You are on page 1of 16

3/22/2012

Challenges in Dealing with DNA Evidence: Lab Reports and Data Interpretations
Maher Max Noureddine, PhD, MS
President: ForensiGen, LLC Founder and President The Institute for Advanced Career Development
03/22/2012

The Culture of Forensic DNA Evidence

DNA: the ultimate ID card?

Forensic DNA Science is Evolving as we speak!

Are we approaching DNA evidence with a healthy dose of skepticism? DNA evidence evaluation is primarily a science experiment: T or F?

DNA Science

vs

Forensic DNA Evidence

Idea / Observation

Crime / Incident

Hypothesis Testing

Evidence / Leads / Theories

p Design g Flexible Experimental

Restricted Experimental p Design g

Results and Interpretations

Results

Peer Review

Interpretations / Internal Review?

Literature

Trial / Jury

Quality Assurance Standards

-Laboratory Accreditation / Audits -Laboratory Management / Case Management -Staff Proficiency / Education -Validation instruments, V lid ti of fi t t test t t kits, kit protocols t l -Quality Control, sample prep, processing, integrity -Results and Interpretations Standards
The Laboratory Should establish most standards

Chromosomes in Living Organisms

x3,000

Human Chromosomes

Human DNA: Chromosomes


23 Pairs of chromosomes in every human cell (with few exceptions): One copy from Mom, one from Dad

Human Chromosomes

DNA in the Cell

GAAACTTGCA.. CTTT GAACGT..

Every Chromosome is a continuous double strand of DNAThink of it as a long string !

Short Tandem Repeats (STRs) in DNA

AAGTTCATGTAAACGTAGTCCCAGTCCAGTCAGCC ATTTGACAAGTTCATGTAAACGTAGTCCCAGTCCAGT CAGCCATTTGACAAGTTCATGTAAACGTAGTCCCAGT CCAGTCAGCCATTTGAC GATA GATA GATA GATA GATA GATA CCCTCTTC 6 Repeats AAGTTCATGTAAATGTAGTCCCAGTCCAGTCAGCC ATTTGACAAGTTCATGTAAACGTAGTCCCAGTCCAGT CAGCCATTTGACAAGTTCATGTAAACGTAGTCCCAGT CCAGTCAGCCATTTGAC GATA GATA GATA GATA GATA GATA GATA GATA CCCTCTTC 8 Repeats
Chromosome 16 Marker D16S539

Locus (Loci): Location on a Chromosome

Alleles 6 and 8

Chromosome 16 Marker D16S539 6 8

Allele Inheritance for Locus D16S538

Frank

Judy

Anna

Paul

Tony

Phil

Short Tandem Repeats (STRs) in DNA

# repeats

Chromosome # Chr 8 (D8S1179) Marker Name

Chr 21
(D21S11)

Chr 7
(D7S820)

Chr 13
(D13S317)

Genotype:

4,4 Or: 4

2,3

1,4

5,3

GeneralSteps:STRForensicDNAAnalysis:
Sample Collection
Restriction Fragment Length Polymorphism (RFLP)

DNA Extraction

DNA Quantitation

Cut with Enzymes

Amplify w/ PCR

Amplify w/ PCR

Gel Electrophoresis
Mid 80s-90s

Gel Electrophoresis
Mid 90s-early 2000

Capillary Electrophoresis
Current

WhichSuspectMatchestheEvidence?

TH01 alleles
(14) (13) (12) (11) (10) (9) (8) (7) (6) (5) (4) (3)

Allele ladder

Sperm

Female

S1

S2

S3

Matching DNA Profiles: e-grams or peaks


D3S1358 VWA FGA

Electropherograms or e-grams

STR Loci in Modern Forensics

There are more than 100,000 STRs in the human genome

Electropherogram

RFU Or Peak Height (1336)

Allele Calls for Marker TH01 (8 , 9.3)

RFU=Relative Fluorescence Units

EvidenceSample

Sample Types

Positive Controls Negative Controls Evidence Samples

PositiveControl:Ladder

NegativeControl

Note any peaks, a sign of contamination

DNASingleContributor

What are the possible genotypes?

DNASingleContributor

What are the possible genotypes?

DNAMixtures

Type A: No Major Contributor

10

What are the possible genotypes?

DNAMixtures

Type A: No Major Contributor

10

11

What are the possible genotypes?

DNAMixtures

Type A: No Major Contributor

10

11

13

What are the possible genotypes?

DNAMixtures

Type B: Clear Major and Minor contributors

10

11

What are the possible genotypes?

DNAMixtures

Type B: Clear Major and Minor contributors

10

11

13

What are the possible genotypes?

DNAMixtures

Type C: Low signals, possible allele drop outs. No Interpretation possible

250 RFUs

Stochastic Threshold

75 RFUs 7 8 10 11 13

Analytical Threshold

What are the possible genotypes?

Artifacts/Anomalies/Challenges
IncreasedComplexity

Technically Induced Dye Blobs Pull-Ups Spikes

Biologically Induced Stutter Split Peaks Microvariants Tri-alleles Allele Drop In / Out Allele Peak Imbalance Complex Mixtures

Sample Induced Contamination Mixtures Inhibition Low Copy Number DNA (LCN)

Wrong Conclusions

10

Stutter

<15% 6 7 8

<8%

DNASingleContributor:AlleleImbalance

Peak Height Ratio (PHE) >60%

Smaller Peak rfu X 100 Larger Peak rfu 7 8 *Remember this, it will be important shortly!

What are the possible genotypes?

Outcomes of Forensic DNA Analysis

Match PeaksbetweenthecomparedSTRprofileshavethesame genotypesandnounexplainabledifferencesexistbetweenthe samples.Statisticalevaluationofthesignificanceofthematchis usuallyreportedwiththematchreport. Exclusion(Nonmatch) Thegenotypecomparisonshowsprofile differencesthatcanonlybeexplainedbythetwosamplesoriginating fromdifferentsources. Inconclusive Thedatadoesnotsupportaconclusionastowhether theprofilesmatch.Thisfindingmightbereportediftwoanalysts remainindisagreementafterreviewanddiscussionofthedataandit isfeltthatinsufficientinformationexiststosupportanyconclusion.

11

Statistical Methods Currently Used:

Random Match Probability (RMP)

Combined Probability of Inclusion (CPI) or C bi d P Combined Probability b bilit of f Exclusion E l i (CPE) or Random Man Not Excluded (RMNE)

Likelihood Ratio (LR)

AlleleFrequencyinthePopulation
Frank Liz Michelle Judy

12

12

8 Phil

Anna

Paul

Tony

14 14

13 12

13

AlleleFrequencyinthePopulation

Allele Name Allele4 Allele6 Allele7 Allele8 Allele12 Allele13 Allele14

Sizeof Population Surveyed 16 16 16 16 16 16 16

#Chrom. Detectedin Population 1 1 2 5 3 2 2

Allele Frequency 0.0625 0.0625 0.125 0.3125 0.1875 0.125 0.125

Approx % 6% 6% 12% 31% 18% 12% 12%

12

AlleleFrequencyinthePopulation
Joe (s) Evidence 14, 14

Allele Name Allele4

Allele Frequency 0.0625 0.0625 0 125 0.125 0.3125 0.1875 0.125 0.125

14 14

Allele6 All l 7 Allele

Homozygote:

Allele8 Allele12 Allele13 Allele14

Heterozygote: 2pApB

=(0.0125) =0.125 X 0.125 = 0.0156 Or 1 in 64

AlleleFrequencyinthePopulation
Joe (s) Evidence 4, 6

Allele Name Allele4

Allele Frequency 0.0625 0.0625 0 125 0.125 0.3125 0.1875 0.125 0.125

Allele6 Allele7

Homozygote:

p2

Allele8 Allele12 Allele13 Allele14

Heterozygote: 2pApB

2pApB =2 X (0.0625) (0.0625)= 0.0078125


Or 1 in 128

WheredotheseAstronomicalNumberscomefrom?
Locus D3S1358 VWA FGA D8S1179 D21S11 D18S51 D5S818 D13S317 D7S820 D16S539 THO1 TPOX CSF1PO allele 16 17 21 12 28 14 12 11 9 9 6 8 10 value 0.2533 0.2815 0.1854 0.1854 0.1589 0.1374 0 1374 0.3841 0.3394 0.1772 0.1126 0.2318 0.5348 0.2169 11 0.3212 allele 17 18 22 14 30 16 13 14 value 0.2152 0.2003 0.2185 0.1656 0.2782 0.1391 0 1391 0.1407 0.0480 1 in 9.17 8.87 12.35 16.29 11.31 26.18 26 18 9.25 30.69 31.85 13.8 18.62 3.50 21.28 Combined 9.17 81 1005 16,364 185,073 4,845,217 4 845 217 44,818,259 1.38 x 109 4.38 x 1010 6.05 x 1011 1.13 x 1013 3.94 x 1013 8.37 x 1014

The Random Match Probability for this profile in the U.S. Caucasian population is 1 in 837 trillion (1012)

13

WheredotheseAstronomicalNumberscomefrom?

Sample Uniqueness in 4 NC Populations

Formulas used by most laboratories to calculate profile uniqueness or RMP: Homozygote: pi2 Heterozygote: 2PiPj or Homozygote: pi2 + pi (1 - pi) Heterozygote: 2PiPj NC Crime Lab

Case Review Recommendations:

Evaluate the Results / Interpretations (Match, non-exclusion, exclusion, etc) DNA Profiles, Allelic Calls, Peak Heights, Alternative Hypotheses, etc DNA Sample: Collection to Analysis to Results, Contamination Quality Control, Quality Assurance, Audits Chain of Custody Other case documents, pictures, etc Is there anything that does not make sense???

Case Analysis (1)

13%

14

Case Analysis (2)

Case Analysis (3)

Is this a mixture?

Case Analysis (4)

Given the above profile, if a defendant has allele (22) at Marker FGA, should that person be excluded?

15

DifferentialExtraction:SexualAssaultCases
Centrifuge
SDS, EDTA and proteinase K (cell lysis buffer) Incubate at 37 oC

Perpetrators p sperm p mixed with victims epithelial cells

REMOVE supernatant

SDS, EDTA and proteinase K + DTT

Non-sperm Fraction Sperm Fraction


Modified from: Butler, J; NIST

sperm pellet

Case Analysis (5)

Questions

16