International Journal of Agricultural Science and Research (IJASR) ISSN 2250-0057 Vol.

3, Issue 2, Jun 2013, 295-308 TJPRC Pvt. Ltd.

CLONING AND INSILICO CHARACTERIZATION OF JUVENILE HORMONE EPOXIDE HYDROLASE GENE OF SPILARCTIA OBLIQUA
M. HEMA1, DADALA. M. MAMATHA2 & K. SWETHA KUMARI3
1 2 3

Associate Professor, Department of Virology, S. V. University, Tirupati, Andhra Pradesh, India

Associate Professor, Department of Sericulture, S. P. Mahila University, Tirupati, Andhra Pradesh, India

Junior Research Fellow, Department of Sericulture, S. P. Mahila University, Tirupati, Andhra Pradesh, India

ABSTRACT
Identifying new targets within the insect endocrine system for selective insect Pest control is one of the novel strategies that is to be established in India. Juvenile hormone (JH) pathway is one such, which has a major role in reproduction, metamorphosis and developmental functions where its disruption will lead to the interruption of insects development. Into this groove is the Juvenile hormone epoxide hydrolase (JHEH) protein which emerged as a promising bio pesticide. This JHEH protein is found to have great potential as an insecticide as it irreversibly degrades the insects JH pathway and disrupt all the major physiological processes of the insect pests and eventually leading to death of the pests. This paper presents the Cloning and Insilico characterization of JHEH gene from Bihar hairy caterpillar Spilarctia obliqua. V instar Bihary Hairy Caterpillar larvae fat bodies are stage specifically collected and cDNA library is generated. Designing degenerate and gene specific primers, JHEH has been cloned. The full-length JHEH gene sequence consists of 5 UTR with 27bp followed by single ORF corresponding to 1323bp and 3UTR with 85bp followed by a poly A tail (A)
25.

Insilico characterization deduced the protein of 440 amino acids with a short transmembrane region at N-terminus (1-

21aa). Phylogenetic analysis showed that this JHEH gene is having 39-47% homology with other lepidopteran insect pest JHEHs. Further analysis depicted presence of two major domains namely Epoxide Hydrolase (EHN) and Abhydrolase (ABH) domain. The Protein model developed has shown complete conserved motifs and active sites proving its correctness in cloning and for its activity.

KEYWORDS: Juvenile Hormone, Juvenile Hormone Epoxide Hydrolase, Gene Cloning, Spilarctia obliqua INTRODUCTION
Juvenile hormone (JH), a highly pleiotropic sesquiterpenoid insect hormone, is synthesized and released by the corpora allata (CA). The CA is ectodermally-derived endocrine glands generally located in the posterior of the head (Tobe and Stay, 1985). The CA does not store JH and consequently the rate of JH release is proportional to the rate of synthesis (Tobe and Stay, 1977). The structure of JH was first resolved by Roller et al., (1967) and subsequently several forms of JH, differing in the number of methyl and ethyl side chains has been identified in insects (Tobe and Stay, 1985). In general, all JHs possess a methyl ester and an Epoxide group. JH III is the most widespread form, found in Orthoptera, Coleoptera, Diptera, Hymenoptera, Dictyoptera, Lepidoptera, and the primitive ametamorphic Thysanura (Tobe and Stay 1985; Baker et al., 1984). Among insects JH is involved in a broad range of physiological processes including, pheromone production, caste determination of social insects, foraging behavior, phase polyphenism, diapause, vitellogenesis and metamorphosis (Smith and Schal, 1990; Park and Raina, 2004; Jassim et al., 2000; Dale and Tobe, 1986; Bruer et al., 2003; Shiga et al., 2003; Glinka and Wyatt, 1996; Truman et al., 2006 for examples). The basic pathways of JH metabolism were first illustrated by Slade and Zibitt (1971, 1972) and include ester hydrolysis and Epoxide hydration followed by conjugation.

296

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

These observations were expanded to other insects in surveys by Ajami and Riddiford (1971, 1973), and a host of subsequent workers. Hammock and Quistad (1976) subsequently worked by expanding early observations to a wider variety of insects and mammals, correlations of JH metabolism with developmental changes and a biochemical characterization of the JHEH protein involved from several organisms. Their works continue to expand yielding data on the regulation of JH metabolism and allowing development of a model of JH in vivo kinetics. In the hemolymph, JH can be metabolized by JH esterases (JHE) which covert JH to JH acid, and JH epoxide hydrolases (JHEH) which convert JH to JH diol. The result of both is the degradation of JH into JH acid diol (de Kort and Granger, 1996; Gilbert et al., 2000). While JHE and JHEH likely work in conjunction, research suggests that JHEH serves as the predominant route of JH metabolism in several insect species (Jesudason et al., 1990). Epoxide-containing compounds are ubiquitously found in the environment from both natural and man-made sources, and a large variety of aromatic and alkenic compounds are also metabolized to epoxides endogenously (Jerina DM. 1974, Oliw EH. 1994). An epoxide (or oxirane) is three-membered cyclic ether that has specific reactivity patterns owing to the highly polarized oxygen-carbon bonds in addition to a highly strained ring (Parker RE and Isaacs NS. 1959). The observation that both the mammalian mEH and sEH sequences are similar to a bacterial haloalkane dehalogenase and other related proteins was a key in suggesting that both EHs have a similar mechanism to the bacterial enzyme (Verschueren et al., 1993) and that they are members of the /-hydrolase fold family of proteins (Arand et al., 1994). All the enzymes in this family are characterized by a nucleophile-histidine-acid catalytic triad and have a two-step mechanism involving the formation of a covalent intermediate (Ollis et al., 1992, Holmquist et al., 2000). This suggested that these EHs hydrolyze epoxides through the formation of a hydroxyl alkyl-enzyme intermediate as described by Christophe Morisseau and Bruce. D. Hammock, in EH Mechanisms 2005.

Source: Christophe Morisseau and Bruce. D. Hammock, Epoxide Hydrolases: Mechanisms, Inhibitor Designs, and Biological Roles, Annu. Rev. Pharmacol. Toxicol. 2005. 45:311 33 Figure 1: Proposed Mechanism for Epoxide Hydrolase. (A) Two-Step Mechanism with the Formation of a Hydroxyl-Alkyl-Enzyme Intermediate (B) General-Based-Catalyzed Direct Hydration of the Epoxide

METHODOLOGY
Bioassays Stage Specific Tissue Collection from Spilarctia obliqua The Bihar hairy Caterpillar (Spilarctia obliqua) larvae were collected from fields and were reared under optimum conditions and disease-free state in the laboratory. Insect pests were closely monitored for head capsule rupture process, moulting behavior and duration, feeding and mating behavior and fecundity for complete life cycle and eggs were collected in a sheet. Under optimum conditions eggs were allowed to hatch and the larvae were reared. Based on the above external features, the pests that were collected from different climatic conditions and regions showed some variation in the 5 th and 6th instar of the larval stage. It was noted that Bihar hairy caterpillars collected from Andhra Pradesh and Karnataka are having 6 instars in its larval life cycle and the durations of the instars were observed under laboratory conditions. Two

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

297

rounds of bioassays were conducted to fix on the instar and larval duration and the stage specific fat body tissues are collected. 100 insect pests were maintained each time and weights were taken for each insect at each instar. Generally Juvenile hormone (JH) titers are high towards the mid of the last instar and it is at this stage the juvenile hormone epoxide hydrolase JHEH is secreted to bring down the JH levels. Thus, upon close monitoring on the moulting behavior of these pests, the fat bodies were isolated at day 1, 2, 3, 4 and 5 of the of the 6th instar larvae. The fat bodies are dissected, collected and preserved in RNA later preserved in RNA later (Ambion Inc.,) reagent for further analysis. Cloning of Juvenile Hormone Epoxide Hydrolase (JHEH) Gene Degenerate primers were designed based on the conserved JHEH sequences of related lepidopterans from Genbank and were shown in Table 1. Total RNA was isolated from the fat bodies collected at day 1, 2, 3, 4 and 5 of the last instar larvae using Trizol (Sigma) method. RNAs were checked on formaldehyde denaturing agarose gels. Intact single band was observed with respect to the rRNA profiles and the remaining small rRNAs were not visible in the gel. Total RNAs were quantified using UV-Spectrophotometer (Shimadzu). I strand cDNA was synthesized for the total RNA using the oligo dT primer and MMLV RT (Fermentas) and PCR was done using 6 sets of degenerate primer combinations with Phusion DNA polymerase (NEB). cDNAs were constructed for the day 3 and 4 of the last instar larval total RNA with different primer combinations that resulted in amplicons of expected sizes at different annealing temperatures. Using cDNA of sample 4, by changing the concentration of dNTPs, MgCl2 and annealing temperatures, conditions were standardized for getting specific amplicons and are selected for further cloning (shown in Figure 2). Generation of Full-Length JHEH Gene Sequence Combinations of gene specific and degenerate primers were designed, synthesized and used to walk along the gene (Table 2 & Figure 3A). Obtained overlapping amplicons of expected size (Figure 3B) were cloned into CloneJET vectors. The authenticity of the positive clones was tested by Colony PCR, restriction digestion analysis (Figure 3C, 3D and 3E) and DNA sequencing. The sequences obtained from the partial JHEH gene were aligned and it has 3UTR and partial ORF. This region was compared with the available Lepidopteran pest JHEH sequences in the database and observed homology with JHEH protein of insect pests.

Figure 2: Agarose Gel Analysis of JHEH Partial Gene Amplicons Arrows Indicate the Amplicons that were Selected for Cloning and Sequencing. Lane 1 and 10: Marker-1 kb Ladder (MBI Fermentas); 2-7: PCR Amplicons of Size Range (02-1.4 kb); 8: - Template (Negative Control); 9: - Primer (Negative Control); I-VI Represents the Primer Combinations that were Shown in the Table.1

298

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

To obtain 5end of the JHEH gene, 5RACE was performed. Gene specific primer (GSP 2R; Table 1) was designed based on the nucleotide sequence of the 5fastst clone and used to synthesize cDNA. The cDNA mixture was purified using QIA quick columns and used for tailing of dC using terminal nucleotidyl transferase (NEB). PCR amplification was carried using oligo d(G)14 as forward primer and a nested primer (GSP 6R;Table 1) specific to upstream sequences of the antisense RACE primer was used as reverse primer (Figure 4A). Amplified fragments were cloned (Figure 4B) and confirmed by restriction enzyme analysis (Figure 4C), nested PCR analysis (Figure 4D) and sequencing. The sequence obtained from RACE positive clone was aligned with the available partial sequence and contig (1460 nts) was generated which contains 27 nucleotides of 5 UTR followed by single ORF with 1323 nucleotides, 3UTR of 85 nucleotides and a poly A tail. BLASTx was performed on the obtained full-length Spilarctia JHEH nucleotide sequence and it showed 47% homology with Bombyx mori and 46% with Helicoverpa armigera indicating the authenticity of the generated Spilarctia JHEH sequence. The percentage identities between Lepidopteron pests JHEHs were shown in the Table 2. One set of gene specific primers (FL-FP & FL-RP; Table 1 & Figure 5A) were designed to amplify full-length JHEH gene and the other set (ORF-FP & ORF-RP; Table 1 & Figure 5A) with initiation codon, stop codon and restriction sites to amplify JHEH ORF (Figure 5B). These primers were used to amplify the full-length JHEH gene and ORF using proof reading enzyme (NEB) from the cDNA (that is stored at -70oC). These products were cloned into TA cloning vectors upon As addition and checked for restriction digestion (Figure 5C) using restriction sites at MCS and also by enzymes ( Bam HI, Eco RI and Hind III) that cut at internal portion of the gene (Figure 5D and 5E). Both strands of the full-length gene were sequenced completely using M13 forward and reverse primers and also using gene specific primers. Spilarctia JHEH ORF (named as SoJHEH) was released from the cloning vector using Sal I and Xho I restriction sites and subcloned into Sal I and Xho I cut pFASTBacI baculovirus transfer vector (Invitrogen) (Figure 6A) and the recombinant vector was named as pFast SoJHEH. Authenticity of the positive clones was checked by colony PCR (Figure 6B & 6C). Table 1: List of the Primers Used for the Amplification of the Full-Length JHEH Gene of Bihar Hairy Caterpillar (Spilarctia obliqua). The Sequence Underlined Represents the Sal 1 and Xho 1 Restriction Sites S. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Name of the Primer DMH 260 RP1 (GSP1) DMH 260 RP2 (GSP 2) DMH 650 RP3 (GSP 3) GSP-82 FP1 (GSP 4) 5RACE 82 RP1 (GSP 5) 5RACE 178 RP2 (GSP 6) 5RACE 400- RP3 (GSP 7) DMH DG 14-FP GSP 453 FP (GSP 8) GSP 608 FP (GSP 9) GSP 608 RP (GSP 10) JHEH ORF- FP JHEH ORF- RP BHC JHEH FL-FP BHC JHEH FL-RP Sequence of the Primer (5- 3) GTATGATAGCCCAATATTAC GATTGTAGTGATGCATCAAC GTGAGTCAGTCAATGCAATTC GACACTTCAATTCGAACTTTTAC GTAAAAGTTCGAATTGAAGTGTC CATATTCCCAATTGATACCTTCGAG CTATAGAATTCTCGAACAGATCCAG GGGGGGGGGGGGGG CATAATGGTATCGCACTTGAAATTG GAAGAGACTTGGTTTCAATCAG CTGATTGAAACCAAGTCTCTTC GTAGTCGACATGTATTCTCTGTTGGGTATATTTTTG GAACTCGAGCTAGGCTTTGTTGCATGTACCAC GACTTGTGCGACGATCAGAAAAC TATTTTAACCAACCTTTATTTGCCTGAC

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

299

Table 2: Table Showing Identity Scores among Different Homologues of Spilarctia JHEH (So-Spilarctia obliqua, Bm-Bombyx mori, Ha-Helicoverpa armigera, Dp-Daneus plexippus, Tn-Trichoplusia ni, Hv Heliothis virescens, Px- Papilio xuthus, Ms-Manduca sexta, Se-Spodopteara exigua, Tc-Tribolium castaneum, Nv-Nasonia vitripennis) Name So Bm Ha Dp Tn Hv Px Ms Se Tc Nv Insilico Characterization The deduced SoJHEH amino acid sequence when analyzed on BLASTp, indicated ~39 - 47% homology to all Lepidopteran JHEH sequences. The SoJHEH nucleotide and deduced amino acid sequence were shown in Figure 7. Multiple sequence alignment was performed with nearest homologues using ClustalW and the alignment was shown in the Figure 8A. The alignment showed that the Oxyanion Hole (HGXP motif+ Y298+Y353) and catalytic triad being conserved among different lepidopteran JHEH sequences, were also seen in SoJHEH sequence (Figure 8A). The phylogenetic analysis was done using ClustalW. The phylogenetic tree was constructed applying neighbor-joining method and was shown in the Figure 8B. Spilarctia obliqua JHEH has the closest relation with Manduca sexta JHEH followed by Bombyx Mori JHEH. The Transmembrane region prediction was done using BIOEDIT software. The putative transmembrane region has been identified to be conserved across all JHEHs showing it as a membrane bound protein. The plots were shown in Figure 9. The SoJHEH sequence primary structural analysis was done using PROTPARAM (http://web.expasy.org/protparam/). The SoJHEH protein sequence was subjected to domain search using Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan) and the domains were depicted (Figure 10) . The secondary structural analysis was done by SOPMA ( Self Optimized Prediction Method) (http://npsa-pbil.ibcp.fr/cgi bin/npsa_automat. So 48 45 46 45 42 39 40 40 38 38 Bm 48 100 58 59 63 67 41 46 46 46 41 Ha 45 58 100 55 73 62 46 48 52 50 46 Dp 46 52 63 100 59 65 67 49 51 50 48 Tn 45 63 73 55 100 61 46 49 41 46 45 Hv 42 67 62 65 61 100 48 53 52 50 49 Px 39 41 46 67 46 48 100 46 46 Ms 40 46 48 49 49 53 100 56 65 64 Se 40 46 52 51 41 52 46 56 100 53 Tc 38 46 50 50 46 50 46 65 47 100 48 Nv 38 41 46 48 45 49 64 53 48 100

pl?page=npsa_sopma.html). Further, the SoJHEH secondary structure was compared with respect to other Lepidopteran JHEH sequences. The secondary structural plots were shown in Figure 11. Homology modeling of protein was done on the deduced SoJHEH protein using SPDBV and GENO3D servers. Blast against structural database (PDB) showed highest homology with Mus musculus (PDB ID: 1CQZ) and used as a template for model building. Finally, the authenticated Spilarctia obliqua Full length JHEH gene sequence was submitted to NCBI and was released with an Accession Number KC148541.1

RESULTS AND DISCUSSIONS

From the bioassays conducted for the stage and tissue specific isolation of last instar, day 3 fat bodies of Spilarctia obliqua, a cDNA library was generated. This is the stage during the last stadium, where fat body JH III in vitro EH activity is highest (Kollapur et al., 1996). This cloned gene contained complete coding sequence of 1323 nucleotides, 5 UTR of 27nucleotides, 3 UTR of 85 nucleotides followed by a potential poly A tail of (A) 25. The correctness of gene cloning has been confirmed by amplifying the full length JHEH gene by gene specific primers (FL-FP & FL-FP, Table:1, Figure 5B). Second step confirmation has also been done by another set of primers (ORF-FP & ORF-RP; Table.1, Figure 5C) designed with Initiation codon, stop codon and restriction sites to amplify

300

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

complete JHEH ORF. TA cloning vector has been used upon A addition and check for restriction digestion (Figure 5C) using restriction sites at MCS and also by enzymes (Bam HI, Eco RI, Hind III) that cut the internal position of the gene (Figure 5D & 5E). Both the strands of the full length gene were sequenced completely using M13 forward and reverse primers and also using gene specific primers for further confirmation (Figure 5 - A, B, C, D & E).

Figure 3: Amplification of Overlapping Fragments of Spilarctia JHEH Gene by RT-PCR A. Schematic representation of the strategy followed to get the partial JHEH gene amplicons; Combinations of primers used were shown. B. PCR amplification of partial gene amplicons of Spilarctia JHEH with different combinations of degenerate and gene specific primers and the amplicons were loaded in lane 1-A1 of 550 bp; lane 2-A2 of 260 bp and lane 3A3 of 700 bp; M: 1 kb Gene Ruler (Fermentas) was loaded in all gels. C. Restriction enzyme analysis of A3 positive clones (Bam HI & Eco RI) and the release of 700bp inserts were shown in lanes 1 to 4 D. Restriction enzyme analysis of A2 positive clones (Bgl II) and the release of 260 bp inserts were shown in lanes 1 to 3 E. Restriction enzyme analysis of A1 positive clones ( Bam HI & Hind III) and the release of 350 bp and 150 bp inserts were shown in lanes 1 to 4. The two fragments were due to the internal cut by Hind III.

Figure 4: 5RACE Analysis of Spilarctia JHEH Gene

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

301

A. Schematic representation of the strategy followed for amplification of 5end of the Spilarctia JHEH gene; Combinations of primers used were also shown. B. PCR amplification of 5end of Spilarctia JHEH and lane 1 represents 1 kb Gene Ruler and lane 2 represents 5Race product (named as RP of 550 bp) C. Restriction enzyme analysis of RP positive clones (Bam HI & Eco RI) and the release of 550 bp inserts were shown in lanes 1 and 2 D. Nested PCR analysis of 5Race positive clone and lane 1, 2 and 3 represents 550 bp, 300 bp and 200 bp amplicons of RP The Spilarctia obliqua JHEH ORF was inserted with Sal I and Xho I restriction sites and the ORF has been released from the cloning vector using Sal I and Xho I restriction sites. This is subcloned into Sal I and Xho I cut pFastBacI baculovirus transfer vector (Invitrogen). Thus transformed pFAstBacI was named as pFastSoJHEH which has been confirmed by colony PCR and restriction digestion (Figure 6-B &C). The deduced SoJHEH aminoacid sequence yielded 440 aminoacids with a molecular weight of 49.5KDa, a theoretical pI of 6.32 and extinction coefficient of 75540 M-1 cm-1, at 280 nm measured in water. The instability index (II) was computed to be 41.27 which classify the protein as stable and the Grand average of hydropathicity (GRAVY) was calculated as 0.035.

Figure 5: Generation of Full-Length Spilarctia JHEH Gene and its ORF with Flanking Restriction Sites A. Schematic representation of full-length Spilarctia JHEH gene representing the 5UTR followed by single open reading frame (ORF) and 3UTR followed by poly (A) tail; Combinations of primers used were shown in the Figure .

B. PCR amplification of full-length Spilarctia JHEH gene and its ORF using gene specific primers with appropriate flanking restriction sites. Lane 1 shows the full-length JHEH gene of 1460 nts and lane 2 represents the coding region of Spilarctia JHEH of 1323 nts (named as SoJHEH). C. Restriction enzyme analysis of full-length JHEH (1460 nts) and its ORF (1323 nts) positive clones ( Kpn I and Sma I). The release of 1460 nts inserts were shown in lanes 1 - 4 and release of 1323 nts were shown in lanes 5-8 D. E. Schematic representation of recombinant pTZ57R/T vector harbouring full-length Spilarctia JHEH insert (1460 nts). JHEH unique internal restriction sites (Bam HI, Eco RI and Hind III) were shown in the Figure. Internal restriction site digestion analysis of full-length Spilarctia JHEH positive clone and the release of various fragments were shown in lanes 1-7: Enzymes used for digestion are Lanes 1-3, Bam HI, Eco RI and Hind III respectively; Lane 4 Bam HI/ Eco RI; Lane 5 Eco RI/Hind III; Lane 6 Bam HI/ Hind III and Lane 7 Bam HI/ Eco RI and Hind III (triple digest).

302

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

Figure 6: Subcloning of SoJHEH into Baculovirus Transfer Vector A. Schematic representation of SoJHEH subcloning into baculovirus transfer vector pFast BacI (Invitrogen) and the recombinant clone was named as pFast SoJHEH. B. Colony PCR analysis of suspected antibiotic resistant colonies using internal gene specific primers of SoJHEH showing the amplification of nested fragments of SoJHEH (320bp and 120bp) and the positive clones were shown in lanes 1 to 4. C. Restriction enzyme analysis of positive pFast SoJHEH clones (Sal 1 and Xho I). The release of 1323 nts inserts were shown in lanes 1 3. The deduced SoJHEH amino acid sequence showed 39 47% identity with all lepidopteran JHEH sequences. (Figure 8A & B). Along the phylogeny, the deduced protein has 47% of Identity with Bombyx mori JHEH sequence, 46% with Danaus plexippus, Trichoplusia ni and Papilio xanthus, followed by 45% identity with Helicoverpa armigera, 43% with Heliothis virescens and Spodoptera exigua and 40% identity with Tribolium castaneum and 39% with Manduca sexta. This analysis proved the existence of conserved sites, motifs, catalytic triads, which has been conserved among different lepidopteran JHEHs. This also shows the correctness of the cloning of SoJHEH gene. This enzymes functional catalytic triad has been conserved at Asp227 + His428 + Glu351, and oxyanion hole at HGFP (143-146) + Tyr298 + Tyr 373 amino acids. Further, Motif analysis depicted two important conserved domains viz., Epoxide Hydrolase domain (44 156aa) and AB Hydrolase domain (169 298aa) confirming that the obtained SoJHEH protein belongs to the family of Epoxide Hydrolases. Most of the known EHs are / Hydrolase fold enzymes despite a generally low sequence similarity. The common feature is that they share basic structure of / Hydrolase fold domain with a lid domain at the top (Arand et al., 1999a; Nardini et al., 1999; Zou et al., 2000). They possess a high conservation of the catalytic triad composed of Asp, Asp (or Glu in mEH) and His (Smit, 2004) consisting of a catalytic nucleophile and a charge relay system (Figure 1). This active site is located at the interface between the main domain and the lead domain. Two tyrosine residues protrude from the lid domain into the binding pocket. Since, the SoJHEH deduced protein shown to conserve the putative domains, catalytic triad (Asp227-His428Glu351) and the Oxyanion hole (HGFP-Y298-Y353) confirmed the conserved mechanism of Epoxide Hydrolysis of Juvenile Hormone.

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

303

The secondary structural analysis indicated a strong signal peptide (120aa), transmembrane region (1 21 aa) sequence at N-terminal indicating that it is a membrane bound protein. SOPMA analysis indicated that it is comprised of 168 amino acid residues as -helices (blue), 71 as extended strands (red), 17 -turns (green) and 184 as random coils (orange) out of 440 amino acids of SoJHEH. The homology model of SoJHEH protein with respective PDB template 1CQZ of Mus musculus (28% homology) indicated they both shared a common catalytic triad. The ramachandran plot of the modeled SoJHEH showed most aminoacids in favorable regions (Figure. 12A). The deduced model of SoJHEH protein with Qmean 4 score of 0.053 and Qmean Z score of -12.18, showed the conserved regions of the catalytic triad (Asp227-His428-Glu351) and oxyanion hole (HGFP-Y298-Y353) (Figure 12 A-C) indicating the conserved domain of Epoxide hydrolysis of Juvenile hormone. Insilico Analysis

Figure 7: SoJHEH Nucleotide and Protein Sequence

Figure 8: A. Multiple Alignment Using ClustalW Showing the Conserved Amino Acid Sequences of JHEHs and B. Phylogenetic Analysis of Lepidopteran Pest JHEH (Bm-Bombyx mori; Se-Spodoptera exigua; Ms-Manduca sexta; So-Spilarctia obliqua .* Indicates the Conserved Amino Acids among the JHEHs)

304

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

Figure 9: The Hydrophobicity Profiles (BIOEDIT) of SOJHEH to Check for the Conserved Transmembrane Region

Figure 10: Motif Analysis

Figure 11: SOPMA Analysis of SoJHEH Protein with Respect to Manduca and Bombyx

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

305

Figure 12: Homology Modeling of SoJHEH Protein A. Ramachandran plot for the predicted SoJHEH Protein structure, B. Modeled SoJHEH tertiary structure with domains and conserved motifs C. Mus musculus Epoxide Hydrolase (1CQZ) with Conserved domains and motifs

CONCLUSIONS
Thus, this study indicates that the Spilarctia obliqua Juvenile Hormone Epoxide Hydrolase had 47% homology with Bombyx morii followed by Trichoplusia ni and Papilio xanthus. The important active sites of an epoxide hydrolase that plays an important role namely catalytic triad and oxyanion hole are highly conserved in SoJHEH protein sequence indicating the epoxide hydration activity of JHEH on JH metabolism in Spilarctia obliqua.JHEH is one of the key enzymes controling JH concentration during insect development, which works mainly in haemolymph. JHEH plays a more important role, for two reasons: First, it is a non-secreted enzyme, that can decompose JHs to adjust the JH concentration appropriately in each organ at each developmental stage. Second, upon hydrolysis, JHEH yields JH diol, an irreversibly hydrolyzed metabolite. For these two reasons, JHEH can be further explored for its role as a novel strategy in insect Biocontrol.

ACKNOWLEDGEMENTS
We thankfully acknowledge the Department of Biotechnology (DBT), Government of India, Ministry of Science and Technology, India for the research support to carry out this work.

306

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

REFERENCES
1. Alfred M. Ajami, Lynn M. Riddiford, Comparative metabolism of the Cecropia juvenile hormone Journal of Insect Physiology Volume 19, Issue 3, March 1973, Pages 635645 2. Annu. Rev. Pharmacol. Toxicol. 2005. 45:311 33 doi: 10.1146/annurev.pharmtox.45.120403.095920

Copyright_c 2005 by Annual Reviews. All rights reserved First published online as a Review in Advance on September 22, 2004 3. Arand M, Grant DF, Beetham JK, FriedbergT, Oesch F, et al. 1994. Sequence similarity of mammalian epoxide Hydrolases to the bacterial haloalkane dehalogenase and other related proteins: implication for the potential catalytic mechanism of enzymatic epoxide hydrolysis. FEBS Lett. 338:25156 4. Arand M, Hemmer H, Durk H, Baratti J, Archelas A, Furstoss R. 1999a. Cloning and molecular characterization of a soluble epoxide Hydrolase from Aspergillus niger that is related to mammalian microsomal epoxide hydrolase. Biochem J 344:273280. 5. Arand M, Wagner H, Oesch F. 1996. Asp(333), Asp(495), and His(523) form the catalytic triad of rat soluble epoxide hydrolase. J Biol Chem 271:42234229. 6. Baker, F.C., Lanzrein, B., Miller, C.A., Tsai, L.W., Jamieson, G.C., Schooley, D.A., 1984. Detection of only JHIII in several life-stages of Nauphoeta cinerea and Thermobia domestica. Life Sciences 35, 15531560. 7. Bendena, W.G., Donly, B.C., Tobe, S.S., 1999. Allatostatins: a growing family of neuropeptides with structural and functional diversity. Annals of the New York Academy of Sciences 897, 311-329. 8. Breuer, M., Hoste, B., De Loof, A., 2003. The endocrine control of phase transition: some new aspects. Physiological Entomology 28, 3-10. 9. Bruce D. Hammock and Gary B. Quistad, Metabolism and mode of action of juvenile hormone, juvenoids, and other insect growth regulators, Progress in Pesticide Biochemistry, Volume I, 1981 10. Christophe Morisseau and Bruce D Hammock, Gerry Brooks and epoxide hydrolases: four decades to a pharmaceutical Pest Management Science Pest Manag Sci 64:594609 (2008) 11. Christophe Morisseau and Bruce D. Hammock, EPOXIDE HYDROLASES: Mechanisms, Inhibitor Designs, and Biological Roles Department of Entomology and U.C. Davis Cancer Center, University of California, Davis, California 95616; email: bdhammock@ucdavis.edu 12. Dale, J.F., Tobe, S.S., 1986. Biosynthesis and titre of juvenile hormone during the first gonadotrophic cycle in isolated and crowded Locusta migratoria females. Journal of Insect Physiology 32, 763769. 13. Dansette PM, Makedonska VB, Jerina DM. 1978. Mechanism of catalysis for the hydration of substituted styrene oxides by epoxide hydrase. Arch. Biochem. Biophys. 187:29098 14. de Kort, C.A.D., Granger, N.A., 1996. Regulation of JH titers: the relevance of degradative enzymes and binding proteins. Archives of Insect Biochemistry and Physiology 33, 126. 15. Gilbert, L.I., Granger, N.A., Roe, R.M., 2000. The juvenile hormones: historical facts and speculations on future research directions. Insect Biochemistry and Molecular Biology 30, 617 644.

Cloning and Insilico Characterization of Juvenile Hormone Epoxide Hydrolase Gene of Spilarctia obliqua

307

16. Glinka, A.V., Wyatt, G.R., 1996. Juvenile hormone activation of gene transcription in locust fat body. Insect Biochemistry and Molecular Biology 26, 1318. 17. Hammock BD and Quistad GB, The degradative metabolism of juvenoids by insects, in The Juvenile Hormones, ed. By Gilbert LE. Plenum Press, New York, NY, pp. 374393 (1976). 18. Holmquist M. 2000. Alpha/beta-hydrolase fold enzymes: structures, functions and mechanisms. Curr. Protein Pep. Sci. 1:20935 19. Jassim, O., Huang, Z-Y., Robinson, G.E., 2000. Juvenile hormone profiles of worker honey bees, Apis mellifera, during normal and accelerated behavioural development. Journal of Insect Physiology 46, 243 249. 20. Jerina DM. 1974. Biological formation and disposition of arene oxides. Lloydia 37:21218 21. Jesudason, P., Venkatesh, K., Roe, R.M., 1990. Haemolymph juvenile hormone esterase during the life cycle of the tobacco hornworm, Manduca sexta (L.). Insect Biochemistry 20, 593604. 22. Kallapur, V.L., Majumder, C., Roe, R.M., 1996. In vivo and in vitro tissue specific metabolism of juvenile hormone during the last stadium of the cabbage looper, Trichoplusia ni. Journal of Insect Physiology 42, 181 190. 23. Lynn M. Riddiford , Alfred M. Ajami, Purification and characterization of an ommochrome-protein from the eyes of saturniid moths, Biochemistry, 1971, 10 (8), pp 14551460 24. Nardini M, Ridder IS, Rozeboom HJ, Kalk KH, Rink R, Janssen DB, Dijkstra BW. 1999. The X-ray structure of epoxide hydrolase from Agrobacterium radiobacter AD1. J Biol Chem 274:14579 14596. 25. Oliw EH. 1994. Oxygenation of polyunsaturated fatty acids by cytochrome P450 monooxygenases. Prog. Lipid Res. 33:32954 26. Ollis DL, Cheah E, Cygler M, Dijkstra B, Frolow F, et al. 1992. The / Hydrolase fold. Protein Eng. 5:197211 27. Park, Y. I., Raina, A. K., 2004. Juvenile hormone III titers and regulation of soldier caste in Coptotermes formosanus (Isoptera: Rhinotermitidae). Journal of Insect Physiology 50, 561 566. 28. Parker RE, Isaacs NS. 1959. Mechanism of epoxide reactions. Chem. Rev. 264:931013 29. Rller, H., Dahm, K.H., Sweeley, C.C., Trost, B.M., 1967. The structure of juvenile hormone. Angewandte Chemie International Edition 6, 179180. 30. Roller, H., K. H. Dahm, C. C. Sweeley And B. M. Trost, 1967. The structure of the juvenile hormone. Angew. Chem., 6 : 179-180 31. Shiga, S., Hamanaka, Y., Tatsu, Y., Okuda, T., Numata, H., 2003. Juvenile hormone biosynthesis in diapause and nondiapause females of the adult blow fly Protophormia terraenovae. Zoological Science 20, 1199-1206. 32. Slade M and Zibitt CH, Metabolism of cecropia juvenile hormone in lepidopterans. Pestic Chem 3:4558 (1971). 33. Slade M and Zibitt CH, Metabolism of cecropia juvenile hormone in insects and in mammals, in Insect Juvenile Hormones: Chemistry and Action, ed. by Menn JJ and Beroza M. 34. Smit MS. 2004. Fungal epoxide hydrolases: New landmarks in sequence activity space. Trends Biotechnol 22:123129.

308

M. Hema, Dadala. M. Mamatha & K. Swetha Kumari

35. Smith, A.F. and Schal, C., 1990. Corpus allatum control of sex pheromone production and calling in the female brown-banded cockroach, Supella longipalpa (F.) (Dictyoptera: Blattellidae). Journal of Insect Physiology 36, 251257. 36. Tobe, S.S., Bendena, W.G., 1999. The regulation of juvenile hormone production in arthropods. Functional and evolutionary perspectives. Annals of the New York Academy of Sciences 37. Tobe, S.S., Stay, B., 1977. Corpus allatum activity in vitro during the reproductive cycle of the viviparous cockroach, Diploptera punctata (Eschscholtz). General and Comparative Endocrinology 31, 138-147. 38. Tobe, S.S., Stay, B., 1985. Structure and regulation of the corpus allatum. Advances in Insect Physiology 18, 305 432. 39. Truman, J.W., Hiruma, K., Allee, J.P., MacWhinnie, S.G.B., Champlin, D.T., Riddiford, L.M., 2006. Juvenile hormone is required to couple imaginal disc formation with nutrition in insects. Science 312, 1385 1388. 40. Verschueren KHG, Seijee F, Rozeboom HJ, Kalk KH, Dijkstra BW. 1993 Crystallographic analysis of the catalytic mechanism of haloalkane dehalogenase. Nature 363:69398 41. Yin, C.M., Zou, B.-X., Jiang, M., Li, M.-F., Qin, W., Potter, T.L., Stoffolano, J.G., 1995. Identification of juvenile hormone III bisepoxide (JHB3), juvenile hormone III and methyl farnesoate secreted by the corpus allatum of Phormia regina (Meigen) in vitro and function of JHB3, either applied alone or as part of a juvenoid blend. Journal Insect Physiology 40, 283292. 42. Zou J, Hallberg BM, Bergfors T, Oesch F, Arand M, Mowbray SL, Jones TA. 2000. Structure of Aspergillus niger epoxide hydrolase at 1.8 A resolution: Implication for the structure and function of the mammalian microsomal class of epoxide hydrolases. Structure 8:111 122.