Int. J. Cancer: 118, 18621868 (2006) ' 2005 Wiley-Liss, Inc.

Estradiol and its metabolites 4-hydroxyestradiol and 2-hydroxyestradiol induce mutations in human breast epithelial cells
Sandra V. Fernandez, Irma H. Russo and Jose Russo Breast Cancer Research Laboratory, Fox Chase Cancer Center, Philadelphia, PA
An elevated incidence of breast cancer in women has been associated with prolonged exposure to high levels of estrogens. Our laboratory demonstrated that treatment of the immortalized human breast epithelial cells MCF-10F with 17b-estradiol (E2), 4-hydroxyestradiol (4-OHE2) or 2-hydroxyestradiol (2-OHE2) induces phenotypical changes indicative of neoplastic transformation. MCF10F cells treated with E2, 4-OHE2 or 2-OHE2 formed colonies in agar methocel and lost their ductulogenic capacity in collagen, expressing phenotypes similar to those induced by the carcinogen benzo[a]pyrene. To investigate whether the transformation phenotypes were associated with genomic changes, cells treated with E2, 4-OHE2 or 2-OHE2 at different doses were analyzed using microsatellite markers. Since microsatellite instability (MSI) and loss of heterozygosity (LOH) in chromosomes 13 and 17 have been reported in human breast carcinomas, we tested these parameters in MCF10F cells treated with E2, 2-OHE2, or 4-OHE2 alone or in combination with the antiestrogen ICI182780. MCF-10F cells treated with E2 or 4-OHE2, either alone or in combination with ICI182780, exhibited LOH in the region 13q12.3 with the marker D13S893 located at 0.8 cM telomeric to BRCA2. Cells treated with E2 or 4OHE2 at doses of 0.007 and 70 nM and 2-OHE2 only at a higher dose (3.6 lM) showed a complete loss of 1 allele with D13S893. For chromosome 17, differences were found using the marker TP53Dint located in exon 4 of p53. Cells treated with E2 or 4-OHE2 at doses of 0.007 nM and 70 nM and 2-OHE2 only at a higher dose (3.6 lM) exhibited a 5 bp deletion in p53 exon 4. Our results show that E2 and its catechol estrogen metabolites are mutagenic in human breast epithelial cells. ICI182780 did not prevent these mutations, indicating that the carcinogenic effect of E2 is mainly through its reactive metabolites 4-OHE2 and 2-OHE2, with 4-OHE2 and E2 being mutagenic at lower doses than 2-OHE2. ' 2005 Wiley-Liss, Inc. Key words: breast cancer; estrogen; 4-OHE2; 2-OHE2; cell transformation

one of its metabolites would induce (i) transformed phenotypes indicative of neoplasia in human breast epithelial cells (HBEC) in vitro and (ii) genomic alterations similar to those observed in spontaneous malignancies, such as DNA amplication and loss of genetic material near tumor suppressor loci. We have shown that E2 and its catechol metabolites, namely 4-OHE2 and 2-OHE2, are capable of in vitro transforming a HBEC, MCF-10F cell line, that is estrogen receptor-a (ERa) negative and ERb positive.7,9 The transformation phenotypes induced by 17b-estradiol in MCF10F cells have been conrmed by treatment of MCF10A cells with different doses of Zeranol (Ralgro),23 a nonsteroidal agent with estrogenic activity that is used as a growth promoter in the US beef and veal industry. Similar data have been reported using 4-hydroxyequilenin24 in MCF-10A cells, using an anchorage-independent growth assay. In our model the E2-mediated phenotypes and genomic changes were not abrogated by the pure antiestrogen ICI182780,7,9,10 suggesting that in this model the ERa mediated pathway is not involved in neoplastic transformation. Genomic alterations in chromosome 13 and chromosome 17 are known to play an important role in the initiation and progression of human breast cancer.2527 Chromosome 13 contains the breast cancer susceptibility gene BRCA2 located in chromosome 13q12q13.28 Chromosome 17 contains the tumor suppressor gene p53 located at 17p13.1 and BRCA1 at 17q21.31.29 In the present work we demonstrate that the transformation phenotypes induced by E2 and its metabolites are also associated with genomic changes in chromosomes 13 and 17. Material and methods Cell lines MCF-10F cells were treated twice a week for 2 weeks with E2, 2-OHE2 or 4-OHE2 at doses of 0.007 and 70 nM in the presence or absence of an equal concentration of ICI182780.8,9 After the treatment, the cells were maintained in culture in DMEM: F-12 containing 5% horse serum and used after 612 passages. MCF10F cells treated with 0.007 nM or 1 lg/ml benzo[a]pyrene (BP) (passage 12) were used as positive controls for transformation. Microsatellite analysis DNA was extracted from the cells in culture when they were 7080% conuent. The cells were treated with lysis buffer (100 mM NaCl, 20 mM Tris-Cl pH 8.0, 25 mM EDTA pH 8.0, 0.5% SDS) and 200 lg/ml proteinase K was added and incubated at 65C, for 15 min with gentle agitation. The samples were cooled on ice and treated with 100 lg/ml RNase at 37C for 30 min. The DNA
Abbreviations: BP, benzo[a]pyrene; CE, catechol estrogen; E2, 17bestradiol; ER, estrogen receptor; HBEC, human breast epithelial cells; HRT, hormone replacement therapy; ICI, ICI182780; LOH, loss of heterozygosity; MSI, microsatellite instability; 2-OHE2, 2-hydroxyestradiol; 4-OHE2, 4-hydroxyestradiol. Grant sponsor: Department of Defense; Grant number: DAMD17-00-10247, DAMD17-03-1-0229. *Correspondence to: Breast Cancer Research Laboratory, Fox Chase Cancer Center, 7701 Burholme Avenue, Philadelphia, PA 19111, USA. Fax: 215-728-2180. E-mail: J_Russo@fccc.edu Received 1 March 2005; Accepted after revision 19 August 2005 DOI 10.1002/ijc.21590 Published online 14 November 2005 in Wiley InterScience (www. interscience.wiley.com).

Breast cancer (BC) is the most commonly occurring neoplasm and the second most frequent cause of cancer death among women in the United States.1 There is a substantial amount of epidemiological, clinical and experimental evidence pointing to estrogens, e.g. 17b-estradiol (E2), being one of the most important etiological factors for the development and progression of BC.210 The risk factors include high serum or urinary estrogen concentrations,1113 the early onset of menstruation, and late menopause, related to prolonged exposure to estrogens.4,14 Although the precise molecular mechanisms by which E2 induces breast cancer have not been completely understood, the estrogen implication in breast cancer has been associated mostly with the estrogen receptor (ER) that mediates cell proliferation.15,16 The direct role of estrogens as tumor initiators has been supported by the evidence that E2, catechol estrogens (CEs), and their quinone derivatives may be genotoxic in vitro and in vivo, leading to various types of DNA damage, including single strand breaks and stable and depurinating DNA adducts.1720 2-hydroxyestradiol (2-OHE2) and 4-hydroxyestradiol (4-OHE2) are 2 catechol metabolites of estrogens that could be oxidized to CE quinones (CE-Q) that may react with DNA. In particular, the 4-CE are oxidized to CE-3,4-Q, which react with DNA to form depurinating adducts to generate apurinic sites that may lead to mutations in DNA.2022 To fully demonstrate that estrogens are carcinogenic in the human breast through one or more of the mechanisms described earlier will require an experimental system in which E2 by itself or
Publication of the International Union Against Cancer

ESTROGEN AND ITS METABOLITES INDUCE MUTATIONS IN HUMAN BREAST EPITHELIAL CELLS
TABLE I MICROSATELLITE MARKERS USED FOR CHROMOSOME 13 STUDIES Marker Primer A (50 30 ) Primer B (50 30 ) Location Allele size (bp)

1863

Repeat type

D13S217 D13S1244 D13S1242 D13S1246 D13S290 D13S893 D13S260 D13S171 D13S267 D13S1293 D13S220 D13S219 D13S1253 D13S218 D13S175 D13S283 D13S221 D13S1244 D13S289 D13S263 D13S328 D13S273 D13S272 D13S176 D13S269

AACCTGGTGGACTTTTGCT CTGTTTATGGCTGAGAAGTATGC GCCCCCAGTCAGGTTT AGTGGCTATTCATTGCTACAGG CAAATTCCTCAATTGCAAAAT TTGCTAATCTCCTTAAAAAATAACG CCAGATATAAGGACCTGGCT ATTCTTCCTCCCATCTTTGCTCTC TCCCACCATAAGCACAAG AAATAACAAGAAGTGACCTTCCTA TGCATTCTTTAAGTCCATGTC GCATGAGGCAATTGGTTATA CAGAGCCGTGGTAGTATATTTTT TCGGGCACTACGTTTATCTA TGCATCACCTCACATAGGTTA GCCATTCCAAGCGTGT GAGATCGTGCAGCACTTGT CTGTTTATGGCTGAGAAGTATGC TGCAGCCTGGATGACA CCCAGTCTTGGGTATGTTTTTA GGGGGTTTACTTTTGTGAAG ATCTGTATGTCCTCCTTTCAATG AGCTATTAAAGTTCCCTGGATAAAT ATATTCAGACAAAAGCCAAGTTA cCAAAGTGGTTCATCTTGGTCT

ATGCTGGGATCACAGGCh TCAACAAGTGGATTAAGAAACTGTG GTGCCCAGCCAGATTC GAGCATGTGTGACTTTCATATTCAG CCTTAGGCCCCATAATCT ATATTGCACAACTTTGTGTAGAGC TCAGATTGCTAAGCATGTACC AAAATTCCCCAAAAAACTACCTACC GGCCTGAAAGGTATCCTC TGCAGGTGGGAGTCAA CCAACATCGGGAACTG GGAACAGCAAAGCAAATATG CCTGCATTTGTGTACGTGT CCTGCAAACATATGGATGAT TATTGGATACTTGAATCTGCTG TCTCATATTCAATATTCTTACTGCA TAGCCATGATAGGAAATCAACC TCAACAAGTGGATTAAGAAACTGTG CTGGTTGAGCGGCATT CCTGGCCTGTTAGTTTTTATTGTTA GCCTGAACATCACTTTTTTG CTGNGGCAAAAACAACTCTT ATACAGACTTCCCAGTGGCT CTGTGGGATTCCTTAGTGATAC TGTCTTCCAGCAGGGC

13p12.1 13q12.2 13q12.3 13q12.3 13q12.3 13q12.3 13q12.3 13q12-13 13q13.2 13q13.1 13q13.2 13q13 13q14 13q12.2 13q11 13q12.1 13q12.1 13q12.1 13q12.2 13q13 13q14.3 13q14.3 13q14.3 13q14.3 13q22

170 95 228/238 205 178/190 185/189 129/139 237/247 152/158 126/132 192/202 151 133 215/221 101113 128/146 232/240 95/103 265/275 153/157 123/129 241/243 133/135 211227 127/129

Dint Dinucl. Dinucl. Dinucl. Dinucl. Tetran. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl.

TABLE II MICROSATELLITE MARKERS USED FOR CHROMOSOME 17 STUDIES Marker Primer A (50 30 ) Primer B (50 30 ) Location Allele size (nt) Repeat type

D17S926 D17S1840 D17S1528 D17S831 D17S1810 D17S919 D17S1832 D17S260 D17S906 D17S1149 D17S720 D17S578 D17S960 D17S1881 D17S1353 D17S938 D17S796 TP53-Pent TP53-Dint D17S250 THRA1 D17S855 D17S800 D17S579 GH

CCGCAGAAGGCTGTTGT TGGGGCAGACTTGGTCCTT CAGAGGTGGAGATAAGGG GCCAGACGGGACTTGAATTA CCTAGTGAGGGCATGAAAC GCTTAATTTTCACGAGGTTCAG TGTGTGACTGTTCAGCCTC CTCCCCAACATGCTTTCTCTC TTCTAGCAGAGTGAAACTGTCT CGCTGATCTGTCAGGCAGCCCT GAATTCTGAGCATATTGTTTGCCTG CTGGAGTTGAGACTAGCCT TAGCGACTCTTCTGGCA TAGGGCAGTCAGCCTTGTG TACTATTCAGCCCGAGGTGC ATGCTGCCTCTCCCTACTTA AGTCCGATAATGCCAGGATG ACAAAACATCCCCTACCAAACAGC GCAACTGACCGTGCAAGTCA GCTGGCCATATATATATTTAAACC CGGGCAGCATAGCATTGCCT ACACAGACTTGTCCTACTGCC ATAGACTGTGTACTGGGCATTGA CAGTTTCATACCAAGTTCCT AGTCCTTTCTCCAGAGCAGGT

GCAGTGGGCCATCATCA GCCTGGGCGACAGAGTGA AGTAGCCAGGAGGTCAAG CGCCTTTCCTCATACTCCAG TGTCCACTGTAACCCCTG AGGCACAGAGTGAGACTTG ACGCCTTGACATAGTTGC AATGGCTCCAAAAGGAGATATTG AGCAAGATTCTGTCAAAAGAG AACAAGAGTGAACTCCATAGAGAG CCAGCCTTGGCAACATAGCAAGA CTATCAATAAGCATTGGCCT TGATGCATATACATGCGTG CCCAGTTTAAGGAGTTTGGC CTGAGGCACGAGAATTGCAC GGACAGAACATGGTTAAATAGC CAATGGAACCAAATGTGGTC ACTCCAGCCTGGGCAATAAGAGCT ATCTACAGTCCCCCTTGCC GGAAGAATCAAATAGACAAT CTGCGCTTTGCACTATTGGG GGATGGCCTTTTAGAAAGTGG GGTCTCATCCATCAGGTTTT AGTCCTGTAGACAAAACCTG TCCAGCCTCGGAGACAGAAT

17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.3 17p13.2 17p13.2 17p13.1 17p13.1 17q12 17q11.2-q12 17q21 17q21.1 17q21.3 17q22-24

242 205 218 231/235 109/115 145 187/189 154 346/354 337/345 214/222 150 126/130 219/221 208/218 133 171181 130 296/291 146156 159/167 145159 169/171 124 254/272

Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Tetran. Dinucl. Monon. Tetran. Tetran. Tetran. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Pentan. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl. Dinucl.

was puried with a phenol extraction (pH 5 8.0), followed by chloroform/isoamyl alcohol (24:1). The aqueous layer was adjusted to 0.75 M ammonium acetate and the DNA was precipitated with 100% ethanol. The samples were centrifuged, dried and dissolved in distilled water. For microsatellite analysis, PCR was carried out in a nal volume of 10 ll containing 1X PCR buffer (Invitrogen, Carlsbad, CA), 1.5 mM MgCl2, 0.5 pmol of each primer, 100 lM dNTPs, 0.25 U TaqPlatinum (Invitrogen) and 60 90 ng DNA. In each PCR reaction we used uorescent-labeled forward primer (Proligo, CA). The PCR conditions consisted of a denaturation step (5 min at 94C), followed by 8 cycles at 94C for 20 sec, 60C for 45 sec (decreasing 0.5C per cycle) and 72C for 30 sec; 34 cycles at 94C for 20 sec, 56C for 45 sec and 72C for 30 sec. The uorescent PCR product was mixed with an internal standard size marker and fractionated using CEQ8000 (Beckman Coulter, Fullerton, CA). For chromosome 13 and 17 analysis, 25

markers for each chromosome were used (Tables I and II). A panel of 5 markers recommended to study MSI was also included: BAT25 (4q13; intron 16 of the c-kit oncogene); BAT26 (2p22-p21; 5th intron of MSH2 gene); D2S123 (2p16; MSH2 gene); D5S346 (5q22; APC gene) and with D17S250 (17q22). Loss of heterozygosity (LOH) was dened as a total loss (complete deletion) or a 30% or more reduction in the signal of one of the heterozygous alleles compared with control MCF-10F DNA. Each reaction was repeated at least 3 times for each DNA. Cloning and sequencing of 290 bp of p53, exon 4 Non-uorescent TP53-Dint primers were used to amplify 291 bp and 296 bp fragments of p53 exon 4 (Table II).30 The following conditions were used in the amplication: denaturation at 94C for 2 min, 35 cycles of 94C for 30 sec, 55C for 45 sec and 72C for

1864

FERNANDEZ ET AL.

45 sec, and a nal extension at 72C for 10 min. Expand High Fidelity Taq (Roche, Indianapolis, IN) was used in the amplication, and the PCR products were cloned in TOPO TA vector (Invitrogen). DNAs from MCF-10F transformed with 70 nM 4-OHE2 and untreated MCF-10F were used as templates. Several white colonies were picked and plasmids were isolated using standard methods.31 The cloned fragments were sequenced at the Fox Chase Cancer Center Sequencing Facility. Results Microsatellite analysis We analyzed genomic changes in MCF-10F cells treated with E2, 4-OHE2 or 2-OHE2 using different microsatellite markers for chromosomes 13 and 17 (Table I and Table II). Using the microsatellite marker D13S893 located at 13q12.3, we have found that the parental cell line MCF-10F showed 2 peaks, one at 185 bp and the other at 189 bp, representing 2 alleles (Fig. 1). The cells treated with 0.007 nM E2 or 70 nM E2 showed LOH with complete loss of 1 allele; only 1 peak at 185 bp was detected and the other peak at 189 bp was lost. This effect was not prevented by ICI182780

(Fig. 1). Treatment with either dose of 4-OHE2 produced the complete loss of 1 allele; only 1 peak at 185 bp was detected and the other peak at 189 bp was lost. This effect was not prevented by the antiestrogen ICI182780 (Fig. 1). MCF-10F treated with 2-OHE2 at 0.007 or 70 nM showed 2 peaks, similar to the control untreated MCF-10F (Fig. 1). Treatment with 2-OHE2 produced an effect similar to those of E2 and 4-OHE2 (total loss of 1 peak) only at a higher dose (3.6 lM) (Fig. 1). The cells treated with BP showed 2 peaks with the marker D13S893, just as untreated MCF-10F cells (Fig. 1). We have not found microsatellite changes with any of the other 24 markers used for chromosome 13 (Table I). For chromosome 17, using the marker TP53-Dint located in chromosome 17p13.1, exon 4 of the tumor suppressor gene p53, we have found that the parental cell line MCF-10F has only 1 peak at 296 bp (Fig. 2), whereas the MCF-10F cells transformed with 0.007 nM E2 or 70 nM E2 have 2 peaks, at 296 and 291 bp. The antiestrogen ICI182780 did not prevent the appearance of the shorter allele (Fig. 2). MCF-10F cells treated with 4-OHE2 alone or in combination with ICI182780 showed 2 peaks, one at 296 bp and another shorter, at 291 bp (Fig. 2). MCF-10F cells treated with 2-OHE2 at the lowest concentrations (0.007 and 70 nM) showed

FIGURE 1 Microsatellite using the marker D13S893 of the cells treated with E2 or its metabolites. DNAs from the E2 or 4-OHE2 transformed cells at 2 different doses: 0.007 and 70 nM alone or in combination with ICI182780 and DNA from 2-OHE2 transformed cells at 0.007 nM, 70 nM or 3.6 lM were utilized for performing the analysis. The parental cell line MCF-10F showed 2 peaks, one at 185 bp and another at 189 bp, representing 2 alleles. The cells treated with 4-OHE2 or E2 at all the doses tested produced LOH with complete loss of 1 allele; only 1 peak at 185 bp was detected; the other peak at 189 bp was lost and this effect was not prevented by ICI182780. The cells treated with 2-OHE2 at the lower doses (0.007 and 70 nM) showed 2 peaks, although at the highest dose (3.6 lM) it showed only 1 peak. Cells treated with 0.007 nM BP and 1 lg/ml BP were used as controls.

ESTROGEN AND ITS METABOLITES INDUCE MUTATIONS IN HUMAN BREAST EPITHELIAL CELLS

1865

FIGURE 2 TP53-Dint analysis using cells treated with E2, 4-OH-E2 or 2-OH-E2. DNA from the E2 or 4-OHE2-transformed cells at 2 different doses: 0.007 and 70 nM alone or in combination with ICI182780 and DNA from 2-OHE2-transformed cells at 0.007 nM, 70 nM or 3.6 lM were utilized for performing the analysis. Cells treated with 0.007 nM BP and 1 lg/ml BP were used as controls.

only 1 peak at 296 bp, just as the parental cell line MCF-10F (Fig. 2). The 2-OHE2 treated cells showed 2 peaks (296 and 291 bp) only at the highest dose (3.6 lM) (Fig. 2). These data suggest that 4-OHE2 and E2 at the doses tested (0.007 and 70 nM) and 2-OHE2 at a higher concentration (3.6 lM) produced a mutation in p53, exon 4, and this effect was not prevented by the antiestrogen ICI182780. The 296 bp peak would be the PCR product of the wild type allele; the shorter peak of 291 bp would be the product of the amplied mutated allele where a deletion was produced by the treatment. Cells treated with the carcinogen BP showed only 1 peak at 296 bp, just as the control untreated MCF-10F (Fig. 2), indicating that the mutation in this region is a specic effect of the E2 and its metabolites. We did not nd changes with the other markers tested (Table II). Deletion in p53, exon 4 Exon 4 of p53 was amplied from MCF-10F cells transformed with 70 nM 4-OHE2. DNA from untreated MCF-10F cells was used as control. The primers of TP53-Dint were used in the amplication and the PCR product obtained was cloned and sequenced. All the clones isolated from untreated MCF-10F harbored the wild type p53 exon 4. Using DNA from MCF-10F cells treated with 70 nM 4-OHE2 as template in the PCR reactions, it was found that 3 colonies out of 11 had a deletion in p53 exon 4 (3/11); in the other colonies, p53 exon 4 was wild type (8/11). The deletion consisted of 5 bp, TTCCC, and it was between codons 98 and 100 (Fig. 3). The p53 exon 4 has 279 bases in length, from base 12021 to 12300 (GeneBank X54156) and encodes 93 amino acids (amino

acids 33123). The 5 bp deletion would produce a change in the protein after amino acid 99 and it would affect the DNA binding domain and probably other domains because of a different structure of the protein.

Discussion In the present work we have demonstrated that neoplastic transformation of MCF-10F cells with E2 and its metabolites was accompanied by LOH in D13S893 located at 13q12.3 and 5 bp deletion found between codons 98 and 100 in p53. E2 and its metabolites induced genomic changes that were not abrogated by the pure antiestrogen ICI182780. These changes were not observed in BP-transformed cells, indicating that this effect was specic for E2 and its metabolites. Loss of 1 complete allele in the region 13q12.3 was observed (using the marker D13S893) in MCF-10F cells transformed with E2 or 4-OHE2 (0.007 nM, 70 nM) either alone or in combination with the antiestrogen ICI182780. Instead, this effect was observed only in the 2-OHE2 transformed cells at a higher dose (3.6 lM). This could explain the reported low transforming abilities of 2OHE2 compared with 4-OHE2.8,9 The marker D13S893 is located 0.8 cM telomeric to the breast cancer susceptibility gene BRCA2. Genetic deletions around the 13q12 region were observed in breast and ovarian tumors,32,33 and the presence of at least 1 novel gene in this region near D13S893 that is not BRCA2 has been suggested.34 LOH in the chromosome 13q12 region has been reported in 2054% of sporadic breast cancer cases.35,36 Interest-

1866

FERNANDEZ ET AL.

FIGURE 3 Nucleotide sequence from p53 exon 4. (a) The sequence of p53 exon 4 (GeneBank X54156, bases 1202112300) is shown; the 5 bases missing by treatment with 70 nM 4-OHE2 are underlined; (b) the deleted region isolated from cells treated with 70 nM E2 is shown in detail; the arrow shows the location of the deletion.

ingly, the analyses of primary breast tumors of 11 postmenopausal women using the marker D13S893 showed LOH in 2 of them, who have received hormone replacement therapy (HRT) (2/11) but it was not observed in those who never received HRT (9/11) (unpublished data). The tumors of women who received HRT and have the LOH in D13S893 were ER- and PgR-negative, supporting the nding that LOH in this locus was more frequent in ERand PgR-negative tumors.35 The relation between estrogen and breast cancer is supported by epidemiological data showing that women who received HRT were more likely to develop breast cancer than the never users.3743 The addition of a progestin in HRT enhances the risk of breast cancer relative to estrogen use alone.44,45 It has been suggested that the progestins used (medroxyprogesterone acetate and 19-nortestosterone derivatives) are endowed with some nonprogesterone-like effects, which can potentiate the proliferative action of estrogens.46 In 1997, the Collaborative Group on Hormonal Factors in Breast Cancer reanalyzed data from 51 epidemiologic studies and found that use of HRT increases the relative risk (RR) of having breast cancer diagnosed by 2.6% each year; with the duration of use 5 years, the RR was 1.34.38 Later results from randomized clinical studies were in consistent with these estimates.37 Controversies about the safety of different postmenopausal hormone therapies reached a peak in 2003 after the publication of the results from the Womens Health Initiative (WHI) trial37 and the Million Women Study (MWS).39 The single hormone therapy formulation in the WHI trial for non hysterectomized womenan association of oral conjugated

equine estrogens (CEEs, 0.625 mg/day) and a synthetic progestin, medroxyprogesterone acetate (MPA, 2.5 mg/day)increases the risks of breast cancer. The United Kingdoms MWS, an observational study, showed a signicant increase in the RR of breast cancer in women taking estrogens only (CEEs or estradiol orally) (RR 1.30), although the increase was greater for women taking estrogens combined with synthetic progestins (RR 5 2.00).39 The risk increased with the duration of use of estrogen alone (RR10 years, 1.37) and estrogen plus progestin (RR10 years, 2.31). Evidence from studies on blood estrogen levels among posmenopausal women show that higher levels are associated with increased risk of subsequent breast cancer.4749 Our data have shown that 4-OHE2 and E2 at the doses of 0.007 and 70 nM, and 2-OHE2 only at a higher concentration (3.6 lM) produced a 5 bp deletion in p53, exon 4. The tumor suppressor gene p53 located on 17p13 is one of the most commonly mutated genes in all types of human cancer.5052 TP53 is a critical regulator of cell growth, differentiation and apoptosis through its actions in cell cycle checkpoint control.53 Wild-type TP53 responds to DNA damage or checkpoint failure by either arresting the cell in the G1 phase of the cell cycle for damage repair or eliminating the damaged cells through the initiation of an apoptotic pathway.54 The 5 bp deletion in exon 4 could affect mainly the DNA binding domain and probably apoptosis.55,56 The complementary DNA strand of the deleted region (TTCCC) is rich in guanines, and it has been showed that the 2-OHE2 and 4-OHE2, together with Cu(II), cause the appearance of single- and double-strand breaks

ESTROGEN AND ITS METABOLITES INDUCE MUTATIONS IN HUMAN BREAST EPITHELIAL CELLS

1867

in the DNA, particularly in guanine rich sites. This suggests a mechanism for the formation of site-specic oxidative DNA damage, supporting the hypothesis of Liehr and coworkers that increased oxidative DNA damage may have a role in estrogen carcinogenesis.58 Supporting evidence is that the same mutation has been reported in hepatocellular carcinoma (HCC),52 and estradiol, which is mainly metabolized in the liver, induces hepatocarcinogenesis.59,60 In addition, signicant associations between CYP1A1 m1 variants, an enzyme that acts in estrogen hydroxylation, and high risk of HCC in women have been reported.61 The marker TP53-Dint was used to study primary breast cancers, showing that MSI was associated with poor prognosis of the disease.62 One important nding reported here is that E2 and 4-OHE2 are mutagenic even at the lowest dose used, whereas 2-OHE2 transformed cells manifested these mutations only at the highest dose. This observation is supported by data in animal models, in which 4-OHE2 had a carcinogenic effect equal to that of E2, whereas 2OHE2 did not induce kidney tumors in hamsters63,64 and had much less ability to induce uterine adenocarcinomas in CD-1 mice than did 4-OHE2.65 Furthermore, the formation of depurinating adducts

57

at the N-3 of Ade and N-7 of Gua by reaction of E2-3,4-Q or enzyme-catalyzed oxidation of 4-OHE2 with DNA is much higher than that from reaction of E2-3,4-Q enzyme-catalyzed oxidation of 2-OHE2 with DNA.66 Interestingly enough in women with breast carcinoma, the 4-CE were 3.5 times more abundant than the 2-CE and were 4 times higher than in women without breast cancer.67 The rates of 4-OHE2 formation exceeded those of 2-OHE2 formation by almost 4-fold in mammary broadenomas and adenocarcinomas, although the rates did not markedly differ in normal human mammary tissue.68 We have found that mutations produced by E2 and its metabolites were not prevented by the antiestrogen ICI182780, indicating that E2 might act through an alternate non-ERa pathway, but we cannot rule out the intervention of ERb that is positive in these cells8,9 or that specic receptors for 4-OHE2 might be present and operational.69 Other work has shown that 4-OHE2 induces an estrogenic response in the uterus of ERa null mice, and this response was not inhibited by ICI182780.70 Altogether, this supports the concept that E2 and mainly its metabolite 4-OHE2 are carcinogenic in breast epithelial cells.

References
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. Cancer facts and gures. American Cancer Society, 2003. Pike MC, Spicer DV, Dahmoush L, Press MF. Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiol Rev 1993;15:1735. Kelsey JL, Gammon MD, John EM. Reproductive factors and breast cancer. Epidemiol Rev 1993;15:3647. Bernstein L, Ross RK. Endogenous hormones and breast cancer risk. Epidemiol Rev 1993;15:4865. Feigelson HS, Henderson BE. Estrogens and breast cancer. Carcinogenesis 1996;17:227984. Russo J, Hu YF, Tahin Q, Mihaila D, Slater C, Lareef MH, Russo IH. Carcinogenicity of estrogens in human breast epithelial cells. APMIS 2001;109:3952. Russo J, Tahin Q, Lareef MH, Hu YF, Russo IH. Neoplastic transformation of human breast epithelial cells by estrogens and chemical carcinogens. Environ Mol Mutagen 2002;39:25463. Russo J, Lareef MH, Tahin Q, Hu YF, Slater C, Ao X, Russo IH. 17bestradiol is carcinogenic in human breast epithelial cells. J Steroid Biochem Mol Biol 2002;80:14962. Russo J, Hasan Lareef M, Balogh G, Guo S, Russo IH. Estrogen and its metabolites are carcinogenic agents in human breast epithelial cells. J Steroid Biochem Mol Biol 2003;87:125. Fernandez SV, Russo IH, Lareef M, Balsara B, Russo J. Comparative genomic hybridization of human breast epithelial cells transformed by estrogen and its metabolites. Int J Oncol 2005;26:6915. Toniolo PG, Levitz M, Zeleniuch-Jacquotte A, Banerjee S, Koenig KL, Shore RE, Strax P, Pasternack BS. A prospective study of endogenous estrogens and breast cancer in postmenopausal women. J Natl Cancer Inst 1995;87:1907. Adlercreutz H, Fotsis T, Hockerstedt K, Hamalainen E, Bannwart C, Bloigu S, Valtonen A, Ollus A. Diet and urinary estrogen prole in premenopausal omnivorous and vegetarian women and in premenopausal women with breast cancer. J Steroid Biochem 1989;34:52730. Adlercreutz H, Gorbach SL, Goldin BR, Woods MN, Dwyer JT, Hamalainen E. Estrogen metabolism and excretion in Oriental and Caucasian women. J Natl Cancer Inst 1994;86:107682. Henderson BE, Ross RK, Pike MC. Toward the primary prevention of cancer. Science 1991;254:11318. Preston-Martin S, Pike MC, Ross RK, Jones PA, Henderson BE. Increased cell division as a cause of human cancer. Cancer Res 1990;50:741521. Nandi S, Guzman RC, Yang J. Hormones and mammary carcinogenesis in mice, rats, and humans: a unifying hypothesis. Proc Natl Acad Sci U S A 1995;92:36507. Nutter LM, Ngo EO, Abul-Hajj YJ. Characterization of DNA damage induced by 3,4-estrone-o-quinone in human cells. J Biol Chem 1991; 266:163806. Han X, Liehr JG. DNA single-strand breaks in kidneys of Syrian hamsters treated with steroidal estrogens: hormone-induced free radical damage preceding renal malignancy. Carcinogenesis 1994;15:997 1000. Cavalieri EL, Stack DE, Devanesan PD, Todorovic R, Dwivedy I, Higginbotham S, Johansson SL, Patil KD, Gross ML, Gooden JK, Ramanathan R, Cerny RL, et al. Molecular origin of cancer: catechol estrogen-3,4-quinones as endogenous tumor initiators. Proc Natl Acad Sci U S A 1997;94:1093742. 20. Cavalieri E, Rogan E, Chakravarti D. The role of endogenous catechol quinones in the initiation of cancer and neurodegenerative diseases. Methods Enzymol 2004;382:293319. 21. Li KM, Todorovic R, Devanesan P, Higginbotham S, Kofeler H, Ramanathan R, Gross ML, Rogan EG, Cavalieri EL. Metabolism and DNA binding studies of 4-hydroxyestradiol and estradiol-3,4-quinone in vitro and in female ACI rat mammary gland in vivo. Carcinogenesis 2004;25:28997. 22. Chakravarti D, Mailander PC, Li KM, Higginbotham S, Zhang HL, Gross ML, Meza JL, Cavalieri EL, Rogan EG. Evidence that a burst of DNA depurination in SENCAR mouse skin induces error-prone repair and forms mutations in the H-ras gene. Oncogene 2001;20: 794553. 23. Liu S, Lin YC. Transformation of MCF-10A human breast epithelial cells by zeranol and estradiol-17b. Breast J 2004;10:51421. 24. Cuendet M, Liu X, Pisha E, Li Y, Yao J, Yu L, Bolton JL. Equine estrogen metabolite 4-hydroxyequilenin induces anchorage-independent growth of human mammary epithelial MCF-10A cells: differential gene expression. Mutat Res 2004;550:10921. 25. Bieche I, Lidereau R. Genetic alterations in breast cancer. Genes Chromosomes Cancer 1995;14:22751. 26. Chen LC, Neubauer A, Kurisu W, Waldman FM, Ljung BM, Goodson W, III, Goldman ES, Moore D, II, Balazs M, Liu E, et al. Loss of heterozygosity on the short arm of chromosome 17 is associated with high proliferative capacity and DNA aneuploidy in primary human breast cancer. Proc Natl Acad Sci U S A 1991;88:384751. 27. Radford DM, Fair KL, Phillips NJ, Ritter JH, Steinbrueck T, Holt MS, Donis-Keller H. Allelotyping of ductal carcinoma in situ of the breast: deletion of loci on 8p, 13q, 16q, 17p and 17q. Cancer Res 1995; 55:3399405. 28. Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, Nguyen K, Seal S, Tran T, Averill D, Fields P, Marshall G, et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 1994;265:208890. 29. Futreal PA, Soderkvist P, Marks JR, Iglehart JD, Cochran C, Barrett JC, Wiseman RW. Detection of frequent allelic loss on proximal chromosome 17q in sporadic breast carcinoma using microsatellite length polymorphisms. Cancer Res 1992;52:26247. 30. Roy D, Calaf G, Hei TK. Frequent allelic imbalance on chromosome 6 and 17 correlate with radiation-induced neoplastic transformation of human breast epithelial cells. Carcinogenesis 2001;22: 168592. 31. Sambrook J, Maniatis T, Fritsch EF. Molecular cloning: a laboratory manual,2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989. 32. Gras E, Cortes J, Diez O, Alonso C, Matias-Guiu X, Baiget M, Prat J. Loss of heterozygosity on chromosome 13q12-q14, BRCA-2 mutations and lack of BRCA-2 promoter hypermethylation in sporadic epithelial ovarian tumors. Cancer 2001;92:78795. 33. Forsti A, Louhelainen J, Soderberg M, Wijkstrom H, Hemminki K. Loss of heterozygosity in tumour-adjacent normal tissue of breast and bladder cancer. Eur J Cancer 2001;37:137280. 34. Cheng Y, Lung HL, Wong PS, Hao da C, Man CS, Stanbridge EJ, Lung ML. Chromosome 13q12 region critical for the viability and growth of nasopharyngeal carcinoma hybrids. Int J Cancer 2004;109: 35762.

12.

13. 14. 15. 16. 17. 18.

19.

1868

FERNANDEZ ET AL.

35. Schmutzler RK, Bierhoff E, Werkhausen T, Fimmers R, Speiser P, Kubista E, Krebs D, Zeillinger R, Wiestler OD, Von Deimling A. Genomic deletions in the BRCA1, BRCA2 and TP53 regions associate with low expression of the estrogen receptor in sporadic breast carcinoma. Int J Cancer 1997;74:3225. 36. Cleton-Jansen AM, Collins N, Lakhani SR, Weissenbach J, Devilee P, Cornelisse CJ, Stratton MR. Loss of heterozygosity in sporadic breast tumours at the BRCA2 locus on chromosome 13q12-q13. Br J Cancer 1995;72:12414. 37. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J. Risks and benets of estrogen plus progestin in healthy postmenopausal women: principal results from the Womens Health Initiative Randomized Controlled Trial. JAMA 2002;288: 32133. 38. Collaborative Group on Hormonal Factors in Breast Cancer. Breast cancer and hormone replacement therapy: collaborative reanalysis of data from 51 epidemiological studies of 52,705 women with breast cancer and 108,411 women without breast cancer. Lancet 1997;350: 104759. 39. Beral V. Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet 2003;362:41927. 40. Li CI, Malone KE, Porter PL, Weiss NS, Tang MT, Cushing-Haugen KL, Daling JR. Relationship between long durations and different regimens of hormone therapy and risk of breast cancer. JAMA 2003; 289:325463. 41. Chlebowski RT, Hendrix SL, Langer RD, Stefanick ML, Gass M, Lane D, Rodabough RJ, Gilligan MA, Cyr MG, Thomson CA, Khandekar J, Petrovitch H, et al. Inuence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Womens Health Initiative Randomized Trial. JAMA 2003;289: 324353. 42. Bakken K, Alsaker E, Eggen AE, Lund E. Hormone replacement therapy and incidence of hormone-dependent cancers in the Norwegian Women and Cancer study. Int J Cancer 2004;112:1304. 43. Colditz GA. Estrogen, estrogen plus progestin therapy, and risk of breast cancer. Clin Cancer Res 2005;11(2 Pt 2):909s17s. 44. Ross RK, Paganini-Hill A, Wan PC, Pike MC. Effect of hormone replacement therapy on breast cancer risk: estrogen versus estrogen plus progestin. J Natl Cancer Inst 2000;92:32832. 45. Schairer C, Lubin J, Troisi R, Sturgeon S, Brinton L, Hoover R. Menopausal estrogen and estrogen-progestin replacement therapy and breast cancer risk. JAMA 2000;283:48591. 46. Campagnoli C, Clavel-Chapelon F, Kaaks R, Peris C, Berrino F. Progestins and progesterone in hormone replacement therapy and the risk of breast cancer. J Steroid Biochem Mol Biol 2005;96:95108. 47. Colditz GA. Relationship between estrogen levels, use of hormone replacement therapy, and breast cancer. J Natl Cancer Inst 1998;90: 81423. 48. Key T, Appleby P, Barnes I, Reeves G. Endogenous sex hormones and breast cancer in postmenopausal women: reanalysis of nine prospective studies. J Natl Cancer Inst 2002;94:60616. 49. Friel PN, Hinchcliffe C, Wright JV. Hormone replacement with estradiol: conventional oral doses result in excessive exposure to estrone. Altern Med Rev 2005;10:3641. 50. Ara S, Lee PS, Hansen MF, Saya H. Codon 72 polymorphism of the TP53 gene. Nucleic Acids Res 1990;18:4961. 51. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science 1991;253:4953.

52. Zhu GN, Zuo L, Zhou Q, Zhang SM, Zhu HQ, Gui SY, Wang Y. Loss of heterozygosity on chromosome 10q22-10q23 and 22q11.2-22q12.1 and p53 gene in primary hepatocellular carcinoma. World J Gastroenterol 2004;10:19758. 53. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 1994;54:485578. 54. Lane DP. Cancer. p53, guardian of the genome. Nature 1992;358:156. 55. Venot C, Maratrat M, Dureuil C, Conseiller E, Bracco L, Debussche L. The requirement for the p53 proline-rich functional domain for mediation of apoptosis is correlated with specic PIG3 gene transactivation and with transcriptional repression. EMBO J 1998;17:466879. 56. Zhu J, Zhou W, Jiang J, Chen X. Identication of a novel p53 functional domain that is necessary for mediating apoptosis. J Biol Chem 1998;273:130306. 57. Li Y, Trush MA, Yager JD. DNA damage caused by reactive oxygen species originating from a copper-dependent oxidation of the 2hydroxy catechol of estradiol. Carcinogenesis 1994;15:14217. 58. Liehr JG. Is estradiol a genotoxic mutagenic carcinogen? Endocr Rev 2000;21:4054. 59. Coe JE, Ishak KG, Ross MJ. Estrogen induction of hepatocellular carcinomas in Armenian hamsters. Hepatology 1990;11:5707. 60. Yager JD, Jr, Yager R. Oral contraceptive steroids as promoters of hepatocarcinogenesis in female Sprague-Dawley rats. Cancer Res 1980;40:36805. 61. Yin PH, Lee HC, Chau GY, Liu TY, Liu HC, Lui WY, Chi CW. Polymorphisms of estrogen-metabolizing genes and risk of hepatocellular carcinoma in Taiwan females. Cancer Lett 2004;212:195201. 62. Chagpar A, Magliocco A, Kerviche A, Tan L, Walley B, DeCoteau JF. The replication error phenotype is associated with the development of distant metastases in hormonally treated patients with breast carcinoma. Cancer 2004;100:9139. 63. Liehr JG, Fang WF, Sirbasku DA, Ari-Ulubelen A. Carcinogenicity of catechol estrogens in Syrian hamsters. J Steroid Biochem 1986;24: 3536. 64. Li JJ, Li SA. Estrogen carcinogenesis in Syrian hamster tissues: role of metabolism. Fed Proc 1987;46:185863. 65. Newbold RR, Liehr JG. Induction of uterine adenocarcinoma in CD-1 mice by catechol estrogens. Cancer Res 2000;60:2357. 66. Cavalieri E, Kohli E, Zahid M, Rogan E. Greater reactivity of estradiol-3,4-quinone vs estradiol-2,3-quinone with DNA in the formation of depurinating DNA adducts. Proc Am Assoc Cancer Res 2003; 44: 180. 67. Rogan EG, Badawi AF, Devanesan PD, Meza JL, Edney JA, West WW, Higginbotham SM, Cavalieri EL. Relative imbalances in estrogen metabolism and conjugation in breast tissue of women with carcinoma: potential biomarkers of susceptibility to cancer. Carcinogenesis 2003;24:697702. 68. Liehr JG, Ricci MJ. 4-Hydroxylation of estrogens as marker of human mammary tumors. Proc Natl Acad Sci U S A 1996;93:32946. 69. Philips BJ, Ansell PJ, Newton LG, Harada N, Honda S, Ganjam VK, Rottinghaus GE, Welshons WV, Lubahn DB. Estrogen receptor-independent catechol estrogen binding activity: protein binding studies in wild-type, Estrogen receptor-a KO, and aromatase KO mice tissues. Biochemistry 2004;43:6698708. 70. Couse JF, Korach KS. Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 1999;20:358417.