminosugars in the enzyme active site or an additional binding at a close allosteric site may account for the distinct specificity enhancement observed.[9, 11, 22] Beyond its fundamental interest, our work shows that, in addition to the modulation of selectivity, multivalency is a promising tool for the design of potent glycosidase inhibitors.
Received: May 8, 2010 Published online: July 7, 2010

9.1

0.41

22.2 (1.84)

Keywords: enzymes fullerenes iminosugars inhibitors multivalency

NI[c]

NI[c]

322

0.15

2147 (179)

[a] Values reported in mm. [b] The value indicated in brackets corresponds to the relative inhibition potency per nojirimycin residue. [c] NI: no inhibition detected at 2 mm.

For most of the glycosidases tested, a significant binding enhancement (up to 2150-fold) was observed relative to the corresponding monomer. The most impressive results were obtained for three a-glycosidases. Remarkably, multivalent iminosugar 8 was found to be a good inhibitor of green coffee a-galactosidase, whereas its monomeric analogue 6 in the d gluco series was completely inactive. The stronger measurable multivalent effects were obtained with bakers yeast isomaltase and Jack bean a-mannosidase, which had Ki values that were two and three orders of magnitude higher, respectively, than monomeric iminosugar 6. Comparison of the inhibition profile of the dodecavalent system 8 and a previously described trivalent iminosugar[14] provides interesting insights. For both compounds, the best multivalent effect was obtained with Jack bean a-mannosidase (sixfold enhancement for trivalent and approximately 2150-fold for dodecavalent as compared to monovalent iminosugars). However, contrary to compound 8, the trivalent iminosugar was a weaker inhibitor of bakers yeast isomaltase than its monomeric analogue. The analysis of the valencycorrected potency of the two multivalent systems toward Jack bean a-mannosidase (twofold and approximately 180-fold for the trivalent and dodecavalent systems respectively) is more interesting. These results highlight the impact of the central scaffold on the inhibition activity of the multivalent architecture. It is noteworthy that, in general, N-alkylated analogues
Angew. Chem. 2010, 122, 5889 5892

[1] Fullerenes: Principles and Applications, RSC Nanoscience and Nanotechnology Series (Eds.: F. Langa, J.-F. Nierengarten), Royal Society of Chemistry, London, 2007. [2] A. Hirsch, I. Lamparth, T. Grsser, H. R. Karfunkel, J. Am. Chem. Soc. 1994, 116, 9385 9386. [3] For a review on fullerene hexakis adducts, see: A. Hirsch, O. Vostrowsky, Eur. J. Org. Chem. 2001, 829 848. [4] X. Camps, A. Hirsch, J. Chem. Soc. Perkin Trans. 1 1997, 1595 1596; H. Li, A. Kitaygorodskiy, R. A. Carino, Y.-P. Sun, Org. Lett. 2005, 7, 859 862. [5] a) J. Iehl, R. Pereira de Freitas, B. Delavaux-Nicot, J.-F. Nierengarten, Chem. Commun. 2008, 2450 2452; b) P. Pierrat, S. Vanderheiden, T. Muller, S. Brse, Chem. Commun. 2009, 1748 1750; c) P. Pierrat, C. Rthor, T. Muller, S. Brse, Chem. Eur. J. 2009, 15, 11458 11460; d) J. Iehl, J.-F. Nierengarten, Chem. Commun. 2010, 46, 4160 4162. [6] J. Iehl, J.-F. Nierengarten, Chem. Eur. J. 2009, 15, 7306 7309. [7] J.-F. Nierengarten, J. Iehl, V. Oerthel, M. Holler, B. M. Illescas, A. Muoz, N. Martn, J. Rojo, M. Snchez-Navarro, S. Cecioni, S. Vidal, K. Buffet, M. Durka, S. P. Vincent, Chem. Commun. 2010, 46, 3860 3862. [8] Y. M. Chabre, R. Roy, Adv. Carbohydr. Chem. Biochem. 2010, 63, 165 393, and references cited herein. [9] a) S.-K. Choi, Synthetic Multivalent Molecules: Concepts and Biomedical Applications, Wiley, New York, 2004 ; b) S. Cecioni, O.-A. Argintaru, T. Dosca, P. Gergely, J.-P. Praly, S. Vidal, New J. Chem. 2009, 33, 148 156, and references cited therein. [10] J. M. Rini, Annu. Rev. Biophys. Biomol. Struct. 1995, 24, 551 577. [11] M. Mammen, S.-K. Choi, G. M. Withesides, Angew. Chem. 1998, 110, 2908 2953; Angew. Chem. Int. Ed. 1998, 37, 2754 2794. [12] a) T. Wennekes, R. J. B. H. N. van den Berg, K. M. Bonger, W. E. Donker-Koopman, A. Ghisaidoobe, G. A. Van der Marel, A. Strijiland, J. M. F. G. Aerts, H. S. Overkleeft, Tetrahedron: Asymmetry 2009, 20, 836 846; b) A. Lohse, K. B. Jensen, K. Lundgren, M. Bols, Bioorg. Med. Chem. 1999, 7, 1965 1971; c) B. A. Johns, C. R. Johnson, Tetrahedron Lett. 1998, 39, 749 752. [13] Iminosugars: From Synthesis to Therapeutic Applications (Eds.: P. Compain, O. R. Martin), Wiley, New York, 2007; Iminosugars

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5891

Zuschriften
as Glycosidase Inhibitors: Nojirimycin and Beyond (Ed.: A. E. Sttz), Wiley-VCH, Weinheim, 1999. [14] J. Diot, M. I. Garcia-Moreno, S. G. Gouin, C. Ortiz Mellet, K. Haupt, J. Kovensky, Org. Biomol. Chem. 2009, 7, 357 363. [15] Glycosidase inhibitors are useful probes to elucidate fundamental biological pathways and attractive leads for drug discovery, see for example: a) V. H. Lillelund, H. H. Jensen, X. Liang, M. Bols, Chem. Rev. 2002, 102, 515 553; b) N. Asano, Glycobiology 2003, 13, 93R 104R; c) T. M. Gloster, G. J. Davies, Org. Biomol. Chem. 2010, 8, 305 320; d) T. D. Heightman, A. T. Vasella, Angew. Chem. 1999, 111, 794 815; Angew. Chem. Int. Ed. 1999, 38, 750 770; e) B. P. Rempel, S. G. Withers, Glycobiology 2008, 18, 570 586. [16] a) R. Huisgen, Pure Appl. Chem. 1989, 61, 613 628; b) R. Huisgen, W. Szeimies, L. Moebius, Chem. Ber. 1967, 100, 2494 2507; c) C. W. Torne, M. Meldal, Proceedings of the 2nd International and 17th American Peptide Symposium, Peptides: The Waves of the Future (Eds.: M. Lebl, R. A. Houghten), San Diego, 2001, 263 264; d) V. V. Rostovtsev, L. G. Green, V. V. [17] [18] [19] Fokin, K. B. Sharpless, Angew. Chem. 2002, 114, 2708 2711; Angew. Chem. Int. Ed. 2002, 41, 2596 2599. H. S. Overkleeft, J. van Wiltenburg, U. K. Pandit, Tetrahedron 1994, 50, 4215 4224. V. Hoos, A. B. Naughon, A. Vasella, Helv. Chim. Acta 1993, 76, 1802 1807. a) L. Colombeau, T. Tenin, P. Compain, O. R. Martin, J. Org. Chem. 2008, 73, 8647 8650; b) M.-Y. Chen, J.-L. Hsu, J.-J. Shie, J.-M. Fang, J. Chin. Chem. Soc. 2003, 50, 129 133. a) V. Liautard, A. E. Christina, V. Desvergnes, O. R. Martin, J. Org. Chem. 2006, 71, 7337 7345; b) S. Desvergnes, Y. Valle, S. Py, Org. Lett. 2008, 10, 2967 2970. A. J. Rawlings, H. Lomas, A. W. Pilling, M. J.-R. Lee, D. S. Alonzi, J. S. S. Rountree, S. F. Jenkinson, G. W. J. Fleet, R. A. Dwek, J. H. Jones, T. D. Butters, ChemBioChem 2009, 10, 1101 1105. J. E. Gestwicki, C. W. Cairo, L. E. Strong, K. A. Oetjen, L. L. Kiessling, J. Am. Chem. Soc. 2002, 124, 14922 14933.

[20]

[21]

[22]

5892

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5889 5892

Angewandte
DOI: 10.1002/ange.201002328

Chemie

Arylation Reactions

Palladium-Catalyzed g-Arylation of a,b-Unsaturated Esters from Silyl Ketene Acetals**


David S. Huang and John F Hartwig*
The palladium-catalyzed coupling of enolates with aryl and vinyl electrophiles has become a useful method for the construction of carboncarbon bonds.[1] Although many palladium complexes have been identified that catalyze the coupling of enolates of ketones, esters, amides, and aldehydes with haloarenes, the vinylogous coupling of dienolates of a,bunsaturated carbonyl compounds with haloarenes (g-arylation) has been less studied. g-Aryl a,b-unsaturated carbonyl compounds are useful building blocks because they can be further functionalized at the carbonyl or olefinic positions.[2] To develop a catalyst for the g-arylation of a,b-unsaturated carbonyl compounds, one must address several issues, including the regioselectivity for forming products from a-, b-, or g-arylation, the selectivity for monoarylation versus diarylation, and the potential condensation of the reactive products. The selectivity for formation of products from aor g-arylation versus b-arylation depends on whether an enolate complex forms by transmetalation with the arylpalladium halide intermediate, as occurs during the a-arylation of carbonyl compounds, or whether it forms by insertion of the a,b-unsaturated carbonyl compound into the metalaryl bond, as occurs during a Heck reaction. The selectivity for products from a- versus g-arylation likely depends on the stability and reactivity of the series of isomeric arylpalladium dienolate intermediates that result from transmetalation. Despite these obstacles, a few g-arylation reactions of a,bunsaturated ketones and aldehydes have been reported. Terao et al. reported the palladium-catalyzed g-arylation of unfuntionalized a,b-unsaturated aldehydes and ketones.[3] Martin and Buchwald reported the g-arylation of similar asubstituted a,b-unsaturated aldehydes.[4] Varseev and Maier later reported a sequential g-arylation and dehydrogenation for the synthesis of substituted tetralones.[5] Finally, Hyde and Buchwald reported the g-arylation of g-substituted a,b- or b,g-unsaturated ketones[6] and lactones[7] with aryl chlorides and bromides in moderate to good yield. Despite these advances, the coupling of enolates of a,bunsaturated esters is underdeveloped. The g-arylation of acyclic esters has been limited to reactions of tin enolates in low to moderate yields.[8] Moreover, the previous couplings of a,b-unsaturated ketones and aldehydes have required elevated temperatures and substrates that contain substituents at either the a or g position of the carbonyl compound for high yield. Herein, we report the g-arylation and g-vinylation of a,bunsaturated esters in high yield with broad scope by coupling aryl, heteroaryl, and vinyl halides with the corresponding silicon dienolates. These reactions occur in high yield with a variety of esters, including those lacking substituents at the a and g positions, and with aromatic and vinylic electrophiles that contain potentially reactive functional groups. Moreover, these reactions occur without typical fluoride additives to activate silicon enolates. Our studies of the coupling of haloarenes with the dienolates of a,b-unsaturated esters began with alkali metal dienolates of a,b-unsaturated esters. However, the reaction of bromobenzene with the alkali metal dienolate of methyl trans-2-hexenoate did not form the g-aryl a,b-unsaturated esters in significant yield. Thus, we investigated reactions of silicon enolates of a,b-unsaturated esters. These studies were based on our prior work on the coupling of aryl halides with silyl enol ethers and silyl ketene acetals.[911] Our initial studies on the coupling of silyl ketene acetals derived from a,b-unsaturated esters focused on the model palladium-catalyzed coupling of bromobenzene with the trimethylsilyl ketene acetal of methyl-2-hexenoate (1 a). Most previous a-arylations of silyl ketene acetals or silyl enol ethers were conducted with fluoride additives, such as ZnF2, CsF, MgF2, Bu3SnF, or CuF2. In contrast to these previous studies, the coupling of silyl ketene acetal 1 a occurred without a fluoride additive. Instead, the reaction formed the g-aryl E-product 2 in high yield in the presence of inexpensive zinc chloride. Previously reported coupling reactions of aryl halides with silicon enolates without a fluoride additive have been limited to the a-arylation and vinylation of silicon enolates in the presence of thallium acetate[11] or to intramolecular a-vinylations.[9] A summary of the effect of the silyl group and additive on the coupling of bromobenzene with the silyl ketene acetals of methyl hexenoate is shown in Table 1. The g-arylation product was formed in the highest yields with the triethylsilyl (TES) ketene acetal (1 b ; Table 1, entry 3). The coupling between 1 b and bromobenzene in the presence of ZnF2 occurred in low yield (Table 1, entry 4), perhaps owing to the poor solubility of ZnF2 in tetrahydrofuran. Reactions of 1 b with bromobenzene in the presence of ZnBr2 and ZnI2 (Table 1, entries 5 and 6) formed the g-arylation product 2 in lower yield than the same reaction in the presence of ZnCl2. The coupling between 1 b and bromobenzene with catalytic

[*] D. S. Huang, Prof. Dr. J. F. Hartwig Department of Chemistry, University of Illinois Urbana-Champaign Urbana, Il 61801 (USA) Fax: (+ 1) 217-244-8024 E-mail: jhartwig@illinois.edu Homepage: http://www.scs.uiuc.edu/hartwig/ [**] We thank the NIH (GM-58108). for support of this work and Johnson-Matthey for gifts of palladium. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002328.
Angew. Chem. 2010, 122, 5893 5897

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5893

Zuschriften
Table 1: Effects of the silyl group and zinc halides on the g-arylation of silyl ketene acetals with bromobenzene.[a] Table 2: Aryl and vinyl bromide scope of the g-arylation of 1 b.[a]

Entry 1 2 3 4 5 6 7[c] 8

Acetal 1b 1a 1b 1b 1b 1b 1b 1c

Additive none ZnCl2 ZnCl2 ZnF2 ZnBr2 ZnI2 ZnCl2 ZnCl2

t [h] 24 2 4 24 4 25 12 12

Yield [%][b] <5 82 87 11 81 <5 83 64

Entry 1 2[d] 3[e] 4 5 6 7 8[f ] 9[g] 10 11 12 13 14 15 16[f,h] 17[h] 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 PhBr PhBr PhBr 4-tBu-C6H4Br 3,5-Me2-C6H3Br 2-MeC6H4Br 2-PhC6H4Br 2,6-Me2C6H3Br 2,6-Me2C6H3Br 2,6-Me2C6H3Br 1-bromonaphthalene 2-bromonaphthalene 2-OMe-C6H4Br 3-OMe-C6H4Br 4-OMe-C6H4Br 4-NH2-C6H4Br 4-MeN(H)-C6H4Br 4-NMe2-C6H4Br 4-CF3-C6H4Br 4-F-C6H4Br 4-Cl-C6H4Br 4-CN-C6H4Br 4-NO2-C6H4Br 4-C(O)Me-C6H4Br 4-C(O)Et-C6H4Br 4-CO2Me-C6H4Br 3-bromothiophene 3-bromopyridineBEt3 6-bromoquinoline 5-bromoindole 2-bromoindene 1-Br-2-Me-1-propene

[Pd] cat.[b] A B C A A A A A B C A A A A A A A A A A A A A A A A A A A A A A

Yield [%][c] 82 77 77 82 78 83 78 96 83 95 82 90 83 81 83 74 80 83 77 91 91 81 82 58 84 89 76 58[i] 69[j] 64 51 34

[a] Reaction conditions: acetal (0.26 mmol), PhBr (0.20 mmol), additive (0.30 mmol), [Pd(dba)2] (0.010 mmol), PtBu3 (0.01 mmol), THF (0.8 mL). [b] Yields were determined by GC analysis with dodecane as an internal standard (average of two runs). [c] 0.2 equiv ZnCl2

amounts of ZnCl2 occurred in yields similar to those of reactions with stoichiometric ZnCl2, although the reaction was slower (Table 1, entry 7). Ester 2 was not formed from the reaction of 1 b with bromobenzene in the absence of ZnCl2 (Table 1, entry 1). Several palladium catalyst systems for the coupling of silyl ketone acetal 1 b with bromobenzene were also explored; ester 2 did not form in a detectable amounts from the coupling of 1 b with bromobenzene in the presence of catalyst systems containing X-phos, dppe, dppf, Xantphos, racBINAP, PCy3, or PPh3 ligands. Ester 2 formed in the presence of [Pd(dba)2] and Qphos, but the yield was lower than that from the reaction conducted with a catalyst containing PtBu3. The coupling of silyl ketene acetal 1 b with chlorobenzene and iodobenzene was also attempted. The coupling product 2 was not detected from the reaction with chlorobenzene, and the g-aryl a,b-unsaturated ester 2 was formed in only 29 % yield from the coupling of 1 b with iodobenzene after 24 hours. The scope of the g-arylation with a variety of aryl bromides is shown in Table 2. g-Aryl a,b-unsaturated esters were obtained in high yields from reactions with both electron-rich and electron-poor aryl bromides. The reaction proceeded in high yield with aryl bromides containing a single ortho substituent (Table 2, entries 6 and 7); higher catalyst loadings were required for more sterically hindered aryl bromides (Table 2, entry 8), but the reaction of 2,6-dimethylbromobenzene occurred in high yield. The reaction tolerated a variety of functional groups that could be used for further elaboration, such as a chloro, nitro, cyano, acyl, and a phenacyl group (Table 2, entries 2125). The coupling also proceeded with aryl bromides that contained acidic NH groups (Table 2, entries 16, 17, and 30). A variety of heteroaryl bromides also successfully coupled with silyl ketene acetal 1 b, including the coupling of 1 b with bromothiophene, bromopyridine, and bromoquinoline (Table 2, entries 2729), and the coupling of 1 b with 5bromo indole containing an unprotected NH bond (Table 2,

[a] Reaction conditions: 1 b (1.3 mmol), aryl or vinyl halide (1.0 mmol), ZnCl2 (1.5 mmol), [Pd] cat. (0.010 mmol), THF (2 mL). [b] [Pd] cat.: A: [Pd(dba)2], PtBu3 (1:1); B: [Pd(PtBu3)2]; C: [{P(tBu3)Pd(m-Br)}2]. [c] Yield of isolated product (average of two runs). [d] 0.4 % [Pd] cat. [e] 0.1 % [Pd] cat. [f ] 5 % [Pd] cat. [g] 2 % [Pd] cat. [h] 2.6 equiv 1 b, 3.0 equiv ZnCl2. [i] Isolated as uncoordinated pyridine. [j] Product was isolated in 85 % purity.

entry 30). The coupling of 1 b with the BEt3 adduct of 3bromopyridine occurred faster and in comparable yields to the reactions of the free pyridine. The use of a borane to inhibit coordination of a pyridine to the catalyst and to promote carbonhalogen bond cleavage and subsequent reductive elimination has been previously reported for the amidation of aryl halides.[12] The coupling also occurred with vinyl bromides; g-vinyla,b-unsaturated esters were isolated in moderate yields from the reactions of 2-bromoindene and 1-bromo-2-methyl-1propene (Table 2, entries 31 and 32). The isolated complexes [Pd(PtBu3)2] and [{(PtBu3)Pd(mBr)}2] were particularly active for the coupling of silyl ketene acetal 1 b with aryl bromides. For example, the coupling of 1 b
Angew. Chem. 2010, 122, 5893 5897

5894

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
with bromobenzene proceeded in high yield in the presence of just 0.4 % [Pd(PtBu3)2] (Table 2, entry 2) or 0.2 % [{(PtBu3)Pd(m-Br)}2] (Table 2, entry 3). The coupling between silyl ketene acetal 1 b and a larger 10 mmol scale of bromobenzene in the presence of 0.2 % [{(PtBu3)Pd(m-Br)}2] gave the coupled product ester 2 in 69 % yield. The coupling of the more sterically demanding substrates also proceeded with lower catalyst loadings of [Pd(PtBu3)2] or [{(PtBu3)Pd(m-Br)}2] than of the combination of [Pd(dba)2] and PtBu3 (Table 2, entries 9 and 10). Thus, [Pd(PtBu3)2] or [{(PtBu3)Pd(m-Br)}2] could used in place of [Pd(dba)2] and PtBu3 in most cases when a single-component catalyst is preferred. The scope of the process with different silyl ketene acetals is shown in Table 3. The reaction tolerates substitution at the a, b, g, or d positions of the acetal. Products from reactions of silyl ketene acetals containing substituents at the a or
Table 3: g-Arylation of substituted silyl ketene acetals.[a]

Chemie

Scheme 1. Potential mechanism for the coupling of 1 b with PhBr. TES = triethylsilyl.

Entry 1[c,d] 2 3 4
[d]

R1 Me Me Me iPr

R2 H H Me H

R3 H Me H H

R4 Me H H H

Yield [%][b] 62 (E) 10 (Z) 57 (E) 5 (Z) 75 68

acidity of the zinc halide facilitates transmetalation of the enolate from silicon to palladium, we conducted the coupling of enolate 1 b with bromobenzene in the presence of BF3THF. The reaction with BF3THF in place of ZnCl2 proceeded to full conversion, albeit over a longer reaction time and in diminished yield (Table 4, entry 3). To assess whether the zinc chloride served as a source of halide,[14] the coupling of enolate 1 b with bromobenzene was performed in the presence of zinc triflate. This reaction occurred in a yield
Table 4: Effect of different additives on the coupling of 1 b with bromobenzene.[a]

[a] Reaction conditions: acetal (1.5 mmol), PhBr (1.0 mmol), ZnCl2 (1.5 mmol), [Pd(dba)2] (0.010 mmol), PtBu3 (0.01 mmol), THF (2 mL). [b] Yield of isolated product (average of two runs). [c] 2.2 equiv silyl ketene acetal, 3.0 equiv ZnCl2. [d] 2 % [Pd(dba)2], 2 % PtBu3.

Entry 1 2 3 4 5[c]

Additive ZnCl2 Zn(OTf)2 BF3THF N(octyl)3MeCl N(octyl)3MeCl

t [h] 4 4 48 8 24

Yield [%][b] 87 95 39 83 45

b positions were isolated as a mixture of olefin geometries (Table 3, entries 1 and 2). The coupling of a silyl ketene acetal containing two substituents at the g position required increased catalyst loading, but occurred in 75 % yield (Table 3, entry 3). Finally a substrate substituted in the d position reacted in similar yields. Under our reaction conditions, no product was observed from the g-arylation of the silyl ketene acetals derived from a,b-unsaturated lactones. A potential mechanism for the palladium-catalyzed coupling of 1 b with aryl bromides is shown in Scheme 1. This catalytic cycle is analogous to that proposed for the palladium-catalyzed a-arylation of carbonyl compounds. In this cycle, the zinc chloride would facilitate the formation of the palladium dienolate complex (4 and 5), and reductive elimination from a palladium dienolate complex would generate the desired product. Reductive elimination from an h3-palladium dienolate complex (4) has been reported by Kurosawa and co-workers,[13] but the zinc chloride induced transmetalation of a silyl ketene acetal or silyl enol ether with the palladium aryl halide complex has not been studied. To understand the promoting effect of zinc chloride, we studied reactions containing additives that possess Lewis acidic properties or chloride ions. To determine if the Lewis
Angew. Chem. 2010, 122, 5893 5897

[a] Reaction conditions: 11 (0.030 mmol), 1b (0.13 mmol), additive (0.15 mmol), THF (0.8 mL). [b] Yields were determined by GC analysis with dodecane as an internal standard (average of two runs). [c] Reaction performed in the presence of 4 equiv 4-ClC6H4Br.

that was comparable to that from the reaction in the presence of zinc chloride (Table 4. entry 2). Because the yield and reaction times for the coupling in the presence of zinc triflate were comparable to those of reactions in the presence of zinc chloride, we conclude that the ZnCl2 is not simply a source of halide; instead the Lewis acidic property likely helps labilize the halide on palladium.[15] At the same time, a genuine source of halide without Lewis acid did promote the coupling process. The reaction of 1 b with bromobenzene catalyzed by [Pd(dba)2] and PtBu3 in the presence of methyltrioctylammonium chloride occurred in high yield (Table 4, entry 4), although the rate was slower than that for reactions conducted with zinc chloride. Because ammonium halides are not Lewis acidic, it appears that the garylation process with the silyl enolates can be accelerated by www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5895

Zuschriften
either a Lewis acid or a Lewis base. The palladium-catalyzed coupling of 1 b with bromobenzene in the presence of methyltrioctylammonium chloride and zinc chloride together required long times and did not occur in high yield (Table 4, entry 5); thus, we conclude that the ammonium chloride and zinc chloride promote the coupling of silyl ketene acetal and bromobenzene through different mechanisms. To determine which portion of the catalytic cycle is affected by the zinc and ammonium additives, reactions of enolate 1 b were performed with an arylpalladium bromide complex that is closely related to the complexes that would be intermediates in the coupling process. Arylpalladium halide complexes of P(1-Ad)tBu2 (1-Ad = 1-adamantyl) are more easily isolated than those containing PtBu3, and the combination of [Pd(dba)2] and P(1-Ad)tBu2 catalyzed the formation of 2 in 86 % yield. Thus, we studied complex 6 containing P(1Ad)tBu2. The reaction of silyl ketene acetal 1 b with complex 6 was faster in the presence of zinc chloride than in the absence of any additive (Table 5 entries 1 and 2). When the reaction between 6 and 1 b was performed in the presence of an excess
Table 5: Stoichiometric reactions between arylpalladium halide specides with 1 b.[a]

product is formed by reductive elimination from a palladium dienolate complex. Further studies are required to determine the precise mechanism for activation of silyl ketene acetal, but the formation of this dienolate complex is promoted by the mildly acidic zinc chloride. Further studies on reactions of dienolates and efforts to develop stereoselective transformations of these species are in progress.

Experimental Section
General procedure for the g-arylation of silyl ketene acetals catalyzed by PtBu3 and [Pd(dba)2] (Table 2): PtBu3 (2.0 mg, 0.010 mmol; in a 1 dram vial) was placed inside a drybox under either an argon or nitrogen atmosphere. Bromobenzene (157 mg, 1.00 mmol) was added, followed by triethyl(1-methoxyhexa-1,3-dienyloxy)silane (346 mg, 1.30 mmol). Zinc chloride (204 mg, 1.50 mmol) was then added, followed by [Pd(dba)2] (5.8 mg, 0.010 mmol). A Teflon-coated stirrer bar was then added, followed by 2 mL of THF. The vial was closed with a cap that was lined with a PTFE/silicone septum and removed from the drybox. The reaction mixture was stirred at room temperature until GC analysis showed that full consumption of the aryl bromide had occurred. Upon completion, the reaction mixture was diluted with 30 mL of ethyl acetate (EtOAc) and washed three times with saturated NaHCO3. An additional 10 mL of EtOAc was added to the combined aqueous washes for back-extraction. The combined organic solutions were washed once with brine and dried with anhydrous MgSO4. The suspension was filtered through a plug of Celite. Volatile materials were removed by rotary evaporation. The crude mixture was then purified by column chromatography on silica gel (acetone/pentane) to give the g-aryl a,b-unsaturated ester. Received: April 20, 2010 Published online: July 6, 2010

Entry 1 2 3[c] 4

Additive none ZnCl2 ZnCl2 N(octyl)4Cl

t 30 h 10 min 10 min 30 min

Yield 2 [%][b] 27 65 82 69

Keywords: cross-coupling enolates homogeneous catalysis palladium a,b-unsaturated compounds

[a] Reaction conditions: 6 (0.030 mmol), 1 b (0.13 mmol), additive (0.15 mmol), THF (0.8 mL). [b] Yields were determined by GC analysis with dodecane as an internal standard (average of two runs). [c] Reaction performed in the presence of 4 equiv 4-ClC6H4Br.

of an aryl halide (with an aryl moiety that is different from that bound to palladium) to trap the palladium(0) product, the g-arylation product 2 was formed in yields that were comparable to those of the catalytic reaction (Table 5, entry 3). Thus, the zinc halide accelerates the transmetalation between silicon and palladium. Chloride sources also triggered the stoichiometric reaction of 6 with 1 b, but we have not yet identified the role of tetraalkylammonium halides in the catalytic process. In summary, we have developed the first palladiumcatalyzed coupling of aryl halides with acyclic a,b-unsaturated esters to form products from coupling at the g position. These reactions are conducted via silyl ketene acetals, and, unlike many couplings of silicon enolates, does not require a fluoride additive. These reactions occur at room temperature with low catalyst loadings, in high yield with aryl bromides that contain a wide array of functional groups and with silyl ketene acetals that contain substitution at the a, b, g, and d positions. The

[1] C. C. C. Johansson, T. J. Colacot, Angew. Chem. 2010, 122, 686; Angew. Chem. Int. Ed. 2010, 49, 676. [2] a) J. Inanaga, S. Sakai, Y. Handa, M. Yamaguchi, Y. Yokoyama, Chem. Lett. 1991, 2117; b) S. Ohira, A. Kuboki, T. Hasegawa, T. Kikuchi, T. Kutsukake, M. Nomura, Tetrahedron Lett. 2002, 43, 4641; c) S. Takano, M. Yanase, T. Sugihara, K. Ogasawara, J. Chem. Soc. Chem. Commun. 1988, 1538; d) J. S. Yadav, A. K. Basak, P. Srihari, Tetrahedron Lett. 2007, 48, 2841; e) S. Chandrasekhar, C. Narasihmulu, V. Jagadeshwar, K. V. Reddy, Tetrahedron Lett. 2003, 44, 3629; f) J. M. Concelln, H. Rodriguez-Solla, C. Gomez, Angew. Chem. 2002, 114, 1997; Angew. Chem. Int. Ed. 2002, 41, 1917; g) S. K. Das, G. Panda, Tetrahedron 2008, 64, 4162; h) Y. Chounan, Y. Ono, S. Nishii, H. Kitahara, S. Ito, Y. Yamamoto, Tetrahedron 2000, 56, 2821; i) F. Lpez, A. W. van Zijl, A. J. Minnaard, B. L. Feringa, Chem. Commun. 2006, 409; j) I. Shibata, T. Kano, N. Kanazawa, S. Fukuoka, A. Baba, Angew. Chem. 2002, 114, 1447; Angew. Chem. Int. Ed. 2002, 41, 1389; k) A. W. van Zijl, W. Szymanski, F. Lopez, A. J. Minnaard, B. L. Feringa, J. Org. Chem. 2008, 73, 6994; l) Y. Yamamoto, S. Nishii, T. Ibuka, J. Chem. Soc. D 1987, 1572. [3] Y. Terao, T. Satoh, M. Miura, M. Nomura, Tetrahedron Lett. 1998, 39, 6203. [4] R. Martin, S. L. Buchwald, Angew. Chem. 2007, 119, 7374; Angew. Chem. Int. Ed. 2007, 46, 7236. [5] G. N. Varseev, M. E. Maier, Org. Lett. 2005, 7, 3881.
Angew. Chem. 2010, 122, 5893 5897

5896

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[6] A. M. Hyde, S. L. Buchwald, Angew. Chem. 2008, 120, 183; Angew. Chem. Int. Ed. 2008, 47, 177. [7] A. M. Hyde, S. L. Buchwald, Org. Lett. 2009, 11, 2663. [8] Y. Yamamoto, S. Hatsuya, J. Yamada, J. Chem. Soc. Chem. Commun. 1988, 86. [9] H. Shigehisa, T. Jikihara, O. Takizawa, H. Nagase, T. Honda, Tetrahedron Lett. 2008, 49, 3983. [10] a) T. Iwama, V. H. Rawal, Org. Lett. 2006, 8, 5725; b) W. P. Su, S. Raders, J. G. Verkade, X. B. Liao, J. F. Hartwig, Angew. Chem. 2006, 118, 5981; Angew. Chem. Int. Ed. 2006, 45, 5852; c) X. X. Liu, J. F. Hartwig, J. Am. Chem. Soc. 2004, 126, 5182; d) S. K. Kang, H. C. Ryu, Y. T. Hong, J. Chem. Soc. Perkin Trans. 1 2000, 3350; e) F. Agnelli, G. A. Sulikowski, Tetrahedron Lett. 1998, 39, 8807. a) C. Carfagna, A. Musco, G. Sallese, R. Santi, T. Fiorani, J. Org. Chem. 1991, 56, 261; b) T. Sakamoto, Y. Kondo, K. Masumoto, H. Yamanaka, J. Chem. Soc. Perkin Trans. 1 1994, 235. Q. L. Shen, J. F. Hartwig, J. Am. Chem. Soc. 2007, 129, 7734. S. Numata, H. Kurosawa, J. Organomet. Chem. 1977, 131, 301. K. Fagnou, M. Lautens, Angew. Chem. 2002, 114, 26; Angew. Chem. Int. Ed. 2002, 41, 26. D. J. Spielvogel, S. L. Buchwald, J. Am. Chem. Soc. 2002, 124, 3500.

Chemie

[11]

[12] [13] [14] [15]

Angew. Chem. 2010, 122, 5893 5897

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5897

Zuschriften
Organocatalysis
DOI: 10.1002/ange.201002065

Enantioselective Synthesis of Trifluoromethyl-Substituted 2Isoxazolines: Asymmetric Hydroxylamine/Enone Cascade Reaction**


Kazutaka Matoba, Hiroyuki Kawai, Tatsuya Furukawa, Akihiro Kusuda, Etsuko Tokunaga, Shuichi Nakamura, Motoo Shiro, and Norio Shibata*
Heterocycles containing a trifluoromethyl group are representatives of a major structure type in agricultural and medicinal chemistry, and thus the development of a simple and flexible method to generate a novel trifluoromethylated heterocyclic system has received much attention.[1] Trifluoromethyl-substituted 2-isoxazolines are amongst an important class of heterocyclic compounds with remarkable biological activities, and they make interesting synthetic targets.[2] Since the first discovery of the structurally unique 3,5-diaryl-5(trifluoromethyl)-2-isoxazoline derivatives 1 (Figure 1) as pest control agents in 2004,[3a] the search for new agroactive component.[3b] Once the importance of the optical purity of these compounds was verified, the next challenge was to control the stereochemistry at a quaternary carbon center bearing a CF3 group. As part of our ongoing research programs directed to the development of efficient methods for the asymmetric synthesis of organofluorine compounds,[4] we disclose herein the synthesis of trifluoromethyl-substituted 2-isoxazolines by a cinchona alkaloid catalyzed asymmetric hydroxylamine/enone cascade reaction consisting of a conjugate addition/cyclization/dehydration sequence (Scheme 1).

Figure 1. Structures of 3,5-diaryl-5-(trifluoromethyl)-2-isoxazolines 1 and biologically attractive derivatives of types A and B.

chemicals and veterinary medicines has focused largely on this skeleton,[3] despite their diverse structural variants.[2] Thus far, more than 20 000 compounds have been synthesized and patented in the past 5 years (the results of substructure searching using 1 with Scifinder), and many promising drug candidates have been disclosed including an antiparasiticide compound of either type A or B (Figure 1).[3] More interestingly, recent biological evaluation of the optically active type B compound (X6 = CONHCH2COCH2CF3), obtained by HPLC methods using a chiral stationary phase, revealed that the R enantiomer of B is inactive and the S enantiomer is the
[*] K. Matoba, H. Kawai, T. Furukawa, A. Kusuda, E. Tokunaga, Dr. S. Nakamura, Prof. N. Shibata Department of Frontier Materials, Graduate School of Engineering, Nagoya Institute of Technology Gokiso, Showa-ku, Nagoya 466-8555 (Japan) Fax: (+ 81) 52-735-5442 E-mail: nozshiba@nitech.ac.jp Dr. M. Shiro Rigaku Corporation 3-9-12 Mastubara-cho, Akishima Tokyo 196-8666 (Japan) [**] Support was provided by KAKENHI (21390030, 22106515). The corresponding author thanks the JSPS for financial support of this work in part through a Joint Research Project between Japan and France. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002065.

Scheme 1. Enantioselective synthesis of trifluoromethyl-substituted 2isoxazolines 1 by an asymmetric hydroxylamine/enone cascade reaction.

Optically active 2-isoxazolines are mostly constructed by the asymmetric 1,3-dipolar cycloaddition of nitrile oxides to olefins,[5ah] the asymmetric cyclization of b,g-unsaturated oximes,[5i] stereoselective ring-closure reaction through oximes of chiral Michael adducts of thiophenol to chalcones,[5j] and proline-catalyzed conjugate addition/oxime-transfer reactions of unsaturated aldehydes.[5k] These methods, however, were not applicable to the synthesis of 1 because of the limitations in substrate specificity, and indeed, the catalytic enantioselective synthesis of trifluoromethyl-substituted 2-isoxazolines 1 has not been reported. We therefore started to investigate the asymmetric version of the nonchiral 2-isoxazoline-formation reaction.[3c] We first examined the reaction of (E)-4,4,4-trifluoro-1,3-diphenylbut-2-en-1-one (2 a) with hydroxylamine in the presence of NaOH and a catalytic amount of N-3,5-bis(trifluoromethylbenzyl) quinidinium bromide (3 a) as a chiral phase-transfer catalyst in toluene at 30 8C (Table 1). The trifluoromethylated 2isoxazoline (R)-1 a was formed in 89 % ee, although the yield was 24 % (Table 1, entry 1). Preliminary results encouraged us to change the solvent, which additionally improved
Angew. Chem. 2010, 122, 5898 5902

5898

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
the yields under the same catalyst conditions. Whereas THF, DME, MeCN, and EtOH did not effectively improve both the yield and ee value (Table 1, entries 25), chlorinated solvents such as CH2Cl2, (ClCH2)2, CHCl3, and CH2(CH2Cl)2 proved to
Table 2: Substrate scope.

Chemie

Table 1: Optimization of reaction conditions.[a]

Entry 2 1 2[c] 3 4 5 6 7 8 9 10 11 12 13 14 15 16 2b 2c 2d 2e 2f 2g 2h 2i 2j 2k 2l 2m 2n 2o 2p 2q

R1 3-MeC6H4 4-MeC6H4 4-MeOC6H4 4-FC6H4 4-ClC6H4 4-BrC6H4 2-naphthyl Ph Ph Ph Ph Ph Ph Ph Ph Ph

R2 Ph Ph Ph Ph Ph Ph Ph 2-MeC6H4 3-MeC6H4 4-MeC6H4 4-MeOC6H4 4-FC6H4 4-ClC6H4 4-BrC6H4 2-naphthyl cyclohexyl

3 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3c 3c 3a 3a

1 1b 1c 1d 1e 1f 1g 1h 1i 1j 1k 1l 1m 1n 1o 1p 1q

Yield [%] [a] ee [%][b] 83 83 99 92 97 99 94 92 96 99 88 91 96 99 99 80 92 94 92 91 91 90 92 82 91 93 91 88 90 91 91 91

Entry 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Base 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 10 n NaOH 5 n LiOH 10 n KOH 10 n CsOH 10 n Na2CO3 10 n CsOH

Solvent toluene THF DME EtOH MeCN CH2Cl2 (ClCH2)2 CH2(CH2Cl)2 CHCl3 CHCl3 CHCl3 CHCl3 CHCl3 CHCl3

3 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3a 3b

Yield [%][b] 24 16 12 36 14 80 99 92 71 34 38 88 n.r. 89

ee [%][c] 89(R) 76(R) 67(R) 2(R) 62(R) 85(R) 90(R) 89(R) 92(R) 91(R) 92(R) 92(R) 88(S)

[a] Yield of isolated product. [b] Determined by HPLC methods using a chiral stationary phase. [c] (CH2Cl)2 was used as a solvent.

[a] All reactions performed at 0.10 mmol substrate in 1.1 mL of solvent. [b] Yield of isolated product. [c] Determined by HPLC methods using a chiral stationary phase. DME = 1,2-dimethoxyethane, n.r. = no reaction, THF = tetrahydrofuran.

1 h, 1 p, and 1 q in high yields with ee values of 91 %92 % (Table 2, entries 7, 15, and 16). The absolute stereochemistry of (R)-1 g was clearly determined by X-ray analysis (Figure 2)

be better solvents, providing 1 a with up to 92 % ee (Table 1, entries 69). A subsequent survey of bases (Table 1, entries 1013) revealed that CsOH was the base of choice with regards to both enantioselectivity and yield (Table 1, entry 12). We also discovered that the analogous ammonium bromide, 3 b, derived from quinine showed excellent enantioselectivity for giving 1 a with the opposite (S) stereochemistry (Table 1, entry 14). Screening of the cinchona alkaloids ascertained that the use of 3 a displayed the highest enantioselectivity in the formation of 1 a (see Table S1 in the Supporting Information). With optimal reaction conditions in hand, the scope of the asymmetric hydroxylamine/enone cascade reaction was explored using a variety of substrates selected to establish the generality of the process. By using a catalytic amount of 3 a, all substrates afforded good to excellent yield and high to excellent enantioselectivity (Table 2). A series of trifluoromethylated enone derivatives, 2 bm, having a variety of substituents such as bromo, chloro, fluoro, methyl, and methoxy, on their aromatic rings were nicely converted into the corresponding products 1 bm in good yields with 82 % 94 % ee (Table 2, entries 112). Catalyst 3 c was a better catalyst for a couple of substrates such as 2 n and 2 o, furnishing 1 n and 1 o, respectively, in excellent yields with high enantioselectivity (Table 2, entries 13 and 14). Sterically demanding naphthyl-substituted enones 2 h and 2 p, and enolizable aliphatic aryl enone 2 q were also compatible with the reaction conditions, affording the respective products
Angew. Chem. 2010, 122, 5898 5902

Figure 2. X-ray crystallographic analysis of (R)-1 g. The thermal ellipsoids are shown at 50% probability.[10]

and all the other products were tentatively assigned by analogy with 1 g. Notably, the enantioselectivity was dramatically changed when the cascade reaction of 2 a with hydroxylamine was performed using the methylether catalyst 3 e to give (S)-1 a with 34 % ee (Scheme 2 a). This result indicates the hydrogen bond of the OH group is crucial for asymmetric induction. Furthermore, a similarly high enantioselectivity of (R)-1 a with 85 % ee was observed in the presence of the cinchonine-type catalyst 3 f instead of the quinidinium catalyst 3 a (Scheme 2 b). Consequently, the methoxy group on the quinoline ring of 3 a does not effect on the enantiomeric excess of the products. www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5899

Zuschriften
of 2 is difficult to obtained because of the viscous character of 2. The three-dimensional conformation of 2 a was therefore generated through calculations with MOPAC PM3 method (Figure 3 b). It is of great interest that the two phenyl substituents and the carbonyl s plane of 2 a are found to be nonplanar, that is, not p conjugated. This phenomena is surprisingly similar to the case of the highly enantioselective epoxidation of enones using the ammonium salt of a cinchona alkaloid reported by Corey and co-workers.[8] On the basis of Coreys speculation on the reaction mechanism using the charge-accelerated catalysis by a rigid quaternary ammonium salt,[8] we postulated a similar transition-state structure for the

Scheme 2. Effects of the hydroxy group and methoxy group on 3 for asymmetric induction.

This isoxazoline-formation reaction consists of two distinct steps, Michael addition and imine formation reactions. The possible reaction routes, a and b, are shown in Scheme 3.

Figure 3. a) X-Ray crystallographic structure of catalyst 3 f generated from the cif file of 3 f. [11] b) Three-dimensional arrangement of 2 a optimized by using the MOPAC PM3 method.

Scheme 3. The possible reaction routes, a or b, for 1 a. Reaction conditions: 10 n CsOH (3.3 equiv), 3 a (10 mol %), CHCl3, 30 to 10 8C, 1020 h.

The first hypothesis (route a) is that the oxygen anion of hydroxylamine adds in Michael fashion to the unsaturated ketone 2 a to furnish 4, with a subsequent intramolecular ringclosure cascade from the nitrogen atom onto ketone moiety. Then the elimination of water generates the isoxazoline 1 a. An alternative (route b) is that the reaction proceeds through an imine formation first to produce the intermediate oxime 5 ; this then ring closes in a second step by intramolecular conjugated addition. To identify the mechanism, the oxime 5 was isolated individually and then we attempted to cyclize it under the same reaction conditions in a separate experiment. However, no isoxazoline 1 a was detected. This result can also be supported by Baldwins rules of guidelines for ring-closing reactions that the 5-endo-trig is disfavored.[6] Thus, route b does not operate here. In contrast, route a consists of the ringclosure reaction in a second step through a favored 5-exo-trig process.[6] Accordingly, intermediate 4 is difficult to isolate because of the rapid cyclization of 4 into 1 a. To understand the high enantioselectivity observed for the present reaction catalyzed by the ammonium salts of cinchona alkaloids, the three-dimensional arrangement of the starting enones 2 and either the catalyst 3 a or 3 f is required. Although the X-ray crystallographic structure of catalyst 3 f has been disclosed by us[7] (Figure 3 a), the conformational information

production of (R)-1 a catalyzed by 3, that is, the specific threedimensional arrangement of cation 3, 2 a, and the hydroxylamine anion (Figure 4). The free hydroxy group in 3 captures substrate 2 a, presumably by intermolecular hydrogen-bond formation to the oxygen atom in 2 a. Only the arrangement as shown in the Figure 4 a should be acceptable because of the very limited space available by the sterically demanding and rigid structure of 3. The hydroxylamine anion generated by the base is sandwiched between 3 f and 2 a, and associates strongly with the nitrogen cation of the catalyst 3, as a nearest neighbor, through ion pairing. The hydroxylamine approaches from the Re face of 2 a. Both the hydrogen bonding between the prochiral substrate 2 and catalyst 3, and the ionic interaction between the ammonium cation 3 and

Figure 4. Proposed transition-state model from 2 a to (R)-1 a catalyzed by 3 f. a) CPK model based on the X-ray crystallographic structure of 3 f and calculated structure of 2 a. b) Schematic presentation of the transition-state structure.
Angew. Chem. 2010, 122, 5898 5902

5900

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
hydroxylamine anion should realize the highly enantioselective reaction (Figure 4 b). The possibility of the aromatic pp interactions between 2 a and 3 might be ruled out because the nonaromatic substrate 2 p was also converted into product 1 p with high enantiomeric excess. We next focused on the asymmetric hydroxylamine/enone cascade reaction of multiply substituted substrate 2 r. Under the optimized reaction conditions using catalyst 3 a, the corresponding trifluoromethyl-substituted 2-isoxazoline 1 r with an R configuration was obtained in 99 % yield with 75 % ee. Upon addition of catalyst 3 c instead of 3 a to the reaction, the enantioselectivity of the 2-isoxazoline was improved by as much as 13 % ee to provide 1 r in 99 % yield with 88 % ee. As expected, (S)-1 r with 81 % ee was obtained in excellent yield from the asymmetric hydroxylamine/enone cascade reaction by using the pseudoenantiomer catalyst 3 d. The 2-isoxazoline 1 r could be a key intermediate for the synthesis of chiral type B compounds (Scheme 4).[3gj]
medical Applications, Elsevier, Amsterdam, 1993 ; e) J. T. Welch, S. Eswarakrishman, Fluorine in Bioorganic Chemistry, Wiley, New York, 1991; f) R. Filler, Y. Kobayashi, Biomedicinal Aspects of Fluorine Chemistry, Elsevier Biomedical Press and Kodansya Ltd, Amsterdam, 1982 ; g) V. M. Muzalevskiy, A. V. Shastin, E. S. Balenkova, G. Haufe, V. G. Nenajdenko, Synthesis 2009, 3905 3929; h) A. W. Erian, J. Heterocycl. Chem. 2001, 38, 793 808; i) P. Lin, J. Jiang, Tetrahedron 2000, 56, 3635 3671; j) M. J. Silvester, Adv. Heterocycl. Chem. 1994, 59, 1 38; k) J. T. Welch, Tetrahedron 1987, 43, 3123 3197. For example: a) M. L. Quan, C. D. Ellis, A. Y. Liauw, R. S. Alexander, R. M. Knabb, G. Lam, M. R. Wright, P. C. Wong, R. R. Wexler, J. Med. Chem. 1999, 42, 2760 2773; b) V. Kumar, R. Aggarwal, S. P. Singh, J. Fluorine Chem. 2006, 127, 880 888; c) P. Bravo, L. Bruch, M. Crucianelli, A. Farina, S. V. Meille, A. Merli, P. Seresini, J. Chem. Res. Synop. 1996, 348 349. For example: a) T. Mita, Y. Kudo, T. Mizukoshi, H. Hotta, K. Maeda, S. Takii, WO2004018410, 2004 ; b) Y. Ozoe, M. Asahi, F. Ozoe, K. Nakahira, T. Mita, Biochem. Biophys. Res. Commun. 2010, 391, 744 749; c) M. Yaosaka, T. Utsunomiya, Y. Moriyama, T. Matsumoto, K. Matoba, WO2009001942, 2009 ; d) K. Matoba, WO 2009063910, 2009. type A. ; e) G. P. Lahm, W. L. Shoop, M. Xu, WO2007079162, 2007; f) J. K. Long, T. P. Selby, M. Xu, WO2009045999, 2009 ; type B. ; g) T. Mita, T. Kikuchi, T. Mizukoshi, M. Yaosaka, M. Komoda, WO2005085216, 2005 ; h) W. Zambach, P. Renold, WO2009049846, 2009 ; i) P. Renold, W. Zambach, P. Maienfisch, M. Muehlebach, WO2009080250, 2009 ; j) T. Murata, Y. Yoneta, J. Mihara, K. Domon, M. Hatazawa, K. Araki, E. Shimojo, K. Shibuya, T. Ichihara, U. Goergens, A. Voerste, A. Becker, E. Franken, K. Mueller, WO2009112275, 2009. a) N. Shibata, S. Mizuta, H. Kawai, Tetrahedron: Asymmetry 2008, 19, 2633 2644; b) N. Shibata, T. Ishimaru, S. Nakamura, T. Toru, J. Fluorine Chem. 2007, 128, 469 483; c) N. Shibata, T. Furukawa, D. S. Reddy, Chem. Today 2009, 27, 38 42; d) N. Shibata, S. Mizuta, T. Toru, J. Synth. Org. Chem. Jpn. 2008, 66, 215 228; e) N. Shibata, J. Synth. Org. Chem. Jpn. 2006, 64, 14 24. a) Y. Ukaji, K. Sada, K. Inomata, Chem. Lett. 1993, 1847 1850; b) M. Shimizu, Y. Ukaji, K. Inomata, Chem. Lett. 1996, 455 456; c) M. Tsuji, Y. Ukaji, K. Inomata, Chem. Lett. 2002, 1112 1113; d) M. P. Sibi, K. Itoh, C. P. Jasperse, J. Am. Chem. Soc. 2004, 126, 5366 5367; e) H. Suga, Y. Adachi, K. Fujimoto, Y. Furihata, T. Tsuchida, J. Org. Chem. 2009, 74, 1099 1113; f) A. Ros, E. Alvarez, H. Dietrich, R. Fernndez, J. M. Lassaletta, Synlett 2005, 2899 2904; g) Y. Brinkmann, R. J. Madhushaw, R. Jazzar, Tetrahedron 2007, 63, 8413 8419; h) C. D. Davies, S. P. Marsden, E. S. E. Stokes, Tetrahedron Lett. 2000, 41, 4229 4233; i) A. L. Norman, M. D. Mosher, Tetrahedron Lett. 2008, 49, ewski, 4153 4155; j) M. Zielinska-Bajet, R. Kowalczyk, J. Skarz Tetrahedron 2005, 61, 5235 5240; k) A. Pohjakallio, P. M. Pihko, Chem. Eur. J. 2009, 15, 3960 3964. J. E. Baldwin, J. Chem. Soc. Chem. Commun. 1976, 734 736. H. Kawai, A. Kusuda, S. Nakamura, M. Shiro, N. Shibata, Angew. Chem. 2009, 121, 6442 6445; Angew. Chem. Int. Ed. 2009, 48, 6324 6327. a) E. J. Corey, F. Xu, M. C. Noe, J. Am. Chem. Soc. 1997, 119, 12414 12415; b) E. J. Corey, Y. Bo, J. Busch-Petersen, J. Am. Chem. Soc. 1998, 120, 13000 13001; c) E. J. Corey, M. C. Noe, F. Xu, Tetrahedron Lett. 1998, 39, 5347 5350; d) M. Horikawa, J. Busch-Petersen, E. J. Corey, Tetrahedron Lett. 1999, 40, 3843 3846; e) E. J. Corey, F.-Y. Zhang, Angew. Chem. 1999, 111, 2057 2059; Angew. Chem. Int. Ed. 1999, 38, 1931 1934; f) E. J. Corey, F.-Y. Zhang, Org. Lett. 1999, 1, 1287 1290. Although the wisdom in using chloroform as a solvent with a strong base such as CsOH might be questionable since dichlorocarbene can be formed, an unexpected side reaction was not

Chemie

[2]

[3]

[4]

Scheme 4. Synthesis of key type B compounds (see Figure 1). [5]

In summary, we have developed the first catalytic enantioselective synthesis of trifluoromethyl-substituted 2-isoxazolines by a cinchona alkaloid-catalyzed asymmetric hydroxylamine/enone cascade reaction consisting of conjugate addition/cyclization/dehydration reactions to provide the medicinally important trifluoromethylated compounds.[3d] Wide substrate generality, the flexibility to generate either the S or R enantiomers, and high levels of enantioselectivity have been achieved.[9]
Received: April 7, 2010 Revised: May 27, 2010 Published online: July 7, 2010

[6] [7]

Keywords: asymmetric catalysis fluorine heterocycles organocatalysis phase-transfer catalysis

[8]

[1] a) V. A. Petrov, Fluorinated Heterocyclic Compounds: Synthesis Chemistry, and Applications, Wiley, Hoboken, NJ, 2009 ; b) P. Kirsch, Modern Fluoroorganic Chemistry, Wiley-VCH, Weinheim, 2004 ; c) I. Ojima, J. R. MacCarthy, J. T. Welch, Biomedical Frontiers of Fluorine Chemistry, American Chemical Society, New York, 1996 ; d) R. Filler, Y. Kobayashi, L. M. Yagupolskii, Organofluorine Compounds in Medicinal Chemistry and Bio
Angew. Chem. 2010, 122, 5898 5902

[9]

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5901

Zuschriften
detected at all. Importantly, we have ascertained that environmentally benign trifluorotoluene can be used as a solvent in this transformation without any loss of the yields and enantioselectivity. [10] CCDC 763815 ((R)-1 g) contains the supplementary crystallographic data for this paper. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_request/cif). [11] CCDC 738896 (3 f) contains the supplementary crystallographic data for this paper. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www. ccdc.cam.ac.uk/data_request/cif).

5902

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5898 5902

Angewandte
DOI: 10.1002/ange.201001853

Chemie

Alkaloids

Catalytic Selective Cyclizations of Aminocyclopropanes: Formal Synthesis of Aspidospermidine and Total Synthesis of Goniomitine**
Filippo De Simone, Jrg Gertsch, and Jrme Waser*
Polyheterocyclic structures are present in most natural and synthetic molecules with important biological activity.[1] Therefore, the discovery of new efficient cyclization reactions is important to access natural products and to explore a broad range of complex scaffolds with potentially enhanced bioactivity.[2] We have recently reported the first catalytic formal homo-Nazarov cyclization of vinyl cyclopropyl ketones for the synthesis of cyclohexenones (Scheme 1 a).[3] In contrast to the well-established Nazarov cyclization of divinyl ketones to conditions developed in our work allowed us to apply our method to several unprecedented heterocyclic structures, but the scope of the reaction was limited by the required presence of an electron-rich aromatic group to stabilize the formed carbocationic intermediate A. A heteroatom should also be able to stabilize the formed carbocation, as demonstrated by the rich chemistry of donor acceptor cyclopropanes.[6] Aminocyclopropanes in particular may lead to the fused aminocyclohexane core of numerous biologically relevant alkaloids (R1 = N in Scheme 1). Cyclization of an acyl indole substituted aminocyclopropane 1 would constitute a general entry into the Aspidosperma alkaloids, such as aspidospermidine (2 ; Scheme 1 b). The tetracyclic core obtained in the cyclization is present not only in the Aspidosperma family, but also in more complex natural products such as vinblastine and vincristine, which are frontline drugs in cancer therapy.[7] Although the combination of synthetically challenging structures and potential medical applications has resulted in a large number of successful total syntheses of aspidospermidine in the past,[8] the development of more general and flexible synthetic approaches is still required to access new analogues. Herein, we report the first example of the formal homo-Nazarov cyclization of aminocyclopropanes and its application in the formal total synthesis of aspidospermidine (2). Additionally, we demonstrate how a simple modification in reaction conditions leads to the scaffold of goniomitine (3), an indole alkaloid isolated from the tree Gonioma malagasy,[9] starting from aminocyclopropane 1. In contrast to the Aspidosperma scaffold, the goniomitine ring system is unique in natural products, and only two total syntheses have been reported so far.[9b, c] Based on our cyclization strategy, an efficient total synthesis of goniomitine (3) was accomplished and we present herein the first study of its bioactivity, revealing significant cytotoxicity against several cancer cell lines, including vinblastine and taxol-resistant P-glycoprotein (Pgp, MDR-1) overexpressing cells. We began our research by examining the cyclization of the simple model system 4 containing the aminocyclopropane derived from the unsubstituted tetrahydropyridine ring and a N-methylindole (Scheme 2).[10] Our standard conditions developed for the catalytic homo-Nazarov cyclization were highly successful and the reaction occurred in 90 % yield with high diastereoselectivity for the cis-fused product 5.[11] This result demonstrated that carbamates were also excellent activating groups for the cyclization reaction. Encouraged by this promising result, we then synthesized the ethyl-substituted cyclopropane 12 required for the core of the Aspidosperma alkaloids (Scheme 3). The synthesis of carboxylic acid 10 was accomplished using a slightly modified

Scheme 1. Formal homo-Nazarov reaction and applications in the synthesis of polyheterocyclic natural products. Cbz = benzyloxycarbonyl.

give cyclopentenones,[4] examples of homo-Nazarov cyclizations are rare and require stoichiometric amounts of strong Lewis acids or high temperatures.[5] The mild catalytic
[*] F. De Simone, Prof. Dr. J. Waser Laboratory of Catalysis and Organic Synthesis, Ecole Polytechnique Fdrale de Lausanne, EPFL SB ISIC LCSO BCH 4306, 1015 Lausanne (Switzerland) Fax: (+ 41) 21-693-9700 E-mail: jerome.waser@epfl.ch Homepage: http://isic.epfl.ch/lcso Prof. Dr. J. Gertsch Institute of Biochemistry and Molecular Medicine Bhlstrasse 28, 3012 Bern (Switzerland) [**] The EPFL is acknowledged for financial support. Letitzia Gullifa (EPFL) is acknowledged for the preparation of the starting material, Dr. Rosario Scopelliti (EPFL) for the X-ray studies, Dr. Markus Wartmann (Novartis AG) and Dr. Stefanie Krmer (ETH Zurich) for the gift of cancer cells, and Prof. Brian L. Pagenkopf (University of Western Ontario) for a copy of the original NMR data for goniomitine (3). The collaboration between J.W. and J.G. was initiated with the support of COST CM0804 (Chemical Biology with Natural Products). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001853.
Angew. Chem. 2010, 122, 5903 5906

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5903

Zuschriften

Scheme 2. Model study for the cyclization of aminocyclopropane 4. Ts = 4-toluenesulfonyl.

Scheme 4. Coupling of N-carboxylated indoles.

Scheme 3. Synthesis and cyclization of aminocyclopropane 12. Reagents and conditions: a) nBuLi, CbzCl, EtI, THF, 78 8C, 67 %; b) NaBH4, MeOH; c) H2SO4, THF, 93 % overall; d) (CuOTf)2C7H8, N2CHCO2Et, CH2Cl2, 76 % (d.r. 1:1); e) BF3Et2O, CH2Cl2 ; f) NaOH H2O/THF/EtOH (1:1:3), 91 % overall; e) DMTMM, NMM, THF, MeNHOMeHCl, 93 %; h) N-methylindole, nBuLi, tBuOK, THF, 48 %; i) TsOH, MeCN, quant; j) H2, Pd/C, quant. DMTMM = 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)methylmorpholinium chloride, NMM = N-methylmorpholine, THF = tetrahydrofuran.

procedure of Grieco and Kaufman.[12] d-Valerolactam (7) was Cbz protected and alkylated in one pot. Reduction and dehydratation led to dehydropiperidine 8. Enamide 8 was converted into aminocyclopropane 9 by cyclopropanation using CuOTf as the catalyst.[13] The low diastereoselectivity observed in the cyclopropanation reaction is inconsequential, as the diastereomeric mixture of esters equilibrated to the exo isomer in the presence of BF3.[12] The exo ester obtained was hydrolyzed to obtain 10 as a pure diastereoisomer. The choice of DMTMM[14] to convert the sensitive cyclopropane 10 into the Weinreb amide 11 in good yield was crucial. The coupling reaction between amide 11 and 2lithiated N-methylindole afforded the precursor 12 of the homo-Nazarov reaction. To our delight, our catalytic conditions for the cyclization gave the tetracyclic core of Aspidosperma alkaloids as a single diastereoisomer 13 after removal of the Cbz protecting group. The high diastereoselectivity observed is an important advantage of the formal homo-Nazarov cyclization. Other approaches based on aminocyclopropanes in intermolecular FriedelCrafts reactions used for the synthesis of Aspidosperma alkaloids proceeded with low selectivity.[8d] If an enantioselective cyclopropanation method can be developed, an asymmetric synthesis will become possible.[15] For the synthesis of aspidospermidine (2) an indole having an unprotected NH moiety was required. Therefore, we investigated the use of bis-lithiated N-carboxy indoles for the addition reaction to the Weinreb amide 11 (Scheme 4).[16] The

interest in using carbon dioxide as protecting/directing group lies in its easy removal, which occurs upon aqueous workup. However, its use has been limited to simple substrates.[16] We were therefore pleased to observe that the coupling procedure proceeded in moderate to good yields, leading directly to indoles 1 ac. This approach was highly convergent and allowed the easy variation of coupling partners for the synthesis of analogues. The obtained product 1 a was submitted to the standard conditions for the homo-Nazarov cyclization. We were surprised to observe the formation of two different products. The two compounds were identified as the desired product 15 a resulting from cyclization at the C3 position of indole, and the compound 16 a obtained from attack upon the N1 position. The cyclic products were isolated in 74 % yield and the ratio of 15 a to 16 a was 1.6:1 (Table 1, entry 1). To increase the selectivity for CC cyclization, we examined several Brnsted and Lewis acids as catalysts (entries 14). The use of soft Lewis acids instead of Brnsted acids allowed the desired formation of 15 a as a pure diastereoisomer (entries 2 and 3). Softer, milder Lewis acids could potentially exert an influence on the formation of the acyl iminium intermediate and favor
Table 1: Cyclization of aminocyclopropanes 1.

Entry 1 2 3 4 5 6 7 8 9 10 11 12 13

R (1) H (1 a) H (1 a) H H H H H H H 4-OMe (1 b) 4-OMe 5-OMe (1 c) 5-OMe

Catalyst

Solvent

15/16 1.6:1[a] 8:1[b] 11:1[b] 7:1[a] 1.3:1[b] polymers[b] 1:18[b] 1:16[b] 1:21[a] 1:22[a] 8:1[a] 1:20[a] 8:1[a]

Yield [%] 74 n.d.[c] n.d. 91 n.d. n.d. n.d. n.d. 89 92 88 86 95

TsOH MeCN Cu(OTf)2 MeCN Pd(CH3CN)4(BF4)2 MeCN MeCN Cu(OTf)2 TsOH MeNO2 TsOH THF TsOH CH2Cl2 TsOH toluene TsOH CH2Cl2 TsOH CH2Cl2 MeCN Cu(OTf)2 TsOH CH2Cl2 MeCN Cu(OTf)2

[a] Yields and ratios determined from products isolated after purification. Reaction run with 1 ac (40100 mg, 90250 mmol) and 15 25 mol % catalyst, and at a concentration of 0.025 m. [b] Ratios calculated by integration of peaks in the 1H NMR spectra of the crude reaction mixture. Reaction carried out on a 10 mg (25 mmol) scale at a concentration of 0.025 m. [c] n.d. = not determined.
Angew. Chem. 2010, 122, 5903 5906

5904

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
the reaction at the softer C3 position of the indole ring. Deprotection of 15 a gave the free amine, concluding the successful formal total synthesis of aspidospermidine (2), as this intermediate had already been reported by Wenkert and Hudlicky.[8d, 17] The N-cyclization product 16 a was also highly interesting, as it corresponded to the tetracyclic skeleton of goniomitine (3). When considering the rarity of this scaffold, the limited number of synthetic approaches,[9b,c] and the absence of any study on its bioactivity, we found it worthwhile to optimize the formation of the N1-cyclization product 16 a. We hypothesized that the use of a less polar solvent for the cyclization reaction could enhance the reactivity of the iminium intermediate and favor a fast attack on the harder N1 position. Indeed, a strong influence of solvents upon the cyclization was observed in the presence of Brnsted acids (Table 1, entries 58). We were delighted to isolate the goniomitine scaffold 16 a in high yield and excellent selectivity using dichloromethane and toluene sulfonic acid as catalyst (entry 9). Cyclizations involving (acyl)iminium ions are important tools in the synthesis of alkaloids.[18] Examples involving a possible competition between N1 and C3 cyclization are rare, and it is difficult to control the regioselectivity and stereoselectivity of these reactions.[19] The ring-opening of aminocyclopropanes constitutes a new method for the generation of acyl iminium ions and the high level of control on the regioand stereoselectivity observed is unprecedented. To gain a first impression for the generality of the method, two methoxy indole analogues, 1 b and 1 c, were examined, as similar electron-rich indoles are frequently encountered in natural products. Again, high yields and control of regioselectivity were achieved in these cases (Table 1, entries 1013). To finish the total synthesis of goniomitine (3) starting from 16 a, it would be necessary to introduce the lateral chain at C3 in the presence of the sensitive aminal functionality. To avoid this difficult task, we envisaged a more convergent approach starting from the cyclization precursor 1 d (Scheme 5). Indole 1 d was obtained from tryptophol by TIPS protection, carboxylation, lithiation, and then addition to the Weinreb amide 11.[20] The cyclopropane 1 d was cyclized in the presence of a catalytic amount of TsOH, affording the tetracyclic core 17 of goniomitine (3) in 93 % yield. The carbonyl group was reduced to the alcohol and acetylated. The acetate and the benzyl carbamate were cleaved in one step through hydrogenolysis. Deprotection of the primary alcohol gave goniomitine (3) in 77 % overall yield from 17.[21] The total synthesis of ( )-goniomitine (3) was accomplished in a longer linear sequence of 13 steps (5 purifications by column chromatography) with an overall yield of 11 %. Somewhat surprisingly, we were unable to find any studies about the bioactivity of goniomitine (3). In a first biological assessment we therefore investigated the cytotoxicity of this natural product. Preliminary results are highly promising as goniomitine displays nanomolar antiproliferative effects in several tumor cell lines (Table 2). Interestingly, unlike taxol and vinblastine, which are approximately 100-fold less effective in cells overexpressing P-gp (not shown), goniomitine did not lose its effect in the resistant MDR-1-MDCK cell line.

Chemie

Table 2: Antiproliferative activity of goniomitine. Cell lines A549 MCF-7 HCT116 PC-3M MDCK MDR-1-MDCK IC50 [nm][a] 205 27 239 13 281 29 159 24 247 10 381 17

[a] IC50 values for inhibition of human tumor cell growth; A549 (lung), MCF-7 (breast), HCT-116 (colon), PC-3M (prostate), MDCK (canine kidney). MDR-1-MDCK is a human P-glycoprotein 170 (P-gp170)-overexpressing multidrug-resistant cell line.[22]

In conclusion, we have demonstrated the versatility of aminocyclopropanes as (acyl)iminium precursors for intramolecular cyclizations. The reaction proceeded under mild conditions and control of the regioselectivity was possible by the right choice of catalyst and solvent. The power of the methodology has been demonstrated in the efficient formal total synthesis of aspidospermidine (2) and the total synthesis of goniomitine (3). First studies on the bioactivity of goniomitine revealed its relatively potent cytotoxicity (antiproliferative effect; IC50 = 150400 nm ) against several tumor cell lines. Preliminary data show that this natural product disrupts the microtubule network (not shown). Therefore, goniomitine is a potential new anticancer lead structure. In the future, the high convergence of our synthetic approach will allow access a large number of analogs of goniomitine (3) for structureactivity relationship studies. Applications of aminocyclopropanes as iminium precursors for other types of cyclization or addition reactions as well as the development of asymmetric cyclopropanation methods for enamides are currently under investigation in our laboratory and the results of this work will be reported in due course.
Received: March 29, 2010 Published online: June 8, 2010

Scheme 5. Total synthesis of goniomitine (3). Reagents and conditions: a) TsOH, CH2Cl2, 93 %; b) NaBH4, MeOH; c) Ac2O, pyridine; d) Pd/C, H2, EtOH; e) TBAF, THF, 77 % overall. TBAF = tetra-n-butylammonium fluoride, TIPS = triisopropylsilyl.
Angew. Chem. 2010, 122, 5903 5906

Keywords: alkaloids antitumor agents cyclization heterocycles regioselectivity www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5905

Zuschriften
[1] a) A. F. Pozharskii, A. R. Katritsky, A. T. Soldatenkov in Heterocycles in Life and Society: An Introduction to Heterocyclic Chemistry and Biochemistry and the Role of Heterocycles in Science Technology, Medicine and Agriculture, Wiley-VCH, Weinheim, 1997; b) J. Clardy, C. Walsh, Nature 2004, 432, 829. [2] S. M. Ma in Handbook of Cyclization Reactions, Wiley-VCH, Weinheim, 2009. [3] F. De Simone, J. Andres, R. Torosantucci, J. Waser, Org. Lett. 2009, 11, 1023. [4] a) I. N. Nazarov, I. I. Zaretskaya, Izv. Akad. Nauk SSSR Ser. Khim. 1941, 211; For reviews, see: b) K. L. Habermas, S. E. Denmark, T. K. Jones, Org. React. 1994, 45, 1 158; c) A. J. Frontier, C. Collison, Tetrahedron 2005, 61, 7577; d) H. Pellissier, Tetrahedron 2005, 61, 6479; e) M. A. Tius, Eur. J. Org. Chem. 2005, 2193; f) W. Nakanishi, F. G. West, Curr. Opin. Drug Discovery Dev. 2009, 12, 732. [5] a) W. S. Murphy, S. Wattanasin, Tetrahedron Lett. 1980, 21, 1887; b) W. S. Murphy, S. Wattanasin, J. Chem. Soc. Perkin Trans. 1 1981, 2920; c) W. S. Murphy, S. Wattanasin, J. Chem. Soc. Perkin Trans. 1 1982, 1029; d) O. Tsuge, S. Kanemasa, T. Otsuka, T. Suzuki, Bull. Chem. Soc. Jpn. 1988, 61, 2897; e) V. K. Yadav, N. V. Kumar, Chem. Commun. 2008, 3774. [6] a) H. U. Reissig, R. Zimmer, Chem. Rev. 2003, 103, 1151; b) M. Yu, B. L. Pagenkopf, Tetrahedron 2005, 61, 321; c) F. De Simone, J. Waser, Synthesis 2009, 3353. [7] a) S. E. Malawista, H. Sato, K. G. Bensch, Science 1968, 160, 770; b) B. Gigant, C. G. Wang, R. B. G. Ravelli, F. Roussi, M. O. Steinmetz, P. A. Curmi, A. Sobel, M. Knossow, Nature 2005, 435, 519; c) F. Gueritte, J. Fahy, The Vinca Alkaloids, Anticancer Agents from Natural Products (Eds.: D. J. C. Newman, G. M. Kingston), Taylor & Francis, London, 2005. [8] For a few selected examples, see: a) G. Stork, J. E. Dolfini, J. Am. Chem. Soc. 1963, 85, 2872; b) J. P. Kutney, N. Abdurahm, P. Lequesne, E. Piers, I. Vlattas, J. Am. Chem. Soc. 1966, 88, 3656; c) T. Gallagher, P. Magnus, J. C. Huffman, J. Am. Chem. Soc. 1982, 104, 1140; d) E. Wenkert, T. Hudlicky, J. Org. Chem. 1988, 53, 1953; e) R. Iyengar, K. Schildknegt, J. Aube, Org. Lett. 2000, 2, 1625; f) M. A. Toczko, C. H. Heathcock, J. Org. Chem. 2000, 65, 2642; g) S. A. Kozmin, T. Iwama, Y. Huang, V. H. Rawal, J. Am. Chem. Soc. 2002, 124, 4628; h) L. A. Sharp, S. Z. Zard, Org. Lett. 2006, 8, 831; i) C. Sabot, K. C. Guerard, S. Canesi, Chem. Commun. 2009, 2941. [9] Isolation: a) L. Randriambola, J. C. Quirion, C. Kanfan, H. P. Husson, Tetrahedron Lett. 1987, 28, 2123; Total syntheses: b) S. Takano, T. Sato, K. Inomata, K. Ogasawara, J. Chem. Soc. Chem. Commun. 1991, 462; c) C. L. Morales, B. L. Pagenkopf, Org. Lett. 2008, 10, 157; Analogs studies: d) C. Hashimoto, H. P. Husson, Tetrahedron Lett. 1988, 29, 4563; e) G. Lewin, C. Schaeffer, Nat. Prod. Lett. 1995, 7, 227; f) G. Lewin, C. Schaeffer, P. H. Lambert, J. Org. Chem. 1995, 60, 3282; g) G. Lewin, C. Schaeffer, R. Hocquemiller, E. Jacoby, S. Leonce, A. Pierre, G. Atassi, Heterocycles 2000, 53, 2353. See the Supporting Information for the synthesis of 4. The cis stereochemistry was determined by two-dimensional NMR experiments. See the Supporting Information for details. P. A. Grieco, M. D. Kaufman, J. Org. Chem. 1999, 64, 7586. R. Beumer, C. Bubert, C. Cabrele, O. Vielhauer, M. Pietzsch, O. Reiser, J. Org. Chem. 2000, 65, 8960. 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-N-methylmorpholinium chloride. For a review on metal-catalyzed enantioselective cyclopropanation reactions, see: a) H. Pellissier, Tetrahedron 2008, 64, 7041. Highly selective methods for enamide substrates have not yet been reported. Alternatively, the kinetic resolution of aminocyclopropane esters can also be envisaged.[13] A. R. Katritzky, K. Akutagawa, Tetrahedron Lett. 1985, 26, 5935. The structure of deprotected 15 a was definitively confirmed by X-ray diffraction studies on the corresponding hydrochloride salt; see the Supporting Information. B. E. Maryanoff, H. C. Zhang, J. H. Cohen, I. J. Turchi, C. A. Maryanoff, Chem. Rev. 2004, 104, 1431. a) A. Jackson, N. D. V. Wilson, A. J. Gaskell, J. A. Joule, J. Chem. Soc. C 1969, 2738; b) P. Forns, A. Diez, M. Rubiralta, J. Org. Chem. 1996, 61, 7882; c) M. Amat, M. Perez, N. Llor, C. Escolano, F. J. Luque, E. Molins, J. Bosch, J. Org. Chem. 2004, 69, 8681; d) S. Cutri, A. Diez, M. Bonin, L. Micouin, H. P. Husson, Org. Lett. 2005, 7, 1911. See the Supporting Information. The data contained in the 400 MHz 1H NMR spectra of goniomitine (3) were identical to those of natural[9a] and synthetic[9b,c] goniomitine. The obtained values for 13C NMR spectra fitted perfectly with the reported values for synthetic goniomitine, but small differences were apparent when compared with natural goniomitine. A comparison of the spectra is provided in the Supporting Information. See the Supporting Information for more details. See also: J. Gertsch, F. Feyen, A. Btzberger, B. Gerber, B. Pfeiffer, K. H. Altmann, ChemBioChem 2009, 10, 2513.

[10] [11] [12] [13] [14] [15]

[16] [17]

[18] [19]

[20] [21]

[22]

5906

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5903 5906

Angewandte
DOI: 10.1002/ange.201000452

Chemie

Nanoparticles

Highly Active Iron Oxide Supported Gold Catalysts for CO Oxidation: How Small Must the Gold Nanoparticles Be?**
Yong Liu, Chun-Jiang Jia, Jun Yamasaki, Osamu Terasaki, and Ferdi Schth*
Dedicated to Professor Rdiger Kniep on the occasion of his 65th birthday Since the pioneering studies of Haruta et al.,[1] CO oxidation over supported gold nanoparticles has become one of the most extensively studied systems in heterogeneous catalysis.[2] Most of the studies have been focused on the origin of the unique catalytic activity of gold nanoparticles. The reasons for this are that on the one hand it is of great scientific interest and on the other hand it may support the development of new catalysts in different fields such as automotive catalysis and polymer electrolyte fuel cells.[3] Specifically, preparation of active gold catalysts[4] influences the size and shape of the gold nanoparticles,[5] the role of the support,[6] the oxidation state of the active gold species (metallic, Au+ or Au3+),[7] and the oxygen supply pathways[6a, 8] . Unfortunately, however, many reports are highly controversial and the debate is likely to continue for some time owing to the sensitivity and complexity of gold catalysis. Taking the influence of gold particle size as an example, it has been believed that gold nanoparticles of 25 nm are the active species for CO oxidation, while Chen and Goodman reported that gold bilayers are more active than the monolayers.[5a] Recently, Hutchings and co-workers used aberration-corrected scanning transmission electron microscopy (STEM) to study iron oxide supported gold catalyst and the activity in CO oxidation was correlated with the presence of gold clusters which are about 0.5 nm in diameter and contain around ten gold atoms.[9] The origin of this still unclear situation liesamong other factorsmainly in the wide size distribution of gold nanoparticles. By the conventional methods, especially for coprecipitation, typically gold nanoparticles with a wide size distribution of < 1 nm to about 20 nm are obtained, which makes the identification of the active species extremely difficult. To help clarify this situation, the colloidal deposition method seems to be more suitable because the gold colloid is already generated before the addition of the support. Furthermore, the size of gold nanoparticles is preserved after the deposition onto the support. Thus, this method has been used to study the effect of the support in gold catalysis.[10] For all the gold catalysts tested, gold nanoparticles were in the size range of around 25 nm, as before deposition, and the catalysts showed activities comparable to the gold catalysts synthesized through the depositionprecipitation method.[10] As this method should not result in the formation of smaller clusters, which are described in the literature as the origin of the high activity, the question arose as to whether highly active Au/FeOx catalysts could be produced by colloidal deposition. This approach would give further clues with respect to the absolute requirement of small clusters for high activity. To study very small particles in detail, atomic-resolution STEM is probably the most powerful technique because it is capable of characterizing metal clusters of subnanometer dimensions.[9, 11] When the high-angle annular dark-field scanning transmission electron microscopy (HAADFSTEM) mode is used, the STEM image can be considered as an incoherent image, and the image intensity increases with the atomic number (Z) of the constituent atoms,[12] therefore even single gold atoms can be observed.[13] Thus, iron oxide supported gold catalysts were synthesized, studied in CO oxidation, and carefully analyzed by HAADF-STEM to obtain precise information on the size and structure of the gold clusters. As will be shown herein, high activity catalysts do not necessarily require the presence of subnanometer gold clusters. The iron oxide support was synthesized by following a similar procedure as described in the literature.[7b, 9] By carefully controlling the synthesis parameters, iron oxide with a BrunauerEmmettTeller (BET) surface area of around 260 m2 g1 can be reproducibly achieved (detailed synthetic procedures are given in the Experimental Section, and N2 adsorption isotherms of the support are plotted in

[*] Y. Liu, Dr. C.-J. Jia, Prof. Dr. F. Schth Max-Planck-Institut fr Kohlenforschung Kaiser-Wilhelm-Platz 1, 45470 Mlheim an der Ruhr (Germany) Fax: (+ 49) 208-306-2995 E-mail: schueth@mpi-muelheim.mpg.de Dr. J. Yamasaki EcoTopia Science Institute, Nagoya University Furochou, Chikusa-ku, Nagoya 464-8601 (Japan) Prof. O. Terasaki Inorganic & Structural Chemistry and EXSELENT, Stockholm University 10691 Stockholm (Sweden) and Graduate School of EEWS (WCU), KAIST Daejeon Daejeon 305-701 (Korea) [**] We thank Dr. E. Okunishi (JEOL) for acquiring STEM images, Prof. G. J. Hutchings and Prof. C. J. Kiely for valuable discussions, B. Spliethoff for the size distribution statistics of the gold nanoparticles, S. Palm for EDX measurements, and Dr. C. Weidenthaler for XRD measurements and helpful discussions. Financial support from the DFG (SFB 558), the Swedish Research Council-VR, the Berzelii Center EXSELENT (Sweden), the World Class University (WCU) program through KOSEF funded by MEST (korea; R31-2008000-10055-0), and the Alexander von Humboldt Foundation are gratefully acknowledged. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201000452.
Angew. Chem. 2010, 122, 5907 5911

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5907

Zuschriften
Figure S1 in the Supporting Information). By following the same procedure previously described by our research group,[10] 1 wt % of gold nanoparticles was then deposited onto the iron oxide. The energy-dispersive X-ray (EDX) measurements carried out using scanning electron microscopy (SEM) revealed a gold weight percentage of 1.22 %, which is in good agreement with the nominal value. The X-ray diffraction (XRD) patterns of the Au/FeOx catalyst (Figure S2 in the Supporting Information) indicate that the iron oxide substrate is not well crystalline, which is also confirmed by the STEM images shown later. Also, it is highly possible that the sample contains a mixture of more than one phase (Figure S3 in the Supporting Information). Notably, the reflections of gold cannot be detected because of the low gold loading and small particle size of gold. The catalytic performance of the Au/FeOx catalyst thus obtained was then evaluated in CO oxidation, and the CO conversion curves are shown in Figure 1. It can be seen that and the CO concentration in the reaction gas is also different (1 vol % in our case and 0.5 vol % in the literature[9]). Activities of the catalyst synthesized by colloidal deposition and by coprecipitation are thus quite similarif normalized to the amount of gold in the catalyst. From the data above, it is obvious that highly active iron oxide supported gold catalyst can be also synthesized through the colloidal deposition method. Here the most interesting question arises: could the activity of the current catalyst also be attributed to gold bilayer clusters with about 0.5 nm in diameter, or are only larger particles with an average size of around 2 nm present? To answer this question, the Au/FeOx catalyst was characterized using aberration-corrected STEM in both bright field (BF) and HAADF modes, and representative HAADF-STEM images are shown in Figure 2 (corresponding BF-STEM images and some other images are shown in Figure S4 in the Supporting Information). It can be seen that the iron oxide support is nearly amorphous, which is consistent with the XRD results. It is noteworthy that in certain areas, as shown in Figure 2, many gold nanoparticles

Figure 1. CO oxidation curves of the Au/FeOx catalyst (1 vol % CO, 20 vol % O2, rest N2, space velocity = 80 000 mL g1).

the catalyst first goes through a thermal activation in the first run to burn away the protecting agent, (poly(vinyl alcohol)), which was added during the preparation of the gold colloid. The catalyst shows identical activities in the second and third runs. This outcome is in agreement with previous studies on catalysts produced by colloidal deposition.[10] A T1/2 value (temperature at which half conversion of CO is reached) of 14 8C can be observed, thus indicating that the catalyst has a high activity for the low temperature oxidation of CO. Compared with other catalysts that are also synthesized through the colloidal deposition method, the activity of Au/ FeOx is comparable with that of Au/TiO2, which is probably the best known low-temperature active catalyst for this reaction. For the analogous iron oxide supported gold catalysts prepared by coprecipitation the T1/2 value is not given in the literature,[7b, 9] instead it was stated that the most active catalyst shows almost full conversion at 25 8C. At this temperature the catalyst reaches 25 % conversion at a space velocity of 450 000 h1. We have obtained close to 80 % conversion at 25 8C at a space velocity of 80 000 h1. However, when comparing the two systems, one also has to take into account other differences: the gold loading in the current system is significantly lower (1.22 wt % instead of 5 wt %),

Figure 2. Aberration-corrected HAADF-STEM images and size distribution of the gold particles of Au/FeOx catalyst prepared by the colloidal deposition method.

can be observed while in some other areas almost no gold particles can be detected. The uneven distribution of the gold nanoparticles has been observed by us in other gold catalysts prepared through the colloidal deposition method,[10a] but the reason for this is not yet clear. However, the most important issue of this study is the size distribution of these particles, and this was thus determined based on Figure 2 ac . In total, 110 particles were found and a mean size of (2.1 0.54) nm was determined. Most significantly, no gold nanoparticles smaller than 1 nm were observed in any of the many images taken. Obviously, it is extremely difficult to disprove the existence of
Angew. Chem. 2010, 122, 5907 5911

5908

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
certain species (especially the extremely small ones like in this case) by microscopy techniques, however, after careful characterization we are confident to claim that no gold clusters of about 0.5 nm are present in the Au/FeOx catalyst prepared by the colloidal deposition method. Even single atoms can be detected, if they are present. However, gold catalysis is extremely complicated and sensitive, and the current study does not question the observations of previous studies on catalysts prepared by different techniques. This study, however, shows that the small clusters are not crucial for high activity of the catalyst. The catalysts were also characterized after use in CO oxidation by XRD and STEM (the XRD patterns as well as BF-STEM and HAADF-STEM images are given in Figure S2b and Figure S5 in the Supporting Information, respectively). No changes in the structure of the iron oxide support or the particle size distribution of gold nanoparticles were observed, which is in line with the identical activities in the second and third runs of the catalytic test, and also corresponds to previous studies using this synthetic method. Another interesting question is: how are the gold atoms packed in the gold particles? It is known that gold bilayer structures are the most catalytically active structure for CO oxidation and some gold nanoparticles around 1 nm have been proposed to have this same structure.[5a, 11b] The STEM technique can also give valuable information on this issue: HAADF-STEM images have a lateral resolution on the sub scale and can give a projected image on the scale, while at the same time the intensity distribution can provide information on the number of atoms in each atomic column along the beam. If the crystal is thin, it can be expected that the intensity is linearly correlated to the number of gold atoms. In other words, 3D information may be obtained by combining the 2D image and the intensity distributions of the sample. To confirm this assumption, aberration-corrected HAADFSTEM images were simulated under the present experimental conditions (see the Experimental Section) for a Au14 cluster model, which consists of four stacked layers in ABCA sequence along [111] and each layer contains 7, 3, 3, and 1 atoms (Figure S6 in the Supporting Information). Figure S7a and S7b show simulated images of this model cluster along [111] and 10" 1 projections, and Figure S7c and S7d show intensity profiles along the lines shown by arrows (see the Supporting Information). Similarly, the correlation between the simulated atomic column intensity along [001] and the number of gold atoms can be obtained and is shown in Figure 3. The intensity is roughly proportional to the number of gold atoms up to about six atoms, although slight deviations from linearity are detected. Notably, the increase in intensity is not constant with the increasing number of gold atoms (e.g. the intensity of two overlapping atoms is 2.58 times that of a single atom). However, it is clear that one can still calibrate the number of atoms in every column along the beam, as long as this factor is taken into account. Among typical and wellaligned gold nanoclusters along the incident electron beam, one representative gold cluster with a diameter of 18 is shown in Figure 4 a. As marked (A, B, E-L) in the figure, several single gold atoms can also be observed. Because the gold catalyst was prepared by the colloidal deposition
Angew. Chem. 2010, 122, 5907 5911

Chemie

Figure 3. Correlation between simulated atomic column intensity along [001] and the number of gold atoms.

Figure 4. a) HAADF-STEM image of the Au/FeOx catalyst. Different single atoms (A, B, E-L) are marked. b) and c) The intensity profiles along C and D marked by dashed lines in (a).

method, it is highly unlikely that single gold atoms would exist in the colloid, at least not in such a concentration. These single gold atoms are most probably generated by incident electrons during the measurement. Figure S8 in the Supporting Information shows two successively recorded images on the same focus area, and the generation of one single gold atom can clearly be seen an observation that strongly supports this explanation for the occurrence of single gold atoms. Furthermore, while recording the aberration-corrected HAADF-STEM images we also confirmed that the amount of single gold atoms was increasing with the observation time, www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5909

Zuschriften
and that there was no serious change in the cluster during the time of the observation. To achieve the standard intensity for a single gold atom, based on which the gold cluster could be studied, the intensity profiles of the ten marked single gold atoms are summarized in Table 1. As can be seen, the intensities vary from 25 to 41,
Table 1: Intensities of different gold single atoms marked in Figure 4 a. Au single atom A B E F G H I J K L Intensity 40 38 41 36 28 25 26 30 33 31 FWHM [pixel][a] 5 6 5 8 8 7 6 8 6 6

[a] 1 pixel = 0.16 . FWHM = full width at half maximum.

and the average value is 32.8. The reason for the different intensities may result from different focus conditions owing to the different height of gold atoms with respect to the lens, and this variation in intensity can be understood based on the electron probe size through electron optics of the HAADFSTEM technique. The gold atom (L) is the closest to the cluster, and its intensity (31) is also close to the average value. Therefore, the intensity of the gold atom (L) is chosen as the standard for further investigation of the gold cluster. Figure 4 b,c shows the intensity profiles of lines C (along [100]) and D (along [110]) after subtracting the background, respectively. Taking 31 as a standard intensity of a single atom and based on the factors between the intensities and increased gold atom numbers given in Figure 3, the theoretical intensities of different gold layers are calculated and indicated by the dashed lines in Figure 4. The quantized nature of the intensities can be seen, and it is clear that the gold cluster has a structure containing up to four gold atoms along the electron beam. Because a variation in the intensities between 25 and 41 was observed for different gold single atoms, both values were then used as standard intensity and the corresponding results are given in Figure S9 in the Supporting Information. Based on these results, we can conclude that the brightest atom columns contain (41) atoms along the beam direction, and the possibility that the gold cluster has a bilayer structure can thus be excluded. Haruta and co-workers studied CeO2 and TiO2 supported gold catalysts using high-resolution transmission electron microscopy (HRTEM) and HAADF-STEM techniques, and the gold nanoparticles clearly showed multilayer packing, although for these model catalysts no catalytic data is available.[14] Our electron microscopy observation is in agreement with their reports, and, combined with our catalytic data on the same solid, this finally rules out the monolayer or bilayer structure as an absolute requirement for the high catalytic activity in CO oxidation.

Based on the data obtained above, not only the diameter but also the thickness of the gold nanoparticles can be calculated. As the gold particle depicted in Figure 4 b, c show, the (4 1) atoms packed in the [100] direction correspond to (12 4) , which is close to the diameter of the cluster (18 ). However, it is very difficult to declare whether the gold nanoparticle is spherical or hemispherical. In summary, highly active iron oxide supported gold catalysts have been prepared through the colloidal deposition method. HAADF-STEM analyses confirmed that for the current catalyst, gold nanoclusters have diameters larger than 1 nm and that bilayer structures and/or diameters of about 0.5 nm are not mandatory to achieve the high activity. A question one may ask is: what is the active gold species in our system? However, this question can not be answered on the basis of the data that we have collected so far. Nevertheless, the influence of the support, especially the goldsupport interaction should probably not be neglected. Actually, in the study of Herzing et al.[9] the major part of the catalytic activity was attributed to very small particles which only comprise about 12 % of the total gold loading, and based on this assumption a TOF of about 3.5 s1 was calculated. In our catalysts, depending on assumptions about the shape of the gold particles and average size, a TOF of 0.51 s1 can be estimated. Thus, although highly active catalysts can be synthesized with gold nanoparticles sized 1 nm and above, there could still be potential for even higher activityif it were possible to synthesize gold-based catalysts with a high loading that exclusively contained very small gold clusters. In fact, we have reported an extremely active gold-based catalyst having a TOF of approximately 1 s1 at temperatures as low as 89 8C,[8d] but due to the instability of the Mg(OH)2 support in the electron beam of the electron microscopy, sufficiently high resolution to either prove or exclude the presence of bilayer gold particles could not be achieved.

Experimental Section
The iron oxide was prepared through a procedure similar to the one reported by Hutchings and co-workers[9] . Typical procedure for the synthesis of iron oxide: an aqueous solution of NaCO3 (0.25 mol L1) was added dropwise to 200 mL of aqueous Fe(NO3)3 (0.1 mol L1) with stirring at 80 8C until the pH value reached 8.2. The precipitate was then recovered by filtration and washing with 1 L of hot deionized water (80 8C). The material was then dried at 120 8C for 16 h. The preparation of the Au/FeOx catalyst by the colloidal deposition method and the catalytic test conditions are the same as described previously.[9] Detailed procedures are outlined in the Supporting Information. BF-STEM and HAADF-STEM images were acquired on a JEMARM200F with a Cs corrector at 200 kV (Cs = 0, convergence angle: 22 mrad, semiangles for HAADF detector: 90170 mrad, image: 512 512 pixels). STEM image simulation was carried out based on the FFT multislice algorithm together with TDS process using xHREM (v 3.0 by HREM Research Inc). Resolutions of HAADFSTEM and BF-STEM images are 0.08 nm and 0.19 nm, respectively. XRD measurements were carried out on a Stoe P diffractometer in transmission geometry with Mo ka1 radiation of 0.70930 . Nitrogen adsorption isotherms of the support was measured using an ASAP 2010 adsorption analyzer (Micromeritics) at liquid nitrogen temperature.
Angew. Chem. 2010, 122, 5907 5911

5910

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Received: January 26, 2010 Revised: May 12, 2010 Published online: July 9, 2010 e) S. Carrettin, P. Concepcin, A. Corma, J. M. Lopez Nieto, V. F. Puntes, Angew. Chem. 2004, 116, 2592; Angew. Chem. Int. Ed. 2004, 43, 2538. a) J. Guzman, B. C. Gates, J. Am. Chem. Soc. 2004, 126, 2672; b) G. J. Hutchings, M. S. Hall, A. F. Carley, P. Landon, B. E. Solsona, C. J. Kiely, A. Herzing, M. Makkee, J. A. Moulijn, A. Overweg, J. C. Fierro-Gonzalez, J. Guzman, B. C. Gates, J. Catal. 2006, 242, 71; c) N. Weiher, E. Bus, L. Delannoy, C. Louis, D. E. Ramaker, J. T. Miller, J. A. van Bokhoven, J. Catal. 2006, 240, 100. a) J. Guzman, S. Carrettin, A. Corma, J. Am. Chem. Soc. 2005, 127, 3286; b) L. M. Liu, B. McAllister, H. Q. Ye, P. Hu, J. Am. Chem. Soc. 2006, 128, 4017; c) X. Y. Deng, B. K. Min, A. Guloy, C. M. Friend, J. Am. Chem. Soc. 2005, 127, 9267; d) C.-J. Jia, Y. Liu, H. Bongard, F. Schth, J. Am. Chem. Soc. 2010, 132, 1520. A. A. Herzing, C. J. Kiely, A. F. Carley, P. Landon, G. J. Hutchings, Science 2008, 321, 1331. a) M. Comotti, W.-C. Li, B. Spliethoff, F. Schth, J. Am. Chem. Soc. 2006, 128, 917; b) M. Comotti, C. Weidenthaler, W.-C. Li, F. Schth, Top. Catal. 2007, 44, 275; c) M. Comotti, C. D. Pina, R. Matarrese, M. Rossi, Angew. Chem. 2004, 116, 5936; Angew. Chem. Int. Ed. 2004, 43, 5812. a) P. D. Nellist, S. J. Pennycook, Science 1996, 274, 413; b) S. N. Rashkeev, A. R. Lupini, S. V. Overbury, S. J. Pennycook, S. T. Pantelides, Phys. Rev. B 2007, 76, 035438; c) J. H. Kwak, J. Hu, D. Mei, C.-W. Yi, D. H. Kim, C. H. F. Peden, L. F. Allard, J. Szanyi, Science 2009, 325, 1670. S. J. Pennycook, D. E. Jesson, Ultramicroscopy 1991, 37, 14. N. Shibata, A. Goto, K. Matsunaga, T. Mizoguchi, S. D. Findlay, T. Yamamoto, Y. Ikuhara, Phys. Rev. Lett. 2009, 102, 136105. a) T. Akita, M. Okumura, K. Tanaka, M. Kohyama, M. Haruta, J. Mater. Sci. 2005, 40, 3101; b) T. Akita, K. Tanaka, M. Kohyama, M. Haruta, Surf. Interface Anal. 2008, 40, 1760.

Chemie

[7]

Keywords: gold heterogeneous catalysis iron nanostructures oxidation

[1] a) M. Haruta, T. Kobayashi, H. Sano, N. Yamada, Chem. Lett. 1987, 405; b) M. Haruta, N. Yamada, T. Kobayashi, S. Lijima, J. Catal. 1989, 115, 301. [2] a) M. Haruta, Gold Bull. 2004, 37, 27; b) G. J. Hutchings, Gold Bull. 2004, 37, 3; c) A. S. K. Hashmi, G. J. Hutchings, Angew. Chem. 2006, 118, 8064; Angew. Chem. Int. Ed. 2006, 45, 7896; d) B. K. Min, C. M. Friend, Chem. Rev. 2007, 107, 2709; e) G. C. Bond, D. T. Thompson, Catal. Rev. Sci. Eng. 1999, 41, 319. [3] a) X. W. Xie, Y. Li, Z.-Q. Liu, M. Haruta, W. J. Shen, Nature 2009, 458, 746; b) P. Landon, J. Ferguson, B. E. Solsona, T. Garcia, A. F. Carley, A. A. Herzing, C. J. Kiely, S. E. Golunski, G. J. Hutchings, Chem. Commun. 2005, 3385. [4] a) S. Tsubota, M. Haruta, T. Kobayashi, A. Ueda, Y. Nakahara, Stud. Surf. Sci. Catal. 1991, 63, 695; b) W.-C. Li, M. Comotti, F. Schth, J. Catal. 2006, 237, 190; c) C. Xu, J. Su, X. Xu, P. Liu, H. Zhao, F. Tian, Y. Ding, J. Am. Chem. Soc. 2007, 129, 42. [5] a) M. S. Chen, D. W. Goodman, Science 2004, 306, 252; b) N. Lopez, T. V. W. Janssens, B. S. Clausen, Y. Xu, M. Mavrikakis, T. Bligaard, J. K. Nrskov, J. Catal. 2004, 223, 232. [6] a) M. M. Schubert, S. Hackenberg, A. C. van Veen, M. Muhler, V. Plzak, R. J. Behm, J. Catal. 2001, 197, 113; b) M. Kotobuki, R. Leppelt, D. A. Hansgen, D. Widmann, R. J. Behm, J. Catal. 2009, 264, 67; c) B. Yoon, H. Hkkinen, U. Landman, A. S. Wrz, J.-M. Antonietti, S. Abbet, K. Judai, U. Heiz, Science 2005, 307, 403; d) S. Carrettin, Y. Hao, V. Aguilar-Guerrero, B. C. Gates, S. Trasobares, J. J. Calvino, A. Corma, Chem. Eur. J. 2007, 13, 7771;

[8]

[9] [10]

[11]

[12] [13] [14]

Angew. Chem. 2010, 122, 5907 5911

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5911

Zuschriften
Electrochemistry
DOI: 10.1002/ange.201001298

Fluorescent Cyclic Voltammetry of Immobilized Azurin: Direct Observation of Thermodynamic and Kinetic Heterogeneity**
Jante M. Salverda, Amol V. Patil, Giulia Mizzon, Sofya Kuznetsova, Gerhild Zauner, Namik Akkilic, Gerard W. Canters, Jason J. Davis,* Hendrik A. Heering, and Thijs J. Aartsma*
The electrochemical analysis of surface-confined metalloproteins has resulted in a significant advance in our knowledge of the kinetic and thermodynamic nuances of biological electron transfer.[1] Surface confinement on a carefully engineered or appropriately modified electrode surface removes diffusion limitations in cyclic voltammetry, facilitates direct imaging or spectroscopic analyses, and requires small quantities of material. However, the associated voltammetric responses are typically nonideal, with broad voltammetric peaks and experiment-to-experiment variation.[2, 3] Such observations have been loosely ascribed to kinetic and thermodynamic dispersion across the surface.[49] A range of causes may contribute to this variation, from lateral molecular interaction, variation in redox-site/electrode electronic coupling, to microenviromental variance in properties such as surface charge or molecular orientation. This dispersion can be studied by taking advantage of the enhanced sensitivity of a newly developed method for monitoring redox-state transitions by fluorescence detection.[1014] Herein, we have used azurin, a well-characterized
[*] Dr. J. M. Salverda, N. Akkilic, Prof. Dr. T. J. Aartsma Leiden Institute of Physics, Leiden University PO Box 9504, 2300 RA Leiden (The Netherlands) Fax: (+ 31) 71-527-5819 E-mail: aartsma@physics.leidenuniv.nl Dr. A. V. Patil, G. Mizzon, Dr. J. J. Davis Department of Chemistry, University of Oxford Physical and Theoretical Chemistry Laboratory South Parks Road, Oxford OX1 3QZ (UK) Fax: (+ 44) 1865-275-410 E-mail: jason.davis@chem.ox.ac.uk Dr. S. Kuznetsova, Dr. G. Zauner, Prof. Dr. G. W. Canters, Dr. H. A. Heering Leiden Institute of Chemistry, Leiden University, Gorlaeus Laboratories PO Box 9502, 2300 RA Leiden (The Netherlands) [**] We are grateful to Laurent Holtzer for technical assistance, to Thyra de Jong, Lionel Ndamba, and Alessio Andreoni for protein purification, and to Ralf Schmauder, Leandro Tabares, Grzegorz Orlowski, and Razvan Stan for helpful discussions. J.M.S. and G.Z. were supported by the Foundation for Fundamental Research on Matter (FOM) and by a Veni grant (J.M.S.) from the Netherlands Organisation for Scientific Research (NWO). S.K. was funded by the program From Molecule to Cell from NWO. N.A. and G.M. were supported by the European Community through the EdRox Network (contract no. MRTN-CT-2006-035649). H.A.H. was funded by a Vidi grant from NWO. A.V.P. was funded by the Leverhulme Trust. The TIRF analyses described herein were carried out within the Nikon Oxford Molecular Imaging Centre (NOMIC). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001298.

14 kDa large protein from P. aeruginosa with a single Cu ion as the redox-active center (see Figure S1 in the Supporting Information).[1523] In its oxidized (Cu2+) form, the protein displays a strong absorption at 630 nm, which is absent in the reduced state. This redox-dependent absorbance change can be monitored in the fluorescence domain by means of a Frster resonance energy transfer (FRET) donoracceptor pair, whereby the redox site is the energy acceptor and an externally linked dye label is the fluorescent donor. We applied fluorescence-detected cyclic voltammetry (FCV) to investigate both a full monolayer of protein (using epifluorescence detection) and a dilute sub-monolayer (using total internal reflection-excited fluorescence; TIRF). Figure 1

Figure 1. Cyclic voltammogram (black) and successive epifluorescent cyclic voltammograms (gray) of Cy5-labeled wt azurin at 100 mVs1 scan rate (4 cycles). The fluorescence change in FCV reflects the change in redox state of the labeled azurin.

shows the conventional cyclic voltammogram and the simultaneously recorded FCV of Cy5-labeled wild-type (wt) azurin adsorbed on gold covered with a hexanethiol self-assembled monolayer (SAM), using epifluorescent detection, at a scan rate of 100 mV s1. Both signals have the shape expected for an immobilized protein at slow voltage scan rate (see sections 13 in the Supporting Information for details). A control analysis with Cy5-labeled redox-inactive Zn-azurin (section 4 in the Supporting Information) confirmed that the fluorescence switching of labeled Cu-azurin is due to the redox transition. FCVs measured at three different scan rates (Figure 2) show that the separation between oxidizing and reducing curves increases with scan rate, which is the same behavior as that for the peak separation in cyclic voltammetry (CV) experiments. The data points in these FCV curves were fitted by ButlerVolmer analysis (sections 57 in the Supporting Information, adapted from Heering et al.[24]).
Angew. Chem. 2010, 122, 5912 5915

5912

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte

Chemie

Figure 3. a) Image from the epifluorescence movie measured at 200 mVs1 scan rate on wt azurin at monolayer coverage. b) Epifluorescent voltammograms for three ROIs of 1.5 pixel radius, selected from the image in (a): ROI 1 = gray line, ROI 2 = black dashed line, ROI 3 = black line.

Figure 2. FCV curves measured at 10 mVs1, 100 mVs1, and 1 Vs1 showing scan-rate dependence.

From the scan-rate dependence of both CV and FCV, values for the midpoint potential E0, electron-transfer rate constant k0, and unusual quasi-reversibility UQR[25] were thus obtained (section 5 in the Supporting Information; Table 1).
Table 1: Fit parameters E0, k0, and UQR for CV and FCV. Dataset CV FCV E0 [mV][a] 44 28 k0 [s1][b] 67 21 UQR[c] 9.7 (1.0) 9.7 (fixed)

[a] Midpoint potential vs. SCE. [b] Standard electron-transfer rate constant. [c] Unusual quasi reversibility.

The kinetics of electron transfer determined by FCV are in reasonable agreement with those determined by CV.[2123] The observed differences in k0 values can be explained by the presence of heterogeneity in the electron-transfer rate. Owing to the bias of fluorescence detection towards proteins that are more weakly electronically coupled to the electrode (where fluorescence emission is less quenched), such heterogeneity results in a lower average rate in the optical sampling relative to the purely voltammetric results. Heterogeneity is evident in the variance in fluorescence intensity across the surface (Figure 3 a), which is typical for monolayer coverage. At low coverage, this variance is even more pronounced (section 2 in the Supporting Information). In Figure 3 b, three FCV cycles of diffraction-limited spots (region-of-interest, or ROI, size % 300 nm) show a large dispersion in the separation between the reducing and oxidizing curves, which is an observation diagnostic of a large dispersion in interfacial electron-transfer kinetics. We quantified the kinetic and thermodynamic dispersion by constructing FCV cycles for over 200 such diffractionlimited ROIs at a range of scan rates. A ROI contains 500 3000 and 100450 fluorescently labeled proteins for highcoverage and low-coverage samples, respectively (calculations in section 8 of the Supporting Information), which demonstrates an unprecedented molecular-scale electroAngew. Chem. 2010, 122, 5912 5915

chemical analysis. The results of fitting all ROI FCV cycles with ButlerVolmer curves are summarized in the histograms in Figure 4 ad (see also sections 5 and 6 in the Supporting Information). The dispersions of E0 and k0 values are different for high and low protein coverage. In the former, we find a small spread in E0 values (Figure 4 a), which is dominated by noise (see section 9 in the Supporting Information), whereas significant dispersion is evident in the low-coverage data. The k0 distributions show a high dispersion in both datasets (Figure 4 c,d), but there is a qualitative difference between them. The low-coverage distribution is more asymmetric and contains a larger contribution from low electron-transfer rates (which is consistent with a data bias towards weakly coupled proteins). The large k0 dispersion at low coverage may be due to variation in the orientation of the protein with respect to the surface as well as to microscopic variation in the Au surface properties (local surface charges etc., that is, microenvironmental variance[5]). At these coverages, AFM and confocal analyses are consistent with significant molecular aggregation (data not shown). We propose that the analyzed kinetic distribution becomes biased towards faster k0 values as surface coverage and film order increases (and there is a reduced weighting of the contribution from the aggregated forms, where k0 is likely to be lower; Figure 4 c,d). As for E0, at low coverage, the microenvironmental variance will strongly affect the midpoint potential and therefore the observed dispersion in E0 values. At high molecular coverage, the effect of microenvironmental variance will be damped by sampling more molecules per ROI. It is of interest to compare the present results with what is known from bulk measurements on electron transfer (ET) within proteinprotein complexes and on ET between proteins and SAM-coated electrodes. As for the thermodynamics of the ET process, it is known that proteinprotein or proteinelectrode interactions can lead to significant modulation in the expressed half-wave potential within a range of 100 mV.[2629] Haehnel and co-workers[29] have, for example, convincingly argued that the electric field exerted by a protein at the site of the redox-active cofactor of the partner protein may account for the observed variations in the midpoint potential. Immobilization of a protein on a SAM-covered Au electrode may lead to changes of the same order of www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5913

Zuschriften
regime applies with an exponential (bR) distance dependence for the ET rate. At shorter distances, the rate becomes independent of SAM thickness,[21, 23, 3841] either because the adiabatic limit now applies and the ET becomes friction controlled or because the protein has to reorient to reach an alignment with respect to the Au SAM surface that is conducive for ET to or from the electrode.[30, 42] From studies on azurin and cytochrome c immobilized on a Au/hexanethiol SAM, the ET was found to be gated by protein reorientation.[23, 43] In our experiments, we found that from one ROI to another there is appreciable variation in the value of k0. This variation most likely reflects inhomogeneity of the tunneling barrier as a result of orientational flexibility. This must depend on parameters other than the electric field variation, which is responsible for the variation in E0, since its value is averaged out at higher coverage. It is conceivable that differences in solvation and also in (local) coverageFigure 4. a) Histogram of midpoint potential values E0 = (Ep,ox + Ep,red)/2 obtained and orientation-dependent lateral proteinprofrom all epifluorescence ROI FCV curves showing a 14 mV spread (FWHM) around tein interactions are critical in this respect. an average of 28 mV. Bin values on the x axis refer to the upper limit of the bin range In summary, we have demonstrated that the for all histograms shown. b) Histogram of midpoint potential values E0 obtained redox states of appropriately tagged surfacefrom all TIRF ROI FCV curves showing a 70 mV spread (FWHM) around an average immobilized blue copper proteins can be optically of 16 mV. c) Histogram of standard electron-transfer rate constants k0 obtained from sampled down to levels of a few hundred moleall epifluorescence ROI FCV curves showing values ranging from 0.1 s1 to 200 s1. cules, a sensitivity which is unprecedented for d) Histogram of standard electron-transfer rate constants k0 obtained from all TIRF ROI FCV curves showing values clustering between 0.5 and 2 s1 with a high-k0 tail electrochemistry on a macroscopic surface. The up to 100 s1. thermodynamic midpoint potential was found to vary by tens of millivolts across the electrode surface, and the standard electron-transfer rate constant by more than a factor of 100. Furthermore, evidence magnitude. Murgida and Hildebrandt[30] have shown that the for different types of heterogeneity was obtained by comparelectric field at the boundary between solvent and SAM may ing high- and low-coverage data. To the best of our knowlbe in the order of 10100 mV 1 and may lead to similar edge, the analysis herein constitutes the first direct observachanges in the midpoint potential of a redox protein that tion of both kinetic and thermodynamic dispersion in a becomes immobilized on the SAM. In addition, the dielectric protein film on an electrode surface at a molecular scale of constant of the ET medium may be affected by the expulsion sampling. of water from the interface, and this may also influence the value of E0.[2931] The dispersion in the values of E0 that we observe for the low-coverage data has a similar range (70 mV full width at half maximum; FWHM) as the mentioned values.[29, 30] This result is ascribed to variations in the electric Experimental Section field that result from discontinuities or imperfections in the Sample preparation: Preparation and purification of wild-type and N42C azurin were carried out as previously described.[44] Wild-type SAM or the underlying Au surface. (wt) azurin and zinc-reconstituted wt azurin were labeled on the The kinetics of ET are strikingly similar between protein N terminus as described by Kuznetsova et al.[12] The labeling ratio was protein and protein/AuSAM data. It has been argued that 0.16. N42C azurin was prepared similarly (see section 10 in the ET within productive protein ET complexes occurs in the Supporting Information). The labeling ratio for the N42C sample Marcus non-adiabatic limit and requires the formation of a used was 0.55. specific complex.[3234] The encounter complex between two Sample immobilization and electrode preparation: The working proteins, however, may require mutual reorientation of the electrode consisted of a semitransparent gold layer of 10 nm thickness deposited on a glass coverslip [1 inch (25.4 mm) diameter, thickness partners to reach the ET-competent configuration. Depend0.140.17 mm (#1), Menzel]. Thin gold films were prepared either by ing on the details of the protein surfaces and the protein RF sputtering (ATC 1800F, AJA International) or evaporation protein energy landscape,[3537] this step may become rate(Edward Auto 306 cryo evaporator). Sputtering was performed as [30, 3234] limiting. described by van Baarle et al.[45] Azurin was immobilized on the The rate of electron transfer between an ET protein and a working electrode through a self-assembling monolayer (SAM) of 1SAM-coated Au electrode has been investigated as a function hexanethiol (wt azurin) or 1-octanethiol (zinc azurin and N42C). For of the SAM thickness. At large distances, the non-adiabatic more details see section 11 in the Supporting Information.

5914

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5912 5915

Angewandte
Fluorescent electrochemistry setup: Measurements on wt azurin were performed with a wide-field epifluorescence microscopy setup (Zeiss Axiovert 200, Plan Apo 100X oil). A total internal reflection fluorescence (TIRF) setup (Nikon 2000-E, TIRF 100x Plan Apo oil) was used to perform FCV of immobilized N42C azurin at a surface coverage below the classical CV detection limit. Cy5 excitation was provided by a red diode laser (639 nm, Power Technology Inc., IQ1A30) for epifluorescence and by a HeNe laser (Model 1135, 20 mW, 633 nmn, JD Uniphase) for TIRF. Fluorescence was detected with a Peltier-cooled CCD camera (Cascade 512 X, Roper Scientific) or a back illuminated iCCD camera (iXon 885 EMCCD, Andor, Belfast, Northern Ireland), respectively. In both cases, fluorescence was measured in a series of images (a movie) at fixed potential intervals (more details and a setup scheme in section 12 of the Supporting Information). Electrochemistry: A copper wire connected the working electrode to a potentiostat (CH Instruments, model Chi832b, for epifluorescence, m-Autolab, Eco Chemie, for TIRF). A Pt wire or Pt gauze counter electrode and saturated calomel (SCE) reference electrode (Radiometer Analytical/BASI) were inserted into a buffer droplet of approximately 100 mL on top of the immobilized protein film. CV scans were measured at rates of 10 mV s1 to 10 V s1, in potential steps of 1 mV. CV scanning was combined with epifluorescence detection up to 1 V s1 scan rate. TIRF FCV was measured at scan rates between 25 mV s1 and 600 mV s1. Received: March 4, 2010 Revised: April 27, 2010 Published online: July 13, 2010 [17] H. Nar, A. Messerschmidt, R. Huber, M. Vandekamp, G. W. Canters, J. Mol. Biol. 1991, 221, 765 772. [18] F. A. Armstrong, H. A. Heering, J. Hirst, Chem. Soc. Rev. 1997, 26, 169 179. [19] U. Kolczak, C. Dennison, A. Messerschmidt, G. W. Canters in Handbook of Metalloproteins (Eds.: A. Messerschmidt, R. Huber, T. Poulos, K. Wieghardt), Wiley, Chichester 2001, pp. 1170 1194. [20] I. M. C. van Amsterdam, M. Ubbink, O. Einsle, A. Messerschmidt, A. Merli, D. Cavazzini, G. L. Rossi, G. W. Canters, Nat. Struct. Biol. 2002, 9, 48 52. [21] J. J. Davis, D. Bruce, G. W. Canters, J. Crozier, H. A. O. Hill, Chem. Commun. 2003, 576 577. [22] J. Zhang, S. X. Guo, A. M. Bond, M. J. Honeychurch, K. B. Oldham, J. Phys. Chem. B 2005, 109, 8935 8947. [23] Q. J. Chi, O. Farver, J. Ulstrup, Proc. Natl. Acad. Sci. USA 2005, 102, 16203 16208. [24] H. A. Heering, M. S. Mondal, F. A. Armstrong, Anal. Chem. 1999, 71, 174 182. [25] S. W. Feldberg, I. Rubinstein, J. Electroanal. Chem. 1988, 240, 1 15. [26] J. M. Smith, W. H. Smith, D. B. Knaff, Biochim. Biophys. Acta Bioenerg. 1981, 635, 405 411. [27] C. J. Batie, H. Kamin, J. Biol. Chem. 1981, 256, 7756 7763. [28] K. A. Gray, V. L. Davidson, D. B. Knaff, J. Biol. Chem. 1988, 263, 13 987 13 990. [29] F. Drepper, M. Hippler, W. Nitschke, W. Haehnel, Biochemistry 1996, 35, 1282 1295. [30] D. H. Murgida, P. Hildebrandt, Chem. Soc. Rev. 2008, 37, 937 945. [31] L. Rivas, C. M. Soares, A. M. Baptista, J. Simaan, R. E. Di Paolo, D. H. Murgida, P. Hildebrandt, Biophys. J. 2005, 88, 4188 4199. [32] P. B. Crowley, M. Ubbink, Acc. Chem. Res. 2003, 36, 723 730. [33] P. B. Crowley, M. A. Carrondo, Proteins Struct. Funct. Bioinf. 2004, 55, 603 612. [34] M. Prudncio, M. Ubbink, J. Mol. Recognit. 2004, 17, 524 539. [35] B. M. Hoffman, L. M. Celis, D. A. Cull, A. D. Patel, J. L. Seifert, K. E. Wheeler, J. Y. Wang, J. Yao, I. V. Kurnikov, J. M. Nocek, Proc. Natl. Acad. Sci. USA 2005, 102, 3564 3569. [36] K. E. Wheeler, J. M. Nocek, D. A. Cull, L. A. Yatsunyk, A. C. Rosenzweig, B. M. Hoffman, J. Am. Chem. Soc. 2007, 129, 3906 3917. [37] P. Xiong, J. M. Nocek, A. K. K. Griffin, J. Y. Wang, B. M. Hoffman, J. Am. Chem. Soc. 2009, 131, 6938 6939. [38] Z. Qing Feng, S. Imabayashi, T. Kakiuchi, K. Niki, J. Chem. Soc. Faraday Trans. 1997, 93, 1367 1370. [39] A. Avila, B. W. Gregory, K. Niki, T. M. Cotton, J. Phys. Chem. B 2000, 104, 2759 2766. [40] K. Fujita, N. Nakamura, H. Ohno, B. S. Leigh, K. Niki, H. B. Gray, J. H. Richards, J. Am. Chem. Soc. 2004, 126, 13954 13961. [41] H. J. Yue, D. Khoshtariya, D. H. Waldeck, J. Grochol, P. Hildebrandt, D. H. Murgida, J. Phys. Chem. B 2006, 110, 19906 19913. [42] D. E. Khoshtariya, T. D. Dolidze, M. Shushanyan, K. L. Davis, D. H. Waldeck, R. van Eldik, Proc. Natl. Acad. Sci. USA 2010, 107, 2757 2762. [43] D. H. Murgida, P. Hildebrandt, Acc. Chem. Res. 2004, 37, 854 861. [44] M. van de Kamp, F. C. Hali, N. Rosato, A. F. Agro, G. W. Canters, Biochim. Biophys. Acta Bioenerg. 1990, 1019, 283 292. [45] G. J. C. van Baarle, A. M. Troianovski, T. Nishizaki, P. H. Kes, J. Aarts, Appl. Phys. Lett. 2003, 82, 1081 1083.

Chemie

Keywords: cyclic voltammetry electrochemistry fluorescence metalloproteins monolayers

[1] P. Yeh, T. Kuwana, Chem. Lett. 1977, 1145 1148. [2] A. P. Brown, F. C. Anson, Anal. Chem. 1977, 49, 1589 1595. [3] D. F. Smith, K. Willman, K. Kuo, R. W. Murray, J. Electroanal. Chem. 1979, 95, 217 227. [4] G. K. Rowe, M. T. Carter, J. N. Richardson, R. W. Murray, Langmuir 1995, 11, 1797 1806. [5] R. A. Clark, E. F. Bowden, Langmuir 1997, 13, 559 565. [6] Z. Zhang, J. F. Rusling, Biophys. Chem. 1997, 63, 133 146. [7] J. Hirst, F. A. Armstrong, Anal. Chem. 1998, 70, 5062 5071. [8] L. J. C. Jeuken, F. A. Armstrong, J. Phys. Chem. B 2001, 105, 5271 5282. [9] C. Lger, A. K. Jones, S. P. J. Albracht, F. A. Armstrong, J. Phys. Chem. B 2002, 106, 13 058 13 063. [10] R. Schmauder, S. Alagaratnam, C. Chan, T. Schmidt, G. W. Canters, T. J. Aartsma, J. Biol. Inorg. Chem. 2005, 10, 683 687. [11] R. Schmauder, F. Librizzi, G. W. Canters, T. Schmidt, T. J. Aartsma, ChemPhysChem 2005, 6, 1381 1386. [12] S. Kuznetsova, G. Zauner, R. Schmauder, O. A. Mayboroda, A. M. Deelder, T. J. Aartsma, G. W. Canters, Anal. Biochem. 2006, 350, 52 60. [13] J. J. Davis, H. Burgess, G. Zauner, S. Kuznetsova, J. Salverda, T. Aartsma, G. W. Canters, J. Phys. Chem. B 2006, 110, 20649 20654. [14] S. Kuznetsova, G. Zauner, T. J. Aartsma, H. Engelkamp, N. Hatzakis, A. E. Rowan, R. J. M. Nolte, P. C. M. Christianen, G. W. Canters, Proc. Natl. Acad. Sci. USA 2008, 105, 3250 3255. [15] C. M. Groeneveld, G. W. Canters, J. Biol. Chem. 1988, 263, 167 173. [16] M. Van de Kamp, R. Floris, F. C. Hali, G. W. Canters, J. Am. Chem. Soc. 1990, 112, 907 908.

Angew. Chem. 2010, 122, 5912 5915

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5915

Zuschriften
Asymmetric Catalysis
DOI: 10.1002/ange.201001883

Rhodium-Catalyzed Asymmetric Conjugate Addition of Organoboronic Acids to Nitroalkenes Using Chiral Bicyclo[3.3.0] Diene Ligands**
Zhi-Qian Wang, Chen-Guo Feng, Shu-Sheng Zhang, Ming-Hua Xu,* and Guo-Qiang Lin*
In recent years, the use of transition-metal-catalyzed reactions have been an important and general method in carbon carbon and carbonheteroatom bond-forming synthesis.[1] Among them, the rhodium-catalyzed asymmetric conjugate addition of organoboronic acids to electron-deficient olefins, pioneered by Miyaura, Hayashi, and co-workers,[2] has been established as one of the most powerful and convenient tools for the enantioselective synthesis of b-substituted functionalized compounds. In particular, excellent results were achieved in the addition to a,b-unsaturated carbonyl compounds.[3] However, despite the great synthetic importance of nitro compounds,[4] it is surprising that far fewer studies reported the efficient asymmetric addition of boronic acids to nitroalkenes, most likely because of the difficulty in controlling the reaction stereoselectivity.[5] In fact, high enantioselectivities were only achieved by the Hayashi group in the asymmetric addition of organoboronic acids to a-substituted 1-nitroalkenes using a rhodium/binap (binap = 2,2-bis(diphenylphosphanyl)-1,1 -binaphthyl) catalyst.[6] In other reports,[7] low levels of enantiomeric enrichment (< 50 % ee) were often observed with general 1-nitroalkene substrates that lack a substitutents. Therefore, the development of a capable catalyst system for efficient asymmetric boronic acid addition to nitroalkenes is highly desirable. Herein, we report our preliminary results on the rhodium-catalyzed asymmetric addition of organoboronic acids to nitroalkenes that lack a substitutents; high enantiocontrol is afforded using chiral bicyclo[3.3.0] diene ligands. In 2007, we reported our discovery of a new family of C2symmetric chiral diene ligands bearing a simple bicyclo[3.3.0] backbone; these ligands were successfully applied in the rhodium-catalyzed enantioselective arylation of N-tosylarylimines and the 1,4-addition of arylboronic acids to a,bunsaturated carbonyl compounds under mild conditions.[8] Inspired by these successes, we wondered whether these rhodium/diene complexes could also act as effective catalysts for the asymmetric addition of boronic acids to nitroalkenes. In spite of the recent significant advances, there has been no report on the use of chiral diene ligands[9] in this field. Our initial investigation was carried out by examining the reaction of nitrostyrene 2 with para-anisylboronic acid (3) in the presence of chiral diene ligand 1 a (3 mol %) under the reaction conditions previously reported[8a] for the arylation of N-tosylarylimines with arylboronic acids (Scheme 1). How-

Scheme 1. Initial attempts on using bicyclo[3.3.0] diene ligand.

[*] Z.-Q. Wang, C.-G. Feng, S.-S. Zhang, Prof. Dr. M.-H. Xu, Prof. G.-Q. Lin Key Laboratory of Synthetic Chemistry of Natural Substances Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences 345 Lingling Road, Shanghai 200032 (China) Fax: (+ 86) 21-5080-7388 E-mail: xumh@mail.sioc.ac.cn lingq@mail.sioc.ac.cn Prof. Dr. M.-H. Xu Shanghai Institute of Materia Medica, Chinese Academy of Sciences 555 Zuchongzhi Road, Shanghai 201203 (China) [**] We thank the National Natural Science Foundation of China, the Chinese Academy of Sciences, the Shanghai Municipal Committee of Science and Technology (09JC1417300, 08QH14027), and the Major State Basic Research Development Program (2010CB833302) for their generous financial support. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001883.

ever, the result was disappointing. The addition product 4 a was obtained in only 9 % yield, albeit with moderate enantioselectivity (40 %), and a large amount of starting material 2 was recovered. Considering the known catalytic cycle for the 1,4-addition of organoboron reagents to activated alkenes,[10] it is likely that the low yield can be attributed to poor catalyst regeneration from its rhodium nitronate intermediate in the hydrolysis step. Indeed, we were pleased to find that the reaction provided much better yield (70 %) and enantioselectivity (68 %) when performed in the presence of a stoichiometric amount of rhodium/1 a catalyst. This result indicates the possibility of related asymmetric catalysis by new chiral rhodium/diene complex. A potential solution to the catalyst regeneration problem could be by tuning the reaction conditions. To achieve an efficient catalytic process, the reaction conditions were carefully screened. One concern was that the in situ generation of the rhodium/diene catalyst would be facilitated by acidic conditions. After extensive studies, we found that the expected catalytic cycle took place when potassium acid fluoride (KHF2) was employed in the reaction (Table 1). Further optimization of the conditions led to the
Angew. Chem. 2010, 122, 5916 5919

5916

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Table 1: Exploration and optimization of the conjugate addition reaction.

Chemie

Entry[a] 1 2 3 4 5 6 7

3 [equiv] 1.1 1.5 1.5 1.5 1.5 1.5 1.5[d]

KHF2 [equiv] 5 5 3 2 1 0 0

t [h] 14 14 1 1 1 19 1

Yield [%][b] 76 97 98 96 92 60 91

ee [%][c] 68 68 70 70 70 68 69

Scheme 2. Proposed reaction mechanism.

[a] The reaction was carried out on a 0.5 mmol scale with [{RhCl(C2H4)2}2] (0.0075 mmol), diene 1 g (0.0165 mmol, 1.1 equiv to Rh) in toluene/H2O at 100 8C. [b] Yield of isolated product. [c] Determined by chiral HPLC analysis. [d] The corresponding trifluoroborate p-MeOC6H4BF3K was used.

formation of addition product in 98 % yield and 70 % ee when nitrostyrene 2 was treated with a small excess of paraanisylboronic acid (1.5 equiv) in the presence of 3 equivalents of KHF2 in toluene/water (10:1) at 100 8C for 1 hour by the catalysis of rhodium/1 a (3 mol %; Table 1, entry 3). Since KHF2 in aqueous conditions can react with organoboronic acids to generate potassium organotrifluoroborates,[11, 12] which are also capable of transmetalation with rhodium for addition reactions to unsaturated substrates, we speculated that the transformation was actually promoted by an organotrifluoroborate species formed in situ. To better understand the reaction, several control experiments were performed. It was found that the direct use of the corresponding potassium trifluoroborate (p-MeOC6H4BF3K) in the presence of water did give comparable results (91 % yield, 69 % ee ; Table 1, entry 7). In contrast, a significant decrease in the reaction rate was observed using boronic acid under identical conditions (Table 1, entry 6). The presence of excess KHF2 also had a detrimental effect on the reaction rate (Table 1, entries 1 and 2). In line with most 1,4-addition processes, a small amount of water was essential for good conversion, and almost no reaction occurred under anhydrous conditions. Although the exact mechanism remains unclear, and the possibility of an equilibrium between the fluoroborate and the boronic acid is not ruled out, these results may suggest a pathway of fast transmetalation between the rhodium nitronate (A/A) and the relevant organoborate intermediate (B/C) benefited by hydrolysis of potassium organotrifluoroborate (Scheme 2). It is worth noting that the fluoride ions may also play an important role in stabilizing the various catalytic intermediates.[13] With the catalytic system developed, we then focused our efforts on the use of different chiral diene ligands to attain excellent enantioselectivity. A series of bicyclo[3.3.0] dienes with various R substituents were evaluated (Scheme 3). In most cases, the reaction proceeded smoothly under the catalysis of rhodium/1. The enantioselectivity could be increased to 78 % by using 2-naphthyl-substituted diene 1 g as the ligand. We also tested the use of an (R)-binap ligand
Angew. Chem. 2010, 122, 5916 5919

Scheme 3. Evaluation of catalytic activities of chiral diene ligands. n.r. = no reaction.

under same conditions; however, only trace amounts of product was observed. As the catalytic asymmetric addition of organoboronic acids to a-unsubstituted nitroalkenes with high enantiocontrol remains unprecedented,[14] this result represents a rather promising achievement. To explore the scope of this rhodium/diene catalyzed process, a variety of boronic acids with diverse steric and electronic properties were tested with aliphatic and aromatic nitroalkenes (Table 2). Under the optimized conditions, we were pleased to find that the addition reactions universally gave the expected products in very high yields and moderate to good ee values. Excellent enantioselectivities (9597 %) were observed in the cases using sterically more hindered arylboronic acids, such as 1-naphthylboronic acid and 2tolylboronic acid (Table 2, entries 8, 10, 12, and 14). The electron-withdrawing group on the phenyl ring of the boronic acids was helpful for obtaining high enantioselectivity (Table 2, entries 24). In contrast, the electronic properties of the substituent on the phenyl ring of the substrates did not seem to affect the reaction stereoselectivity significantly (Table 2, entries 8 and 1113). More interestingly, when aliphatic 2-nitrovinylcyclohexane was subjected to the conjugate addition with 4-anisylboronic acid, the same level of enantioselectivity was observed (Table 2, entry 16). The use of linear nitroolefin 1-nitrohexene as the substrate resulted in appreciably lower enantioselectivity compared to 2-nitrovinylcyclohexane; however, a dramatic increase in the selectivity was obtained when sterically encumbered 2tolylboronic acid was employed (Table 2, entries 17 and 18). It is worth noting that these results are among the best in the asymmetric addition of organoboronic acids to nitroalkenes www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5917

Zuschriften
Table 2: Asymmetric conjugate addition to nitroalkenes catalyzed by [Rh]/1 g.

Entry[a] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

R Ph Ph Ph Ph Ph Ph Ph Ph Ph Ph 4-MeOC6H4 4-MeOC6H4 4-ClC6H4 4-ClC6H4 1-Np C6H11 nBu nBu

Ar 4-MeOC6H4 4-FC6H4 4-ClC6H4 4-BrC6H4 4-MeC6H4 4-tBuC6H4 3-ClC6H4 2-MeC6H4 2-Np 1-Np Ph 2-MeC6H4 Ph 2-MeC6H4 Ph 4-MeOC6H4 4-MeOC6H4 2-MeC6H4

4 4a 4b 4c 4d 4e 4f 4g 4h 4i 4j 4 a 4k 4 c 4l 4 j 4m 4n 4o

Yield [%][b] 96 96 92 91 95 92 99 85 99 92 99 85 95 97 99 90 81 95

ee [%][c] 78 (R) 89 (R) 92 (R) 92 (R) 81 (R) 81 (R) 92 (R) 97 (R) 84 (R) 95 (R) 89 (S) 97 (R) 82 (S) 97 (R) 85 (S) 84 (R) 61 (R) 86 (R)

fluorophenyl)-6,7-dimethoxy-3,4-dihydroisoquinoline (7) in good yield in three steps. In summary, we have developed a rhodium-diene catalyzed asymmetric conjugate addition of organoboronic acids to challenging a-unsubstituted nitroalkene substrates, for which chiral bicyclo[3.3.0] dienes were identified as superior ligands. Under optimal conditions, the reaction proceeds with high enantioselectivity to give a broad range of synthetically useful chiral b,b-disubstituted nitroalkanes. The simple use of boronic acids in combination with potassium acid fluoride as reactive organoboron reagents is a promising alternative to organotrifluoroborates in transition-metal-catalyzed reactions. Further investigation on the reaction mechanism as well as extensions of this new reaction system are underway in our laboratories.

Experimental Section
General procedure for the asymmetric conjugate addition reaction (Table 2): Under a nitrogen atmosphere, a mixture of [{RhCl(C2H4)2}2] (2.9 mg, 0.007 mmol), diene ligand 1 g (6.0 mg, 0.023 mmol), and arylboronic acid (0.75 mmol) in toluene (1 mL) was stirred at 60 8C for 30 min. Then nitroalkene (0.5 mmol) in toluene (1 mL) and aqueous KHF2 (3.0 m , 0.5 mL) were added successively. After being heated to reflux at 100 8C for 47 h, the reaction was cooled to room temperature and water (20 mL) was added. The mixture was extracted with ethyl acetate and the combined organic phases were washed with brine and dried over anhydrous Na2SO4. After being concentrated under reduced pressure, the residue was purified by column chromatography on silica gel to afford the desired product 4. Received: March 30, 2010 Revised: April 22, 2010 Published online: July 7, 2010

[a] The reaction was carried out on a 0.5 mmol scale with 1.5 equiv of arylboronic acid, [{RhCl(C2H4)2}2] (0.0075 mmol), diene 1 g (0.0165 mmol, 1.1 equiv to Rh), and 3 equiv of KHF2 in toluene/H2O at 100 8C for 47 h. [b] Yield of isolated product. [c] Determined by chiral HPLC analysis. Np = napthyl.

that lack a substitutents. Gratifyingly, the stereochemistry of the newly formed stereogenic center of product 4 d (Table 2, entry 4) was determined to be R by X-ray crystallography.[15] Assuming an analogous reaction mechanism, the absolute configuration of the products obtained was assigned as indicated in the table. To further demonstrate the synthetic utility of this methodology, the transformation of nitroalkene 5 into pharmaceutically interesting isoquinoline derivative 7 was also carried out (Scheme 4). The enantioselective addition of 4-furophenylboronic acid to 5 in the presence of a rhodium/1 g catalyst afforded product 4 p in 99 % yield with 91 % ee. Raney nickel reduction followed by formamide formation provided the intermediate 6, which underwent Bischler Napieralski cyclization to form optically active (S)-4-(4-

Keywords: asymmetric catalysis diene ligands conjugate addition nitroalkenes rhodium

Scheme 4. Synthesis of isoquinoline derivative 7.

[1] a) Transition Metals for Organic Synthesis (Eds.: M. Beller, C. Bolm), Wiley-VCH, Weinheim, 2004 ; b) Multimetallic Catalysts in Organic Synthesis (Eds.: M. Shibasaki, Y. Yamamoto), WileyVCH, Weinheim, 2004 ; c) Transition Metal Catalysed Reactions (Eds.: S. Murahashi, S. G. Davies), Blackwell Science, Oxford, 1999. [2] a) M. Sakai, H. Hayashi, N. Miyaura, Organometallics 1997, 16, 4229; b) Y. Takaya, M. Ogasawara, T. Hayashi, M. Saskai, N. Miyaura, J. Am. Chem. Soc. 1998, 120, 5579. [3] For reviews, see: a) T. Hayashi, Synlett 2001, 879; b) K. Fagnou, M. Lautens, Chem. Rev. 2003, 103, 169; c) T. Hayashi, K. Yamasaki, Chem. Rev. 2003, 103, 2829; d) J. Christoffers, G. Koripelly, A. Rosiak, M. Rssle, Synthesis 2007, 1279; e) T. Hayashi, K. Yoshida in Modern Rhodium-Catalyzed Organic Reactions (Eds.: P. A. Evans), Wiley-VCH, Weinheim, 2004, pp. 55 78. [4] N. Ono, The Nitro Group in Organic Synthesis, Wiley-VCH, Weinheim, 2001. [5] For selected other alternative asymmetric approaches to the related products, see: a) O. M. Berner, L. Tedeschi, D. Enders, Eur. J. Org. Chem. 2002, 1877; b) H. Schfer, D. Seebach, Tetrahedron 1995, 51, 2305; c) A. Alexakis, C. Benhaim, S. Rosset, M. Humam, J. Am. Chem. Soc. 2002, 124, 5262; d) D. Polet, A. Alexakis, Tetrahedron Lett. 2005, 46, 1529; e) A.
Angew. Chem. 2010, 122, 5916 5919

5918

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Duursma, A. J. Minnaard, B. L. Feringa, J. Am. Chem. Soc. 2003, 125, 3700; f) D. M. Mampreian, A. H. Hoveyda, Org. Lett. 2004, 6, 2829; g) T. Ishii, S. Fujioka, Y. Sekiguchi, H. Kotsuki, J. Am. Chem. Soc. 2004, 126, 9558; h) H. Li, Y. Wang, L. Tang, L. Deng, J. Am. Chem. Soc. 2004, 126, 9906; i) C. Czekelius, E. M. Carreira, Angew. Chem. 2003, 115, 4941; Angew. Chem. Int. Ed. 2003, 42, 4793; j) C. Czekelius, E. M. Carreira, Org. Lett. 2004, 6, 4575; k) A. Ct, V. N. G. Lindsay, A. B. Charette, Org. Lett. 2007, 9, 85; l) N. J. A. Martin, L. Ozores, B. List, J. Am. Chem. Soc. 2007, 129, 8976. T. Hayashi, T. Senda, M. Ogasawara, J. Am. Chem. Soc. 2000, 122, 10716. a) J.-G. Boiteau, R. Imbos, A. J. Minnaard, B. L. Feringa, Org. Lett. 2003, 5, 681; b) A. Duursma, R. Hoen, J. Schuppan, R. Hulst, A. J. Minnaard, B. L. Feringa, Org. Lett. 2003, 5, 3111; c) A. Duursma, D. Pea, A. J. Minnaard, B. L. Feringa, Tetrahedron: Asymmetry 2005, 16, 1901. a) Z.-Q. Wang, C.-G. Feng, M.-H. Xu, G.-Q. Lin, J. Am. Chem. Soc. 2007, 129, 5336; b) C.-G. Feng, Z.-Q. Wang, P. Tian, M.-H. Xu, G.-Q. Lin, Chem. Asian J. 2008, 3, 1511; c) C.-G. Feng, Z.-Q. Wang, C. Shao, M.-H. Xu, G.-Q. Lin, Org. Lett. 2008, 10, 4101. For pioneering work on chiral diene ligands in asymmetric catalysis, see: a) T. Hayashi, K. Ueyama, N. Tokunaga, K. Yoshida, J. Am. Chem. Soc. 2003, 125, 11508; b) C. Fischer, C. Defieber, T. Suzuki, E. M. Carreira, J. Am. Chem. Soc. 2004, 126, 1628; For reviews, see: c) F. Glorius, Angew. Chem. 2004, 116, 3444; Angew. Chem. Int. Ed. 2004, 43, 3364; d) C. Defieber, H. Grtzmacher, E. M. Carreira, Angew. Chem. 2008, 120, 4558; Angew. Chem. Int. Ed. 2008, 47, 4482; e) R. Shintani, T. Hayashi, Aldrichimica Acta 2009, 42, 31. T. Hayashi, M. Takahashi, Y. Takaya, M. Ogasawara, J. Am. Chem. Soc. 2002, 124, 5052, and Ref. [3b,e]. E. Vedejs, R. W. Chapman, S. C. Fields, S. Lin, M. R. Schrimpf, J. Org. Chem. 1995, 60, 3020. For recent reviews on organotrifluoroborates, see: a) G. A. Molander, R. Figueroa, Aldrichimica Acta 2005, 38, 49; b) G. A. Molander, N. Ellis, Acc. Chem. Res. 2007, 40, 275; c) H. A. Stefani, R. Cella, A. S. Vieira, Tetrahedron 2007, 63, 3623; d) S. Darses, J.-P. Genet, Chem. Rev. 2008, 108, 288. The use of KF as additive in the boronic acid addition reaction was also examined; the reaction did not give any products, even at 55 8C, thus suggesting that the fluoride ion itself is not helpful for a smooth reaction process. In the work by Hayashi and co-workers (Ref. [6]), it was mentioned that the asymmetric addition of phenylboronic acid to (E)-1-nitro-3,3-dimethylbutene catalyzed by Rh/binap could give the corresponding product with 99 % ee ; however, the yield was not ideal in only 5 %. In our hands, when aromatic substrate (E)-1-chloro-4-(2-nitrovinyl)benzene was subjected to addition with phenylboronic acid under their conditions, a low yield (16 %) as well as enantioselectivity (8 % ee) was observed. See the Supporting Information for details. CCDC 770554 (4 d) contains the supplementary crystallographic data for this paper. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_ request/cif.

Chemie

[10] [11] [12]

[6] [7]

[13]

[14]

[8]

[9]

[15]

Angew. Chem. 2010, 122, 5916 5919

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5919

Zuschriften
Oxaplatinacycles
DOI: 10.1002/ange.201001937

Cleavage of CS and OH Bonds by Platinum(0) Complexes To Give Five-Membered 1,2-Oxaplatinacycles**


Norio Nakata, Noriyuki Furukawa, Tomoyuki Toda, and Akihiko Ishii*
CS bonds are known to be efficiently activated by transition metals and lead, through cleavage of CS bonds, to novel sulfur compounds or sulfide complexes. This transformation allows insight into the related processes that may occur during heterogeneous catalytic processes.[1] The platinum(0)-mediated CS bond cleavage reactions have been well studied and are established for the C(sp2)S bonds of thiophene,[2] thioester,[3] and vinyl sulfide.[4] However, to the best of our knowledge, a simple C(sp3)S bond activation with platinum(0) complexes has never been explored. Meanwhile, oxametallacycles are of great interest because of their unique structure and catalytic activity. Although there are several reports on the preparation and application of oxametallacycles containing nickel[5, 6] or palladium,[7] the chemistry of oxaplatinacycle is limited. Pregosin and co-workers have reported the synthesis of five-membered acyl(oxa)platinacycle 1 by the reaction of salicylaldehyde with K2PtCl4 in the presence of PPh3.[8] Also, Sweigart and coworkers have described that the platinum(0)-mediated CO bond cleavage reaction of benzofuran afforded the sixmembered oxaplatinacycle 2.[9] As a four-membered analogue, Sharp and co-workers have reported the formation and unique reactivity of platinaoxetane 3 (cod = 1,5-cyclooctadiene).[10] Herein, we report the cleavage of C(sp3)S and OH bonds of 2-hydroxybenzyl sulfide derivatives 4 mediated by platinum(0). This process led to an unusual formation of novel five-membered 1,2-oxaplatinacycles (5 a, 5 b ; see Scheme 2 for structures). We also describe the thermal reaction of 5 a involving the unexpected PC/PtO metathesis. We have examined the coordination ability of [OSSO]type diphenolate 6[11] as a chelate ligand toward transitionmetal complexes. When 6 was treated with 3 equivalents of [Pt(h2-nb)(PPh3)2] in toluene,[12] the activation of both benzylic CS and OH bonds[13] in 6 occurred unexpectedly and gave novel 1,2-oxaplatinacycle 5 b and cis-(dithiolato)PtII complex 7[14] in 72 % and 69 % yields, respectively (Scheme 1). On monitoring this reaction that was carried out in a sealed NMR tube, the generation of H2 was observed by 1H NMR spectroscopy (d = 4.21 ppm in C6D6).

Scheme 1. Reaction of [OSSO]-type diphenolate 6 with [Pt(h2-nb)(PPh3)2]. nb = norbornene.

[*] Dr. N. Nakata, N. Furukawa, T. Toda, Prof. Dr. A. Ishii Department of Chemistry, Graduate School of Science and Engineering, Saitama University 255 Shimo-okubo, Sakura-ku, Saitama 338-8570 (Japan) Fax: (+ 81) 48-858-3700 E-mail: ishiiaki@chem.saitama-u.ac.jp Homepage: http://www.chem.saitama-u.ac.jp/ishii-lab/ [**] This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas (nos. 19027014 and 20036013, Synergy of Elements) from the Ministry of Education, Culture, Sports, Science and Technology (Japan). Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201001937.

To elucidate the general validity of this platinum(0)mediated benzylic CS and phenolic OH bond activation, we examined the reactions of alkyl or aryl 2-hydroxybenzyl sulfides 4 ad, which have only half the framework of 6 (i.e. [Pt(h2-nb)(PPh3)2]). The reactions readily proceeded in toluene at room temperature and gave the corresponding 1,2-oxaplatinacycles 5 a or 5 b in 5584 % yields, together with polymeric thiolato PtII complexes [Pt(SR)2]n as insoluble materials (Scheme 2). When 4 b was allowed to react with [Pt(h2-nb)(PPh3)2] in the presence of an excess amount of PPh3 in toluene at room temperature, 5 a and the bis(thiolato) PtII complex cis-[Pt(SPh)2(PPh3)2] 8,[15] instead of polymeric thiolato Pt complexes, were formed in 16 % and 38 % yields, respectively. These results show that substrates having a set of phenolic OH and the ortho benzylic CS bonds react with a platinum(0) complex to yield five-membered oxaplatinacycles and thiolato PtII complexes, where 1.5 equivalents of the platinum(0) complex are required for the stoichiometric reaction. In the 1H NMR spectra, the characteristic benzylic protons resonate at d = 2.75 ppm (3J(P,H) = 9, 3 Hz) for 5 a and 2.77 ppm (3J(P,H) = 9, 3 Hz) for 5 b as a doublet of doublets. The 31P{1H} NMR spectra showed two doublet
Angew. Chem. 2010, 122, 5920 5923

5920

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
of Pt1P2 (2.232(2) ), thus suggesting the higher trans influence of the benzylic carbon atom compared to the oxo ligand. We next investigated the thermal reaction of oxaplatinacycle 5a.[17] A solution of 5 a in toluene at reflux for 24 hours gave the novel six-membered 1,2,3-oxaphosphaplatinacycle 9 in 39 % yield after column chromatography on silica gel (Scheme 3). The thermal reaction of 5 a in xylene at reflux

Chemie

Scheme 2. Reactions of alkyl or aryl 2-hydroxybenzyl sulfides 4 ad with [Pt(h2-nb)(PPh3)2]. Cy = cyclohexyl, Tol = tolyl.

signals with the 195Pt satellites at d = 16.3 (1J(Pt,P) = 3972 Hz) and 27.8 ppm (1J(Pt,P) = 1788 Hz) for 5 a and d = 17.4 (1J(Pt,P) = 3947 Hz) and 28.1 ppm (1J(Pt,P) = 1743 Hz) for 5 b (see the Supporting Information). These resonances were assigned to the signals resulting from the phosphorus atoms lying trans with respect to the oxygen and benzylic carbon atoms, respectively. The molecular structure of 5 a was confirmed by X-ray crystallography (Figure 1).[16] In the crystalline state, the platinum core lies at the centre of a slightly distorted square-planar coordination sphere consisting of two PPh3 ligands as well as oxygen and carbon atoms. The P1-Pt1-P2 angle of 98.33(10)8 deviates considerably from the ideal 908 of a square-planar geometry. The Pt1O1 bond length was 2.082(7) , which is similar to those of related oxaplatinacycles 1 (2.07(1) )[8] and 2 (2.067(1) ).[9] The Pt1P1 bond length (2.329(3) ) was slightly longer than that

Scheme 3. Thermal reactions of oxaplatinacycle 5 a.

Figure 1. ORTEP drawing of oxaplatinacycle 5 a with thermal ellipsoids drawn at the 30 % probability level. Selected bond lengths [] and bond angles [8]: Pt1O1 2.082(7), Pt1C1 2.096(9), Pt1P1 2.329(3), Pt1P2 2.232(2); O1-Pt1-C1 82.9(3), O1-Pt1-P1 85.1(2), C1-Pt1-P2 94.5(2), P1-Pt1-P2 98.33(10), Pt1-C1-C2 107.3(6), C1-C2-C3 117.5(10), C2-C3-O1 121.9(11).
Angew. Chem. 2010, 122, 5920 5923

produced 9 and its cis isomer 10 in 38 % and 41 % yield, respectively (Scheme 3). A small amount of the starting material, 5 a, was recovered from these thermal reactions (27 % and 20 % yield, respectively). It is interesting to compare this ring expansion by the insertion of a ligated phosphorus atom into the PtO bond. Van Leeuwen and Roobeek reported the insertion of a ligated phosphorus atom accompanied by a 1,2-shift of a phenyl group on the phosphorus atom with the thermal ring contraction of 1,3,2oxaphosphaplatinacycle 11 that gave platinum(II) complex 12, which has a 3H-2,1-benzoxaphosphole ligand.[18, 19] They proposed a mechanism involving nucleophilic attack of the oxygen atom bound at the platinum center at the phosphorus atom in the ring and a 1,2-shift of a phenyl group on the phosphorus atom (Scheme 4).[18b, 19] The molecular structures of 9 and 10 were characterized by 1H, 13C{1H}, and 31P{1H} NMR spectroscopy, and finally verified by X-ray crystallography. The 31P{1H} NMR spectrum of 9 displays two nonequivalent doublet signals with 195Pt satellites and 31P coupling at d = 29.9 (2J(P,P) = 475, 1J(Pt,P) = 2948 Hz) and 142.3 ppm (2J(P,P) = 475, 1J(Pt,P) = 3899 Hz). In sharp contrast, the 31P{1H} NMR spectrum of 10 exhibits two nonequivalent singlet signals at d = 22.8 and 137.3 ppm with the 195Pt satellites of 2080 and 2300 Hz, respectively. The lower-field signals of complexes 9 (d = 142.3 ppm) and 10 (d=137.3 ppm) are assigned to the phosphorus atoms of the phosphinite ligands, and these chemical shift values are www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5921

Zuschriften

Scheme 4. Thermal reaction of 1,3,2-oxaphosphaplatinacycle 11.

similar to that reported by van Leeuwen and Roobeek for complex 11 (d = 125.9 ppm (1J(Pt,P) = 2730 Hz)).[18] In the Xray structures (Figure 2 and 3),[16] the platinum atoms in each oxaphosphaplatinacycle 9 and 10 formed a distorted squareFigure 3. ORTEP drawing of 1,2,3-oxaphosphaplatinacycle 10 with thermal ellipsoids drawn at the 30 % probability level (a solvated hexane molecule was omitted for clarity). Selected bond lengths () and bond angles [8]: Pt1C1 2.119(4), Pt1C8 2.057(4), Pt1P1 2.2618(10), Pt1P2 2.2920(10), P1O1 1.640(3); C1-Pt1-P1 81.44(12), C1-Pt1-C8 87.70(16), C8-Pt1-P2 88.45(11), P1-Pt1-P2 102.35(4), Pt1-P1O1 111.21(11), P1-O1-C3 123.03, O1-C3-C2 120.5(4), C2-C1-Pt1 106.0(3).

Figure 2. ORTEP drawing of 1,2,3-oxaphosphaplatinacycle 9 with thermal ellipsoids drawn at the 30 % probability level (the solvated CH2Cl2 molecules were omitted for clarity). Selected bond lengths () and bond angles [8]: Pt1C1 2.153(6), Pt1C8 2.088(6), Pt1P1 2.2240(16), Pt1P2 2.2968(15), P1O1 1.635(4); C1-Pt1-P1 87.55(17), C1-Pt1-P2 91.96(18), C8-Pt1-P1 89.92(17), C8-Pt1-P2 91.25(17), Pt1-P1-O1 113.81(17), P1-O1-C3 117.2(4), O1-C3-C2 121.6(6), C2-C1-Pt1 114.4(4).

the crude reaction mixture. In addition, the conversion of 10 into 9 and/or 5 a was also observed when 10 was heated under the same reaction conditions (the ratio of 9/5 a/10 was 35:20:45 based on the integral ratio of the 31P{1H} NMR spectrum of the crude reaction mixture). These results indicate that the rearrangement is governed by the thermal equilibrium among five-membered oxaplatinacycle 5 a and six-membered oxaphosphaplatinacycles 9 and 10. As shown in Scheme 5, the rearrangement of 5 a into 9 and 10 can be explained by the initial nucleophilic attack of the phenoxido ligand in 5 a at the coordinated cis phosphorus center to give a betaine intermediate 13, and subsequent migration of a

planar coordination sphere with phenyl, PPh3, phosphinite, and benzylic carbon ligands. In both complexes 9 and 10, the Pt1P1 bond lengths (9 : 2.2240(16), 10 : 2.2618(10) ) were somewhat shorter than those of the Pt1P2 (9 : 2.2968(15), 10 : 2.2920(10) ), thus indicating weaker coordination of the PPh3 ligand to the central platinum atom than that of the cyclic phosphinite ligand , and results from the lower s-donor ability of PPh3. The Pt1C1 bond lengths were 2.153(6) for 9 and 2.119(4) for 10, which are longer than those of fivemembered oxaplatinacycles 5 a (2.066(9) ) and 1 (1.96(2) ).[8] To gain insight into the mechanism of formation for oxaphosphaplatinacycles 9 and 10, we studied the thermolyses of 9 and 10. Heating of trans complex 9 in xylene at reflux for 15 hours resulted in the formation of a mixture of cis complex 10, 5 a, and the starting material 9 in the ratio of 13:24:63 based on the integral ratio of the 31P{1H} NMR spectrum of

Scheme 5. A plausible mechanism for the formation of oxaphosphaplatinacycles 9 and 10.


Angew. Chem. 2010, 122, 5920 5923

5922

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
phenyl group from the anionic phosphorus atom to the cationic platinum center.[18b, 19] In summary, we have found unusual C(sp3)S and OH bond cleavage in the reactions of a series of 2-hydroxybenzyl sulfide derivatives 4 or 6 with [Pt(h2-nb)(PPh3)2] to form 1,2oxaplatinacycles 5 a and 5 b. The thermal isomerization of 5 a afforded novel six-membered 1,2,3-oxaphosphaplatinacycles 9 and 10 as trans and cis isomers, respectively. In addition, 5 a, 9, and 10 are in equilibrium under the experimental reaction conditions. Studies on the intrinsic reactivity of 5 are currently in progress.
Received: April 1, 2010 Revised: May 20, 2010 Published online: July 7, 2010 1351; b) S. Ogoshi, T. Arai, M. Ohashi, H. Kurosawa, Chem. Commun. 2008, 1347 1349; c) J. Langer, R. Fischer, H. Grls, D. Walther, Eur. J. Inorg. Chem. 2007, 2257 2264; d) S. Ogoshi, K. Tonomori, M. Oka, H. Kurosawa, J. Am. Chem. Soc. 2006, 128, 7077 7086; e) R. Fischer, J. Langer, A. Malassa, D. Walther, H. Grls, G, Vaughan, Chem. Commun. 2006, 2510 2512; f) S. Ogoshi, M. Ueta, T. Arai, H. Kurosawa, J. Am. Chem. Soc. 2005, 127, 12810 12811; g) S. Ogoshi, M. Oka, H. Kurosawa, J. Am. Chem. Soc. 2004, 126, 11802 11803. For recent examples of oxapalladacycles, see: a) T. Miura, T. Toyoshima, Y. Takahashi, M. Murakami, Org. Lett. 2008, 10, 4887 4889; b) J. C. Hershberger, L. Zhang, G. Lu, H. C. Malinakova, J. Org. Chem. 2006, 71, 231 235; c) G. Lu, J. L. Portscheller, H. C. Malinakova, Organometallics 2005, 24, 945 961; d) G. Lu, H. C. Malinakova, J. Org. Chem. 2004, 69, 8266 8279; e) J. L. Portscheller, S. E. Lilley, H. C. Malinakova, Organometallics 2003, 22, 2961 2971; f) C. Bianchini, A. Meli, W. Oberhauser, P. W. N. M. van Leeuwen, M. A. Zuideveld, Z. Freixa, P. C. J. Kamer, A. L. Spek, O. V. Gusev, A. M. Kalsin, Organometallics 2003, 22, 2409 2421; g) J. L. Portscheller, H. C. Malinakova, Org. Lett. 2002, 4, 3679 3681; h) C. FernndezRivas, D. J. Crdenas, B. Martn-Matute, A. Monge, E. Gutirrez-Puebla, A. M. Echavarren, Organometallics 2001, 20, 2998 3006. C. Anklin, P. S. Pregosin, F. Bachechi, P. Mura, Z. Zamonelli, J. Organomet. Chem. 1981, 222, 175 185. X. Zhang, E. J. Dullaghan, S. M. Gorun, D. A. Sweigart, Angew. Chem. 1999, 111, 2343 2346; Angew. Chem. Int. Ed. 1999, 38, 2206 2208. E. Szuromi, S. Hui, P. P. Sharp, J. Am. Chem. Soc. 2003, 125, 10522 10523. A. Ishii, T. Toda, N. Nakata, T. Matsuo, J. Am. Chem. Soc. 2009, 131, 13566 13567. H. Petzold, H. Grls, W. Weigand, J. Organomet. Chem. 2007, 692, 2736 2742. OH activation of alcohols or phenols by low-valent metals including platinum(0) have been less studied; a) D. B. Grotjahn, Y. Gong, A. G. DisPasquale, L. N. Zakharov, A. L. Rheingold, Organometallics 2006, 25, 5693 5695; b) R. S. Paonessa, A. L. Prignano, W. C. Trogler, Organometallics 1985, 4, 647 657. N. Nakata, M. Sakashita, C. Komatsubara, A. Ishii, Eur. J. Inorg. Chem. 2010, 447 453. F. Yamashita, H. Kuniyasu, J. Terao, N. Kambe, Inorg. Chem. 2006, 45, 1399 1404. CCDC 771775 (5 a), 771776 (5 b), 771777 (9), and 771778 (10) contain the supplementary crystallographic data for this paper. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_ request/cif. We examined the thermal reaction of 5 b in xylene at reflux, but the reaction did not occur. This failure is probably a result of steric hindrance from the tBu group ortho to the PtO group in the formation of the intermediate corresponding to 13. For reviews on cleavage of CP bonds mediated by transition metals, see: a) T. J. Geldbach, P. S. Pregosin, Eur. J. Inorg. Chem. 2002, 1907 1918; b) S. A. Macgregor, Chem. Soc. Rev. 2007, 36, 67 76. P. W. N. M. van Leeuwen, C. F. Roobeek, Organometallics 1990, 9, 2179 2181.

Chemie

[7]

Keywords: cleavage reactions oxaphosphaplatinacycles oxaplatinacycles platinum thermal rearrangements

[1] For recent studies on cleavage of CS bond by transition metals, see: a) T. Schaub, M. Backes, O. Plietzsch, H. Radius, Dalton Trans. 2009, 7071 7079; b) M. R. Grochowski, W. W. Brennessel, W. D. Jones, Organometallics 2009, 28, 2661 2667; c) J. Torres-Nieto, W. W. Brennessel, W. D. Jones, J. J. Garca, J. Am. Chem. Soc. 2009, 131, 4120 4126; d) T. A. Atesin, W. D. Jones, Inorg. Chem. 2008, 47, 10 889 10 894; e) K. Iwasa, H. Seino, Y. Mizobe, J. Organomet. Chem. 2008, 693, 3197 3200; f) M. Shibue, M. Hirotsu, T. Nishioka, I. Kinoshita, Organometallics 2008, 27, 4475 4483; g) T. Schaub, M. Backes, H. Radius, Chem. Commun. 2007, 2037 2039; h) D. Shimizu, N. Takeda, N. Tokitoh, J. Organomet. Chem. 2007, 692, 2716 2728; i) L. A. Goj, M. Lail, K. A. Pittard, K. C. Riley, T. B. Gunnoe, J. L. Petersen, Chem. Commun. 2006, 982; j) D. Shimizu, N. Takeda, N. Tokitoh, Chem. Commun. 2006, 177 179; k) J. A. Cabeza, I. del Ro, I. M. G. Snchez-Vega, M. Surez, Organometallics 2006, 25, 1831 1834. [2] a) A. Nova, F. Novio, P. Gonzals-Duarte, A. Lledos, R. MasBallest, Eur. J. Inorg. Chem. 2007, 5707 5719; b) K. Yu, H. Li, E. J. Watson, K. L. Virkaitis, G. B. Carpenter, D. A. Sweigart, Organometallics 2001, 20, 3550 3559; c) H. Li, G. B. Carpenter, D. A. Sweigart, Organometallics 2000, 19, 1823 1825; d) A. Arvalo, S. Berns, J. J. Garcia, P. M. Maitlis, Organometallics 1999, 18, 1680 1685; e) C. A. Dullaghan, X. Zhang, D. L. Greene, G. B. Carpenter, D. A. Sweigart, C. Camiletti, E. Rajaseelan, Organometallics 1998, 17, 3316 3322; f) J. J. Garcia, B. E. Mann, H. Adams, N. A. Bailey, P. M. Maitlis, J. Am. Chem. Soc. 1995, 117, 2179 2186; g) J. J. Garcia, P. M. Maitlis, J. Am. Chem. Soc. 1993, 115, 12200 12201. [3] a) T. Kato, H. Kuniyasu, T. Kajiura, Y. Minami, A. Ohtake, M. Kinomoto, J. Terao, H. Kurosawa, N. Kambe, Chem. Commun. 2006, 868 870; b) Y. Minami, T. Kato, H. Kuniyasu, J. Terao, N. Kambe, Organometallics 2006, 25, 2949 2959. [4] H. Kuniyasu, A. Ohtake, T. Nakazono, M. Kinomoto, H. Kurosawa, J. Am. Chem. Soc. 2000, 122, 2375 2376. [5] For a recent review on the application of oxanickelacycles, see: M. Mori, Eur. J. Org. Chem. 2007, 4981 4993. [6] For recent examples of oxanikelacycles, see: a) I. Koyama, T. Kurahashi, S. Matsubara, J. Am. Chem. Soc. 2009, 131, 1350

[8] [9]

[10] [11] [12] [13]

[14] [15] [16]

[17]

[18]

[19]

Angew. Chem. 2010, 122, 5920 5923

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5923

Zuschriften
Frustrated Lewis Pairs
DOI: 10.1002/ange.201002119

Exploring the Reactivity of Carbon(0)/Borane-Based Frustrated Lewis Pairs**


Manuel Alcarazo,* Catherine Gomez, Sigrid Holle, and Richard Goddard
Dedicated to Professor Rosario Fernndez Since the unveiling of the concept of frustrated Lewis pairs (FLPs) by Stephan et al.,[1] the chemistry of these systems has flourished. Arguably their most attractive application has been the heterolytic activation of H2,[2] and the subsequent development of metal-free hydrogenation catalysis directly employing dihydrogen[3] rather than a surrogate.[4] Although several other bonds such as CO,[5] CH,[6] BH,[7] SS,[8] and CC,[9] have also been cleaved by using FLPs, these systems largely rely on P- or N-based Lewis bases combined with a polyfluorinated borane.[10] The sole exceptions are the sterically crowded carbene 1,3-di-tert-butyl-1,3-imidazol-2-ylidene (ItBu) in combination with B(C6F5)3, a pair that contains a Cderived base,[11] and the use of Al(C6F5)3 instead of a borane as Lewis acid.[12] Clearly, extension of the FLP concept to include currently unexplored partners is desirable, as it may lead to the discovery of a range of interesting new applications. In our research to broaden the range of bases that can be used in FLP chemistry, we were inspired by the computational investigations of Tonner and Frenking on the nature of carbodiphosphoranes.[13, 14] They proposed that these compounds should be considered to comprise two phosphine ligands coordinated to a central zero-valent carbon atom that retains its four valence electrons. This view has been subsequently confirmed experimentally by the work of Bertrand et al., Frstner et al., and others.[15] The available information suggests that C0 compounds must be exceptionally good nucleophiles. In fact, the calculated proton affinity for carbodiphosphoranes surpasses the values reported for amines, phosphines, and even N-heterocyclic carbenes. It can be envisaged therefore that, if sufficiently sterically hindered, C0 compounds should be qualified to function as bases in the framework of FLP chemistry. Herein, in an attempt to address this issue, the pair hexaphenylcarbodiphosphorane (1)/B(C6F5)3 is studied and its reactivity towards several small molecules evaluated.[17]
[*] Dr. M. Alcarazo, Dr. C. Gomez, S. Holle, Dr. R. Goddard Max Planck Institut fr Kohlenforschung 45470 Mlheim and der Ruhr (Germany) Fax: (+ 49) 208-306-2994 E-mail: alcarazo@mpi-muelheim.mpg.de [**] We thank Prof. A. Frstner for generous support and constant encouragement. The NMR spectroscopy and X-ray crystallography departments of our institute are also gratefully acknowledged for excellent support, as well as H. Bruns and R. Schinzel for the preparation of starting materials. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002119.

Initially, we carried out the reaction of 1 with B(C6F5)3 in toluene at room temperature. The NMR spectroscopic data of the obtained product suggested formation of 2 by nucleophilic attack at the para position of the pentafluorophenyl ring and trapping of the generated fluoride anion by the boron atom. X-ray crystallographic analysis later confirmed the structure of 2 (see Supporting Information).[18] However, when the same reagents were mixed at 78 8C, NMR spectroscopy indicated no interaction between the partners, that is, frustration. Purging this stoichiometric mixture with H2 resulted in formation of a white precipitate which could be isolated in 91 % yield. The NMR data support the formulation for this product as [(Ph3P)2CH][HB(C6F5)3] (3 ; Scheme 1). The cation exhibits a 1H signal at d = 1.73 ppm with 2J(1H,31P) of 5.4 Hz and a 31P{1H} resonance at d = 21.3 ppm, while the

Scheme 1. Some reactions of FLP 1/B(C6F5)3. Reagents and conditions (yields): a) toluene, 78 8C !RT (74 %); b) H2 1 atm, toluene, 78 8C !RT (91 %); c) THF, 78 8C !RT (76 %); d) nC5H11F, toluene, 78 8C, quant.; e) ethylene carbonate, toluene, 78 8C !RT (84 %); f) 2,2-dimethyl-g-butyrolactone, toluene, 78 8C !RT (71 %).

anion gives the expected 11B signal of a borohydride at d = 25.5 ppm with a 1J(1H,11B) of 100 Hz. Single crystals were obtained by slow diffusion of pentane into a solution of 3 in CH2Cl2, and X-ray structure analysis confirmed not only the proposed structure (Figure 1), but also the ability of 1/ B(C6F5)3 to function as an FLP. As expected for an FLP, 1/B(C6F5)3 in solution in THF resulted in ring opening of the ether to produce phosphonio borate 4, also confirmed by X-ray analysis (see Supporting Information). This reactivity was extended to ethylene carbonate and the non-enolizable ester 3,3-dimethyl-g-butyrolactone to produce zwitterionic species 5 and 6, respectively. Moreover, addition of one equivalent of 1-fluoropentane to a suspension of 1/B(C6F5)3 at 78 8C generates [(Ph3P)2CAngew. Chem. 2010, 122, 5924 5927

5924

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte

Chemie

Figure 2. Molecular structure of 9CH2Cl2 in the solid state (hydrogen atoms removed for clarity; ellipsoids set at 50 % probability).[16] Figure 1. Molecular structure of 3 in the solid state (except for the hydrogen atom bonded to B, hydrogen atoms and solvent molecules were removed for clarity; ellipsoids set at 50 % probability).[16]

(C5H11)][FB(C6F5)3] in quantitative yield. This CF bond activation of an alkyl fluoride is unprecedented in the scope of FLP chemistry and does not take place in the absence of borane, even at room temperature.[19] The reactivity of terminal alkynes such as phenylacetylene in presence of several P/B- and P/Al-based FLPs has been studied by Stephan and co-workers.[6] Two possible reaction pathways, involving either deprotonation of the alkyne or Markovnikov addition of the FLP to the CC triple bond, were observed. This divergent reactivity was explained in terms of the Brnsted basicity of the phosphines used. The very basic tBu3P prompts deprotonation of the alkyne CH, while aryl phosphines, which are less basic, prefer nucleophilic attack on the activated alkyne. Nonetheless, this rationale does not explain the fact that treatment of phenylacetylene with 1/B(C6F5)3, whereby 1 is a stronger base than tBu3P, resulted in formation of both possible products, that is, the expected 8 but also 9. This points towards a concomitant, previously unconsidered, influence of steric factors. The Xray structure of 9 is shown in Figure 2. Activation of SiH bonds with the FLP 1/B(C6F5)3 was also attempted. Upon stirring an equimolar mixture of Ph2SiH2, 1 and B(C6F5)3 at 78 8C in toluene, the yellow color of the suspension slowly vanished and an immiscible colorless oil separated from the toluene phase. Purification by column chromatography afforded a pure compound that showed 1H signals at d = 5.12 ppm with 3J(1H,31P) of 16 Hz and at d = 3.54 ppm with 1J(1H,11B) of 92.6 Hz, which can be assigned to a silane proton and a borohydride proton respectively. A 31P{1H} resonance at d = 26.7 ppm and a 11 B{1H} signal at d = 23.8 ppm, together with high-resolution mass spectra of both the anion and the cation, unambiguously confirmed the proposed structure for 10 (Scheme 2).[20] Activation of the SiH bond in EtMe2SiH was also achieved under the same reaction conditions to give 11. Formation of a free silylium cation by direct interaction of the silane with B(C6F5)3 has been ruled out by the work of Oestreich and Render on the enantioselective reduction of acetophenone
Angew. Chem. 2010, 122, 5924 5927

Scheme 2. Reactivity of the pair 1/B(C6F5)3 towards terminal alkynes. Reagents and conditions (yields): a) phenylacetylene, toluene 78 8C !RT, 8 (78 %), 9 (12 %); b) Ph2SiH2, toluene, 78 8C !RT (87 %); c) Me2EtSiH, toluene, 78 8C !RT (93 %); d) Me3SiOMe, toluene, 78 8C !RT, hydrolysis (88 %).

with a chiral silane.[21] Likewise, an equimolar solution of 1 and Ph2SiH2 in benzene does not show any reactivity even after a day at room temperature. These results confirmed that the synergic effect of the base and the acid of our FLP is responsible for activation of the SiH bonds. To the best of our knowledge, the achieved activation of SiH bonds also has no precedent in FLP chemistry. In contrast, heterolytic cleavage of SiF and SiO bonds in PhMe2SiF and Me3SiOPh was not successful under the same reaction conditions, and only 2 was obtained after allowing the reaction mixture to reach room temperature. When Me3SiOMe was tested, product 12 was isolated. This compound presumably results from activation of the CO bond of the silyl ether and hydrolysis of the trimethylsilyl borate during chromatographic purification. Frenking estimated the second proton affinity of 1 to be 193.4 kcal mol1. This basicity is considered a hallmark of carbon(0)-containing compounds and suggests that even protonated or alkylated derivatives of 1 may still have an appreciable degree of frustration when confronted with B(C6F5)3. To explore this possibility, salt 13 consisting of the methylated cation [1Me]+ and a noninterfering [B(C6F5)4] anion was synthesized.[17] Although the pair 13/B(C6F5)3 was not able to activate H2 or NH of amines, it still cleaves the www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

5925

Zuschriften
OH bond of methanol, something that 13 alone is not able to do (Scheme 3). In fact, 13 can be crystallized from MeOH without generating any protonated product. frustration persists. The application of these FLPs in homogeneous catalysis is currently under investigation.
Received: April 9, 2010 Published online: July 2, 2010

.
Scheme 3. Cleavage of the OH bond of methanol with the pair 13/ B(C6F5)3. Reagents and conditions (yields): a) MeOH (1 equiv), toluene, RT, 14 (86 %).

Keywords: boranes carbodiphosphoranes donor acceptor systems frustrated Lewis pairs hydrogen activation

This reveals a degree of frustration that, albeit clearly diminished in comparison to the 1/B(C6F5)3 pair, is still remarkable considering the cationic nature of the employed base. Cationic Lewis acids like [CPh3]+ have been studied in the context of FLPs;[12] however, this is the first example of the counterintuitive use of a cationic base in this field. The formulation of compound 14 is supported by a 1H NMR signal at d = 1.95 ppm for the Me group with 3J(1H,31P) of 16.0 Hz and a 3J(1H,1H) of 7.6 Hz, a 31P{1H} resonance at d = 28.6 ppm and two 11B{1H} signals at d = 2.3 and 15.2 ppm. In addition, during attempts to crystallize 14, crystals of 14[B(C6F5)4]2 were obtained and its structure confirmed by X-ray analysis (Figure 3).

Figure 3. Molecular structure of 14[B(C6F5)4]2 in the solid state. (B(C6F5)4 anions and hydrogen atoms, except that bonded to C1, were removed for clarity; ellipsoids set at 50 % probability).[16]

In conclusion, this study demonstrates that the combination of hexaphenylcarbodiphosphorane as carbon-based Lewis base and B(C6F5)3 forms a novel frustrated Lewis pair. The system is not only able to achieve the classical HH, CO, and CH bond cleavages, but also unprecedented activation of SiH bonds and alkyl fluorides. The peculiar electronic situation of the C0 base makes the system unique: after the first protonation or alkylation, some degree of

[1] G. C. Welch, R. R. S. Juan, J. D. Masuda, D. W. Stephan, Science 2006, 314, 1124 1126. For some reviews on the chemistry of frustrated Lewis pairs, see: a) D. W. Stephan, G. Erker, Angew. Chem. 2010, 122, 50 81; Angew. Chem. Int. Ed. 2010, 49, 46 76; b) D. W. Stephan, Org. Biomol. Chem. 2008, 6, 1535 1539. [2] For theoretical mechanistic studies, see: a) T. A. Rokob, A. Hamza, A. Stirling, T. Sos, I. Ppai, Angew. Chem. 2008, 120, 2469 2472; Angew. Chem. Int. Ed. 2008, 47, 2435 2438; b) T. A. Rokob, A. Hamza, I. Ppai, J. Am. Chem. Soc. 2009, 131, 10701 10710; c) S. Grimme, H. Kruse, L. Goerigk, G. Erker, Angew. Chem. 2010, 122, 1444 1447; Angew. Chem. Int. Ed. 2010, 49, 1402 1405; d) For splitting of dihydrogen by using a single carbon center, see: G. D. Frey, V. Lavallo, B. Donnadieu, W. W. Schoeller, G. Bertrand, Science 2007, 316, 439 441. [3] a) P. Spies, S. Schwendermann, S. Lange, G. Kehr, R. Frlich, G. Erker, Angew. Chem. 2008, 120, 7654 7657; Angew. Chem. Int. Ed. 2008, 47, 7543 7546; b) P. A. Chase, G. C. Welch, T. Jurca, D. W. Stephan, Angew. Chem. 2007, 119, 8196 8199; Angew. Chem. Int. Ed. 2007, 46, 8050 8053; c) H. Wang, R. Frhlich, G. Kehr, G. Erker, Chem. Commun. 2008, 5966 5968; d) T. A. Rokob, A. Hamza, A. Stirling, I. Ppai, J. Am. Chem. Soc. 2009, 131, 2029 2036. [4] a) J. W. Yang, M. T. Hechavarria Fonseca, B. List, Angew. Chem. 2004, 116, 6829 6832; Angew. Chem. Int. Ed. 2004, 43, 6660 8053; b) J. B. Tuttle, S. G. Ouellet, D. W. C. MacMillan, J. Am. Chem. Soc. 2006, 128, 12662 12663. [5] a) S. J. Geier, D. W. Stephan, J. Am. Chem. Soc. 2009, 131, 3476 3477; b) G. C. Welch, J. D. Masuda, D. W. Stephan, Inorg. Chem. 2006, 45, 478 480. [6] M. A. Dureen, D. W. Stephan, J. Am. Chem. Soc. 2009, 131, 8396 8397. [7] M. A. Dureen, A. Lough, T. M. Gilbert, D. W. Stephan, Chem. Commun. 2008, 4303 4305. [8] M. A. Dureen, G. C. Welch, T. M. Gilbert, D. W. Stephan, Inorg. Chem. 2009, 48, 9910 9917. [9] a) J. S. J. McCahill, G. C. Welch, D. W. Stephan, Angew. Chem. 2007, 119, 5056 5059; Angew. Chem. Int. Ed. 2007, 46, 4968 4971; b) M. Ullrich, K. S. H. Seto, A. J. Lough, D. W. Stephan, Chem. Commun. 2009, 2335 2337; C. M. Mmming, G. Kehr, B. Wibbeling, R. Frhlich, B. Schirmer, S. Grimme, G. Erker, Angew. Chem. 2010, 122, 2464 2467; Angew. Chem. Int. Ed. 2010, 49, 2414 2417. [10] a) P. Spies, G. Erker, G. Kehr, K. Bergander, R. Frlich, S. Grimme, D. W. Stephan, Chem. Commun. 2007, 5072 5074; b) C. M. Mmming, S. Frmel, G. Kehr, R. Frhlich, S. Grimme, G. Erker, J. Am. Chem. Soc. 2009, 131, 12 280 12 289. [11] a) D. Holschumacher, T. Bannenberg, C. G. Hrib, P. G. Jones, M. Tamm, Angew. Chem. 2008, 120, 7538 7542; Angew. Chem. Int. Ed. 2008, 47, 7428 7432; b) P. A. Chase, D. W. Stephan, Angew. Chem. 2008, 120, 7543 7547; Angew. Chem. Int. Ed. 2008, 47, 7433 7437. [12] The use of carbon-based Lewis acids for FLP chemistry has been tried but with limited success: L. Cabrera, G. C. Welch, J. D. Masuda, P. Wei, D. W. Stephan, Inorg. Chim. Acta 2006, 359, 3066 3071.
Angew. Chem. 2010, 122, 5924 5927

5926

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
[13] a) R. Tonner, G. Frenking, Chem. Eur. J. 2008, 14, 3260 3272; b) R. Tonner, G. Frenking, Chem. Eur. J. 2008, 14, 3273 3289; c) R. Tonner, G. Frenking, Angew. Chem. 2007, 119, 8850 8853; Angew. Chem. Int. Ed. 2007, 46, 8695 8698; d) R. Tonner, F. xler, B. Neumller, W. Petz, G. Frenking, Angew. Chem. 2006, 118, 8206 8211; Angew. Chem. Int. Ed. 2006, 45, 8038 8042. See also W. C. Kaska, D. K. Mitchell, R. F. Reichelderfer, J. Organomet. Chem. 1973, 47, 391 402. [14] For a review on the coordination chemistry of ylides and carbodiphosphoranes, see: H. Schmidbaur, Angew. Chem. 1983, 95, 980 1000; Angew. Chem. Int. Ed. Engl. 1983, 22, 907 927. [15] a) C. A. Dyker, V. Lavallo, B. Donnadieu, G. Bertrand, Angew. Chem. 2008, 120, 3250 3253; Angew. Chem. Int. Ed. 2008, 47, 3206 3209; b) M. Alcarazo, C. W. Lehmann, A. Anoop, W. Thiel, A. Frstner, Nat. Chem. 2009, 1, 294 301; c) C. A. Dyker, G. Bertrand, Nat. Chem. 2009, 1, 265 266; d) A. Frstner, M. Alcarazo, R. Goddard, C. W. Lehmann, Angew. Chem. 2008, 120, 3254 3258; Angew. Chem. Int. Ed. 2008, 47, 3210 3214; e) M. Melaimi, P. Parameswaran, B. Donnadieu, G. Frenking, G. Bertrand, Angew. Chem. 2009, 121, 4886 4889; Angew. Chem. Int. Ed. 2009, 48, 4792 4795; f) J. Vicente, A. R. Singhal, P. G. Jones, Organometallics 2002, 21, 5887 5900. [16] CCDC 772576 (2), 772577 (3), 772578 (4), 772579 (5), 772580 (6), 772581 (8), 772582 (9), 772583 (13) and 772593 (14) contain the supplementary crystallographic data for this paper. These data can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac.uk/data_request/cif. F. Ramrez, N. B. Desai, B. Hansen, N. McKelvie, J. Am. Chem. Soc. 1961, 83, 3539 3540. See also a) N. D. Jones, R. G. Cavell, J. Organomet. Chem. 2005, 690, 5485 5496; b) W. C. Kaska, D. K. Mitswchell, R. F. Reichelerfer, J. Organomet. Chem. 1973, 47, 391 402. This observed reactivity has a precedent in the case of some phosphines and bulky phosphorus ylides: a) G. C. Welch, R. Prieto, M. A. Dureen, A. J. Lough, O. A. Labeodan, T. Hlltrichter-Rssmann, D. W. Stepan, Dalton Trans. 2009, 1559 1570; b) S. Dring, G. Erker, R. Frhlich, O. Meyer, K. Bergander, Organometallics 1998, 17, 2183 2187. Alkylations of carbodiphosphorane 1 are known but only if harsher reaction conditions and alkyl chlorides or bromides are employed: H. J. Bestmann, H. Oechner, Z. Naturforsch. B 1983, 38, 861 865. Preliminary studies show that the well-established tBu3P/B(C6F5)3 pair under the same conditions produces [tBu3PH] [HB(C6F5)3], presumably by hydrolysis of the SiP bond during the workup or purification. S. Rendler, M. Oestreich, Angew. Chem. 2008, 120, 6086 6089; Angew. Chem. Int. Ed. 2008, 47, 5997 6000.

Chemie

[17]

[18]

[19]

[20]

[21]

Angew. Chem. 2010, 122, 5924 5927

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5927

Zuschriften
CH Bond Activation
DOI: 10.1002/ange.201002737

Palladium-Catalyzed Cross-Coupling of Internal Alkenes with Terminal Alkenes to Functionalized 1,3-Butadienes Using CH Bond Activation: Efficient Synthesis of Bicyclic Pyridones**
Haifeng Yu, Weiwei Jin, Chenglin Sun, Jiping Chen, Wangmin Du, Songbo He, and Zhengkun Yu*
Transition-metal-catalyzed cross-coupling through CH bond activation is emerging as one of the most important tools for carboncarbon bond formation.[1] In general, vinylogous compounds can be synthesized by Wittig,[2] Heck,[3] and Suzuki[4] reactions, from the condensation of carbonyl compounds,[5] CH addition to alkynes,[6] or by means of organometallic alkenyl compounds,[7] but direct alkenylation using CH bond activation remains particularly attractive for constructing carboncarbon double bonds owing to their synthetic simplicity and use of readily available reagents.[8] Vinylborates,[9] vinyl halides,[10] alkenyl acetates,[11] and cyclic 1,3-dicarbonyls[12] have been known for the direct alkenylation of arene and (hetero)arene CH bonds. In a more simple and synthetically useful alkenylation, terminal alkenes have been applied as the coupling partners.[1315] However, little attention has been paid to the direct alkenylation of alkenyl CH bonds with an alkene as the coupling partner using CH bond activation.[16] 1,3-Butadienes, as a class of versatile organic synthetic reagents,[17] have usually been prepared by indirect methods.[18] To date, only two reports have been documented for their direct synthesis, involving coupling two simple terminal alkenes, owing to the difficulty in activating two alkene substrates at the same time (Scheme 1).[16] Although two examples involving the reaction of 3-methyl-1H-indenes with tert-butyl acrylate were also reported,[16b] no work has been directed to the direct alkenylation of open-chain internal

Scheme 1. Direct cross-coupling of two terminal alkenes.[16] Ac = acetate, DMSO = dimethyl sulfoxide.

alkenes with another alkene as the coupling partner. In order to realize the direct cross-coupling of an internal alkene with a terminal alkene, the low reactivity of an internal alkenyl CH bond should be overcome. We envisioned the introduction of a structural element that could increase the reactivity of an internal alkenyl CH bond.[19] Thus, we hypothesized that a 1,2-dithiane group at the terminal position of an alkene should satisfy the requirement on activating an internal alkenyl CH bond, and a-oxoketene dithioacetals[20] were chosen as the internal alkenes. Herein, we report the palladium(II)-catalyzed direct cross-coupling of a-oxoketene dithioacetals with terminal alkenes as well as the synthesis of bicyclic pyridones [Eq. (1)].

[*] Dr. H. F. Yu, W. W. Jin, Prof. C. L. Sun, Prof. Dr. J. P. Chen, W. M. Du, Dr. S. B. He, Prof. Dr. Z. K. Yu Dalian Institute of Chemical Physics, Chinese Academy of Sciences (CAS), 457 Zhongshan Road, Dalian 116023 (China) Fax: (+ 86) 411-8437-9227 E-mail: zkyu@dicp.ac.cn Homepage: http://www.omcat.dicp.ac.cn Dr. H. F. Yu Department of Chemistry, Anshan Normal University Anshan, Liaoning 114007 (China) Prof. Dr. Z. K. Yu State Key Laboratory of Organometallic Chemistry, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences (CAS) 354 Fenglin Road, Shanghai 200032 (China) [**] We are grateful to the National Basic Research Program of China (2009CB825300), the Innovation Program of CAS (DICP K2009D04), NSFC and China Postdoctoral Science Foundation (20080431160 to H.F.Y) for support of this research. Supporting information for this article is available on the WWW under http://dx.doi.org/10.1002/anie.201002737.

The reaction of a-oxoketene dithioacetal 1 a with tertbutyl acrylate (2 a) was explored to screen the reaction conditions (Table 1). With 10 mol % of Pd(OAc)2 as the catalyst and in the presence of 2 equivalents of AgOAc, the reaction proceeded in N,N-dimethylformamide (DMF) at ambient temperature under an air atmosphere, forming the desired product, 1,3-buta-diene 3 a, in 49 % yield within 40 hours (Table 1, entry 1). Increasing the temperature to 50 8C remarkably accelerated the reaction, while further elevating the reaction temperature did not obviously improve the reaction efficiency (Table 1, entries 2 and 3). Extending the reaction time deteriorated the yield of 3 a from 63 % to 50 %, owing to product decomposition (Table 1, entry 4). N,N-dimethylformamide seemed to be a suitable reaction solvent. An oxygen atmosphere did not promote the reaction,
Angew. Chem. 2010, 122, 5928 5933

5928

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angewandte
Table 1: Screening of reaction conditions for the direct cross-coupling of a-oxoketene dithioacetal 1 a with terminal alkene 2 a.[a]

Chemie

Entry Catalyst (mol %) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) Pd(OAc)2 (10) PdCl2 (10) [Pd(PPh3)2Cl2] (10) [Pd(PPh3)4] (10) Pd(OAc)2 (15) Pd(OAc)2 (20) Pd(OAc)2 (20) Pd(OAc)2 (20) Pd(OAc)2 (20)

Oxidant AgOAc AgOAc AgOAc AgOAc AgOAc AgOAc AgOAc AgOAc AgOAc O2[d] AgOAc/O2[d] Cu(OAc)2 BQ PhI(OAc)2 AgOAc AgOAc AgOAc AgOAc AgOAc AgOAc[e] AgOAc[f ] AgOAc[g]

Solvent T [8C] t [h] Yield [%][b] DMF DMF DMF DMF DMSO toluene TFA DMA THF DMF DMF DMF DMF DMF DMF DMF DMF DMF DMF DMF DMF DMF RT 50 70 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 40 12 12 22 12 12 12 12 12 12 12 12 12 12 12 12 12 8 8 8 8 8 49 (39)[c] 63 64 50 32 15 n.r. 52 40 3 64 11 20 n.r. 15 6 5 75 94 (86)[c] 74 81 90

[a] Conditions: 1 a (0.5 mmol), 2 a (1.0 mmol), oxidant (1.0 mmol), solvent (2 mL), in air. [b] Determined by GC analysis. [c] Yield of isolated product given in parentheses. [d] Atmospheric O2. [e] 1.0 equivalent. [f] 1.5 equivalents. [g] 3 equivalents. n.r. = no reaction, TFA = trifluoroacetic acid.

and Cu(OAc)2, para-benzoquinone (BQ), and PhI(OAc)2 were much less efficient oxidants than AgOAc. The use of PdCl2, [Pd(PPh3)2Cl2], or [Pd(PPh3)4] as the catalyst led to poor formation of the product (Table 1, entries 1517). Increasing the catalyst loading from 10 to 20 mol % significantly increased the product yield from 63 % to 94 % (Table 1, entries 2, 18, and 19). It is noteworthy that 2 equivalents of AgOAc were necessary for a satisfactory conversion of 1 a (Table 1, entries 2022). Using these optimized conditions, the scope of the procedure was then examined (Table 2). The reactions of 1 a with electron-deficient terminal alkenes, i.e., alkyl acrylates and N,N-dimethylacrylamide 2 ad, afforded 1,3-butadienes 3 ad in 8389 % yield (Table 2, entries 14). With acrolein 2 e, product 3 e was obtained in only 45 % yield (Table 2, entry 5). Treatment of 1 a with styrene (2 f) generated the desired product 3 f (69 %) and its isomer 3 f (11 %; Table 2, entry 6). In a similar fashion, the reaction of 1 a with 4-chlorostyrene (2 g) also resulted in the separable isomers 3 g (73 %) and 3 g (10 %; Table 2, entry 7). However, the reaction of 1 a and 4methoxystyrene (2 h) or 2-methylstyrene (2 i) led to inseparable mixtures of isomers 3 and 3 (Table 2, entries 8 and 9). Unexpectedly, the reaction of 1 a and allyl benzoate (2 j) formed the allylation product 3 j in 56 % yield. Vinyl acetate (2 k) only exhibited a moderate reactivity. Allyl alcohol (2 l) underwent the cross-coupling reaction with 1 a to afford 1,3butadiene 3 e (37 %), thus suggesting oxidation of the alcoholic hydroxyl during the reaction. The reactions of 1 bac with 2 c and 2 d produced the desired products 3 lo in 54-67 % yields (Table 2, entries 1316), respectively, while the reactions of heteroaryl a-oxoketene dithioacetals 1 bd and 1 be with 2 c formed the desired major products 3 p (62 %) and 3 q (60 %) as well as the by-products 3 p (7 %) and 3 q (7 %) [Table 2, entries 17 and 18; Eq. (2)]. However, a-oxoketene

Table 2: Direct alkenylation of a-oxoketene dithioacetals 1 ad with terminal alkenes 2.[a] Entry 1 2 Product 3 Yield [%][b] Entry 1 2 Product 3 Yield [%][b]

86

10[c]

1a

56

1a

83

11[c]

1a

35

1a

85

12[c]

1a

3e

37

1a

89

13

2c

56

5[c]

1a

45

14

2c

64

Angew. Chem. 2010, 122, 5928 5933

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

www.angewandte.de

5929

Zuschriften
Table 2: (Continued) Entry 1 2 Product 3 Yield [%][b] Entry 1 2 Product 3 Yield [%][b]

6[c]

1a

69

15

1 bb

2d

67

11

16

2c

54

7[c,d]

1a

73

17[g]

2c

62

10

18[g]

2c

60

8[c,e]

1a

71 (3 h/3 h=4:1)[f ]

19

2a

38

20

2a

<5

9[c]

1a

67 (3 i/3 i=1:4)[f ]

[a] Conditions: 1 (0.5 mmol), 2 (1.0 mmol), Pd(OAc)2 (20 mol %), AgOAc (1.0 mmol), DMF (2 mL), 50 8C, in air. Entries 14, 8 h; entries 58 and 10 12, 12 h; entries 9 and 1318, 24 h. [b] Yield of isolated products. [c] 2 (2.5 mmol). [d] R = 4-ClC6H4. [e] R = 4-MeOC6H4. [f] Determined by 1H NMR spectroscopy. [g] See Equation (2).

dithioacetals 1 c and 1 d only exhibited poor reactivity (Table 2, entries 19 and 20), thus revealing an obvious substituent effect of the alkylthio groups. The molecular structures of 3 were confirmed by the X-ray crystallographic structural determination of 3 n, in which the newly coupled carboncarbon double bond exists in an E configuration (see the Supporting Information). The cross-coupling reactions of a-cinnamoyl ketene dithioacetals 1 ea with alkenes 2 ad gave ployene products 4 ad in 7182 % yields (Table 3, entries 14). Using styrene 2 f, the desired product 4 e was obtained in 62 % yield. Treatment of 1 eb and 1 ec with 2 a also efficiently afforded the desired products in 79 % and 78 % yields, respectively (Table 3, entries 6 and 7). Heteroaryl dithioacetals 1 ed and 1 ee were coupled with 2 a to afford 4 h and 4 i (60 % and 62 %, respectively) as well as the separable double alkenylation products 4 h and 4 i (8 % and 10 %, respectively; Table 3, entries 8 and 9). Triene 1 ef underwent the same reaction,

5930

www.angewandte.de

 2010 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Angew. Chem. 2010, 122, 5928 5933

Angewandte
Table 3: Direct alkenylation of a-cinnamoyl ketene dithioacetals 1 e with terminal alkenes 2.[a]

Chemie

Entry

Product 4

Yield [%][b]

Entry

Product 4

Yield [%][b]

2a

82

2a

78

1 ea

2b

75

2a

60

1 ea

2c

73

10

1 ea

2d

71

2a

62

5[c]

1 ea

2f

62

2a

79

10

2a

59

[a] Conditions: 1 e (0.5 mmol), 2 (1.0 mmol), Pd(OAc)2 (20 mol %), AgOAc (1.0 mmol), DMF (2 mL), 50 8C, in air, 8 h. [b] Yield of isolated product. [c] 2 f (2.5 mmol).

forming tetraene 4 j (59 %; Table 3, entry 10). Trienes of type A were not detected from the reactions, thus suggesting that the C(4)H bond is much less reactive than the C(2)H bond in 1 e. This observation is rationalized by the electronic nature of the carboncarbon double bonds of 1 e, wherein polarization flows from the two electron-donating sulfur atoms to the electron-withdrawing carbonyl group[20] and makes C(2) more nucleophilic than C(4). Therefore, the C(2)H bond in 1 e can be more easily activated to couple with terminal alkenes 2. In addition, the C(5)H bond in 2-furyl or 2thienyl substrates is also more reactive than the C(4)H bond,
Angew. Chem. 2010, 122, 5928 5933

so that double alkenylation occurred at C(5) instead of C(4) in 1 e. The reaction of 1 and 2 is presumably initiated by formation of the organometallic ketene species B from the electrophilic attack of the catalyst precursor Pd(OAc)2 at C(2)H bond of a-oxoketene dithioacetal 1 (Scheme 2). Coordination of terminal alkene 2 to the metal center, followed by insertion of the coordinated carboncarbon double bond to the PdC bond forms species C which controls the stereochemical configuration of the products. bHydrogen elimination occurs to afford the desire