On the Evolutionary Origins of the Cacti Author(s): Mark A. Hershkovitz and Elizabeth A.

Zimmer Reviewed work(s): Source: Taxon, Vol. 46, No. 2 (May, 1997), pp. 217-232 Published by: International Association for Plant Taxonomy (IAPT) Stable URL: http://www.jstor.org/stable/1224092 . Accessed: 02/12/2012 11:34
Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp

.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact support@jstor.org.

International Association for Plant Taxonomy (IAPT) is collaborating with JSTOR to digitize, preserve and extend access to Taxon.

http://www.jstor.org

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

217

On the evolutionaryorigins of the cacti A. Zimmer2 & Elizabeth MarkA. Hershkovitz1l2

Summary Hershkovitz, M. A. & Zimmer, E. A.: On the evolutionary origins of the cacti. - Taxon 46: 217-232. 1997. - ISSN 0040-0262. evolutionaryresponsesof plantsto desertenvironmentsdependsupon phylogenetic Understanding knowledge of desertplants.The diverse Americandesertfamily Cactaceae has been presumed,on the basis of distinctiveness,to be phylogenetically isolated and relatively ancient (> 65 million years old). Using maximum likelihood and parsimonyanalyses of the rapidly evolving internal transcribedspacer (ITS) sequences of nuclear ribosomalDNA (nrDNA), we show that the cacti are phylogeneticallynested among other aridity-adapted lineages of the angiospermfamily Portulacaceae. The ITS divergencebetween pereskioidcacti and the genus Talinum(Portulacaceae) is less than that between many Portulacaceae genera. Synthesis of the ITS data with morphological c. 30 million years ago, and chloroplastDNA evidence suggests an origin of cacti in mid-Tertiary, and a later Tertiarydiversificationcoincident with developmentof the American desert. This, in turn, implies that the diversificationrate in cacti was much higher than in their nearestrelatives. The present results illustrate the central role of phylogenetic reconstructionin ecological and evolutionarytheory.

Introduction

1500 species in c. 100 generaand threesubfamilies,CactaWith approximately ceae representone of the most conspicuousand diverse angiospermfamilies of 1981;A. C. Gibson& Nobel, 1986;Mauseth,1990; warm,aridAmerica(Cronquist, Barthlott& Hunt, 1993; Rzedowski, 1993). Cactus diversity is most obvious in vegetative habit, which encompassesleafy shrubs and trees, columnars,barrels, of photosynthetic stems into forms cacti, and elaborations pricklypears, Christmas also fronds and Cacti are diverse and in chemically agave plants. resemblingpalm & Hunt, theirarrayof pollination (A. C. Gibson& Nobel, 1986;Barthlott syndromes the time of origin 1993). This diversityposes severalbiologicalquestions,including rate. Cactussuccess in aridenvironments also invites investigaand diversification tion into ecological stimuli and their effects on adaptiveresponsesand speciation. We considerhere the most fundamental question,phylogeneticoriginsof cacti and on cactusdiversification. the implications orderCaryophyllales Cactaceaeare membersof the unequivocally monophyletic & which includes 12-18 traditional 1993; Thome, 1994), (Bittrich, Cronquist are characterized families comprisingc. 10,000 species. Caryophyllales by distinctive floral, vegetative,embryological, chemical,and physiologicaltraitscommonly to universallypresentwithin the order, and rare or absent in other angiosperms 1981;Bittrich,1993).Mostnotableamongthesetraitsis the replacement, (Cronquist, of the flavonoid-derived with tyrosine-derived in most Caryophyllales, anthocyanins
National Center for Biotechnology Information(Genbank),National Libraryof Medicine, Bldg. 38A, National Institutesof Health, 8600 Rockville Pike, Bethesda,MD 20894, U.S.A. 2 Laboratoryof Molecular Systematics, Museum SupportCenter,MRC534, SmithsonianInstitution,Washington, DC 20560, U.S.A.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

218

TAXON 46 - MAY 1997

betalainpigments,which do not occurin any otherplants.AlthoughCaryophyllales aredistributed world-wide in all kindsof terrestrial habitats andfeature essentiallyall life forms,they are especiallydiversein aridenvironments angiosperm (Cronquist, 1981). In additionto cacti, the orderincludesAizoaceae,especiallydiversein Afri"the most important can deserts, and Chenopodiaceae, family of the desert flora [world-wide]" (Shmida,1985). Opinionshave varied widely regarding phylogenyof Caryophyllales, including the positionof cactitherein(Takhtajan, 1980;Cronquist, 1981;Rodman& al., 1984; A. C. Gibson & Nobel, 1986; Hershkovitz,1989; Rodman, 1990, 1994; Thorne, 1992; Bittrich, 1993; Barthlott& Hunt, 1993; Cronquist& Thorne, 1994; A. C. Gibson, 1994; Leins & Erbar,1994; Turner,1994; Clement& Mabry,1996). The basal positionof subfamilyPereskioideaeamongcacti, however,is well evidenced & Hunt, 1993). Except 1986;Barthlott (A. C. Gibson& Nobel, 1986;Leuenberger, for the presenceof typicalcactusthorns,flowers,andareoles(pubescent short-shoots wherethornsarise),somePereskiaspeciesappear as ordinary dicotyledonous woody carboxylase large subunit(rbcL)DNA seplants.Analysesof ribulosebisphophate DNA (cpDNA) restriction lengthpolymorphisms fragment quencesand chloroplast corroborate evidence for the basal position of pereskioids (RFLPs) morphological amongcacti(Wallace,1995). & Hunt, 1993), cacti have been Althoughthere are no relevantfossils (Barthlott the lateCretaceous, 65-90 millionyearsago (mya), ascribedan originduring perhaps the of Gondwana (Axelrod, 1979; Shmida, 1985; break-up immediatelyfollowing of cacti amongotherdesertangiosperms has Mauseth,1990). The relativeantiquity and the degreeof taxobeen presumedon the groundsof boththeirdistinctiveness to be impliedby theirfamily-level(or sometimesordernomic isolationpresumed rank Axelrod(1979) (Axelrod,1979;Shmida,1985).In addition, level) classificatory of cacti was evidenced that the other desert taxa) by their antiquity (among argued to have occurrencein non-desert vegetationthought geologicallyprecededmodern Americandeserts.Nonetheless,the relativerecency of modernAmericandeserts, hence much of moderncactus habitats,is widely acknowledged(Axelrod, 1979; Mauseth,1990). The presentpaperfocuses on evidenceof cactusoriginsrevealedby phylogenetic analyses of Portulacaceae(Carolin,1987; Hershkovitz,1993), which have someas closely allied with the familiesCactaceae,Basellaceae,and times been regarded Didiereaceae(Luitolf, 1969;A. C. Gibson& Nobel, 1986;Hershkovitz, 1991, 1993; & Rettig, 1994;Rodman,1994).Portulacaceaeinclude400Bittrich,1993;Manhart southern 450 mostlyfleshy-leaved Africa, speciesdistributed mainlyin the Americas, of of morphological characters andAustralia (Carolin,1993).Cladisticinterpretation with most of the traditional Portulacaceaehad suggestedrelationships incongruent it taxonboundaries 1993).Coincidentally, (Carolin,1987;Hershkovitz, supraspecific fromthe American" the taxa into a "western primarily groupdistributed partitioned American/African" andan "eastern cordillera American westward, group,distributed primarilyfrom the Americancordilleraeastwardand in Africa. The easternand and mediterto warm/arid as adapted westerngroupsmight be aptly characterized climaticconditions, respectively. ranean/alpine ceae, Didiereaceae (collectively, the portulacaceousalliance or portulacaceous families) were relatedto, specifically,membersof the easternAmerican/African
The Portulacaceae analysis also indicated that the families Cactaceae, Basella-

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

219

Portulacaceae,with which they sharetwo leaf traitsand copiousmucilageproducthe nodalpubescence tion (Hershkovitz, 1993).In addition, typicalof cacti is similar a base number x = 9. Pereskia characterized chromosome to that of easterntaxa by of taxa from the combination differ other other cacti) portulacaceous by species (and in and numerous woodier their habit,thorns, tepal (sepals petals,intergrading cacti) whorls, specialized ovary, and chromosomebase numberx = 11. The same, or taxa, but only one or two in a given similar,traits occur in other portulacaceous 1993). species (Hershkovitz, & in Caryophyllales using rbcL (Manhart relationships Analyses of interfamilial Rettig, 1994) and RFLPsof the cpDNA invertedrepeat(Downie & Palmer,1994), as conservative bothregarded markers, yieldedequivocalresultson the phylogenetic few the alliance.Both of the included of portulacaceous representatives monophyly from and included Pereskia Portulaca,and these apsamples analyses, however, in in the Taxon as sister-taxa cladograms. sampling these molecularanalyses peared in the were assumedto dethat familial circumscriptions Caryophyllales suggests and limit phylogenetically divergentanalyticalunits. The independent substantially never of this has been evidence,but it by phylogenetic validity assumption supported of familialrelationships had been taken for grantedin many investigations among cladisticones (Hershkovitz, 1989).Morphological analysis including Caryophyllales, of relationships 1993) suggestedthatthis family amongPortulacaceae(Hershkovitz, otherwords,while these taxa are traditionally recognizedas families,an analysisof shouldbe conceptually envisionedas an infrafamilial theirrelationships phylogenetic chose to explorethese relationships using a relativelyrapidly problem.We therefore the two internal transcribed spacersequences(ITS1 and evolving molecularmarker, the three and 5.8s, 26s) of the nuclearriboso(18s, ITS2) separating codingregions mal DNA (nrDNA;Baldwin& al., 1995).
Materials and methods was not phylogenetically distinct from Cactaceae, Basellaceae or Didiereaceae. In

DNA isolation. - Total genomic DNA from fresh, frozen (>70?C), or, rarely, was isolatedusing a CTABprotocol(Miltaceae, and selectedotherCaryophyllales numberof reprecipitation steps adjustedin varioustaxa to improveyield and PCR sources of plantmaterial The arelistedin Table 1. In some cases, plant amplification. were received from collectors who were unableto providevoucherspefragments cimens. The identity of these as well as of voucheredmaterialwas verified on basesby the firstauthor. Datafor unvouchered material were included morphological in the analysis because they help documentportulacaceous nrDNA-ITSsequence diversity and behaved in the phylogeneticanalysis as predictedon the basis of evidence. morphological and the Australiancalandrinias are here regardedas generically Phemeranthus distinct from, respectively,Talinumand Calandrinia(Carolin,1987; Hershkovitz, for the Phemeranthus combinations 1993). Nomenclatural species includedin this in footnotesto Table1. analysisareprovided fied using the primerpairs:(1) ITS4 (Baldwin,1992) and ITS5 modifiedfor plants
PCR amplification, cloning, and DNA sequencing. - The ITS regions were ampliligan, 1992), with the amount of tissue, concentrations of CTAB, NaCl, EDTA, and silica gel-dried tissue of species of Portulacaceae, Basellaceae, Didiereaceae, Cac-

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

220

TAXON 46 - MAY 1997

Table 1. Sources of plant materials and sequence accession numbers. The list below includes living collection accession numbers, vouchers, and other specimen documentation. The identityof all plant materials was determined by the first author. New combinations in Phemeranthus are validated in footnotes.
Taxon Alluaudia dumosa Drake Alluaudia proceraDrake L. Amaranthus retroflexus Anacampserosaustraliana J. M. Black Anacampseroskurtzii Bacig. Anacampserosquinaria E. Meyerex Fenzl subsp. Anacampserosrecurvata buderiana(Poelln.)Gerbaulet Anacampserossp. 1 Source1/voucherinformation2 UCDBCB67.568, Mar1997, Stone (DAV) UCDBCB59.147, unvouchered Sep 1993, Hershkovitz (US) unvouchered, fragmentreceivedfromFerguson, in cultivation by firstauthor ZSS 92-1903, Kirschnek 7203 (ZSS) UCDBCB90.315, unvouchered3 UCDBCB81.171, Mar1997, Stone (DAV) UCDBC 90-1239, unvouchered, fragment receivedfromHogan- Argentina, Prov.Jujuy, Hogan3669 UCBG95-0913; unvouchered, fragment receivedfromHogan- SouthAfrica,Cape Prov.,Hogan4265b unvouchered, fragmentreceivedfromFerguson, in SouthAfrica reportedly originating Mar1997, Stone (DAV)3 UCDBCB86.4873 ZSS, 5 Nov 1992, Roosli(ZSS) UCDBCB81.998;Mar1997, Stone (DAV) 14 Oct 1992, Hershkovitz (US) Sequence accession L78011 L78084 L78085 L78013 L78063 L78012 L78014 L78059

Anacampserossp. 2 (? Anacampseros) Anacampserossp. 3 (? Anacampseros) Anrederacordifolia (Ten.)Steenis Basella alba L. Basella excavata Scott-Elliot spectabilisWilld. Bougainvillea 'Camarillo Festival' affinisGilliesex Am. Calandrinia Calandrinia ciliataDC.

L78016

L78015 L78086 L78018 L78019 L78087 L78020 L78021 L78050 L78022 L78023

1993, Hershkovitz (US) F. Muell.4 cultivated from Calandrinia seed, ex West 4244 (CANB) ptychosperma Merxm. & ZSS 90-1396; Mar1987, Lavranos&Bleck(ZSS) Ceraria longipedunculata Podlech Ceraria namaquensisPearson & Stephens Ceraria pygmaea Pillans albumL. Chenopodium Cistanthedensiflora(Barneoud) Hershkovitz UCBG95-0919, unvouchered, fragment receivedfromHogan- SouthAfrica,Cape Prov.,Hogan4353 ZSS 89-2123; Lavranos&Bleck27238 (ZSS) (US) Sep 1993, Hershkovitz 22 Nov 1987, Peralta&Kiesling (MERL)

L78044 L78088 L78025 L78062 L78026 L78024

Cistanthequadripetala (S. Watson) 1993, Hershkovitz (US) Hershkovitz cultivated fromseed, ex Ford 12230 (MO) Cistanthesp. (? Cistanthe; mucronulata Calandrinia Meyen.) cultivated fromseed, ex Ford746 (MO) Cistanthesp. (? Philippiamra Hershkovitz) (Philippi)

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

221

Table 1 (continued).
Taxon Cistanthetweedyi(A. Gray) Hershkovitz Source'/voucher information2 UCBG89-1408, unvouchered, fragment receivedfromHogan- U.S.A.,Washington, Kittitas Co., Hogan 1173 Sequence accession L78089

megarhiza(A. Gray)Parry Hershkovitz (US) Claytonia ex S. Watson Grahamia bracteataGilliesex Hooker elegans M. Bieb. Gypsophila LewisiacanteloviiJ. T. Howell 27 Nov 1992, Peralta&Hershkovitz (US) Hershkovitz (US) UCBG89-1364, unvouchered, fragment receivedfromHogan- U.S.A.,California, PlumasCo., Hogan 1047 Hershkovitz (DAV)3 UCBG89-1472, unvouchered, fragment receivedfromHogan- Argentina, Prov.Chubut, Hogan3935 UCBG89-1429, unvouchered, fragment receivedfromHogan- Argentina, Prov. Neuquen,Hogan3886 Sep 1994, Hershkovitz (WS) Sep 1993, Hershkovitz (WS)

L78027 L78028 L78090 L78029

LewisiaredivivaPursh Maihuenia & patagonicaBritton Rose Maihuenia poeppigii(Ottoex Pfeiffer) F. A. C. Weberex Schumann L. Mirabilisjalapa L. Mollugoverticillata

L78030 L78031

L78091

L78092 L78093 L78034 L78032 L78033 L78035 L78036

Montia parvifolia (Moc.)E. Greene Hershkovitz (photo,US)3 D. I. cultivated fromseed, ex Ford424b (MO) Montiopsis gayana (Barneoud) Ford umbellata(Ruiz& Montiopsis Pavon) D. I. Ford Pereskia aculeata Miller Pereskia grandifolia Haw. cultivated fromseed, ex Ford12535 (MO) UCDBCB59.064, Mar1997, Stone (DAV) Yolo Co., unvouchered, U.S.A.,California, of California, campus of University Davis, Hershkovitz3 ZSS 92-1623, Eggli&Nyffeler 2005 (ZSS) UCBG89-1418, unvouchered, fragment receivedfromHogan- U.S.A.,Arizona, CoconinoCo., 5 Sep 1988, Zadnik UCBG90-1500, unvouchered, fragment receivedfromHogan- U.S.A., New Mexico, HidalgoCo., Ferguson 1081 Sep 1993, Hershkovitz (WS) UCBG89-1406, unvouchered, fragment receivedfromHogan- U.S.A.,Washington, GrantCo., Hogan 1170 ZSS 92-1793, Wong(ZSS) UCBG90-0986, unvouchered, fragment receivedfromHogan- Argentina, San Juan Province,Hogan3508 Sep 1993, Hershkovitz (US)

& Rose PereskiopsisporteriBritton Phemeranthusbrevifolius (Torr.) Hershkovitz5 Phemeranthusconfertiflorus (E. Greene) Hershkovitz6 PhytolaccaamericanaL. Phemeranthusspinescens (Torr.) Hershkovitz7 Portulacamolokiniensis Hobdy Portulaca jacobseniana Rowley

L78037 L78038

L78039

L78041 L78040

L78046 L78045

Portulaca oleracea L.

L78047

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

222

TAXON 46 - MAY 1997

Table 1 (continued).
Taxon L. Portulacaquadrifida Portulacasp. (aff.P. quadrifida) afraJacq. (variegated Portulacaria form) armiana Van Jaarsv. Portulacaria Source'/voucher information2 ZSS 81-1227; 1981, Stunzi(ZSS) ZSS 90-1917, 1986, Taylor (ZSS) UCDBCB59.096, Mar1997, Stone (DAV) UCBG95-0922, unvouchered, fragment receivedfromHogan- SouthAfrica,Cape Prov.,Hogan4325.1c Sep 1993, Hershkovitz (US) unvouchered, fragmentreceivedfromHogan Rauh32242 (HEID) Sequence accession L78048 L78049 L78042 L78043

Stellariamedia (L.)Vill. Talinaria palmeriBrandegee Baill. boiviniana Talinella

L78051 L78052 L78053 L78054 L78058 L78055 L78094 L78056 L78057 L78095 L78060

Talinella sp. (T. aff. grevei Danguy) 1989, Roosli&Rechberger(ZSS) frutescensA. Gray unvouchered, fragmentreceivedfromHogan Talinopsis Mexico,Ferguson 1372 Eckl.& ZSS 93-2096, 17 Mar1960, Bally(ZSS) caffrum Talinum (Thunb.) Zeyh. Talinum (US) (Jacq.)Gaertn. Hershkovitz paniculatum Talinum paraguayenseSpeg. Asch. ex Talinum portulacifolium Schweinf. (Pallas) tetragonioides Tetragonia Kuntze 3636 (MO) cultivated fromseed, ex Zardini ZSS 89-2123, Lavranos (ZSS) (WS) Sep 1994, Hershkovitz

3534 (ZSS) Xenia vulcanensis(Anon)Gerbaulet ZSS 90-4035, Leuenberger

and plant explorer,Universityof CaliforniaBotanical Garden,Berkeley, Hogan: S. B. Hogan, horticulturist and plant explorer, Mesa Gardens,P.O. Box 72, CA 94720, U.S.A.; Ferguson:D. Ferguson,horticulturist Belen, NM 87002, U.S.A. 2 The following abbreviationsare used (in additionto standardherbariumacronyms):UCBG, University of of CaliforniaBotanicalGarden,Berkeley, CA 94720, U.S.A.; UCDBC, BotanicalConservatory, Department der Stadt Zurich, Plant Biology, University of California, Davis CA 95616, U.S.A.; ZSS, Gartenbauamt StadtischeSukkulenten-Sammlung, Mythenquai88, CH-8002 Zurich,Switzerland. 3 materialis presentin the collection of the first author. Spirit-preserved 4 Morphologicalanalysis (Carolin, 1987; Hershkovitz,1993) indicatesthat the Australianspecies classified in Calandrinia s.l. are not closely relatedto this genus and are best segregated.Carolin(1987, 1993) proposed that Rumicastrum Ulbrich, describedas a genus of Chenopodiaceae,was the oldest available name for the Wilson (1984) also commentedthatthis genus apparently Australiancalandrinias. belonged to Portulacaceae. Neither Carolin nor Wilson commentedon the synonymy between the type, R. chamaecladum(Diels) Ulbr. (syn. AtriplexchamaecladaDiels) and any species of Portulacaceae.Accordingto W. Greuterand B. Zimmer (pers. comm., Feb 1997), a specimen from the type locality of A. chamaecladawhich fits Ulbrich's (admittedly non-portulacaceous)descriptionof Rumicastrumdoes not appear to be, if portulacaceousat all, an Australian calandrinia.Given this situation, the first authoragrees with Greuterand Zimmer's assessment underRumicastrum. that, pendingadditionalresearch,it is unadvisableto recombineAustraliancalandrinias 5 = in Sitgreaves, Rep. Torr. Phemeranthus brevifolius (Torr.)Hershkovitz,comb. nov. Talinumbrevifolium Exp.: 156. 1853. 6 Phemeranthus E. Greene in confertiflorus (E. Greene) Hershkovitz,comb. nov. = Talinumconfertiflorum Bull. TorreyBot. Club 8: 121. 1881. 7 Phemeranthus spinescens (Torrey) Hershkovitz,comb. nov. _ Talinumspinescens Torr., U.S. Expl. Exp. 17: 250. 1874.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

46 - MAY1997 TAXON

223

or (2) 26A (Suh & al., 1993) and Nncl8S10 (GGAAGGAGAAGTCGTAACAAGG); 4-21 of the modified Cloned or direct amplification products were ITS5). (bases in both directions either manual or automated protocols. For the sequenced using manual protocol, single-stranded DNA (both coding and non-coding) was derived via asymmetric amplification of 2 1l of crude double-stranded amplification product using the ITS4 or N18L18 (AAGTCGTAACAAGGTTTC) primer. 7-deaza-dGTP was substituted for dGTP in order to relax secondary structure in the single-stranded sequencing template. Asymmetric amplification products were purified according to the Gene Clean protocol (Bio 101, Inc.) and sequenced with the primers ITS3 (Baldwin, 1992), C58S (Suh & al., 1993), ITS4, and N18L18, following the Sequenase version 2.0 protocol (U.S. Biochemical) for the 7-deaza-dGTP reagent kit and 35SdATP labelling. Sequencing reactions were electrophoresed and the gels exposed to radiographic film according to standard protocols. Automated sequencing used the same primer set and followed the dye-terminatorcycle-sequencing protocol for the ABI model 373A sequencer (Applied Biosystems, Inc.). Chromatogramswere analysed using Sequencher (Gene Codes, Inc.). For apparently ITS-polymorphic taxa, double-stranded amplification product was ligated and cloned following the T/A cloning protocol (Invitrogen, Inc.) and double-stranded products amplified directly from recombinant colonies were sequenced as described above. The sequences analysed in this paper are available in the public databases (e.g., GenBank) and have accession numbers L48800, L49495, L78011-L78060, L78062L78095. Sequence analysis. - Sequences were aligned manually with the aid of the GDE version 2.2 (Smith, 1994) multiple sequence editor. A data matrix of alignable sites (available from the first author upon request) was analysed using maximum likelihood (ML), maximum parsimony (MP), and minimum evolution (ME) algorithms in prerelease test versions of PAUP* 4.0 (Swofford, 1997). Some sites were alignable in only a subset of the taxa, with the remainder scored as missing. For MP analysis, aligned gaps were treated as a fifth characterstate, but were scored as such only once per insertion/deletion (indel) per sequence, with the remaining gap positions scored as missing. This procedurehas the same effect as treating each of the analysed indels, regardless of length, as a single independent character. MP trees were generated using the tree bisection-reconnection (TBR) swapping algorithm, with 100 trees held during each step of stepwise taxon addition. One thousand bootstrap replicates were performed with 10 trees held at each step of random taxon addition, with MAXTREES set at 100. ML searches were performed with stepwise taxon addition and TBR swapping using a general time-reversible (GTR) base substitution model with among-site rate heterogeneity (gamma rates). Relative substitution rates and the gamma rate shape parameter (a) were estimated from the data using an arbitrarily selected MP tree. ML branch-lengths and parameterestimates ignored missing data (gaps and ambiguities). ME searches were performed using stepwise addition, TBR swapping, and log-det distances underthe invariantsmodel (a fractionof constant sites removed proportionallyto base frequencies estimated from constant sites; Swofford & al., 1996) and GTR distances with gamma rates. Distance for missing data in pairwise comparisons was extrapolatedfrom the distance inferred from non-missing data. Because ITS sequences were relatively homogeneous among the western American Portuwere includedin the phylogeneticanalysis. lacaceae, only threerepresentatives

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

224

TAXON 46 - MAY 1997

: BASELLACEAE

Australian calandrinia

western American taxa ....:::

DIDIEREACEAE anacampseroids

... ......::

\ ,,,, , ,.,~~!':, ,.

iiii

Talinum caffrum CACTACEAE

Portulaca

AIZOACEAE Tetragonia tetragonioides

MOLLUGINACEAE Mollugo verticillata CHENOPODIACEAE Chenopodium , album

I.

PHYTOLACCACEAE Phytolacca americana

k

Mi bilis jalapai /

Bougain- M\ / villea spectabilis \

NAM ANTHACEAE laranthus Am retroflexus

A An JIA

Gypsophila Stellaria media elegans NYCTAGINACEAECARYOPHYLLACEAE

Fig. 1. Clustal W guide tree (phenogram) for ITS sequences of Caryophyllales. The portulacaceous taxa, including Cactaceae, Basellaceae, and Didiereaceae, are clustered relative to representativesfrom other families. Shaded groupings are the same as those delimited in Fig. 2.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

225

in unalignable Because analysesof alignedpositionsignoresinformation regions, se was examined the tree feature of CLUSTAL W (T. J. using guide alignabilityper as a preliminary Gibson & al., 1994). The guide tree, prescribed phylogeneticestibased on optimal mate for iterativemultiplesequencealignment,is a phenogram The distances are scores. andcorrections non-additive, inherently pairwisealignment rates are not allowed. Nevertheless,this for distance and variabletransformation of estimatingsimilaritybetweenentirelength-variprocedureoffers the advantage & Zimmer,1996). The guide tree analysisincludedall able sequences(Hershkovitz of the taxa listed in Table 1. The data consisted of contiguousITS1 and ITS2 for the essentiallyuninforby a decamerof N's as placeholders sequencesseparated mative 5.8s sequence. Gap-opening/-extension penalties of 9/0.1 were estimated from gap frequenciesper sequencelength and gap lengths in an alignmentof 40
western American Portulacaceae. Results

PCR productsfromamplifiedITS regionsof abouthalf of the total sampledtaxa

of Cactaceae, Basellaceae, Didiereaceae, and eastern American/African Portulaca-

to preventdirect sequencing.Sequencingof ceae were sufficientlyheterogeneous in these taxa revealedthat the infragenomic cloned amplification variants products non-functional were mainly of two types: (1) obviouslydegenerate, copies, as eviin highly conservedITS and 5.8s denced by numerousindels and/orsubstitutions & Lewis, 1996;Hershkovitz & Zimmer,1996);and(2) trivial positions(Hershkovitz one to a few indelsand/orsubstitutions variantscontaining which,uponcomparison of the firsttype acrosstaxa,showedno usefulphylogenetic signal.Sequencevariants were not includedin the analysis.For variantsof the second type, one variant,if possible the least divergentfrom relatedtaxa, was selectedfor the analysis.In one two ITS variants to be sp. 2 (sect. Anacampseros), appeared sample,Anacampseros at from each other informative normal potentially yet positions, sufficiently divergent in the analysis. Bothof thesewere included as to be functional. ITS regionsequences(including5.8s) are variablein length(585Portulacaceous of all the sequencesexpanded 625 bp). The alignment to 713 bp, becauseindelswere situatedin differentpositionsin differenttaxa. Only about60 % of these 713 base positions aligned in all taxa. Positionsnot alignableacross all taxa, however, are highly alignablewithintaxon subsets.Thus, the guide-treedemonstrates clustering ITS sequences,as well as clusteringof portulacaamong groupsof portulacaceous ceous taxa among Caryophyllales (Fig. 1). Branchlengthsin Fig. 1 reflect optimal pairwisesequencesimilarity.Becausethis calculation (numberof identitiesdivided by numberof bases) excludes gap positions,branchlengthssuggest "divergences" amongportulacaceous sequencesas greatas amongthe non-portulacaceous sample. Thereare no formal"robustness" but the strongestclustershave low divercriteria, of the nexthigherorder. gence bothabsolutelyandrelativeto the branch In all of the phylogeneticanalysesof the alignableportionsof the sequences,the & Hunt,1993;Wallace,1995),forma discrete (A. C. Gibson& Nobel, 1986;Barthlott lineage emergingfrom a poorly resolved bush. The trees could not be outgrouprootedunambiguously basedon availableITS or independent & (e.g., rbcL;Manhart Rettig, 1994) evidence.
cacti, including four from Pereskioideae and one (Pereskiopsis) from Opuntioideae

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

226

TAXON 46 - MAY 1997

~~ ~~ ~ ~~ ~~~ ~~ ~ ~~~~~~~~~~

-L

Basellaceae

I
o
0

63

-Alluaudia dumosa Dldlereaceae Alluaudia (11Ispp.) procera Portulacaria afra 7 Portulacaria armiana Ceraria namaquensis PCBDclade 9j jL Ceraria pygmaea Ceraria longipedunculata 40 spp.
I

78
78 i

0 0 0
*

71 73 73 71 71 70

Talinum caffrum

.1
99
99

-I
anacampserolds (37spp.) Anacampseros sp. 1

99

Grahamia bracteata Xeniavulcanensis frutescens 0 Talinopsis Talinaria o palmeri * sp. 3 7599 Anacampseros * Anacampseros sp. 2B * Anacampseros sp. 2A B buderiana * A. recurvata 98 Anacampseros quinaria * 75' australiana Anacampseros V 100 P oleracea Portulaca molokiniensis Portulaca Portulaca jacobseniana P Portulaca quadrifida aff. quadrifidax=9 cade Portulaca
77 -annd

J~'.

76

kurtzii Anacampseros

U 77 U 74 U 66
68

77

81
79 75

73 77
74 I -.11 47 46

50 51 59

LTalinum paniculatum Talinella aff. 9reyei Talinella boiviniana I alinum portulacifolium . Talinum paraguayense Pereskiopsis porteri
97 Pereskia grandiflora Maihuenia patagonica aihuenia poeppigii I?D I6

0 0 0 Cactaceae
1500 spp.

60 62 64

60
56 54
61 626 58

07

Pereskiaaculeata

100 7
95 76
IIIClnr

Phemeranthus spinescens
Phemeranthus brevifolius

PA W clade
200 spp.

Phemeranthus confertiflorus
iCalandrinia ptychosperma

0 0 0
V

62
63

62
54

istanthedensiflora Cistanthe tweedyi Montia parvifolia

-

western American taxa

(125 spp.)

U 58 0 56 0 48

NorthAmerica * SouthAmerica V Australia * Hawaii

E

P Pantropical

O Madagascar

* Southern Africa

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

227

Fig. 2 shows the midpoint-rooted ML tree (-In likelihood = 4649.87), which was derived using six reversible relative substitutionrate parameters(A-C = 1; A-G = 2.4; A-T = 1.3; C-G = 0.8; C-T = 4.5; G-T = 1) and a gamma rate shape parameter (a = 0.42). These parameterswere rounded from likelihood estimates derived from a maximum parsimony (MP) tree. Fig. 2 also indicates branches recovered in > 50 % of 1000 unweighted parsimony bootstrapreplicates. For the MP analysis, 209/582 aligned sites were informative; 60/209 were scored as gaps in at least two taxa; and 141/209 included at least one missing data point. The 24 MP trees (not shown) had length (1) = 851, consistency index excluding autapomorphies (CI) = 0.52; retention index (RI)= 0.73; and rescaled consistency index (RC) = 0.42. Under the ML model parametersabove, their -In likelihood values were 4653.98-4664.58. For comparison,underparsimony,the ML tree has 1= 863, CI = 0.51, RI = 0.72, and RC = 0.41. The MP and ML trees were topologically similar and united cacti, most Talinum species, and the x = 9 portulacaceous taxa (Portulaca and the "anacampseroid" clade). In the MP strict consensus, Talinum caffrum, cacti, and the remaining Talinum species are successive outgroups to the x = 9 clade. MP and ML both diagnosed "PAW" (Phemeranthus, Australian calandrinias,western taxa) and "PCBD" (Portulacaria, Ceraria, Basellaceae, Didiereaceae) clades. The x = 9 and PCBD clades are supported by morphology (Hershkovitz, 1993); their modest bootstrap support derives in part from differential GC contents in Portulaca versus the anacampseroids and the labile position of the Talinum caffrum sequence, which is strikingly different from other Talinum sequences (cf. Fig. 1). The bootstrap analysis strongly supports the anacampseroidclade, but the present work does not adequately analyse relationships among these taxa. Aside from poor sampling among the African members (cf. Gerbaulet, 1992), considerable ITS polymorphism was encountered in this group. Although infragenomic variants in all but one taxon appeared to be either degenerate copies or only trivially diverged, the possibility remains that additional paralogs exist and/or that lineage sorting has occurred (cf. Baldwin & al., 1994). Nonetheless, the present data do seem to support Gerbaulet's segregation of the Argentinian Xenia vulcanensis from Anacampseros. Unfortunately, Gerbaulet did not analyse the Argentinian Anacampseros kurtzii nor another possibly distinct Argentinian anacampseroid(Anacampseros sp. 1 in Fig. 2). The present analysis does not show these as sister to Xenia vulcanensis, although the markedly different GC contents might have caused spurious branchattractions. The ME trees (not shown) yielded the clades recovered by > 70 % MP bootstrap values, but the phylogenetic arrangements among some of these were inconsistent with morphology (e.g., anacampseroids nested between Basellaceae and Didiere-

maximumlikelihood(ML ) tree of ITS region sequences for 44 Fig. 2. Midpoint-rooted The taxa. branches show all recoveries> 50 % from 1000 unweighted portulacaceous parsimony bootstrapreplicates.The shaded and boxed groupingscircumscribelineages that include all but 22 portulacaceous Talinella,and the unsampledCalyptrospecies (Talinum, theca, Amphipetalum, Hectorella, and Lyallia; the last two sometimes segregated as are approximated & Hunt, 1993; Carolin,1993; Hectorellaceae).Species numbers (Barthlott to the rightof the treeindicate distribuHershkovitz, 1993). Symbolsandnumbers geographic tions andpercentGC contentof aligned,parsimony-informative sites.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

228

TAXON 46 - MAY 1997

aceae). Moreover,ME trees scored poorly underML and parsimonycriteria(-In likelihood= 4678.72 and 4756.51, 1 = 881 and 895, for log-det and GTR, respecthe spuriousresultsto distancedistortion from heterogeneous tively). We attribute and rates (in the case of GTR) base compositions(Swofford & al., evolutionary the distancesbetweenPereskiaaculeata 1996), both evidentin Fig. 2. Nevertheless, andTalinum GTR: 0.05) areless thanthose betweenany (log-det:0.11; paniculatum of the examinedTalinumspecies and any otherexaminedPortulacaceae(log-det: 0.13-0.32;GTR:0.06-0.19). The ITS data indicatethat the genetic divergenceof CactaceaefromPortulacaceae is equalto or less thanthatbetweenmanyPortulacaceae genera.This interpretationfollows fromthe Fig. 2 divergencepattern, of which cactusneighregardless Further resolutionof cactus originswill hinge upon bour is the exact sister-group. analyses of Portulacaceaeat the specific and generic levels. The ITS trees also has been greater andmorerapidthanin any of the suggestthatcactusdiversification lineages.The PAWclade (Fig. 2), not likely to be the well-supported portulacaceous immediate cactussisterbasedon morphological evidence(Hershkovitz, 1993), is the next most diverseclade, with c. 200 species distributed amongnine generaand 32 taxa. Still, this clade includesonly c. 1/8 as many species as Cactaceae. subgeneric herbaceous the westerntaxa are all low-growing Moreover, species, c. 100 of which are sufficientlysimilarto once have been assignedto the single genus Calandrinia 1993). (Hershkovitz, of the aboveresultsat the Fifth International Congressof Followingpresentation in Werner Greuter and Evolutionary Biology Budapest(Aug 1996), Systematic to the a Ltitolf the first author existence of thesis alerted (1969), which by kindly concludedthat Cactaceaewere especiallyclosely relatedto Portulaca.This work of Caryophyllales considerations has not been cited in any subsequent apparently Ltitolf the of cacti therein. and/or (1969) examphylogeneticposition relationships the ined floral anatomyin Pereskia and 10 species of Portulacaceaerepresenting as precociously the, Montiopsis,and Lewisia.Ltitolfs conclusionscan be regarded that time on cactus at accurate (see, e.g., Cronquist, originsprevalent given opinions sister is the cactus conclusion that Portulaca the Nonetheless, group is not 1968). evidencedby the rDNA dataand conflictswith otherevidencethatPortulacais the Pereskiaonly with a Ltitolfcompared sistergroupof the anacampseroids. Moreover, Geesink's(1969, The ITS datacorroborate Portulaca,P. grandiflora. large-flowered 1987) opinionthatthis and otherlarge-flowered species alliedwithPortulacapilosa in the presentdataby P. jacobseniana)arederivedin the genus,andthat (represented the basalspecieshadmuchsmallerflowers,as in P. quadrifida (cf. Fig. 2).
Discussion genera Portulaca, Anacampseros,Talinum,Portulacaria,Lewisia, Calandrinia,Cistan-

Previous speculations(Axelrod, 1979; Shmida, 1985; A. C. Gibson & Nobel, 1986; Mauseth,1990) have supposedthat cacti must have evolved before or at the beginning of the Tertiaryperiod, immediatelyfollowing the separationof South AmericafromAfrica.This wouldaccountfor the absenceof endemiccacti in Africa taxonomicisolationof cacti from otherCaryophyllales and the presumed (Axelrod, the time allowedto achievemoderncactus 1979; Shmida,1985), while maximizing a andcpDNA datado not support diversity.Synthesisof the ITS with morphological

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

229

cactus origin,at least on the basis of taxoor early Tertiary presumedpre-Tertiary nomic or phylogenetic isolation. Lacking definitive palaeontologicalcalibration, however,the moleculardatado not providea clock for datingthe cactusdivergence. A guide tree representingdiverse angiosperms(Hershkovitz& Zimmer, 1996) allianceITS sequencesthan showed slightly higherhomogeneityof portulacaceous of which are recordedin some in Rosaceae subfamilyMaloideae, representatives 35 and basal 40 Eocene(c. mya) late-middle Oligocene(c. mya)deposits(Axelrod& ITS homogeneitywas comparable alliance Raven, 1985). Likewise,portulacaceous as such in the middle first recorded tribe for to thatapparent Asteraceae, Lactuceae, for woody rates estimated RbcL 18 Miocene(c. mya;Cronquist, evolutionary 1981). Portulacathe date would & and herbaceous species (Albert al., 1994) angiosperm Pereskiasplit at 72-330 mya (woodyrate)or 40-55 mya (herbaceous rate).The more ancientestimateis virtuallyinconceivableconsideringthe fossil-basedestimateof as a whole (Crane& al., 1995). of angiosperms 90-130 mya for the majorradiation rbcL trees show branchlength ITS and Caryophyllales Both the portulacaceous rateshave not been conhowever,which indicatesthatthe evolutionary asymmetry, estimator of be a stant(clocklike),so thatthe sequencedivergences misleading might divergence. temporal taxa The collective phylogeneticevidenceand presenthabitatsof portulacaceous above to Cactaceae Miocene late Eocene to corroborate seem by originssuggested rates notwithITS homogeneity,variableevolutionary comparisonsof angiosperm to of plantsadapted coincidentradiations standing.The ITS tree (Fig. 2) illustrates = and and the x cacti climates and 9, PAW, arid, mediterranean, alpine (derived disandgeographic PCBD clades,excludingBasellaceae).Portulacaceous outgroups occubutthe moder habitats remainunknown, andecologicaladaptations tributions taxa were formedduringthe Miocene or later pied by the derivedportulacaceous taxa as a whole have a & (Axelrod Raven, 1978; Axelrod, 1979). Portulacaceous distribution "Gondwanan" (endemicgenerain SouthAmerica, pattern superficially and southern Australia; Africa,Madagascar, Fig. 2), whichmightsuggesta pre-Ternumerous 5000-15000km disjunctions, across The low ITS divergences tiaryorigin. derive from relativelyrecent however, suggests that many, if not all, disjunctions long-distancedispersals.Morphologyprovidesadditionalreasonto assume recent sevand distantdispersalamongclosely relatedspecies of Talinum, Phemeranthus, eral westerngenera(Carolin,1993; Hershkovitz,1993), and probablya substantial & Hunt, 1993). Thus,cacti numberof cacti (A. C. Gibson& Nobel, 1986;Barthlott taxa probably and otherportulacaceous belongto the categoryof deserttaxa whose and Quaterto late Tertiary and diversitycan be attributed distributions present-day nary geoclimatic events that formed modem arid habitats,providingunoccupied of immigrants, and harsh,unstableconditionsthatproniches for the establishment motedspeciation(Axelrod,1979;Shmida,1985). Whileit is likelythatmuchearlier could have accommodated many cacti (especiallyPereskia), Tertiaryenvironments there remainsno evidencethatthese habitatswere so occupied.Finer-levelgenetic the extentto which cacti growingin semi- and nonanalysisshouldhelp determine desert vegetationrepresentthe immediateantecedentsof forms better adaptedto of plantsthat had sucdescendants aridity(Axelrod, 1979) or, rather,opportunistic less favourable desert habitats. cessfully conquered reliedon a presumed close accountsof evolutionary Pre-cladistic phytogeography taxonomicassignmentsand rankswith biotic divergence correlationof traditional

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

230

TAXON 46 - MAY 1997

patterns and ages (Stevens, 1986). Cactaceae, an importantphytogeographic element in American deserts, provide a hallmark example in which classificatory rank has misled phytogeographic interpretation. (Cactaceae and other traditional Caryophyllales families also provide an example of how emphasis on rank has misled attempts at explicitly cladistic reconstruction, e.g., Rodman & al., 1984, Rodman, 1990; cf. Hershkovitz, 1989, 1991). Similar misinterpretationscould be avoided by adhering to a strictly cladistic criterion at all levels of hierarchical classification (Stevens, 1986; Queiroz & Gauthier, 1992; Panchen, 1992), but the challenge of implementing this criterion is underscoredby the universal acceptance of Portulacaceae and Cactaceae at familial rank, especially as phylogeny of intertwined portulacaceous taxa remains unresolved, perhaps unrecoverably so. Nevertheless, the present data illustrate the value of phylogenetic investigation for testing and advancing hypotheses of the vegetational history of deserts and other well-defined, often biotically and physically well-characterizedhabitats.
Acknowledgements

We are indebtedto Dave Swoffordfor access to and permission to publishresultsusing versionsof PAUP*4.0, andto the NIH-National Cancer Research FredeInstitute, pre-release and GeneticsComputer rick, MD, for access to theircomputers Groupsoftwareused during the course of this project. We gratefullyacknowledgeE. Dean, U. Eggli, D. Ferguson, H. Forbes,D. Ford,S. Hogan,H. T. Metcalfe,I. Peralta, J. Rohwer,andM. Stonefor providI. Peralta for field assistance; and V. Bittrich,U. Eggli, T. ing and/orvoucheringspecimens; Glenn,R. Nyffeler, J. Sullivan,and G. L. Websterfor helpfulcommentson the manuscript. Finally, we thank W. Greuterand B. Zimmerfor their carefuland promptediting of our manuscript. Literature cited J. R., Mishler,B. D. & Albert,V. A., Backlund,A., Bremer,K., Chase,M. W., Manhart, constraints and rbcL evidence for land plant phylogeny. Nixon, K. C. 1994. Functional
Ann. Missouri Bot. Gard. 81: 534-567. Axelrod, D. I. 1979. Age and origin ofSonoran Desert vegetation. San Francisco.

- & Raven,P. H. 1978. LateCretaceous andearlyTertiary vegetation historyof Africa.Pp.

77-130 in. Werger, M. J. A (ed.), Biogeography and ecology of Southern Africa. The

Hague. - & - 1985. Originsof the cordilleran flora.J. Biogeogr.12:21-47. transcribed Baldwin,B. G. 1992. Phylogenetic utilityof the internal spacersof nuclearribosomal DNA in plants: an example from the Compositae. Molec. Phylogenet. Evol. 1: 3-16.

- , Sanderson, M. F., Campbell, C. S. & Donoghue,M. M. J., Porter, J. M., Wojciechowski, J. 1995. The ITS region of nuclearribosomalDNA: a valuablesource of evidence on W. & Hunt,D. R. 1993. Cactaceae.Pp. 161-197 in: Kubitzki,K., Rohwer,J. & Barthlott, to Centrospermae. K., Rohwer,J. & Bittrich,V. 1993. Introduction Pp. 13-19 in. Kubitzki, Austral. R. C. 1987. A reviewof the familyPortulacaceae. J. Bot. 35: 383-412. Carolin, - 1993. Portulacaceae.Pp. 544-545 in. Kubitzki,K., Rohwer,J. G. & Bittrich,V. (ed.), a systematic Clement,J. S. & Mabry,T. J. 1996. Pigmentevolutionin the Caryophyllales. overview.Bot.Acta 109:360-367.
Families and genera offlowering plants, 2. Berlin. Bittrich, V. (ed.), Thefamilies and genera of vascular plants, 2. Berlin. Bittrich, V. (ed.), Thefamilies and genera of vascular plants, 2. Berlin. angiosperm phylogeny. Ann. Missouri Bot. Gard. 82: 247-277.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

TAXON 46 - MAY 1997

231

Crane, P. R, Friis, E. M., & Pedersen, K. R. 1995. The origin and early diversification of angiosperms. Nature 374: 27-33. Cronquist, A. 1968. The evolution and classification offloweringplants. Boston. - 1981. An integrated system of classification offlowering plants. New York. - & Thorne, R. F. 1994. Nomenclatural and taxonomic history. Pp. 1-26 in: Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. Downie, S. R. & Palmer, J. D. 1994. A chloroplast DNA phylogeny of Caryophyllales based on structuraland inverted repeat restriction site variation. Syst. Bot. 19: 236-252. Geesink, R. 1969. An account of the genus Portulaca in Indo-Australia and the Pacfic. Blumea 17: 275-301. - 1987. Theory of classification of organisms. Pp. 91-126 in: Vogel, E. F. de (ed.), Manual of herbarium taxonomy. Jakarta. Gerbaulet, M. 1992. Die Gattung Anacampseros L. (Portulacaceae), I. Untersuchungen zur Systematik. Bot. Jahrb. Syst. 113: 477-564. Gibson, A. C. 1994. Vascular tissues. Pp. 45-74 in. Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. - & Nobel, P. S. 1986. The cactus primer. Cambridge, MA. Gibson, T. J, Thompson, J. D., & Higgins, D. G. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties, and weight matrix choice. Nucl. Acids Res. 22: 4673-4680. Hershkovitz, M. A. 1989. Phylogenetic studies in Centrospermae. a brief appraisal. Taxon 38: 602-608. - 1991. More Centrospermae. I: The portulacaceous alliance. II: The phytolaccaceous alliance and the chen-ams. III: The caryophyllaceous alliance, Aizoaceae, odd taxa, and summary. Amer. J. Bot. 68 (6, 2): 191-192. - 1993. Revised circumscriptions and subgeneric taxonomies of Calandrinia and Montiopsis (Portulacaceae) with notes on phylogeny of the portulacaceous alliance. Ann. Missouri Bot. Gard. 80: 333-365. - & Lewis, L. A. 1996. Deep-level diagnostic value of the rDNA-ITS region. Mol. Biol. Evol. 13: 1276-1295. - & Zimmer, E. A. 1996. Conservation patterns in angiosperm ITS2 sequences. Nucl. Acids Res. 24: 2857-2867. Leins, P. & Erbar,C. 1994. Putative origin and relationships of the order from the viewpoint of developmental flower morphology. Pp. 303-316 in: Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. Leuenberger, B. E. 1986. Pereskia (Cactaceae). Mem. New YorkBot. Gard. 41: 1-141. Lutolf, G. A. 1969. Beziehungen zwischen Portulacaceae und Cactaceae. PhD thesis, University of Zirich. Manhart, J. R. & Rettig, J. H. 1994. Gene sequence data. Pp. 235-246 in. Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. Mauseth, J. D. 1990. Continental drift, climate, and the evolution of cacti. Cact. Succ. J. (Los Angeles) 62: 301-308. Milligan, B. G. 1992. Plant DNA isolation. Pp. 59-88 in: Hoelzel, A. R. (ed.), Molecular analysis ofpopulations. Oxford. Panchen, A. L. 1992. Classification and the nature of biology. Cambridge, U.K. Queiroz, K. de & Gauthier, J. 1992. Phylogenetic taxonomy. Annual Rev. Ecol. Syst. 23: 449-480. Rodman, J. E. 1990. Centrospermae revisited, part 1. Taxon 39: 383-393. - 1994. Cladistic and phenetic studies. Pp. 279-302 in: Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. , Oliver, M. K., Nakamura, R. R., McClammer, J. U. & Bledsoe, A. H. 1984. A taxonomic analysis and revised classification of Centrospermae. Syst. Bot. 9: 297-323.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions

232

TAXON 46 - MAY 1997

Rzedowski, J. 1993. Diversity and origins of the phanerogamic flora of Mexico. Pp. 129-146 in. Ramamoorthy, T. P., Bye, R., Lot, A. & Fa, J. (ed.), Biological diversity of Mexico, New York. Shmida, A. 1985. Biogeography of the desert flora. Pp. 23-78 in: Evenari, M., Noy-Meir, I. & Gooddall, D. (ed.), Ecosystems of the world, 12A. Amsterdam. Smith, S. 1994. GDE, version 2.2. Urbana, IL. Stevens, P. F. 1986. Evolutionary classification in botany, 1960-1985 [sic]. J. Arnold Arbor. 67: 313-339. Suh, Y., Thien, L. B., Reeve, H. & Zimmer, E. A. 1993. Molecular evolution and phylogenetic implications of internal transcribed spacer regions of ribosomal DNA in Winteraceae.Amer. J. Bot. 80: 1042-1055. Swofford, D. L. 1997. PAUP*: phylogenetic analysis using parsimony (and other methods). Sunderland,MA. In press. - , Olsen, G. J., Waddell, P. J. & Hillis, D. M. 1996. Phylogenetic inference. Pp. 407-514 in. Hillis, D. M. & Moritz, C. (ed.), Molecular Systematics. Sunderland,MA. Takhtajan, A. 1980. Outline of the classification of flowering plants (Magnoliophyta). Bot. Rev. (Lancaster) 46: 225-359. Thorne, R. F. 1992. An updated phylogenetic classification of the flowering plants. Aliso 13: 365-390. Turner, B. L. 1994. Chromosome numbers and their phyletic interpretations.Pp. 27-44 in: Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin. Wallace, R. S. 1995. Molecular systematic study of the Cactaceae. using chloroplast DNA variation to elucidate cactus phylogeny. Bradleya 13: 1-12.

This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AM All use subject to JSTOR Terms and Conditions