Sie sind auf Seite 1von 19

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 1 de 19

ROFESOR. ESTUDIANTE PERIODO: I

Elsy Leottau Mendoza GRUPO FECHA DEL PERODO 4 Febrero GRADO 9 MOD No: AREA: 1 Ciencias Naturales No

META DE COMPRENSIN DEL AO El estudiante comprender: 1.Los argumentos que sustentan los cambios de la diversidad biolgica como consecuencia de eventos evolutivos y dinmicos en seres vivos. TPICO GENERADOR Cmo se copia el material gentico desde una molcula de ADN? Qu hace posible la formacin de protenas en una clula? CONTENIDOS Replicacin Transcripcin Traduccin METAS DE COMPRENSIN DEL PERIODO El estudiante comprender: La diferenciacin de los procesos relacionados a la replicacin, transcripcin y sntesis de protenas en la clula. CRONOGRAMA COMPETENCIA ESTNDAR DESEMPEOS DE COMPRENSIN Diferencia los procesos de replicacin, transcripcin en la clula. 9 Semanas Caracteriza los proceso de sntesis de protenas en las clulas FECHA VALORACIN CONTINUA Orientaciones del profesor, Seguimiento de Instrucciones Revisin del ejercicio por parte del docente y socializacin de los distintos puntos de vista de los educandos alrededor del tema Preguntas de comprensin lectora a fin de verificar el dominio de las principales ideas expuestas en la gua de estudio Revisin y recomendacin por parte del profesor de la actividad realizada basada en una informacin precisa Socializacin de los conceptos bsicos Pruebas escritas para valorar el grado de comprensin y responsabilidad que han tenido los educandos a lo largo del periodo

Explico la diversidad biolgica como consecuencia de los cambios ambientales, genticos y de relaciones dinmicas dentro de los ecosistemas.

NIVELES DE META SUPERIOR Establecer relaciones entre los procesos de replicacin, transcripcin y traduccin asociados a la biologa molecular ALTO Describe los procesos de replicacin, transcripcin y traduccin en la clula. BASICO Reconoce las estructuras asociadas a la sntesis de protenas BAJO

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 2 de 19

Se le dificulta establecer relaciones entre los procesos de transcripcin y sntesis de protenas. ORIENTACIONES DIDCTICAS Lee cuidadosamente cada uno de los numerales del Mdulo Bscalos en tus libros y respndelos expresndolos en palabras sencillas. Responde con responsabilidad y honestidad. Aprovecha el tiempo del trabajo personal para el desarrollo de las actividades asignadas y consulta con tu profesor las dudas al respecto. Debes llevar hojas de complemento y correcciones para un mejor aprendizaje. Baja de Internet las actualizaciones que encuentres sobre el tema y socialzalo con tus compaeros. Tener en cuenta la actitud y disposicin para el trabajo. Cuando se realice una actividad se tienen en cuenta criterios como: creatividad, presentacin y contenido. Cuando se realicen prcticas de laboratorio debes elaborar un informe teniendo en cuente las especificaciones dadas por el docente. Cuando el profesor lo indique se har una evaluacin escrita de los temas vistos en ella. RECURSOS REQUERIDOS (AMBIENTES PREPARADOS PARA EL PERIODO) Saln organizado y aseado, sillas dispuestas segn momentos de trabajo, que facilitarn la comprensin de los educandos, de los temas a tratar, adems de algunas actividades extra clase sugeridas en pginas web de consulta y el trabajo individual en el Mdulo de estudio. LA BASE NOLECULAR DE LA GENTICA Las caractersticas o propiedades que debe reunir cualquier molcula para ser el material hereditario se deducen de la observacin de las propiedades que tienen los organismos vivos. entre las que tenemos:. ALMACENAR INFORMACIN BIOLGICA DE UNA FORMA ESTABLE. REPLICARSE Y TRANSMITIRSE DE UNA CLULA A OTRA Y DE UNA GENERACIN A LA SIGUIENTE. LLEVAR INFORMACIN PARA OTRO TIPO DE MOLCULAS Y ESTRUCTURAS. MUTACIN Y RECOMBINACIN. La gentica molecular estudia la naturaleza molecular de los genes, cmo se expresan y cmo se pueden manipular. El dogma central de la biologa molecular. Un gen era un fragmento de ADN que contena la informacin necesaria para sintetizar una protena. Pero este proceso no era directo, sino que la informacin de un gen se copiaba (trascripcin) en una molcula de cido ribonucleico (ARN) y a partir de esta se fabricaba (traduccin) una protena. Fuente Primaria de variabilidad gentica: mutacin. Las alteraciones o cambios en la molcula que contiene la informacin se denominan mutaciones. La mutacin es la fuente primaria de variabilidad gentica, si no existiera la mutacin, no habra sido posible observar la enorme variabilidad existente de especies diferentes, ni la variabilidad dentro de cada especie. Sin la mutacin no se podra haber producido el proceso evolutivo. Fuente secundaria de variabilidad gentica: recombinacin. La produccin de nuevas combinaciones genticas a partir de las generadas inicialmente por mutacin se produce cuando dos molculas de material hereditario intercambian informacin mediante el proceso de la recombinacin. Dos mutaciones diferentes que se encontraban en molculas de material hereditario distintas pueden reunirse en la misma molcula mediante la recombinacin. Por consiguiente, la recombinacin genera variabilidad produciendo combinaciones nuevas de mutaciones. ADN: LA MOLCULA DE LA HERENCIA Un poco de historia: Alrededor de 1870, el bioqumico suizo Friedrich Miescher, investigando los glbulos blancos obtenidos del pus de unos vendajes, encontr que en el ncleo de las clulas se hallaba una sustancia a la que llam nuclena. Posteriormente, hall la misma sustancia en los espermatozoides del salmn. Su descubrimiento no alcanz demasiada repercusin en su poca, pero las investigaciones continuaron. Para comienzos del siglo XX, ya se saba que los cromosomas estaban formados por protenas y esa sustancia descubierta por Miescher, rebautizada como cido nucleico, y que los cromosomas eran a responsables de la herencia; la duda era si la informacin estaba contenida en el cido nucleico o en las protenas.Phoebus Levene, en 1920, identific que el ADN estaba constituido por nucletidos, compuestos por un grupo fosfato, una molcula de desoxirribosa y una base nitrogenada, de las cuales haba cuatro: adenina, timina, citosina y guanina. Numerosos cientficos continuaron investigando; para 1952 se saba que: el ADN es la molcula de la herencia, todas las clulas del organismo tienen la misma cantidad de ADN, excepto los gametos, que tienen exactamente la mitad, y que la cantidad de adenina es igual que la de timina, as como la cantidad de citosina es igual a la de guanina. La preocupacin por ese entonces estaba en el mecanismo de transmisin hereditaria y en la duplicacin del ADN. Maurice Wilkins y Rosalind Franklin obtienen imgenes de la molcula por difraccin de rayos X, en las cuales se sugiere una forma helicoidal. James Watson y Francis Crick, quienes por su lado estaban tratando de descifrar la estructura de la molcula de ADN, en 1953, publican los resultados de su trabajo: la molcula de ADN es en realidad una doble hlice, y consta de dos cadenas enroscadas como si fuera una escalera de caracol. Watson, Crick y Wilkins recibieron el Premio Nobel de Medicina en 1962 (Rosalind Franklin no fue galardonada dado que falleci en 1958).

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 3 de 19

Watson, Crick y la doble hlice La investigacin acerca de la molcula de la herencia contina hasta hoy; en la actualidad, se ha llegado a descifrar el genoma de diferentes especies, entre ellas la nuestra (el Proyecto Genoma Humano llev aos de investigacin por parte de cientficos de varios pases), y la manipulacin gentica es cada vez ms frecuente, tanto es as que los organismos modificados genticamente forman parte de nuestra alimentacin diaria. Y al final... Qu es el ADN? El cido desoxirribonucleico es la molcula que contiene la informacin de las caractersticas de cada individuo, de cada especie, capaz de autoduplicarse y de ese modo pasar de una generacin a la siguiente. En las clulas, la molcula de ADN no se encuentra "desenrollada", sino que est unida a protenas, y muestra distintos grados de compactacin, segn la fase del ciclo en que se encuentre la clula. Estructura de la molcula: Est formada por dos hebras o cadenas de nucletidos. Cada uno de ellos est compuesto por: Un grupo fosfato Una pentosa (monosacrido de 5 carbonos), llamada desoxirribosa Una base nitrogenada, de las cuales existen cuatro: las purinas ADENINA y GUANINA, y las pirimidinas TIMINA y CITOSINA

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 4 de 19

En verde, el grupo fosfato; en azul, la pentosa; en rojo, la base nitrogenada (en este caso, citosina) Se numeran los tomos de carbono de la pentosa, comenzando por el que se enlaza con la base nitrogenada, al que se designa con el nmero 1', y se continan numerando en sentido horario hasta el nmero 5', que enlaza con el fosfato:

El grupo fosfato de un nucletido se une a la pentosa de otro, y esa pentosa se une con otro grupo fosfato... formando as una larga cadena de fosfato-pentosa, con bases que sobresalen.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 5 de 19

Las dos cadenas son antiparalelas u opuestas porque se enfrenta el extremo 5' de una con el extremo 3' de la otra Las bases nitrogenadas se enlazan por puentes de hidrgeno Siempre se enlazan Adenina con Timina (A=T) y Citosina con Guanina (C=G); nuestro ADN contiene unos 3.000.000.000 de pares de bases! Las dos cadenas se enroscan entre s formando una doble hlice Cada 10 pares de bases, la molcula da un giro cidos nucleicos Los cidos nucleicos (AN) fueron descubiertos por Freidrich Miescher en 1869. En la naturaleza existen solo dos tipos de cidos nucleicos: El ADN (cido desoxirribonucleico) y el ARN (cido ribonucleico) y estn presentes en todas las clulas. Su funcin biolgica no qued plenamente confirmada hasta que Avery y sus colaboradores demostraron en 1944 que el ADN era la molcula portadora de la informacin gentica. Los cidos nucleicos tienen al menos dos funciones: trasmitir las caractersticas hereditarias de una generacin a la siguiente y dirigir la sntesis de protenas especficas. Tanto la molcula de ARN como la molcula de ADN tienen una estructura de forma helicoidal. Qumicamente, estos cidos estn formados, como dijimos, por unidades llamadas nucletidos: cada nucletido a su vez, est formado por tres tipos de compuestos: 1. Una pentosa o azcar de cinco carbonos: se conocen dos tipos de pentosas que forman parte de los nucletidos, la ribosa y la desoxirribosa, esta ltima se diferencia de la primera por que le falta un oxgeno y de all su nombre. El ADN slo tiene desoxirribosa y el ARN tiene slo ribosa, y de la pentosa que llevan se ha derivado su nombre, cido desoxirribonucleico y cido ribonucleico, respectivamente.

Freidrich Miescher

Las dos pentosas 2. Una base nitrogenada: que son compuestos anillados que contienen nitrgeno. Se pueden identificar cinco de ellas: adenina, guanina, citosina, uracilo y timina.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 6 de 19

Las cinco bases nitrogenadas 3. Un radical fosfato: es derivado del cido fosfrico (H3PO4-).

Los AN son polmeros lineales en los que la unidad repetitiva, llamada nucletido (figura de la izquierda), est constituida por: (1) una pentosa (la ribosa o la desoxirribosa), (2) cido fosfrico y (3) una base nitrogenada (purina o pirimidina). La unin de la pentosa con una base constituye un nuclesido (zona coloreada de la figura). La unin mediante un enlace ster entre el nuclesido y el cido fosfrico da lugar al nucletido.

La secuencia de los nucletidos determina el cdigo de cada cido nucleico particular. A su vez, este cdigo indica a la clula cmo reproducir un duplicado de s misma o las protenas que necesita para su supervivencia.

El ADN y el ARN se diferencian porque: - el peso molecular del ADN es generalmente mayor que el del ARN - el azcar del ARN es ribosa, y el del ADN es desoxirribosa - el ARN contiene la base nitrogenada uracilo, mientras que el ADN presenta timina La configuracin espacial del ADN es la de un doble helicoide, mientras que el ARN es un polinucletido lineal, que ocasionalmente puede presentar apareamientos intracatenarios cido Desoxirribonucleico (ADN) El cido Desoxirribonucleico o ADN (en ingls DNA) contiene la informacin gentica de todos los seres vivos.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 7 de 19

Cada especie viviente tiene su propio ADN y en los humanos es esta cadena la que determina las caractersticas individuales, desde el color de los ojos y el talento musical hasta la propensin a determinadas enfermedades. Es como el cdigo de barra de todos los organismos vivos que existen en la tierra, que est formado por segmentos llamados genes. La combinacin de genes es especfica para cada organismo y permite individualizarnos. Estos genes provienen de la herencia de nuestros padres y por ello se utiliza los test de ADN para determinar el parentesco de alguna persona. Adems, se utiliza el ADN para identificar a sospechosos en crmenes (siempre y cuando se cuente con una muestra que los relacione). Actualmente se ha determinado la composicin del genoma humano que permite identificar y hacer terapias para las enfermedades que se trasmiten genticamente como: enanismo, albinismo, hemofilia, daltonismo, sordera, fibrosis qustica, etc.

Molcula de ADN con sus estructura helicoidal CONCEPTOS CLAVES ADN, ARN, genes, nucletidos, grupo fosfato, purinas, pirimidinas, ribosa, desoxiribosa EJERCICIO # 1 Responde en tu cuaderno 1. Imagina que ests mirando a travs de un microscopio de tanto aumento ( el que desees), que puedes ver en detalle un pedacito de ADN. Si empiezas a disminuir gradualmente el aumento, en que orden crees que veras los siguientes objetos: cromosomas, ncleo, genes, clula? 2. Elabora un cuadro comparativo entre la conformacin qumica del ADN y del ARN teniendo en cuenta: forma de la molcula, tipo de azcar y las bases nitrogenadas que los forman. 3. Qu relacin hay entre gen y genoma? Y entre gen y cromatina? 4. .Cul es el concepto actual de gen?. 5. 5. Cmo se codifica la informacin gentica dentro del ADN? ACTIVIDAD EXTRACLASES Investiga en el medio que puedes un artculo sobre la importancia del ADN en las clulas de los seres vivos. REPLICACIN O DUPLICACIN DEL ADN La duplicacin del ADN Para que una especie no se extinga los individuos deben reproducirse, con el fin de engendrar nuevos seres. De la misma manera, para que una clula pueda dividirse es necesario que primero duplique su material gentico y as poder garantizar la misma dotacin cromosmica a las clulas hijas. El modelo de la doble hlice de Watson y Crick permiti explicar cmo las molculas de ADN pueden copiarse, es decir, replicarse y dar una molcula idntica al molde o patrn. Hiptesis de la duplicacin del ADN Hiptesis semiconservativa: formulada por Watson y Crick. En una doble hlice cada hebra servir de molde y, mediante la complementariedad de bases, se formar una hebra copia de cada hebra molde, quedando al final dos dobles hlices formadas por una hebra antigua (molde) y una hebra nueva (copia). En 1957, experimentos realizados por Meselson y Stahl confirmaron esta hiptesis. Hiptesis conservativa: tras la duplicacin quedan dos hebras antiguas y dos hebras nuevas formando una doble hlice. Hiptesis dispersa: se propone que las hebras estn formadas por fragmentos distintos de ADN antiguo y ADN recin sintetizado. El crecimiento de las nuevas hebras La ADN-polimerasa: El estudio in vitro de la duplicacin del ADN fue posible gracias al aislamiento de la enzima ADN-polimerasa por Kornberg. Esta enzima es incapaz de iniciar una cadena de novo; requiere la presencia de un extremo libre del carbono 3' de un nucletido, para poder ir aadiendo los nucletidos nuevos. Este extremo 3' libre lo aporta el cebador o primer, que es una porcin pequea de nucletidos complementaria al extremo de la cadena patrn. Por tanto, la cadena naciente siempre crecer en el sentido 5'3'. El primer nucletido de la cadena nueva tiene un extremo 5' libre; se irn aadiendo nucletidos a los extremos 3' libre y se irn formando los enlaces fosfodiester 3'5', de forma que el ltimo nucletido tendr libre el carbono 3'. Los nucletidos se aadirn siguiendo las reglas de la complementariedad de bases, de manera que la nueva hebra sintetizada ser antiparalela y complementaria a la patrn. Mecanismo de duplicacin del ADN en bacterias. Mecanismos de duplicacin del ADN

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 8 de 19

Aunque existen algunas diferencias el proceso es bsicamente igual en bacterias y en eucariotas: La secuencia de nucletidos en el origen de replicacin del ADN acta como seal de iniciacin. La enzima helicasa separa las dos hebras de la doble hlice para que sirvan de molde. El desenrollamiento de la hlice da lugar al superenrollamiento en los extremos de la horquilla de replicacin, actuando entonces las enzimas topoisomerasas que liberan esta tensin. La topoisomerasa I corta una hebra y la topoisomerasa II (denominada girasa en E. coli) las dos. Una vez liberada la tensin vuelven a sellar la doble hlice. Mientras se separan las dos hebras se van uniendo las protenas estabilizadoras, de forma que se mantengan separadas ambas hebras y se estabilice la horquilla de replicacin. El proceso de duplicacin es bidireccional; hay dos horquillas de replicacin por cada burbuja de replicacin. La primasa (una ARN-polimerasa) sintetiza los fragmentos de ARN que sirven de cebador (primer) para la ADN-polimerasa. La ADN-polimerasa III incorpora en direccin 5'3' los nucletidos, formando una nueva hebra de crecimiento continuo denominada hebra conductora. Sobre la otra hebra antiparalela, primero, a unos mil nucletidos del origen de replicacin, se sintetizarn unos cincuenta nucletidos de ARN que servirn para que la ADN-polimerasa III incorpore los desoxinucletidos, formndose los fragmentos de Okazaki a medida que se va abriendo la horquilla. Una vez formados, la ADN-polimerasa I, gracias a su funcin exonucleasa, ir eliminando los tramos de ARN y los ir rellenando con ADN, sintetizados gracias a su actividad polimerasa. Finalmente interviene la ADN-ligasa, que empalma entre s los distintos fragmentos de la hebra de crecimiento discontinuo, denominada hebra retardada. CONCEPTOS CLAVES Hiptesis semiconservativa, conservativa, y dispersa, enzima helicasa, topoisomerasas, la primasa, ADN ligasa EJERCICIO # 2 Despus de leer comprensivamente el marco terico responde: 1. Que entendiste por duplicacin 2. Representa mediante un grafico este proceso 3. Por qu crees tu es importante estudiar este proceso 4. En la replicacin del ADN. Cul es la razn por la que la sntesis es continua en una de las cadenas y discontinua en la otra? 5. Por qu la duplicacin del ADN exige un estricto control de calidad y que enzimas lo realizan. . En la purificacin de un fragmento de ADN se ha perdido una porcin de una de las dos hebras, quedando la secuencia de bases nitrogenadas como se indica a continuacin. Reconstruye la porcin que falta y explica en qu te basas para reconstruirla. ATTACC................. AATGGGCCGAATTCGGCTAAGCT MARCO TERICO TRANSCRIPCIN Transcripcin Una vez que se conforman las dos cadenas nuevas de ADN, lo que sigue es pasar la informacin contenida en estas cadenas a una cadena de ARN, proceso que se conoce como transcripcin. Aqu la enzima responsable es la ARN polimerasa, la cual se une a una secuencia especfica en el ADN denominada promotor y sintetiza ARN a partir de ADN. En la transcripcin, la informacin codificada en un polmero formado por la combinacin de 4 nucletidos (ADN) se convierte en otro polmero cuyas unidades tambin son 4 nucletidos (ARN). El cido ribonucleico es similar al ADN (por eso el proceso se denomina transcripcin), pero poseen algunas diferencias, como mostramos en la figura 2.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 9 de 19

Figura 2. Diferencias entre el ADN y el ARN. Ambos polmeros de nucletidos estn formados por un cdigo de 4 bases nitrogenadas. Sin embargo, en la clula el ADN se encuentra como una doble cadena y el ARN generalmente como simple cadena. La similitud en el alfabeto permite la sntesis de un polmero utilizando el otro como molde, en presencia de las enzimas adecuadas. La transcripcin de genes puede dar lugar a ARN mensajero ( ARNm, molcula que sirve como molde de la traduccin), ARN ribosomal (ARNr, que forma parte de los ribosomas, un complejo compuesto por protenas y ARNr donde se realiza el proceso de traduccin) o ARN de transferencia (ARNt, molculas que funcionan como adaptadores en el proceso de traduccin). Fenmenos postranscripcin Si bien estos pasos bsicos son los mismos para la mayora de los organismos, hay diferencias entre los distintos dominios de seres vivos (Bacteria, Arquea y Eucaria) tanto en la replicacin como en la transcripcin y en la traduccin. En organismos procariontes, el ARNm se une a los ribosomas y puede ser traducido tal y como es liberado de la ARN polimerasa, ya que se encuentra en el citoplasma celular y no sufre ninguna modificacin. Incluso, puede ser traducido a medida que es transcripto. En los eucariontes, sin embargo, la traduccin y transcripcin ocurren en forma separada. La transcripcin ocurre en el ncleo y la traduccin, en el citoplasma, puede ocurrir minutos, horas o incluso das ms tarde. Antes de salir del ncleo para ser traducido, el ARNm sufre dos modificaciones, por lo que es llamado pre-ARNm. La primera de ellas es el procesamiento por corte y empalme (splicing, en ingls), en el cual se eliminan algunos secuencias no codificantes (o intrones) y se unen las secuencias codificantes (exones). Una molcula de ARNm puede llegar a tener hasta 70 intrones, que pueden llegar a variar de tamao entre 80 y 10.000 nucletidos. La segunda modificacin ocurre en los extremos: al extremo 5 se le une una caperuza (compuesta por guanina metilada) y al extremo 3 se agrega una cola de poliadenina o poliA (Figura 3). Luego de todas estas modificaciones, tenemos un ARN maduro.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 10 de 19

CONCEPTOS CLAVES Transcripcin, exn, intrn, ARN mensajero, ARN ribosomal, ARN de transferencia, ARN maduro EJERCICIO # 3 1. Qu funcin realizan en general las ADN polimerasas y las ARN polimerasas? 2. Seala los aspectos diferentes que encuentras entre replicacin y transcripcin. Qu tienen en comn? 3. Por qu es importante la transcripcin? 4. Qu funcin cumplen los intrones y los exones? 5. Observa el grfico que representa la transcripcin, elabora un resumen explicando el proceso. MARCO TERICO TRADUCCIN O SNTESIS DE PROTENAS CODIGO GENTICO El cdigo gentico es el conjunto de reglas usadas para traducir la secuencia de nucletidos del ARNm a una secuencia de protena en el proceso de traduccin.

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 11 de 19

Caractersticas del cdigo gentico: La correspondencia entre nucletidos y aminocidos se hace media nte codones. Un codn es un triplete de nucletidos que codifica un aminocido concreto. El cdigo gentico es degenerado: un mismo aminocido es codificado por varios codones, salvo Triptfano y Metionina que estn

codificados por un nico codn. Existen 64 codones diferentes para codificar 20 aminocidos. Los codones que codifican un mismo aminocido en muchos casos comparten los dos primeros nucletidos. El codn AUG que codifica la metionina es el codn de inicio y hay tres codones que establecen la seal de terminacin de la traduccin (UAA, UAG, UGA). Es casi universal. Es el mismo para la mayora de los organismos, con algunas excepciones en protozoarios, micoplasmas y las mitocondrias. La traduccin del ARNm INTRODUCCION El ARN mensajero es el que lleva la informacin para la sntesis de protenas, es decir, determina el orden en que se unirn los aminocidos La sntesis de protenas o traduccin tiene lugar en los ribosomas del citoplasma celular. Los aminocidos son transportados por el ARN de transferencia (ARNt) , especfico para cada uno de ellos, y son llevados hasta el ARN mensajero (ARNm), dnde se aparean el codn de ste y el anticodn del ARN de transferencia, por complementariedad de bases, y de sta forma se sitan en la posicin que les corresponde. Una vez finalizada la sntesis de una protena, el ARN mensajero queda libre y puede ser ledo de nuevo. De hecho, es muy frecuente que antes de que finalice una protena ya est comenzando otra, con lo cual, una misma molcula de ARN mensajero, est siendo utilizada por varios ribosomas simultneamente. Los ARNt desempean un papel central en la sntesis de las protenas La sntesis proteica tiene lugar en el ribosoma, que se arma en el citosol ( medio acuoso del citoplasma) a partir de dos subunidades riborrucleoproteicas provenientes del nuclolo. En el ribosoma el ARN mensajero (ARNm) se traduce en una protena, para lo cual se requiere tambin la intervencin de los ARN de transferencia (ARNt). El trabajo de los ARNt consiste en tomar del citosol a los aminocidos y conducirlos al ribosoma en el orden marcado por los nucletidos del ARNm, que son los moldes del sistema La sntesis de las protenas comienza con la unin entre s de dos aminocidos y contina por el agregado de nuevos aminocidos -de a uno por vez- en uno extremos de la cadena. Como se sabe la clave de la traduccin reside en el cdigo gentico, compuesto por combinaciones de tres nucletidos consecutivos o tripletes- en el ARNm. Los distintos tripletes se relacionan especficamente con tipos de aminocidos usados en la sntesis de las protenas. Cada triplete constituye un codn: existen en total 64 codones, 61 de los cuales sirven para cifrar aminocidos y 3 para marcar el cese de la

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 12 de 19

traduccin. Tal cantidad deriva de una relacin matemtica simple: los cuatro nucletidos (A, U, C y G)se combinan de a tres, por lo que pueden generarse 64 (43). Dado que existen ms codones, (61) que tipos de aminocidos (20), casi todos pueden ser reconocidos por ms de un codn, por lo que algunos tripletes a como "sinnimos". Solamente el triptfano y la metionina -dos de los aminocidos menos frecuentes en las protenas son codificados, cada uno, por un solo codn Fig. A-1. Los dibujos ilustran cuatro de los seis codones que codifican al aminocido leucina (Leu). Los dos de la izquierda se aparean con un mismo anticodn, igual que el par de codones de la derecha. Ello es posible porque la tercera base de los codones suele ser "adaptable ", es decir, puede establecer uniones con una base no complementaria.

Generalmente los codones que representan a un mismo aminocido se parecen entre s y es frecuente que difieran slo en el tercer nucletido. La baja especificidad de este nucletido ha llevado a decir que existe una "degeneracin" en tercera base de la mayora de los codones. Resta agregar que el nmero de codones en el ARNm determina la longitud de la protena. Existen 31 tipos diferentes de ARNt Las molculas intermediarias entre los codones del ARNm y los aminocidos son los ARNt, los cuales tienen un dominio que se liga especficamente a uno de los 20 arninocidos y otro que lo hace, especficamente tambin, con el codn apropiado. El segundo dominio consta de una combinacin de tres nucletidos -llamada anticodn - que es complementaria de la del codn. Cada tipo de ARNt lleva antepuesto el nombre del aminocido que transporta. por ejemplo, leucinil-ARNt para el aminoacil-ARNt de la leucina, lisinil-ARNt para el de la lisina, fenilalanil-ARNt para el de la fenilalanina, metionil-ARNt para el de la metionina, etctera. Por su lado. El ARNt unido al aminocido compatible con l se designa aminoacil-ARNtAA, en el que "AA" correspnde a la sigla del aminocido. Por ejemplo, leucinil-ARNtLeu, lisinil-ARNtlys, fenilalanil-ARNtPhe. metionil-ARNtMet, etctera. Si bien tericamente pueden existir 61 tipos de ARNt diferentes, slo hay 31. El dficit se resuelve por la capacidad que tienen algunos ARNt de reconocer a ms de un codn. Lo logran porque sus anticodones suelen poseer la primera base "adaptable", es decir, que puede unirse con una base no complementaria situada en la tercera posicin del codn (recurdese la "degeneracin" de esta base). As, la G en la primera posicin del anticodn puede aparearse tanto con una C -es lo habitual - como con una U del codn (fig. A-1). Similarmente, la U en la primera posicin del anticodn puede hacerlo con una A -es lo habitual - o con una G. Por otra parte, la inosina (I) una de las bases inusuales se encuentra en la primera posicin del anticodn en varios ARNt y es capaz de aparearse con cualquier base (excepto con una G) localizada en la tercera posicin del codn. El codn de iniciacin es el triplete AUG El primer codn que se traduce en los ARNm es siempre el triplete AUG. cuya informacin codifica al aminocido metionina (fig. A-2). Por lo tanto, este codn cumple dos funciones: seala el sitio de comienzo de la traduccin -caso en el cual recibe el nombre de codn de iniciacin -, y cuando se halla en otras localizaciones en el ARNm codifica a las metioninas del interior de las molculas proteicas. Al especificar el primer aminocido de la protena, el codn AUG de iniciacin determina el encuadre de los sucesivos tripletes, lo que asegura la sntesis correcta de la molcula. Tmese como ejemplo la secuencia AUGGCCUGUAACGGU. Si el ARNm es traducido a partir del codn AUG, los codones siguientes sern GCC, UGU, AAC y GGU, que codifican, respectivamente, a los aminocidos alanina, cisteina ,asparagina y glicina. En cambio, si se omitiera la A del codn de iniciacin, el encuadre de los tripletes sera el siguiente: UGG, CCU, GUA y ACG, los cuales se traducen en los aminocidos triptfano, prolina, valina y treonina, respectivamente. Algo semejante ocurrira si tambin se omitiera la U, pues resultara un tercer tipo de encuadre: GGC, CUG, UAA y CGC. En este caso, despus de codificar los dos primeros codones a los aminocidos glicina y leucina, la traduccin se detendra, ya que UAA es un codn de terminacin.

Fig. A-2

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 13 de 19

Los aminocidos se ligan por medio de uniones peptdicas La unin de los aminocidos entre s para construir una protena se produce de modo que el grupo carboxilo de un aminocido se combina con el grupo a amnocido siguiente, con prdida de una molcula de agua H2O y recordemos que esa combinacin se llama unin peptdica. Cualquiera que sea su longitud, la protena mantiene el carcter anfotrico de los aminocidos aislados, ya que contiene un grupo amino libre en uno de sus extremos y un grupo carboxilo en el otro extremo. La protena se sintetiza a partir de extremo que lleva el grupo amino libre. Ello se corresponde con la direccin 5 3 usada para la traduccin del ARNm, la misma con que el ADN se transcribe (ver figura ) Antes de describir los procesos que dan lugar a la sntesis de las protenas analizaremos cmo arriban los ARNm al citoplasma, qu configuracin poseen los ARNt y cul es la estructura de los ribosomas. Los ARNm arribados al citoplasma se conectan con rbosomas Los transcriptos primarios de los ARNm se hallan combinados con diversas protenas, con las que forman las nueleoprotenas heterogneas nucleares o RNPhn.. No obstante, muchas de esas protenas se desprenden de los ARNm a medida que stos abandonan el ncleo. Los ARNm salen hacia el citoplasma por los poros de la envoltura nuclear. Ya en el citosol, cada ARNm se combina con nuevas protenas y con ribosomas, lo que lo habilita para ejercer su funcin codificadora durante la sntesis proteica. Entre las protenas se encuentra la llamada CBP (por capbinding protein), que se combina con el cap en el extremo 5 del ARNm. Su papel ser analizado ms adelante. Algunos ARNm se localizan en sitios prefijados en el citoplasma, de modo que las protenas que codifican se sintetizan y se concentran en esos sitios. Un ejemplo es el ARNm de la actina, que se sita en la zona perifrica de las clulas epiteliales donde se deposita la mayor parte de la actina . El extremo 5' de los ARNm contiene una secuencia de alrededor de 10 nucletidos previa al codn de iniciacin -entre ste y el cap - que, como es lgico, no se traduce (fig. A-2). En algunos ARNm esta secuencia participa en el control de 1a traduccin y en otros regula la estabilidad del ARNm, es decir, su supervivencia. Otra secuencia especial del ARNm, de hasta miles de nucletidos, suele hallarse despus del codn de terminacin. entre ste y la poli A (fig. A-2). Tiene por funcin controlar la supervivencia del ARNm. Las molculas de los ARNt adquieren una forma caracterstica Hemos visto que los codones del ARNm no seleccionan a los aminocidos directamente y que la traduccin de los ARNM en protenas depende de un conjunto de molculas intermediarias -los ARNt- que actan como adaptadores, ya que discriminan tanto a los codones del ARNm como a los aminocidos compatibles con ellos. As la funcin bsica de los ARNt es alinear a los aminocidos siguiendo el orden de los codones para poder cumplir con sus funciones, los ARNt ,adquieren una forma caracterstica semejante a un trbol de cuatro hojas (fig. A-3). Los cuatro brazos se generan por la presencia en los ARNt de secuencias de 3 a 5 pares de nuelctidos complementarios, los cuales se aparean entre s como los nucletidos de las dos cadenas del ADN. En la punta de uno de los brazos confluyen los extremos 5' y 3 del ARNt. El extremo 3 es ms largo, de modo que sobresale el trinucletido CCAque fue incorporado durante el procesamiento. Este brazo se llama aceptador porque a l se liga el aminocido, que se une a la A del CCA. Los tres brazos restantes poseen en sus extremos secuencias de 7 a 8 nucletidos no apareados, -con forma de asas -, cuyas denominaciones derivan de los nucletidos que las caracterizan. Una de ellas contiene el triplete de nueletidos del anticodn,por lo que su composicin vara en cada tipo de ARNt. Otra, en virtud de que contiene dihidrouridinas (D), se denomina asa D. La tercera se conoce como asa T, por el trinucletido Ty C que la identifica. La letra T simboliza a la ribotimidina y la y a la seudouri dina. Entre el asa T y el anticodn existe un asa adicional, llamada variable porque su longitud difiere en los distintos ARN de transferencia. Un plegamiento ulterior en el ARNt hace que deje de parecerse a un trbol de cuatro hojas y adquiera la forma de la letra L (fig. A-4). El cambio se debe a que se establecen apareamientos inusuales entre algunos nueletidos, como la combinacin de un nucletido con dos a la vez. Formada la L, las asas D y T pasan a la zona de unin de sus dos ramas y el brazo aceptador y el triplete de bases del anticodn se sitan en las puntas de la molcula (fig. A-4).

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 14 de 19

FIGURA A-3 FIGURA A-4

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 15 de 19

Una aminoacil-ARNt sintetasa une el aminocido al ARNt El aminocido se liga a su correspondiente ARNt por la accin de una enzima llamada aminoacil-ARNt sintetasa, que cataliza la unin en dos pasos. Durante el primero, el aminocido se liga a un AMP , con el cual forma un aminoacil AMP. Por ejemplo leucinil AMP , lisinil AMP, fenilalanil AMP, metionil-AMP, etc.. Dado que el AMP deriva de la hidrlisis de un ATP , se libera pirofosfato (PP) y energa , que tambin pasa al aminoacil- AMP AA + ATP AA-AMP + PP En el segundo paso esa energa es utilizada por la aminoacil ARNt sintetasa para transferir el aminocido del aminoacil AMP a la A del brazo aceptador del ARNt compatible, con lo cual se forma una molcula esencial para la sntesis proteica: el aminoacil-ARNtAA que reconoce el codn complementario en el ARNm. AA-A + ARNt ( AMINOACIL SINTETASA) AA-ARNtAA + AMP Debe sealarse que la energa del ATP usada en la primera reaccin queda depositada en la unin qumica entre el aminocido y la A del trinucletido CCA. Existen 20 amnoacil ARNt sintetasas diferentes Existen 20 aminoacil-ARNt sintetasas diferentes, cada una diseada para reconocer a un aminocido y al ARNt compatible con l. Ambos reconocimientos permiten que cada uno de los 31 tipos de ARNt se ligue slo a uno de los 20 aminocidos usados en la sntesis proteica. Ello es posible porque cada aminoacil ARNt sintetasa identifica al ARNt por el anticodn, la parte ms especfica del ARNt (Fig A-3). No obstante, en los ARNt existen otras seales que son reconocidas por la enzima, generalmente tramos de nucletidos cercanos al anticodn. Como es obvio, la existencia de 11 clases de ARNt hace que algunos aminocidos sean reconocidos por ms de un ARNt. Uno de los ARNt redundantes es el llamado ARNt iniciador o ARNt[i], pues transporta a la metionina destinada exclusivamente al codn AUG de iniciacin (FIG A-9). Es muy probable que cerca de ese codn existan seales que diferencien al metionil-ARNt[i]met portador de la metionina dirigida a l- de los metionil ARNtmet comunes, portadores de las metioninas destinadas a los restantes codones AUG del ARNm. Los ribosomas estn compuestos por dos subunidades Los mecanismos para alinear a los aminoacil ARNtAA de acuerdo con el orden de los codones del ARNm son algo complicados. Requieren de los ribosomas cuya primera tarea es localizar al codn AUG de iniciacin y acomodarlo correctamente para que el encuadre de ese triplete y el de los siguientes sea el adecuado. Luego el ribosoma se desliza hacia el extremo 3del ARNm y traduce a los sucesivos tripletes en aminocidos. Estos son trados de a uno por vez por los respectivos ARNt. Las reacciones que ligan a los aminocidos entre s - es decir , las uniones peptdicas - se producen dentro del ribosoma . Finalmente, cuando el ribosoma arriba al codn de terminacin en el extremo 3del ARNm cesa la sntesis proteica y se libera la protena. Como podemos notar, los ribosomas constituyen las "fbricas de las protenas" Cada ribosoma est compuesto por dos subunidades - una mayor y otra menor identificadas con las siglas 40S y 60S respectivamente (los nmeros hacen referencia a los coeficientes de sedimentacin de las subunidades, es decir a las velocidades con que sedimentan cuando son ultracentrifugadas, la 60S migra ms rpido al fondo del tubo). En la subunidad menor algunas protenas forman dos reas - una al lado de la otra denominadas sitio P (por peptidil) y sitio A (por aminoacil).

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 16 de 19

Por otro lado en la subunidad mayor las protenas ribosmicas formaran un tnel por el que saldra la cadena polipeptdicas a medida que se sintetiza Las etapas de la sntesis de protenas La sntesis de las protenas se divide en tres etapas, llamadas de iniciacin , de alargamiento y de terminacin (fig. A-9). a) Iniciacin. La subunidad ribosmica ms pequea se une al extremo 5 de una molcula de ARNm. La primera molcula de ARNt, que lleva el aminocido modificado fMet, se enchufa en el codn iniciador AUG de la molcula deARNm. La unidad ribosmica ms grande se ubica en su lugar, el ARNt ocupa el sitio P (peptidico). El sitio A (aminoacil) est vacante. El complejo de iniciacin est completo ahora. b) Alargamiento. Un segundo ARNt con su aminocido unido se mueve al sitio A y su anticodn se enchufa en el mRNA. Se forma un enlace peptidico entre los dos aminocidos reunidos en el ribosoma. Al mismo tiempo, se rompe el enlace entre el primer aminocido y su ARNt. El ribosoma se mueve a lo largo de la cadena de ARNm en una direccin 5 a 3 y el segundo ARNt, con el dipptido unido se mueve al sitio P desde el sitio A, a medida que el primer ARNt se desprende del ribosoma. Un tercer ARNt se mueve al sitio A y se forma otro enlace peptdico. La cadena peptdica naciente siempre est unida al tRNA que se est moviendo del sitio A al sitio P, y el ARNt entrante que lleva el siguiente aminocido siempre ocupa el sitio A. Este paso se repite una y otra vez hasta que se completa el polipptido. c) Terminacin. Cuando el ribosoma alcanza un codn de terminacin (en este ejemplo UGA), el polipptido se escinde del ltimo ARNt y el ARNt se desprende del sitio P. El sitio A es ocupado por el factor de liberacin que produce la disociacin de las dos subunidades del ribosoma

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 17 de 19

CONCEPTOS CLAVES Cdigo gentico, codn, anticodn, traduccin, codn de iniciacin, codn de terminacin EJERCICIO # 4 Responde en tu cuaderno: 1. Qu es el cdigo Gentico? 2. Qu significa qu el cdigo gentico es altamente especfico y al mismo tiempo degenerado?. 3. Puede esto ofrecer alguna ventaja?. 4. Qu es la Traduccin y donde se realiza?

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 18 de 19

5. Qu funcin cumple el ARN de transferencia en la Sntesis de Protenas? 6. Explique la funcin del codn de iniciacin 7. Cul es la funcin de los Ribosomas en la sntesis de protenas? 8. Explique las etapas de la sntesis de Protenas? 9. Observa los siguientes esquemas, relativos al funcionamiento de los cidos nucleicos, e indica cules son verdaderos y cules son falsos:

ADN

Transcripcin

ARN

ADN

Traduccin

Protena

ADN

Replicacin

ADN1+ ADN2

ADN

Traduccin

ARN

10. Explicar el siguiente esquema:

Es correcto este esquema?. Razona la respuesta. La secuencia de bases de una de las hebras de un fragmento de ADN es: AATCCGCGCTATTATCGT 11.Representar: a. La cadena complementaria b. Replicar el fragmento formado siendo el punto de iniciacin el 12. Despus de responder las preguntas anteriores disea un resumen con el grafico de la sntesis de protenas.

extremo

izquierdo.

BIBLIOGRAFA Y DIRECCIONES ELECTRNICAS (PARA PROFUNDIZAR ) http://personales.ya.com/geopal/biologia_2b/unidades/ejercicios/act1gmtema5.htm( actividad) http://www.ucm.es/info/genetica/grupod/Basemol/base_molecular_de_la_herencia.htm http://biologia-lacienciadelavida.blogspot.com/2010/09/adn-la-molecula-de-la-herencia-4-ano.html http://www.profesorenlinea.cl/Ciencias/AcidosNucleicos.htm http://personales.ya.com/geopal/biologia_2b/unidades/unidad3_5.htm#bia http://www.hiru.com/biologia/la-duplicacion-del-adn http://aportes.educ.ar/biologia/nucleo-teorico/estado-del-arte/como-se-encienden-y-apagan-los-genes-el-dogma-central-de-la-biologia-pasoa-paso/transcripcion.php

Mdulo Biologa I Periodo

GAF-50-V1 Fecha:17-03-09 Pgina 19 de 19