Sie sind auf Seite 1von 7

Enzyme and Microbial Technology 46 (2010) 506512

Contents lists available at ScienceDirect

Enzyme and Microbial Technology


journal homepage: www.elsevier.com/locate/emt

A xylanase with broad pH and temperature adaptability from Streptomyces megasporus DSM 41476, and its potential application in brewing industry
Zhenhua Qiu a,b,1 , Pengjun Shi a,1 , Huiying Luo a , Yingguo Bai a , Tiezheng Yuan a , Peilong Yang a , Suchun Liu b , Bin Yao a,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing 100081, PR China b Department of Nutrition and Food Hygiene, Hunan Agricultural University, Changsha, Hunan 410128, PR China

a r t i c l e

i n f o

a b s t r a c t
A xylanase gene, xynAM6, was isolated from the genomic DNA library of Streptomyces megasporus DSM 41476 using colony PCR screening method. The 1440-bp full-length gene encodes a 479-amino acid peptide consisting of a putative signal peptide of 36 residues, a family 10 glycoside hydrolase domain and a family 2 carbohydrate-binding module. The mature peptide of xynAM6 was successfully expressed in Pichia pastoris GS115. The optimal pH and temperature were pH 5.5 and 70 C, respectively. The enzyme showed broad temperature adaptability (>60% of the maximum activity at 5080 C), had good thermostability at 60 C and 70 C, remained stable at pH 4.011.0, and was resistant to most proteases. The Km and Vmax values for oat spelt xylan were 1.68 mg ml1 and 436.76 mol min1 mg1 , respectively, and 2.33 mg ml1 and 406.93 mol min1 mg1 for birchwood xylan, respectively. The hydrolysis products of XYNAM6 were mainly xylose and xylobiose. Addition of XYNAM6 (80 U) to the brewery mash signicantly reduced the ltration rate and viscosity by 36.33% and 35.51%, respectively. These favorable properties probably make XYNAM6 a good candidate for application in brewing industry. 2010 Elsevier Inc. All rights reserved.

Article history: Received 19 November 2009 Received in revised form 28 January 2010 Accepted 9 February 2010 Keywords: Xylanase Streptomyces megasporus Yeast expression Mashing

1. Introduction Xylan is one of the major components of hemicelluloses in plant cell walls, and is the second most abundant polysaccharide after cellulose [1]. In nature, complete hydrolysis of xylan requires the synergistic action of different xylanolytic enzymes, including endoxylanase, -xylosidase, and accessory enzymes, such as -arabinofuranosidase, acetyl esterase, and -glucuronidase. Among them, endo--1,4-xylanase (EC 3.2.1.8) is very important to catalyze the hydrolysis of long-chain xylan into short xylooligosaccharides [2,3]. In recent years, many kinds of xylanases have been isolated from various microorganisms including bacteria, actinomyces, fungi and yeasts [4]. Up to now, several xylanase genes have been cloned, and over-expression of xylanases in recombinant systems has been attempted [5]. Among them, Streptomyces belonging to actinomycetes produce multiple xylanases with different physicochemical properties, including an extracellular xylanase from Streptomyces lividans 1326 [6], xys1 from Streptomyces halste-

dii JM8 [7], STX-I from Streptomyces thermoviolaceus OPC-520 [8], Xyl30 from Streptomyces avermitilis CECT 3339 [9], XynAS9 from Streptomyces sp. S9 [10], and XynAS27 from Streptomyces sp. S27 [11]. Microbial xylanases have been applied in many industries, including animal feed, baking, paper and pulp, waste treatment and brewing [1,1214]. To meet the specic industrys needs, an ideal xylanase should equip with specic properties, such as good pH and thermal stability, high specic activity, and strong resistance to metal cations and chemicals, are also pivotal factors to the applications. This study describes the cloning, characterization, and over-expression of a new xylanase gene from Streptomyces megasporus DSM 41476 in Pichia pastoris. This enzyme belongs to family 10 of glycoside hydrolases and shows excellent adaptability to acidic to alkaline pHs and mesophilic to moderately halophilic temperatures and superior pH and thermal stability.
2. Materials and methods 2.1. Stains, vectors, media and chemicals S. megasporus DSM 41476 was purchased from the German Resource Centre for Biological Material (DSMZ). Escherichia coli Top10 (TransGen, Beijing, China) cultivated at 37 C in Luria-Bertani medium was used as the host for gene cloning and sequencing. P. pastoris GS115 (Invitrogen, Carlsbad, CA, USA) cultivated at 30 C in yeast extract peptone dextrose medium was used as the host for gene expres-

Corresponding author. Tel.: +86 10 82106053; fax: +86 10 82106054. E-mail address: yaobin@caas-bio.net.cn (B. Yao). 1 These authors contributed equally to this work. 0141-0229/$ see front matter 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2010.02.003

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512 sion. Plasmids pEASY-T3 (TransGen) and pPIC9 (Invitrogen) were used as vectors for cloning and expression, respectively. Oat spelt xylan and birchwood xylan were purchased from Sigma (St. Louis, MO, USA). Media for selection of positive transformants and growth and induction of P. pastoris competent cells including regeneration dextrose base medium (RDB), minimal dextrose medium (MD) or minimal methanol medium (MM), buffered glycerol complex medium (BMGY) and buffered methanol complex medium (BMMY) were prepared according to the manual of the Pichia Expression kit (Invitrogen). The kits for genomic DNA extraction and purication, and plasmid isolation were purchased from TIANGEN (Beijing, China). The restriction endonucleases, T4 DNA ligase, LA Taq DNA polymerase, dNTP and GC buffer I were purchased from TaKaRa (Tsu, Japan). Other chemicals were of analytical grade and commercially available. 2.2. Cloning of the xylanase-encoding gene xynAM6 Genomic DNA of S. megasporus DSM 41476 was isolated and used as template for PCR amplication. The core region of the xylanase gene from S. megasporus DSM 41476 was amplied by the degenerate primers (GH 10F and GH 10R) specic for GH 10 xylanases from Streptomyces as described by Li et al. [10]. The PCR conditions were as follows: 5 min at 94 C, followed by 30 cycles of 95 C for 30 s, 45 C for 30 s, and 72 C for 30 s. The resulting PCR products were puried and ligated into vector pEASY-T3, transformed into E. coli Top10 cells for sequencing, and subjected to BLAST analysis. To obtain the 5 and 3 anking regions of the core region, a modied Thermal Asymmetric Interlaced (TAIL)-PCR with the GCAD and nested insertion-specic primers [15,16] was performed with an annealing temperature (Tm ) of 60 C. All PCR products with appropriate size were puried in 1% agarose gels, sequenced and assembled to obtain the full-length xylanase gene, denoted as xynAM6. 2.3. Sequence analysis The sequence assembly was performed using the Vector NTI Suite 7.0 software, and the nucleotide sequence was analyzed using the NCBI ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The signal peptide was predicted using SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/). Homology searches in GenBank were performed using the BLAST server (http://www.ncbi.nlm.nih.gov/BLAST). Multiple alignments of protein sequences were performed using the CLUSTAL W program (http://www.ebi.ac.uk/clustalW/) [17]. 2.4. Expression of xynAM6 in P. pastoris The gene fragment for mature protein without the signal peptide coding sequence was amplied using expression primers M6picF and M6picR (Table 1) and cloned into the EcoRINotI site of pPIC9. The recombinant plasmid, pPIC9xynAM6 was linearized using BglII and transformed into P. pastoris GS115 competent cells using a Gene Pulser XcellTM Electroporation System (Bio-Rad, Hercules, CA, USA) at 2.5 kV and 4.8 ms. One milliliter of ice-cold 1 mM sorbitol solution was then immediately added, and the transformed cells were grown on RDB plates at 30 C until colonies appeared, then transferred to MM and MD plates and grown for 2 days at 30 C to ensure purity. The positive transformants were cultivated in 3 ml of BMGY and grown at 30 C for 48 h with constant agitation (220 rpm). The

507

cells were pelleted by centrifugation and resuspended in 1 ml BMMY (pH 6.0) containing 0.5% methanol for induction at 30 C for 48 h. The cell-free supernatants were collected for xylanase activity assay. Transformants with the highest xylanase activity was selected for the high-yield fermentation in 1 l shake asks containing 300 ml BMGY medium under the same conditions as described above. Xylanase activity in the supernatant was assessed at 12 h intervals during the induction phase. 2.5. Purication and identication of XYNAM6 To purify the recombinant XYNAM6, the culture supernatant was concentrated by progressive addition of solid ammonium sulfate to 80% of saturation. The precipitate was harvested by centrifugation and resuspended in 20 mM TrisHCl buffer (pH 8.0) and dialyzed against the same buffer with three changes. Undissolved material was removed. The crude supernatant was loaded onto a HiTrap Q Sepharose XL 5 ml FPLC column (GE Healthcare, Uppsala, Sweden) equilibrated with the same buffer. Proteins were eluted using a linear gradient of NaCl (01.0 M) in the same buffer. Fractions having enzyme activity were pooled and concentrated by ultraltration at 4000 g for 20 min at 4 C using an Amicon Ultra Centrifugal Filter Device PL-10 (Millipore, Billerica, MA, USA). The puried recombinant XYNAM6 was analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) with a 12% running gel [18]. The low molecular weight calibration kit for SDS electrophoresis (GE Healthcare, Piscataway, NJ, USA) was used as a standard. The protein concentration was determined by Bradford assay using bovine serum albumin as the standard [19]. 2.6. Xylanase activity assay The xylanase activity was determined by measuring the release of reducing sugar from soluble xylan using 3,5-dinitrosalicylic acid (DNS) method as described by Miller [20]. The standard assay mixture contained 0.1 ml of appropriately diluted enzyme and 0.9 ml of McIlvaine buffer (pH 5.5) containing 1% (w/v) oat spelt xylan. After incubation at 70 C for 10 min, the reaction was terminated by adding 1.5 ml of DNS reagent. The mixture was then boiled for 5 min and cooled to room temperature, and the absorption at 540 nm measured. Each reaction and its control were run in triplicate. One unit (U) of xylanase activity was dened as the amount of enzyme that released 1 mol of reducing sugar equivalent to xylose per minute under the assay conditions. 2.7. Characterization of puried recombinant XYNAM6 The pH optimum for enzymatic activity of puried recombinant XYNAM6 was determined in buffers with pH ranging from 2.0 to 12.0 by assessing activity at 60 C for 10 min. The buffers used were 0.1 M McIlvaine buffer (0.2 M Na2 HPO4 /0.1 M citric acid) for pH 2.08.0, 0.1 M TrisHCl for pH 8.09.0, and 0.1 M glycineNaOH for pH 9.012.0. The pH stability of XYNAM6 was determined by measuring residual enzymatic activity under standard conditions (pH 5.5, 60 C and 10 min) after preincubating the enzyme at 37 C in the buffers mentioned above for 1 h. The optimal temperature for XYNAM6 activity was determined in the temperature range of 2090 C by measuring enzyme activity in 0.1 M McIlvaine buffer (pH 5.5) for 10 min. Thermal stability of puried recombinant XYNAM6 was determined by assessing the residual enzyme activity under standard conditions (pH 5.5, 70 C

Table 1 Primers used in this study. Primers GH 10F GH 10R M6picF M6picR AD1 AD2 AD3 AD4 AD5 AD6 AD7 AD8 AD9 AD10 AD11 M6FSP1 M6FSP2 M6FSP3 M6RSP1 M6RSP2 M6RSP3 Primers sequence (5 3 ) TGGGACGTSGTSAACGAG GCATGTCSAGYTCSGTGA GGGGAATTCGCCGCCCCCTGCGGGAG GGGGCGGCCGCTCAGCCCGCGGCGCACCTCTGGCC NTCGASTWTSGWGTT NGTCGASWGANAWGAA WGTGNAGWANCANAGA TGWGNAGWANCASAGA AGWGNAGWANCAWAGG CAWCGICNGAIASGAA TCSTICGNACITWGGA STTGNTASTNCTNTGC WCAGNTGWTNGTNCTG TCTTICGNACITNGGA TTGIAGNACIANAGG CGCCGCCGGCCCAGTTGTAC CTCGACCGCCTCCCACTTCATGG GTTGACCGCCGTGCCGATGAAGC GGCAACGTGAACGGCTCCGCGATCCAGCAGAACCTCC CGCCCTCCGACAGCTCCAAGCTCCAGCAGCAGG CACCTTCCCCGGCGAGGGCGACGCCTGTCCC Tm ( C) 52.064.6 40.763.4 68.8 75.8 42.940.3 41.143.3 30.848.1 30.849.1 33.650.8 42.357.0 46.249.8 44.148.2 42.351.3 46.253.9 27.646.5 56.9 57.3 57.3 68.2 68.0 69.9 GC% 33.361.1 55.661.1 76.7 85.7 40.046.7 31.350.0 31.350.0 37.550.0 37.550.0 37.562.5 43.862.5 37.556.3 37.550.0 37.562.5 26.760.0 75.0 65.2 65.2 64.9 69.7 77.4

508

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512

and 10 min) after incubation of the enzyme at either 60, 70 or 80 C for different lengths of time. To investigate the effects of different metal ions and chemical reagents on the activity of puried recombinant XYNAM6, the enzyme was incubated in McIlvaine buffer (0.1 M, pH 5.5) containing 1 or 10 mM NaCl, KCl, CaCl2 , LiCl, CoCl2 , CrCl3 , NiSO4 , CuSO4 , MgSO4 , FeCl3 , MnSO4 , ZnSO4 , Pb(CH3 COO)2 , AgNO3 , HgCl2 , EDTA, SDS, and mercaptoethanol at 70 C. Incubation of XYNAM6 in the absence of added reagents was the control experiment. To determine resistance to different proteases, puried XYNAM6 was incubated with trypsin (pH 7.6, 25 C), -chymotrypsin (pH 7.8, 25 C), collagenase (pH 7.4, 37 C), subtilisin A (pH 7.4, 37 C), and proteinase K (pH 7.5, 37 C) at a ratio of 0.1:1 (protease:XYNAM6, w/w), respectively. After 1 or 2 h treatment, the residual activity was measured under standard assay conditions. Protease resistance was assessed by measuring the residual enzyme activity under standard conditions following protease treatment. The recombinant enzyme without protease was used as a control. 2.8. Substrate specicity and kinetic parameters The substrate specicity of XYNAM6 for various substrate was determined after incubation at 70 C for 10 min in McIlvaine buffer (0.1 M, pH 5.5) containing one of the following substrates (1%, w/v): oat spelt xylan, birchwood xylan, lichenan, barley glucan, laminarin and CMC-Na. Reactions were terminated by adding 1.5 ml DNS. For a xed amount of XYNAM6 the amount of released reducing sugar was estimated as described above. The Km , Vmax , and kcat values for puried recombinant XYNAM6 were determined in McIlvaine buffer (0.1 M, pH 5.5) containing 110 mg ml1 oat spelt xylan or birchwood xylan, after incubation with XYNAM6 at 70 C for 5 min. The data were plotted according to the LineweaverBurk method. Each data point represents an average of three independent experiments, and each experiment included three samples. 2.9. Analysis of hydrolysis product Reactions containing puried recombinant XYNAM6 (6 U) and oat spelt xylan (100 g) in 140 l McIlvaine buffer (pH 5.5) were incubated at 37 C for 12 h. After hydrolysis, the enzyme was removed from the reaction system using a Nanosep Centrifugal 3K Device (Pall, Chicago, USA). The products were analyzed by highperformance anion-exchange chromatography (HPAEC) with a model 2500 system from Dionex (Sunnyvale, CA, USA) [10]. Xylose, xylobiose and xylotriose were used as standards. 2.10. Effects of XYNAM6 on the ltration rate and viscosity of mash Mash was prepared as Celestino et al. described [21] with some modications. Malt (10 g) was rstly triturated in a disintegrator, ltered through a 0.2-mm sieve, and dissolved in 50 ml McIlvaine buffer (0.1 M, pH 5.5) containing 1 ml puried XYNAM6 (40 or 80 U). The reaction system was processed at 45 C for 30 min, 50 C for 30 min, 60 C for 30 min, and 70 C for 60 min, and then boiled for 5 min. McIlvaine buffer (0.1 M, pH 5.5) instead of enzyme solution was added as controls. Each reaction was stopped by addition of 50 ml cold water and cooled down to 20 C. Ten milliliter of mash after reaction was ltered through a Xinhua lter paper (101, Huangzhou, China). Filtration rate in the absence of enzyme was used as a control. The reduction of ltration rate was calculated using the standard equation [21,22]: =
control

cic for GH 10 xylanases. The fragment exhibited highest nucleotide sequence identity of 80% with the putative xylanase from Streptomyces hygroscopicus ATCC 53653 (ZP 05517968). The PCR products of the 5 and 3 anking regions were then amplied by TAILPCR using nested insertion primers, and assembled with the core region to generate a 1440-bp full-length gene, and the nucleotide sequence of xynAM6 was deposited in GenBank under accession number GU188674. The open reading frame has the G + C content of 70.4%. SignalP analysis revealed the existence of an N-terminal signal peptide at amino acid residues 136. The mature protein, XYNAM6, is composed of 443 residues with a theoretical molecular weight of 47.6 kDa. The deduced amino acid sequence of the ORF was aligned with available protein sequences from the GenBank database. The overall sequence of XYNAM6 showed the highest identity of 50.5% to the xylanase of Thermomonospora alba ULJB1 (CAB02654). Based on sequence analysis, the mature protein consists of two functional domains, a family 10 catalytic domain and a family 2 carbohydratebinding module (CBM). Between these two functional domains there is a polyglycine sequence rich in proline and glycine (Fig. 1). Two putative catalytic site residues, Glu166 and Glu272, were found in two conserved regions (WDVVNE and TELDI). 3.2. Expression and purication of XYNAM6 in P. pastoris The gene fragment encoding the mature protein without the signal peptide was cloned into P. pastoris. Transformants were screened with the xylanase activity assay. The highest activity was 23.2 U ml1 after methanol induction for 48 h in 1 l shaker ask, and no xylanase activity was detected before induction, conrming that xynAM6 encodes a functional xylanase. The recombinant xylanase in the culture supernatant was puried to electrophoretic homogeneity by ammonium sulfate precipitation and exchange chromatography. The specic activity of puried recombinant XYNAM6 was 242.1 U mg1 , with a nal yield of 13.5%. The puried enzyme migrated a single band of about 47.6 kDa as on SDS-PAGE (Fig. 2), which was consistent with the calculated molecular weight. 3.3. Effect of pH and temperature on XYNAM6 activity Puried recombinant XYNAM6 exhibited the highest xylanase activity at pH 5.5, retaining more than 50% of the maximum activity at pH 5.09.0 (Fig. 3A). The enzyme was stable over a broad pH range, retaining more than 80% of the maximum activity after incubation at pH 4.012.0 for 1 h at 37 C (Fig. 3C). The optimal temperature of XYNAM6 at pH 5.5 was 70 C. At temperatures between 50 and 80 C, the enzyme activity was equal to or greater than 60% of the maximum activity (Fig. 3B). The enzyme was stable after incubation at 60 and 70 C for 1 h (Fig. 3D). After incubation at 80 C for 20 min, the enzyme lost almost all of the activity. The xylanase activity of XYNAM6 in the presence of different metal ions or chemical reagents is shown in Table 2. The enzyme activity was signicantly inhibited by Ag+ , Hg2+ and SDS at the concentrations of 1 and 10 mM. Partial inhibition was observed in the presence of some metal ions at 10 mM concentration, such as Cu2+ , Cr3+ , Zn2+ , and Pb2+ . -Mercaptoethanol of 10 mM signicantly enhanced the activity about 1.4-fold. The addition of other reagents had little or no effect on the activity. The puried XYNAM6 was resistant to all test protease. After treatment with trypsin, -chymotrypsin, collagenase, subtilisin A and proteinase K for 1 h, the recombinant enzyme retained 94.2%, 87.8%, 95.2%, 86.3% and 95.3% of its activity, respectively. When treated for 2 h, more than 80% of the activity remained.

100

(1)

control

where is the total ow time of 10 ml and is the reduction of ltration time. Mash supernatant (5 ml) after ltration by lter paper was placed in a viscosimeter at 20 C. Mash viscosity in the absence of enzyme was used as a control. The viscosity reduction was calculated using the following equations [21]: =
water t twater water

(2) 100 (3) is the

control

control

where is the viscosity, t is the total ow time through viscometer, reduction of viscosity, and is the density.

3. Results 3.1. Gene cloning of the xylanase gene XYNM6 and sequence analysis A 346-bp fragment was amplied from the genomic DNA of S. megasporus DSM 41476 by PCR using the degenerate primers spe-

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512

509

Fig. 1. The nucleotide and deduced amino acid sequence of xynAM6 gene. The 36-amino acid putative signal peptide is underlined. The putative catalytic amino acid residues are boxed. Dotted line indicates the putative location of linker region. Two conserved cysteine residues and three exposed tryptophan residues in CBM are shaded in gray. The translational stop codon is indicated by asterisk.

Table 2 Effects of metal ions and chemical reagents on puried recombinant XYNAM6 activity. Chemicals Relative activity (%)a 1 mM None Na+ Co2+ Cr3+ Fe3+ Li+ Ni+ K+ Mg2+
a

Chemicals 10 mM 100 86.72 0.65 76.73 1.65 72.15 2.35 100.86 1.79 84.94 2.68 83.33 0.36 86.95 1.63 91.41 0.42 Cu2+ Ca2+ Zn2+ Pb2+ Ag+ Hg+ -Met EDTA SDS

Relative activity (%)a 1 mM 91.48 91.46 90.12 88.65 55.31 6.54 105.04 92.52 17.83 0.66 0.49 0.18 0.76 0.75 0.33 1.09 0.83 0.84 10 mM 54.06 82.47 87.81 71.39 61.82 5.66 140.34 99.38 0.69 1.32 2.19 1.45 1.35 0.51 2.54 0.14 2.31 0.86

100 109.68 1.01 107.68 0.81 102.76 0.94 96.81 0.22 94.25 0.43 92.57 0.26 91.99 0.69 91.93 0.41

Values represent means SD (n = 3) relative to the untreated control samples.

510

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512

3.4. Kinetic parameters Puried XYNAM6 exhibited high activity on substrate oat spelt xylan, and birchwood xylan, but had no activity towards lichenan, barley -glucan, laminarin and CMC-Na. The Km , Vmax and kcat values of puried recombinant XYNAM6 were 1.68 mg ml1 , 436.76 mol min1 mg1 , 346.35 s1 for oat spelt xylan, respectively. Using birchwood xylan as substrate, the Km , Vmax and kcat values 2.33 mg ml1 , 322.69 mol min1 mg1 , 255.89 s1 , respectively. 3.5. Analysis of hydrolysis product The products of hydrolysis of oat spelt xylan and birchwood xylan by puried recombinant XYNAM6 were analyzed by HPAEC. Xylose and xylobiose were the major hydrolysis products of the xylans from two sources. The hydrolysis products of oat spelt xylan were 34.45% xylose, 57.37% xylobiose, and 8.18% xylotriose. The mass composition of the hydrolysis products from birchwood xylan was 39.20% xylose, and 60.80% xylobiose. 3.6. The ltration rate and viscosity of mash After incubation with 40 U puried XYNAM6, the specic ltration rate and viscosity of mash were reduced by 26.73% and 25.58%, respectively. When at higher enzyme concentration (80 U), the XYNAM6 led to higher reduction in the ltration rate (36.33%) and viscosity (35.51%). 4. Discussion Several Streptomyces species, which are very active in the biochemical decomposition of lignocellulosic biomass, have been

Fig. 2. SDS-PAGE analysis of the purication of recombinant XYNAM6. Lane M, standard protein molecular weight markers; lane 1, XYNAM6 after purication; lane 2, culture supernatants after induction.

Fig. 3. Characterization of puried recombinant XYNAM6. (A) Effect of pH on xylanase activity. The activity assay of puried recombinant XYNAM6 was performed at 60 C in buffers ranging from pH 2.0 to 12.0. (B) Effect of temperature on xylanase activity measured in 0.1 M McIlvaine buffer (pH 5.5). (C) Effect of pH on stability of the xylanase activity. After incubating puried recombinant XYNM6 at 37 C for 1 h in buffers ranging from pH 2.0 to 12.0, the activity was measured in 0.1 M McIlvaine buffer (pH 5.5) at 70 C. (D) The thermostability of puried recombinant XYNM6. The enzyme was pre-incubated at 60, 70, or 80 C in 0.1 M McIlvaine buffer (pH 5.5), and aliquots were removed at specic time points for measurement of residual activity at 70 C. Each value in the panels represents the mean of triplicates plus standard deviation.

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512

511

reported to produce considerable amounts of xylanases [23,24]. In this study, we cloned a new GH 10 xylanase gene from S. megasporus DSM 41476. Sequence analysis showed that the deduced amino acid sequence of xylanase contains three function regions: an N-terminal leader sequence, a glycosyl hydrolase domain and a C-terminal CBM domain. A short linker sequence rich in proline, glycine, aspartic acid, and glutamic acid is between the hydrolase and CBM domains. The CBM of XYNAM6 belongs to CBM2a. Two conserved cysteine residues at the N and C termini (Cys379 and Cys476) have been reported to be involved in a disulphide bond [25]. There are three exposed tryptophan residues (Try389, Try408, and Try424), and two of them (Try408 and Try424) form a carbohydrate-binding cleft [26]. The optimal pH of XYNAM6 was 5.5, but it retained more than 50% of maximum activity under acidic to alkaline conditions (5.09.0). Even at pH 10.0 and 11.0, 38% and 15% of maximum activity were detected. Some xylanases from Streptomyces have no enzyme activity at pH 10.0, however, such as XynAS9 from Streptomyces sp. S9 [10], xylanase from Streptomyces sp. strain AMT-3 [27], STX-I from S. thermoviolaceus OPC-520 [8]. XYNAM6 was also highly stable over a broad pH range, retaining over 80% of the activity after incubation at pH 4.012.0. Its activity and stability under alkaline condition may be understood by analyzing some key amino acids and the surface amino acid composition [28]. The mechanisms causing enzyme stable under alkaline conditions needs further studies on crystallization and site-directed mutagenesis. Compared with majority of xylanases, XYNAM6 was superior in temperature-related properties. XYNAM6 had optimal temperature at 70 C and retained 65% of maximal activity at 80 C. Only a few xylanases have similar biochemical characteristics as XYNAM6 did; these include STXF10 from Streptomyces thermonitricans NTU88 [29], XynAS9 from Streptomyces sp. S9 [10], xylanase from Bacillus halodurans S7 [30], xylanase from Bacillus sp. Strain NG27 [31], and xylanase from Geobacillus sp. MT-1 [32]. However, some of these xylanases were not stable at 70 C. For example, after incubation at 70 C for 30 min, XynAS9 and xylanase from Geobacillus sp. MT-1 rapidly lost all of activity. Therefore, XYNAM6 exhibited better adaptability and stability within the mesophilic to moderately halophilic range, exhibiting >60% of the maximum activity at 5080 C and retaining 95% and 53% of initial activity after pre-incubation at 60 and 70 C for 1 h, respectively. Addition of Hg2+ , Cu2+ , and Zn2+ inhibited the activity of XYNAM6 signicantly, suggesting that XYNAM6 is a thiol-sensitive enzyme because these heavy metal ions bind free mercapto groups (SH) in cysteine residues. The Km values of XYNAM6 for oat spelt xylan and birchwood xylan were 1.68 and 2.33 mg ml1 , respectively, indicating that XYNAM6 had better afnity for oat spelt xylan than birchwood xylan. The substrate preference of XYNAM6 towards oat spelt xylan was similar to the xylanases isolated from other bacteria such as Geobacillus sp. MT-1 [32] and Streptomyces sp. S9 [10]. Arabinoxylans are the major non-starch polysaccharides of barley grain. During the mashing process, arabinoxylans can increase high wort viscosity and turbidity, and ultimately causing some problems such as reduced yields of extracts, decreased ltration rates, and some gelatinous precipitates in the nished beer [33]. To increase the degradation efcacy of arabinoxylans in barley malts, high temperature and addition of xylanase are developed [34]. XYNAM6 with suitable enzyme characteristics met the brewing industrys needs, such as exhibiting highest activity in the pH range of 5.06.0 at 70 C, good thermal and pH stability, less complex hydrolysis products, and resistance to most cations and proteases. Under simulated mashing conditions, addition of XYNAM6 resulted in signicant reduction of ltration rate and viscosity at low enzyme concentrations. These superior properties make XYNAM6 an ideal candidate for application in the brewing industry.

Acknowledgements This work was supported by the Chinese National High Technology Research and Development Program (863 Program, grant 2007AA100601), National Key Technology R&D Program of China (2006BAD12B05-03), and Key program of Transgenic Plant Breeding (2008ZX003-002).

References
[1] Polizeli M, Rizzatti A, Monti R, Terenzi H, Jorge J, Amorim D. Xylanases from fungi: properties and industrial applications. Appl Microbiol Biotechnol 2005;67:57791. [2] Collins T, Gerday C, Feller G. Xylanases, xylanase families and extremophilic xylanases. FEMS Microbiol Rev 2005;29:323. [3] Chvez R, Bull P, Eyzaguirre J. The xylanolytic enzyme system from the genus Penicillium. J Biotechnol 2006;123:41333. [4] Sunna A, Antranikian G. Xylanolytic enzymes from fungi and bacteria. Crit Rev Biotechnol 1997;17:3967. [5] Kulkarni N, Shendye A, Rao M. Molecular and biotechnological aspects of xylanases. FEMS Microbiol Rev 1999;23:41156. [6] Morosoli R, Bertrand JL, Mondou F, Shareck F, Kluepfel D. Purication and properties of a xylanase from Streptomyces lividans. Biochem J 1986;239:58792. [7] Ruiz-Arribas A, Fernandez-Abalos JM, Sanchez P, Garda AL, Santamaria RI. Overproduction, purication, and biochemical characterization of a xylanase (Xys1) from Streptomyces halstedii JM8. Appl Environ Microbiol 1995;61:24149. [8] Tsujibo H, Miyamoto K, Kuda T, Minami K, Sakamoto T, Hasegawa T, et al. Purication, properties, and partial amino acid sequences of thermostable xylanases from Streptomyces thermoviolaceus OPC-520. Appl Environ Microbiol 1992;58:3715. [9] Hernndez A, Lpez JC, Santamara R, Daz M, Fernndez-Abalos JM, Copa JL, et al. Xylan-binding xylanase Xyl30 from Streptomyces avermitilis: Patino cloning, characterization, and overproduction in solid-state fermentation. Int Microbiol 2008;11:13341. [10] Li N, Meng K, Wang Y, Shi P, Luo H, Bai Y, et al. Cloning, expression, and characterization of a new xylanase with broad temperature adaptability from Streptomyces sp. S9. Appl Microbiol Biotechnol 2008;80:23140. [11] Li N, Shi P, Yang P, Wang Y, Luo H, Bai Y, et al. A xylanase with high pH stability from Streptomyces sp. S27 and its carbohydrate-binding module with/without linker-region-truncated versions. Appl Microbiol Biotechnol 2009;83:99107. [12] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their industrial applications: a review. Appl Microbiol Biotechnol 2001;56:32638. [13] Wu YB, Ravidran V, Thomas DG, Birtles MJ, Hendricks WH. Inuence of method of whole wheat inclusion and xylanase supplementation on the performance, apparent metabolisable energy, digestive tract measurements and gut morphology of broilers. Brit Poultry Sci 2004;45:38594. [14] Bajpai P. Application of enzymes in the pulp and paper industry. Biotechnol Prog 1999;15:14757. [15] Liu YG, Whittier RF. Thermal asymmetric interlaced PCR: automatable amplication and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 1995;25:67481. [16] Zhou J, Huang H, Meng K, Shi P, Wang Y, Luo H, et al. Cloning of a new xylanase gene from Streptomyces sp. TN119 using a modied thermal asymmetric interlaced-PCR specic for GC-rich genes and biochemical characterization. Appl Biochem Biotechnol 2010;160:127792. [17] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specic gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:467380. [18] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:6805. [19] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal Biochem 1976;72:24854. [20] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 1959;31:4268. [21] Celestino KR, Cunha RB, Felix CR. Characterization of a beta-glucanase produced by Rhizopus microsporus var. microsporus, and its potential for application in the brewing industry. BMC Biochem 2006;7:23. [22] Vlasenko EY, Ryan AI, Shoemaker CF, Shoemaker SP. The use of capillary viscometry, reducing end-group analysis, and size exclusion chromatography combined with multi-angle laser light scattering to characterize endo-1,4--dglucanases on carboxymethylcellulose: a comparative evaluation of the three methods. Enzyme Microb Technol 1998;23:3509. [23] Johnson KG, Harrison BA, Schneider H, MacKenzie CR, Fontana JD. Xylanhydrolysing enzymes from Streptomyces spp. Enzyme Microb Technol 1988;10:4039. [24] Shareck F, Roy C, Yaguchi M, Morosoli R, Kluepfel D. Sequences of three genes specifying xylanases in Streptomyces lividans. Gene 1991;107:7582. [25] Xu GY, Ong E, Gilkes NR, Kilburn DG, Muhandiram DR, Harris-Brandts M, et al. Solution structure of a cellulose-binding domain from Cellulomonas mi by nuclear magnetic resonance spectroscopy. Biochemistry 1995;34:69937009.

512

Z. Qiu et al. / Enzyme and Microbial Technology 46 (2010) 506512 [31] Gupta N, Reddy VS, Maiti S, Ghosh A. Cloning, expression, and sequence analysis of the gene encoding the alkali-stable, thermostable endoxylanase from alkalophilic, mesophilic Bacillus sp. Strain NG-27. Appl Environ Microbiol 2000;66:26315. [32] Wu SJ, Liu B, Zhang XB. Characterization of a recombinant thermostable xylanase from deep-sea thermophilic Geobacillus sp. MT-1 in East Pacic. Appl Microbiol Biotechnol 2006;72:12106. [33] Vitor RJ, Voragen AGJ, Angelino SAGF, Pilnik W. Non-starch polysaccharides in barley and malt: a mass balance of our fractionation. J Cereal Sci 1991;14:7383. [34] Li Y, Lu J, Gu G, Shi Z, Mao Z. Mathematical modeling for prediction of endoxylanase activity and arabinoxylans concentration during mashing of barley malts for brewing. Biotechnol Lett 2004;26:77985.

[26] Simpson PJ, Xie H, Bolam DN, Gilbert HJ, Williamson MP. The structural basis for the ligand specicity of family 2 carbohydrate-binding modules. J Biol Chem 2000;275:4113742. [27] Nascimento RP, Coelho RRR, Marques S, Alves L, Girio FM, Bon EPS, et al. Production and partial characterisation of xylanase from Streptomyces sp. strain AMT-3 isolated from Brazilian cerrado soil. Enzyme Microb Technol 2002;31:54955. [28] Mamoa G, Thunnissen M, Hatti-Kaul R, Mattiasson B. An alkaline active xylanase: insights into mechanisms of high pH catalytic adaptation. Biochimie 2009;91:118796. [29] Cheng HL, Tsai CY, Chen HJ, Yang SS, Chen YC. The identication, purication, and characterization of STXF10 expressed in Streptomyces thermonitricans NTU-88. Appl Microbiol Biotechnol 2009;82:6819. [30] Mamo G, Delgado O, Martinez A, Mattiasson B, Hatti-Kaul R. Cloning, sequence analysis, and expression of a gene encoding an endoxylanase from Bacillus halodurans S7. Mol Biotechnol 2006;33:14959.