ARTICLE Biosynthesis of Polylactic Acid and Its Copolymers Using Evolved Propionate CoA Transferase and PHA Synthase

Taek Ho Yang,1 Tae Wan Kim,1 Hye Ok Kang,1 Sang-Hyun Lee,1 Eun Jeong Lee,1 Sung-Chul Lim,1 Sun Ok Oh,1 Ae-Jin Song,2 Si Jae Park,1 Sang Yup Lee2,3 Corporate R&D, LG Chem Research Park, 104-1 Moonji-dong, Yuseong-gu, Daejeon 305-380, Republic of Korea; telephone: 82-42-870-6442; fax: +82-42-861-2057; e-mail: park_sj@lgchem.com 2 Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering (BK21 Program), Center for Systems and Synthetic Biotechnology, and Institute for the BioCentury, KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Republic of Korea; telephone: 82-42-350-3930; fax: 82-42-350-3910; e-mail: leesy@kaist.ac.kr 3 Department of Bio and Brain Engineering, Department of Biological Sciences, BioProcess Engineering Research Center, and Bioinformatics Research Center, KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Republic of Korea
Received 26 July 2009; revision received 5 September 2009; accepted 14 September 2009 Published online in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/bit.22547
1

ABSTRACT: For the synthesis of polylactic acid (PLA) and its copolymers by one-step fermentation process, heterologous pathways involving Clostridium propionicum propionate CoA transferase (PctCp) and Pseudomonas sp. MBEL 619 polyhydroxyalkanoate (PHA) synthase 1 (PhaC1Ps6-19) were introduced into Escherichia coli for the generation of lactyl-CoA endogenously and incorporation of lactyl-CoA into the polymer, respectively. Since the wild-type PhaC1Ps619 did not efciently accept lactyl-CoA as a substrate, site directed mutagenesis as well as saturation mutagenesis were performed to improve the enzyme. The wild-type PctCp was not able to efciently convert lactate to lactyl-CoA and was found to exert inhibitory effect on cell growth, random mutagenesis by error-prone PCR was carried out. By employing engineered PhaC1Ps6-19 and PctCp, poly(3-hydroxybutyrateco-lactate), P(3HB-co-LA), containing 2049 mol% lactate could be produced up to 62 wt% from glucose and 3HB. By controlling the 3HB concentration in the medium, PLA homopolymer and P(3HB-co-LA) containing lactate as a major monomer unit could be synthesized. Also, P(3HBco-LA) copolymers containing various lactate fractions could be produced from glucose alone by introducing the Cupriavidus necator b-ketothiolase and acetoacetyl-CoA reductase
Correspondence to: S.Y. Lee and S.J. Park Contract grant sponsor: LG Chem Contract grant sponsor: Korean Systems Biology Research Project of the Ministry of Education, Science and Technology through Korea Science and Engineering Foundation Contract grant sponsor: World Class University Program of the Ministry of Education, Science and Technology Contract grant number: 20090065571

genes. Fed-batch cultures were performed to produce P(3HBco-LA) copolymers having 964 mol% of lactate, and their molecular weights, thermal properties, and melt ow properties were determined. Biotechnol. Bioeng. 2010;105: 150160. 2009 Wiley Periodicals, Inc. KEYWORDS: polylactic acid; PLA; PHA synthase; propionate CoA transferase; enzyme evolution

Introduction
Production of polymers from renewable biomass has been attracting much attention due to the increasing concerns on the environmental problems and the limited nature of fossil resources. Polylactic acid (PLA) has been considered as a good alternative to petroleum-based plastic as it possesses several desirable properties such as biodegradability, biocompatibility, compostability, and low toxicity to humans rd and derga (Drumright et al., 2000; Mehta et al., 2005; So Stolt, 2002; Vink et al., 2003). At present, PLA is synthesized by a two-step process consisting of fermentation for lactic acid production and chemical process for polymerization such as ring opening polymerization of lactide, a cyclic dimer resulting from the dehydration of lactic acid, or solvent-based azeotropic dehydrative condensation (Drumright et al., 2000; rd and Stolt, 2002; Vink et al., derga Mehta et al., 2005; So 2009 Wiley Periodicals, Inc.

150

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

2003). Improvement of the material properties of PLA, which are quite stiff and brittle, has been attempted by copolymerization or blending with other polymers including polyhydroxyalkanoates (PHAs) (Chen and Wu, 2005; Haynes et al., 2007; Noda et al., 2004; Schreck and Hillmyer, 2007). Despite these efforts, existing chemical methods are not effective considering the availability of lactonized monomers used in copolymerization and their cost. Differently from PLA which requires chemical polymerization of lactic acid or lactide, PHAs are synthesized in vivo by PHA synthase (PhaC) which polymerizes various (D)hydroxyacyl-CoAs (HA-CoAs) generated through diverse metabolic pathways in the cell (Lee, 1996). Lactate has also been suggested to be a possible monomer unit of natural PHAs because it contains both hydroxyl and carboxyl chel and groups required to form an ester bond (Steinbu Valentin, 1995). However, until recently, there has been no report on the production of PHAs containing lactate as a major monomer, which is most likely due to the limitation of substrate specicity of the existing PHA synthases; several studies have shown that the in vitro activity of PHA synthase towards (D)-lactyl-CoA is very low or negligible compared with other HA-CoAs, especially (D)-3-hydroxybutyryl-CoA chel, 1994; Yuan et al., (3HB-CoA) (Valentin and Steinbu 2001; Zhang et al., 2001). Several years ago, we were able to show that poly(3hydroxybutyrate-co-lactate), P(3HB-co-LA), could be synthesized in recombinant Cupriavidus necator H16 (formerly, Ralstonia eutropha H16) expressing the Clostridium propionicum propionate CoA transferase (PctCp) gene, which allows generation of (D)-lactyl-CoA in the cell, even though the lactate fraction was very low (Cho et al., 2006). Four representative PHA synthases belonging to different types including C. necator H16 PhaC from type I, Pseudomonas sp. MBEL 6-19 PhaC1 (PhaC1Ps6-19) (Song, 2004) from type II, Allochromatium vinosum DSM 180 PhaEC from type III, and Bacillus cereus ATCC 14579 PhaRC from type IV were examined in recombinant Escherichia coli expressing PctCp as a supplier of (D)lactyl-CoA. Among them, the type I, type III and type IV PHA synthases allowed production of only minute amounts of P(3HB-co-LA) from glucose and 3HB (Cho et al., 2006). In order to make PHA synthase to more efciently accept (D)-lactyl-CoA as a substrate, in vitro mutagenesis of PhaC1Ps6-19 was performed (Park et al., 2008). This allowed slightly better synthesis of P(3HB-co-LA). Recently, a similar strategy was employed for the production of P(94 mol% 3HB-co-6 mol% LA) and P(53 mol% 3HB-co-47 mol% LA) in recombinant E. coli (Taguchi et al., 2008; Yamada et al., 2009). However, the latter polymer could only be produced to 2% of dry cell weight (Yamada et al., 2009). So far, it was not possible to produce PLA homopolymer or the copolymer having the lactate fraction greater than 50 mol%. It was thus reasoned that the in vivo generation of (D)-lactyl-CoA as well as the substrate specicity of PHA synthase are limiting the possibility of producing the PLA and copolymer having high mole fraction of lactate.

Here, we report the development of recombinant E. coli capable of producing PLA and its copolymers having lactate as a major monomer by employing evolved PctCp and PhaC1Ps6-19 for the efcient generation and polymerization of (D)-lactyl-CoA, respectively. Using the recombinant E. coli expressing evolved PctCp and PhaC1Ps6-19, PLA and P(3HB-co-LA) copolymers containing various lactate fraction could be synthesized. Furthermore, the thermal and melt ow properties of synthesized P(3HB-co-LA) copolymers were determined.

Materials and Methods

Bacterial Strains and Plasmids All strains, plasmids, and primers used in this study are listed in Table I. E. coli XL1-Blue was used in all standard cloning procedures and was used as the host strain for screening mutants of PhaC1Ps6-19 and PctCp, and for synthesis of PLA and its copolymer unless otherwise stated. Plasmid pPs619C1-CpPCT was constructed for engineering of PhaC1Ps6-19 and PctCp, as illustrated in Figure 1. First, plasmid pSYL105 (Lee et al., 1994) was digested with BamHI and EcoRI to obtain C. necator PHA biosynthesis operon (phaCABCn), which was inserted into pBluescript II KS() resulting in pCnCAB. Next, the C. necator phaC gene in the pCnCAB was replaced by the phaC1Ps6-19 gene at the BstBI and SbfI sites. The phaC1Ps6-19 gene was amplied by PCR using the primers 619C1F1 and 619C1R2 and the genomic DNA of Pseudomonas sp. MBEL 619 as a template. The internal BstBI site within the wild-type phaC1Ps6-19 gene was removed without amino acid change by sequence overlap extension PCR using the primers 619C1F1, 619C1R2, 619C1BstBIDF, and 619C1BstBIDR. Then, the upstream region of a start codon containing the ribosome binding site and the BstBI site, and the downstream region of a stop codon containing the SbfI site were amplied by PCR using the primers REABF, 619C1R1, 619C1F1, 619C1R2, 619C1F2, and REABR. The resulting plasmid was designated as pPs619C1-CnAB. Finally, the C. necator phaAB (phaABCn) genes in the pPs619C1-CnAB were replaced by the pctCp gene at the SbfI and NdeI sites. The pctCp gene was amplied by PCR using plasmid pTac99Pct (Cho et al., 2006) as a template and the primers CPPCTFSbfI and CPPCTRNdeI anked with the SbfI and NdeI restriction sites, respectively. For the elimination of the internal NdeI site within the wild-type pctCp gene without amino acid change, overlap extension PCR was performed using the primers CPPCTFSbfI, CPPCTRNdeI, CPPCTNdeIDF, and CPPCTNdeIDR. The resulting plasmid, designated as pPs619C1-CpPCT, contains the phaC1Ps6-19 gene and the pctCp gene, in which the expression of the corresponding genes was driven by the promoter of the phaCABCn operon. In order to express the phaABCn genes encoding bketothiolase (PhaA) and acetoacetyl-CoA reductase (PhaB), an expression plasmid was constructed by using pBBR1MCS

Yang et al.: Biosynthesis of PLA and Its Copolymers Biotechnology and Bioengineering

151

Table I.

Bacterial strains, plasmids, and primers used in this study. Relevant characteristicsa PHA synthase (PhaC1Ps6-19) producer e14(McrA) recA1 endA1 gyrA96 thi-1 hsdR17(r K mK ) supE44 relA1 D(lac-proAB) [F traD36 proAB lacIqZDM15] recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F proAB lacIqZDM15 Tn10 (TetR)] ApR, C. necator PHA biosynthesis operon (phaCABCn), parB locus of plasmid R1, derivative of pBluescript SK() ApR, cloning and expression vector Tac promoter, Clostridium propionicum DSM 1682 propionate CoA transferase gene (PctCp), derivative of pTrc99A Promoter of phaCABCn, phaCABCn, transcriptional terminator of phaCABCn, derivative of pBluescriptII KS() Promoter of phaCABCn, phaC1Ps6-19 (GenBank accession number FJ626663), C. necator phaAB genes (phaABCn), transcriptional terminator of phaCABCn, derivative of pCnCAB Promoter of phaCABCn, phaC1Ps6-19, pctCp, transcriptional terminator of phaCABCn, derivative of pPs619C1-CnAB phaC1Ps6-19 variant (phaC1300Ps6-19; E130D, S325T, Q481M), pctCp, derivative of pPs619C1-CpPCT pctCp variant (pct532Cp; A243T, Silent mutation: A1200G), derivative of pPs619C1300-CpPCT pctCp variant (pct540Cp; V193A, Silent mutations: T78C, T669C, A1125G, T1158C), derivative of pPs619C1300-CpPCT ApR, vector for expression of recombinant proteins from trc promotor pctCp, derivative of pTrcHisB pctCp variant (pct532Cp: A243T; Silent mutation: A1200G), derivative of pTrcHisB pctCp variant (pct540Cp: V193A, Silent mutations: T78C, T669C, A1125G, T1158C), derivative of pTrcHisB CmR, cloning vehicle gntT104 promoter, derivative of pTrc99A gntT104 promoter, phaABCn, derivative of p10499A gntT104 promoter, phaABCn, derivative of pBBR1MCS Source or remarks Song (2004) Stratagenea Stratagenea Lee et al. (1994) Stratagenea Cho et al. (2006) This study This study This study This study This study This study Invitrogenb This study This study This study Kovach et al. (1995) Park et al. (2002) This study This study

Strains, plasmids, or primers Strains Pseudomonas sp. MBEL 6-19 E. coli JM109 E. coli XL1-Blue Plasmids pSYL105 pBluescriptII KS() pTac99Pct pCnCAB pPs619C1-CnAB pPs619C1-CpPCT pPs619C1300-CpPCT pPs619C1300-CpPCT532 pPs619C1300-CpPCT540 pTrcHisB pTHCPPCT pTHCPPCT532 pTHCPPCT540

pBBR1MCS p10499A p10499PhaAB pMCS104CnAB Primers Primers for gene cloning REABF atgcccggagccggttcgaa REABR aacgggagggaacctgcagg REABR2 gaaattgttatccgcctgcagg 619C1F1 gagagacaatcaaatcatgagtaacaagagtaacg 619C1R1 cgttactcttgttactcatgatttgattgtctctc 619C1F2 gtacgtgcacgaacggtgacgcttgcatgagtg 619C1R2 cactcatgcaagcgtcaccgttcgtgcacgtac CPPCTFSbfI aggcctgcaggcggataacaatttcacacagg CPPCTRNdeI gcccatatgtctagattaggacttcatttcc Primers for the deletion of internal restriction sites 619C1BstBIDF gcagtcaaacgcttttttgaaaccggtggcaaaag 619C1BstBIDR cttttgccaccggtttcaaaaaagcgtttgactgc CPPCTNdeIDF gaacccaaaaacattacctatgtttattgtggttc CPPCTNdeIDR gaaccacaataaacataggtaatgtttttgggttc Primers for the random mutagenesis of pctCp gene CPPCTEF cgccggcaggcctgcagg CpPCTER ggcaggtcagcccatatgtc

Ap, ampicillin; Tet, tetracycline; Cm, chloramphenicol; R, resistance. a Stratagene Cloning System (La Jolla, CA). b Invitrogen, Corp. (Carlsbad, CA).

(Kovach et al., 1995). The PstI-digested phaABCn genes fragment from pSYL105 (Lee et al., 1994) was inserted into the PstI-digested p10499A (Park et al., 2002) to construct p10499PhaAB. Plasmid p10499PhaAB was digested with SspI to obtain a fragment containing the gntT104 promoter and the phaABCn genes. This fragment was inserted into the EcoRV-digested pBBR1MCS to result in pMCS104CnAB. All

oligonucleotides were synthesized at Bioneer (Daejeon, Korea). The enzymes and related reagents for DNA manipulation were purchased from New England Biolabs (Berverly, MA), TaKaRa Shuzo (Shiga, Japan), Solgent (Daejeon, Korea), and SigmaAldrich (St. Louis, MO). Preparation of plasmids and DNA fragments were performed with Qiagen kits (Qiagen, Chatsworth, CA). All

152

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

Figure 1. Construction of pPs619C1-CpPCT used for engineering of PhaC1Ps6-19 and PctCp. The phaCCn, phaACn, and phaBCn genes derived from C. necator encode PHA synthase, b-ketothiolase and acetoacetyl-CoA reductase, respectively. The phaC1Ps6-19 and pctCp genes encode PHA synthase I from Pseudomonas sp. MBEL 6-19 and propionate CoA transferase from C. propionicum, respectively. PCn and TCn denote the promoter and terminator regions in the phaCABCn operon from C. necator.

other chemicals used were of analytical grade and purchased from SigmaAldrich. DNA sequencing was carried out using AmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA) on an ABI Prism 377 DNA sequencer (Perkin Elmer).

Culture Conditions for the Production of Polymer For the production of polymer using recombinant E. coli, a chemically dened MR medium was used. The MR medium (pH 7.0) contains (per liter) 6.67 g KH2PO4, 4 g (NH4)2HPO4, 0.8 g MgSO47H2O, 0.8 g citric acid, and

5 mL trace metal solution. The trace metal solution contains (per liter of 0.5 M HCl) 10 g FeSO47H2O, 2 g CaCl2, 2.2 g ZnSO47H2O, 0.5 g MnSO44H2O, 1 g CuSO45H2O, 0.1 g (NH4)6Mo7O244H2O, and 0.02 g Na2B4O710H2O. Glucose and 3HB (Acros organics, Geel, Belgium) were sterilized separately. Seed cultures were prepared in 15 mL test tubes containing 3 mL Luria-Bertani (LB) medium at 308C overnight in a rotary shaker at 250 rpm. One milliliter of overnight culture was used to inoculate 250 mL ask containing 100 mL MR medium supplemented with 20 g/L of glucose for accumulation of PLA homopolymer. In the case of P(3HB-co-LA) production, 3HB was also used as

Yang et al.: Biosynthesis of PLA and Its Copolymers Biotechnology and Bioengineering

153

supplement at nal concentration of 2 g/L. Flask cultures were carried out at 308C in a rotary shaker at 200 rpm for 4 days. When necessary, 100 mg/mL ampicillin, 10 mg/mL tetracycline, 34 mg/mL chloramphenicol, and 10 mg/mL thiamine were added to the medium.

Screening Mutants Accumulating Higher Levels of P(3HB-co-LA) Screening of P(3HB-co-LA) accumulating variants of PhaC1Ps6-19 and PctCp was carried out based on a previously reported in vivo PHA screening system (Spiekermann et al., 1999). The recombinants harboring the phaC1Ps6-19 and pctCp mutant genes were grown on LB agar medium supplemented with 20 g/L glucose, 2 g/L 3HB, 0.5 mg/mL Nile red, and 100 mg/mL ampicillin. The change in P(3HBco-LA) accumulation resulting from the introduction of mutations into the phaC1Ps6-19 and pctCp genes was determined on the basis of the intensity of the pinkish color due to the Nile red staining of cells.

Saturation and Site-Directed Mutagenesis A triple mutant of the phaC1Ps6-19 gene, phaC1300Ps6-19 (E130D, S325T, and Q481M), was generated rst to increase the substrate specicity towards short-chain-length (SCL) 3HA-CoAs by site-directed mutagenesis using the mutagenic primers and the upstream/downstream primers, REABF and REABR2, respectively. To prepare Glu130, Ser325, Ser477, and Gln481 substituted mutants of PhaC1300Ps6-19, saturation mutagenesis and site-directed mutagenesis were performed. For example, the saturation mutagenesis library at position 130 was generated by overlap extension PCR using a pair of mutagenic primers and the upstream/downstream primers, REABF and REABR2, respectively. The PCR using pfu DNA polymersase (Solgent) was performed with an automatic thermal cycler (Bioneer) for 20 cycles consisting of 958C for 20 s, 608C for 40 s, and 728C for 1.5 min. Other saturation mutagenesis libraries at position 325, 477, and 481 were prepared by the same method using the corresponding pairs of mutagenic primers. Also, for the site-directed mutagenesis at position 130, 325, 477, and 481, the same overlap extension PCR method was employed using the corresponding pairs of mutagenic primers and the upstream/downstream primers. The mutagenic PCR products were gel-puried and were ligated with BstBI- and SbfI-digested pPs619C1300-CpPCT. This process generated various plasmids harboring the mutated genes of phaC1300Ps6-19.

Western Blot Analysis The expression of wild-type PctCp and its variants were analyzed by western blotting of the whole-cell lysate of E. coli using antiserum against PctCp. A rabbit antiserum against PctCp was prepared by injection of synthetic oligopeptide, QEGKQKKFLKAVEQ. The antiserum was puried by antigen specic afnity chromatography. The whole-cell lysates of recombinant E. coli cells corresponding 10 mL of a suspension (OD600 of 3.0) were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS PAGE). Subsequently, the samples were electroblotted onto polyvinylidene-diuoride membranes and probed with the puried antiserum diluted to 1:2,000 in Tris-buffered saline (TBS; 150 mM NaCl, 50 mM TrisHCl; pH 7.4) containing 1% gelatin and 0.05% Tween-20. Immunoblots were rinsed three times with TBS containing 0.05% Tween-20. Antigenantibody complexes were visualized by reaction with the alkaline phosphatase-linked goat anti-rabbit IgG secondary antibody (Bio-Rad, Hercules, CA) diluted to 1:5,000 in TBS. Colorimetric reaction of alkaline phosphatase was performed according to the manufacturers instructions (Bio-Rad).

Random Mutagenesis by Error-Prone PCR Random mutagenesis of the pctCp gene was carried out by performing mutagenic PCR with pPs619C1300-CpPct as a template. Two primers anked with the SbfI and NdeI restriction sites, CPPCTEF and CPPCTER, were used as forward and reverse primers, respectively. In order to obtain both the desired level of mutation, that is, one or two amino acid substitutions, and the base substitutions without mutational bias, the condition for PCR random mutagenesis was optimized; a 50 mL reaction mixture contained 10 mM TrisHCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 20 mM MnSO4, 0.04 mM dATP, 0.25 mM dTTP, 0.08 mM dGTP 0.25 mM dCTP, 0.2 mM each of two primers, 5 ng template DNA, and 5 U ExTaq polymerase (TaKaRa Shuzo). The PCR was performed with an automatic thermal cycler (Bioneer) for 25 cycles consisting of 958C for 20 s, 608C for 40 s, and 728C for 1.5 min. The mutagenic PCR products were gelpuried and then ligated with the SbfI- and NdeI-digested pPs619C1300-CpPCT. This process generated the plasmids containing the mutated pctCp genes.

PctCp Assay For the assay of PctCp, the plasmids, pTHCPPCT, pTHCPPCT532, and pTHCPPCT540 (Table I), expressing the wild-type PctCp and its variant (pct532Cp and pct540Cp) genes fused to the His-tag under the trc promoter were constructed. Wild-type PctCp and its variants were puried using the Ni-NTA Spin Kit (Qiagen) under native condition. The PctCp activity was determined by measuring the synthesized lactyl-CoA from acetyl-CoA and lactate using high performance liquid chromatography system equipped with an ultraviolet detector (SCL-10A, Shimadzu, Kyoto, Japan). For measuring the activity, reaction was carried out for 4 min at 308C in 50 mM phosphate buffer (pH 7.0) containing 1 mM acetyl-CoA and 10 mM lactate by adding 15 mg of puried protein. Product, lactyl-CoA, was separated by using Capcell Pak C18 UG120 column (Shiseido, Tokyo, Japan) with a mixture of water and acetonitrile as a mobile

154

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

Table II.

Summary of P(3HB-co-LA) copolymer production using PhaC1Ps6-19 mutants in recombinant E. coli XL1-Blue. Molecular weighta Polymer content (wt%) 36.6 28.2 56.0 43.8 20.2 40.5 36.9 46.9 44.2 49.2 47.7 27.9 51.0 55.0 48.0 44.7 61.5 56.0 53.5 51.7 Lactate fraction (mol%) 35.3 19.7 39.1 31.9 21.9 29.6 31.0 27.6 36.2 32.2 39.9 23.7 30.3 41.2 36.8 33.2 46.0 37.3 49.0 41.1

PHA synthase PhaC1202Ps6-19 PhaC1204Ps6-19 PhaC1301Ps6-19 PhaC1300Ps6-19 PhaC1304Ps6-19 PhaC1305Ps6-19 PhaC1307Ps6-19 PhaC1308Ps6-19 PhaC1310Ps6-19 PhaC1311Ps6-19 PhaC1316Ps6-19 PhaC1317Ps6-19 PhaC1401Ps6-19 PhaC1400Ps6-19 PhaC1440Ps6-19 PhaC1441Ps6-19 PhaC1439Ps6-19 PhaC1434Ps6-19 PhaC1437Ps6-19 PhaC1436Ps6-19

Amino acid substitutions E130D/Q481K E130D/Q481M E130D/S325T/Q481K E130D/S325T/Q481M E130D/S477R/Q481K E130D/S477R/Q481M E130D/S477H/Q481K E130D/S477H/Q481M E130D/S477F/Q481K E130D/S477F/Q481M E130D/S477G/Q481K E130D/S477G/Q481M E130D/S325T/S477R/Q481K E130D/S325T/S477R/Q481M E130D/S325T/S477H/Q481K E130D/S325T/S477H/Q481M E130D/S325T/S477F/Q481K E130D/S325T/S477F/Q481M E130D/S325T/S477G/Q481K E130D/S325T/S477G/Q481M

Mn (103 Da) 71 80 38 36 67 56 28 75 56 55 37 66 38 34 28 32 30 33 22 29

Mw (103 Da) 195 267 74 88 203 158 121 237 199 192 94 159 74 58 63 85 53 66 39 52

Plasmid pPs619C1300-CpPct540 was used for the generation of the PhaC1Ps6-19 mutants. The polymer content, the lactate fraction, and the molecular weights of P(3HB-co-LA) produced in recombinant E. coli XL1-Blue shown above are the average of ve independent experiments. a Mn and Mw represent number-average molecular weight and weight-average molecular weight, respectively.

phase at a ow rate of 1 mL/min. A ratio of acetonitrile to water was maintained as 3:97 (v/v) for 5 min, and then gradually increased to 15:85 (v/v) for 25 min. One unit of enzyme activity is dened as the amount of enzyme that converts 1 mmol of the substrate to the product per min.

Fed-Batch Culture Condition Fed-batch cultures were performed at 308C in a 6.6-L jar fermentor (Bioo 3000; New Brunswick Scientic Co., Edison, NJ) initially containing 1.6 L of MR medium. The culture pH was kept at 7.0 by the addition of 28% (v/v) ammonia water. The dissolved oxygen concentration (DOC) was controlled at above 30% or 10% of air saturation by automatically changing the agitation speed up to 1,000 rpm and additionally supplying pure oxygen. The feeding solution contains (per liter) 700 g glucose, 15 g MgSO47H2O, and 250 mg thiamine. The pH-stat feeding strategy was used. When the pH rose to a value greater than its set point (pH 7.0) by 0.1, an appropriate volume of feeding solution was automatically added to increase the glucose concentration in the culture medium to 15 g/L (feeding strategy A) or 5 g/L (feeding strategy B).

Analysis of Polymers The content and monomer composition of polymers accumulated in the cells were determined by gas chromatography (GC) using Agilent 6890N GC system (Agilent Technologies, Palo Alto, CA) equipped with Agilent 7683

automatic injector, ame ionization detector, and a fused silica capillary column (ATTM-Wax, 30 m, ID 0.53 mm, lm thickness 1.20 mm, Alltech, Deereld, IL). About 30 mg of dried cell pellet was subjected to methanolysis with benzoic acid as an internal standard in the presence of 15% sulfuric acid. The resulting methyl esters of constituent lactate and carboxylic acids were assayed by GC according to the method of previous report (Braunegg et al., 1978). The GCmass spectrometry was performed on Hewlett-Packard 5890 GC system (Hewlett-Packard, Wilmington, DE) equipped with capillary column (HP-5, Agilent Technologies). The temperature program was initially maintained at 508C for 5 min, ramped to 3208C at 108C/min and then held at 3208C for 10 min. Methyl-3HB and methyl-lactate were analyzed with an HP 5971A mass selective detector (HewlettPackard). The enantiomeric excess (%ee) of methyl-3HB and methyl-lactate was determined by GC using Agilent 6890N GC system equipped with a capillary column (Chiraldex G-TA, Astec, Whippany, NJ). The temperature program was maintained at 708C for 15 min. To determine the molecular weights, thermal and melt ow properties of the synthesized polymers, the polymers accumulated in the cells were extracted with hot chloroform reuxed in a Soxhlet apparatus (Corning, Lowell, MA) for 14 h and puried by precipitation with ice-cold methanol. Molecular weights of polymers were determined by gel permeation chromatography (GPC) at 408C using a Waters Alliance 2695 Separation Module (Waters, Milford, MA) equipped with Waters 2414 RI detector and two PL Gel columns (Mixed C, 5 mm particles, 30 cm, ID 7.5 mm, Polymer Laboratories, Amherst, MA). Polystyrene mole-

Yang et al.: Biosynthesis of PLA and Its Copolymers Biotechnology and Bioengineering

155

cular weight standards (Polymer Standard Service-USA, Silver Spring, MD) with a narrow range of polydispersity (1.031.05) were employed for calibration. For the analysis of thermal properties of P(3HB-co-LA), differential scanning calorimetry (DSC) was performed on a Q10 DSC (TA Instruments, New Castle, DE). DSC measurements were conducted with ca. 5 mg of fractionated polymer samples in the temperatures ranging from 50 to 1808C under a nitrogen atmosphere at heating and cooling rates of 10 and 28C/min, respectively. The melt viscosities of P(3HB-coLA)s were measured by using an Rh2000 capillary rheometer (Malvern Instrument Ltd., Malvern, UK) at 1808C. The shear rates were set within the range of 204,000/s. All of the 1D (1H, 13C) and 2D COSY NMR spectra of the polymers, PLA and P(3HB-co-LA), were recorded on Bruker AVANCE DMX 600MHz spectrometer (Bruker, Rheinstetten, Germany) using a BBO probe in CDCl3 with tetramethylsilane (TMS) as an internal chemical shift standard at 298 K. The optimized 908 pulse width was 7.6 ms at the delay time of 5 s in 1H NMR experiment. In quantitative 13C NMR experiment, the 308 pulse width was 3.3 ms at the delay time of 2 s for PLA and 10 s for P(3HB-coLA). In 2D NMR experiments, 1.3 s delay time, 128 ms acquisition time, processing data size of 2k 1k for PLA and 1k 1k for P(3HB-co-LA) and sinebell processing function were used. In 2D COSY experiment (Lim et al., 2008), the total number of 256 and 128 increments, and 16 and 8 scans per increment were used for PLA and P(3HB-co-LA), respectively.

Results and Discussion

Directed Evolution of PHA Synthase and Propionate CoA Transferase PHA synthases, which play a key role in PHA biosynthesis, can be classied into four types based on their primary structures and substrate specicities (Rehm, 2003). Type I, III, and IV PHA synthases preferentially catalyze CoA thioesters of hydroxyalkanoates of SCL (C3-C5), while most of the type II synthases prefer CoA thioesters of hydroxyalkanoates of medium-chain-length (C6-C14). Interestingly, type II PHA synthase from Pseudomonas sp. MBEL 619, PhaC1Ps6-19, possesses exceptionally broad substrate specicities towards 3HA-CoAs of 412 carbons and synthesize PHAs containing both short and medium chain length monomer units (Song, 2004). This is similar to the type II PHA synthase from Pseudomonas sp. 61-3 (Takase et al., 2004). For this reason, PhaC1Ps6-19 was chosen as a target PHA synthase for engineering as it will allow synthesis of a wide range of PHA copolymers containing lactate. Since the recombinant E. coli expressing wild-type PhaC1Ps6-19 along with PctCp was able to accumulate negligible levels of P(3HB-co-LA) under 1 wt% of dry cell weight, site-directed mutagenesis of PhaC1Ps6-19 was rst performed to make PHA synthase to more efciently accept

three carbon (D)-lactyl-CoA as a substrate. The nucleotide sites for mutagenesis were chosen based on the previous studies on altering the substrate specicity of Pseudomonas sp. 61-3 PHA synthase 1 (PhaC1Ps61-3) having amino acid homology of 84% with PhaC1Ps6-19 (Matsumoto et al., 2005, 2006; Matsusaki et al., 1998; Takase et al., 2003, 2004). According to these reports, the amino acids E130, S325, S477, and Q481 in PhaC1Ps61-3 are important in altering the substrate specicity toward 3HB-CoA, enhancing PHA accumulation in the cells, or increasing the molecular weight of polymer. After mutagenesis, several variants that were capable of more efciently accepting (D)-lactyl-CoA as a substrate were identied. Recombinant E. coli JM109 expressing one of these mutant synthases PhaC1300Ps6-19 (E130D, S325T, and Q481M) together with PctCp was able to synthesize P(81 mol% 3HB-co-19 mol% LA) with a content of 8 wt% in LB medium containing 20 g/L glucose and 2 g/L 3HB (Fig. 2). Lactate was endogenously generated within the E. coli cells from glucose during cultivation, converted to lactyl-CoA by PctCp, and then was incorporated into the polymer by evolved PhaC1300Ps6-19. The composition and the monomer sequence distribution of P(3HB-co-LA) were investigated by 1D (1H and 13C) NMR and 2D (1H-1H) COSY NMR spectroscopy (Fig. 2AC). The mole fractions of 3HB and lactate units obtained from 1H NMR were in good agreement with those obtained from GC analysis. The stereospecicity analysis of P(3HB-co-LA) showed that the methyl-3HB and methyl-lactate were all in (D)-conguration with enantiopurities above 96% (Fig. 2D). From this result, although P(3HB-co-LA) content in the cells and the lactate mole fraction in the polymer were not high, the amino acid substitutions within PhaC1300Ps6-19, that is, E130D, S325T, and Q481M, resulted in the production of polymer containing lactate monomer unit. Thus, PhaC1300Ps6-19 was subjected to saturation mutagenesis at the above mentioned positions, E130, S325, S477, and Q481, to nd a variant PhaC1Ps6-19 having enhanced activity toward (D)-lactyl-CoA. Various mutant enzymes were selected from each library and examined for their activities to produce P(3HB-co-LA) in vivo with respect to the lactate fraction and the polymer content in recombinant E. coli expressing PctCp. Several mutants obtained from saturation mutagenesis and site-directed mutagenesis were examined again with the evolved PctCp mutants described in the following section (Table II). PctCp had low activity in generating lactyl-CoA from lactate in E. coli. Also, it has been known that the expression of PctCp exerts inhibitory effect on cell growth (Selmer et al., 2002). Thus, random mutagenesis of the pctCp gene was conducted to create a PctCp mutant possessing enhanced ability to supply (D)-lactyl-CoA in E. coli without severe growth inhibition. Among several positive PctCp mutants from two rounds of mutagenesis and screening, two benecial PctCp mutants, Pct532Cp (A243T, and one silent nucleotide mutation of A1200G) and Pct540Cp (V193A, and four silent nucleotide mutations of T78C, T669C, A1125G,

156

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

Figure 2. NMR analysis (1D 1H, 2D COSY, and 1D 13C) and determination of the stereospecicity of P(3HB-co-LA) copolymer synthesized in recombinant E. coli JM109 expressing PhaC1300Ps6-19 and PctCp. A: 600 MHz 1H NMR spectrum. The methylene protons of 3HB are assigned at 2.42.7 ppm (#2), while the oxymethine protons of 3HB-co-LA (#1,#10 ) are at 4.85.5 ppm. The methyl protons (#3,#30 ) of 3HB-co-LA and HOD are assigned at 1.21.6 ppm. B: 1H-1H COSY spectrum, which reveals the congurational structure of P(3HB-co-LA) by highlighting its intra-three bond coupling of protons. The coupling between the oxymethine proton (#1) and the methylene protons (#2) next to the oxymethine proton (#1) can be seen as a cross peak at 5.2 ppm/2.5 ppm (open arrowheads) while the coupling between protons (#1,#10 ) and the remaining protons (#3,#30 ) can be seen at 5.2 ppm/1.3 ppm (closed arrowheads), as expected. C: 150 MHz 13C NMR spectrum with the chemical shift assignments and an expanded spectrum of carbonyl carbons region. This region (168.8170.1 ppm) is clearly resolved into three groups of peaks showing different diad sequences of 3HB and LA bonds. The peak at 169.1 ppm is assigned to carbonyl carbons in the 3HB3HB sequence. The peak at 169.4 ppm is assigned to the carbonyl resonance in 3HBLA and 3HBLA sequences. The peak at 169.7 ppm is assigned to LA LA sequences. D: Determination of the stereospecicity of the monomers in P(3HB-co-LA) copolymer by chiral GC analysis. Methyl-3HB and methyl-LA were all in (D)-conguration with enantiopurity above 96%. [Color gure can be seen in the online version of this article, available at www.interscience.wiley.com.]

and T1158C), which led to the increase of both polymer content and lactate mole fraction in the copolymer, were selected for further characterization. The expression levels, and in vivo and in vitro activities of PctCp mutants were examined and compared with those of the wild-type PctCp (Fig. 3). As shown in Figure 3A, the expression level of Pct532Cp was almost the same as the wild-type PctCp, while Pct540Cp showed slightly higher expression level than the wild-type PctCp. Notably, in vitro specic activities of

Pct532Cp and Pct540Cp were reduced by 2.05- and 1.65-fold, respectively, compared with that of the wild-type. These results indicated that the inhibitory effect of the PctCp on cell growth could be alleviated by employing the PctCp mutants having lower specic activities, which consequently allowed enhanced synthesis of P(3HB-co-LA) in recombinant E. coli also expressing PhaC1300Ps6-19; the polymer content and the lactate fraction were considerably improved by employing the PctCp mutants (Fig. 3B).

Table III. The molecular weights, thermal properties, and melt viscosity of P(3HB-co-LA) synthesized in recombinant E. coli XL1-Blue expressing PhaC1310Ps6-19, Pct540Cp, and PhaABCn. Molecular weightb Polymera P(3HB-co-8.7 mol% LA) P(3HB-co-27.0 mol% LA) P(3HB-co-64.4 mol% LA)
a

Thermal propertiesc PDI 2.6 3.3 3.3 Tg (8C) 9.3 12.6 33.1 Tm (8C) 165.7 159.5 160.5 Tc (8C) 104.9 78.0 83.9 DHm (J/g) 50.5 10.5 5.0 Melt viscosityd (Pa s) 102.2 29.0 7.1

Mn (103 Da) 138.0 68.4 36.0

Mw (103 Da) 355.0 222.0 118.0

P(3HB-co-LA) copolymers having various lactate fractions were produced by the pH-stat fed-batch cultures changing the DO level and glucose concentration in the feeding solution. The DOC and the glucose concentration (upon pH-stat feeding) in the medium were 30% and 15 g/L for P(3HB-co8.7 mol% LA), 10% and 15 g/L for P(3HB-co-27.0 mol% LA), and 10% and 5 g/L for P(3HB-co-64.4 mol% LA), respectively. b Mn, number-average molecular weight; Mw, weight-average molecular weight; PDI, polydispersity index. c Tg, glass transition temperature; Tm, melting temperature; Tc, crystallization temperature; DHm, enthalpy of fusion. d Melt viscosity was measured at a shear rate of 1,000/s.

Yang et al.: Biosynthesis of PLA and Its Copolymers Biotechnology and Bioengineering

157

Expression levels and activities of the wild-type PctCp and its mutants. A: Western blot analysis of whole-cell lysates of recombinant E. coli XL1-Blue expressing the wild-type PctCp and its mutants. For the expression of the wild-type PctCp (WT), Pct532Cp (532), and Pct540Cp (540) in E. coli XL1-Blue, plasmids pTHCPPCT, pTHCPPCT532, and pTHCPPCT540, respectively, were employed. Equal amounts of whole-cell lysates of recombinant E. coli XL1-Blue cells corresponding to 10 mL of a suspension with an OD600 of 3.0 were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis and subsequently Western blot analysis with anti-PctCp antiserum was performed. The arrow head indicates the band corresponding to the His-tagged PctCp. B: In vivo and in vitro activities of wild-type PctCp and its variants. For the synthesis of P(3HB-co-LA) in recombinant E. coli XL1-Blue, plasmids pPs619C1300-CpPCT, pPs619C1300-CpPCT532, and pPs619C1300-CpPCT540, which were containing the wild-type pctCp, pct532Cp, and pct540Cp, respectively, were employed. Recombinant E. coli XL1-Blue strains were cultivated in LB medium supplemented with 20 g/L glucose and 2 g/L 3HB at 378C during 4 days. The polymer content and lactate fraction in P(3HB-co-LA) are the averages of three independent experiments. Error bars indicate standard deviation. For the measurement of in vitro activities of the wildtype PctCp, Pct532Cp and Pct540Cp, each enzyme was puried using the Ni-NTA afnity purication procedure under native condition as described in Materials and Methods Section. One unit is dened as an amount of enzyme that converts 1 mmol of the substrate (acetyl-CoA) to the product (lactyl-CoA) per min at 308C. [Color gure can be seen in the online version of this article, available at www.interscience.wiley.com.]

Figure 3.

Biosynthesis of P(3HB-co-LA) and PLA Homopolymer Various PhaC1Ps6-19 mutants were examined for their ability to produce P(3HB-co-LA) with respect to the lactate fraction in polymer and polymer content in recombinant E. coli XL1Blue expressing Pct540Cp (Table II). A chemically dened MR medium supplemented with 20 g/L glucose and 2 g/L 3HB was used in all P(3HB-co-LA) production studies unless otherwise stated. Recombinant E. coli strains expressing Pct540Cp and evolved mutants of PhaC1Ps6-19 were able to produce P(3HB-co-LA) random copolymers containing different lactate fractions ranging from 20 mol% to 49 mol% to varying polymer contents. Among these, quadruple mutant PhaC1437Ps6-19 (E130D, S325T, S477G, and Q481K) resulted in the highest lactate fraction of 49.0 mol% in P(3HB-co-LA), while PhaC1439Ps6-19 (E130D, S325T, S477F, and Q481K) mutant showed the highest polymer content of 61.5 wt%. Although, there was no apparent correlation between the polymer content and lactate fraction, E130D and S325T mutations resulted in the high polymer content exceeding 44 wt% with high lactate mole fraction over 30 mol% in P(3HB-co-LA). The molecular weight (Mw) of synthesized polymer was highly affected by the lactate mole fraction in copolymer and the PHA synthase mutants employed. When the lactate mole fraction was greater than 30 mol%, the Mws of polymers were lower than 200,000 Da (Table II). When the lactate fraction in P(3HB-co-LA) was gradually increased by decreasing the concentration of 3HB in the culture medium, the Mws of synthesized P(3HB-co-LA) decreased regardless

of the PHA synthase mutants employed, that is, the molecular weight of P(3HB-co-LA) was inversely proportional to the mole fraction of lactate monomer (see accompanying paper Jung et al., 2010). Even though E130D/S325T double mutation in PhaC1Ps6-19 mutants was effective to achieve high polymer content and high lactate fraction, it severely decreased the Mw of polymers. For the synthesis of P(3HB-co-LA) having the lactate fraction higher than 50 mol% and even PLA homopolymer, recombinant E. coli XL1-blue expressing PhaC1310Ps6-19 and Pct540Cp was cultured in MR medium containing 20 g/L glucose and varying concentrations (04 g/L) of 3HB. Since lactate is generated endogenously and activated by PctCp, PLA homopolymer can theoretically be synthesized in recombinant E. coli from glucose if 3HB is not fed. As the 3HB concentration decreased, the lactate fraction increased (Fig. 4). When no 3HB was fed, PLA homopolymer could indeed be produced, albeit to a relatively low polymer content of 0.5 wt% of dry cell weight. Thus, recombinant E. coli strain expressing evolved PhaC1Ps6-19 and PctCp mutant allowed production of PLA homopolymer and P(3HB-co-LA) copolymers with controlled lactate fractions.

Characterization of P(3HB-co-LA) Produced in Recombinant E. coli To characterize the polymer properties, various P(3HB-coLA) copolymers having different lactate mole fractions were produced by fed-batch cultures of recombinant E. coli.

158

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

Figure 4. Production of PLA homopolymer and P(3HB-co-LA) copolymers having different lactate fractions. Recombinant E. coli XL1-Blue expressing PhaC1310Ps6-19 and Pct540Cp was cultured in MR medium containing 20 g/L glucose and varying concentrations (04 g/L) of 3HB at 30 C. The polymer content (black bar) and the lactate fraction (gray bar) in P(3HB-co-LA) produced in recombinant E. coli shown above are the average of ve independent experiments. Error bar indicates standard deviation. Among various PhaC1Ps6-19 mutants obtained, a triple mutant PHA synthase, PhaC1310Ps6-19 (E130D, S477F, and Q481K), which resulted in both relatively high polymer content and Mw, was employed. Also, in order to generate 3HB-CoA from glucose and thus produce P(3HB-co-LA) without 3HB feeding, the C. necator phaA and phaB genes encoding b-ketothiolase and acetoacetyl-CoA reductase, respectively, were introduced. Fed-batch cultures of recombinant E. coli XL1-Blue expressing PhaC1310Ps6-19, Pct540Cp, PhaABCn allowed production of various P(3HBco-LA) copolymers (Table III). The lactate fraction in the polymer could be controlled from 8.7 to 64.4 mol% by varying the fermentation conditions including DOC and glucose feeding strategy (see Materials and Methods Section). It was reasoned that by decreasing the DOC, cells would prefer the production of lactate. Indeed, by decreasing the DOC from 30% of air saturation to 10% of air saturation using the glucose feeding strategy A (15 g/L upon pH-stat feeding), the lactate fraction could be increased from 8.7 to 27.0 mol%. As the glucose feeding strategy can also alter metabolic uxes during fed-batch culture, a different glucose feeding strategy was employed. By using glucose feeding strategy B (5 g/L upon pH-stat feeding) at the DOC of 10% of air saturation, the lactate fraction could be further increased from 27.0 to 64.4 mol%. Thus, by altering the fermentation (fed-batch) culture condition, copolymers of varying lactate fractions can be produced. The properties of the synthesized P(3HB-co-LA) copolymers including the molecular weight, thermal properties, and melt viscosity are summarized in Table III. As observed above, the molecular weight of P(3HB-co-LA) was inversely proportional to the mole fraction of lactate monomer. The glass transition temperature of the polymer increased with an increase of the lactate fraction, whereas the crystallinity estimated from the enthalpy of fusion, decreased with an

increase of the lactate fraction. This tendency is in good agreement with that observed for the chemically synthesized P[(D)-3HB-co-(L,L)-LA] (Abe et al., 1997). The melting temperature (Tm) of the polymer was only slightly affected by the lactate fraction and maintained around 1608C, which was in accordance with the results of previous reports (Taguchi et al., 2008; Yamada et al., 2009). However, according to Abe et al. (1997), the Tm of chemically synthesized P[(D)-3HB-co-(L,L)-LA] was highly dependent on monomer composition; the Tm decreased from 176 to 598C as the lactate fraction was increased from 0 to 47 mol%, and then increased from 115 to 1768C with an increase in the lactate from 70 to 100 mol%. Furthermore, the melting temperatures of P(3HB-co-LA) copolymers synthesized in this study are higher than those of the chemically synthesized ones consisting of similar monomer composition. Discrepancies in the Tm of biologically synthesized copolymer and chemically synthesized one might be due to the differences in lactate monomers having different sterospecicity; the chemically synthesized P[(D)3HB-co-(L,L)-LA] copolymer has the (L) congured lactate as a monomer unit and is composed of a dimeric sequence of the lactate, whereas P(3HB-co-LA) copolymer synthesized in this study has the lactate unit in the (D) conguration and has a random sequence. To investigate the melt ow properties of the synthesized polymers, the melt viscosities were measured by using capillary rheometer at slightly above melting temperature. The melt viscosity decreased with an increase of the lactate fraction, which properly reects the proportional relationship between the melt viscosity and the number-average molecular weight of the synthesized polymer. Thus, the molecular weights, thermal properties, and melt ow properties of the copolymers could be tuned not only by employing the evolved enzymes, but also by varying the fermentation conditions.

Conclusions
In this study, we reported for the rst time that PLA and its copolymers containing various lactate fractions can be produced in recombinant E. coli by establishing heterologous pathways employing evolved Pct and PHA synthase. This allowed one-step fermentative production of PLA and its copolymers from renewable resources. As E. coli cannot supply (D)-lactyl-CoA, which is a monomer required for the synthesis of PLA, evolved PctCp was introduced to generate (D)-lactyl-CoA more efciently. PHA synthase was also evolved to accept (D)-lactyl-CoA more preferentially as a substrate by rational design and saturation mutagenesis. The evolved variants of these two enzymes were introduced into E. coli for establishing new metabolic pathways leading to the biosynthesis of PLA and its copolymers containing various lactate fractions. Also, fed-batch cultures were carried out under three different conditions to tune the lactate fraction of the polymer from 8.7 to 64.4 mol%. The properties of these polymers, including the molecular

Yang et al.: Biosynthesis of PLA and Its Copolymers Biotechnology and Bioengineering

159

weights, thermal properties, and melt ow property, were also examined. This strategy of introducing new metabolic pathways together with evolved enzymes described here should be useful for the efcient production of PLA and various P(HA-co-LA) copolymers. Considering that various HA monomers can be incorporated into the polymer (Lee, 1996), P(HA-co-LA) copolymers composed of lactate and one or more carboxylic acids including 3-hydroxypropionate, 4-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxyhexanoate, 3-hydroxyoctanoate, 3-hydroxydecanoate, 3 chel and hydroxydodecanoate, and many more (Steinbu Valentin, 1995) can be produced by one-step fermentation of engineered microorganisms.
We thank Yu Kyung Jung (KAIST) for her helpful discussion. Further supports by LG Chem Chair Professorship and Microsoft are appreciated.

References
Abe H, Doi Y, Hori Y, Hagiwara T. 1997. Physical properties and enzymatic degradability of copolymers of (R)-3-hydroxybutyric acid and (S,S)lactide. Polymer 39:5967. Braunegg G, Sonnleitner B, Lafferty RM. 1978. A rapid gas chromatographic method for the determination of poly-b-hydroxybutyric acid in microbial biomass. Eur J Appl Microbiol Biotechnol 6:2937. Chen GQ, Wu Q. 2005. The application of polyhydroxyalkanoates as tissue engineering materials. Biomaterials 26:65656578. Cho JH, Park SJ, Lee SY, Jung YK. 2006. Cells or plants that can produce polylactate or its copolymers and to a method for preparing polylactate or its copolymers using the same. WO/2006/126796. Drumright RE, Gruber PR, Henton DE. 2000. Polylactic acid technology. Adv Mater 12:18411846. Haynes D, Abayasinghe NK, Harrison GM, Burg KJ, Smith DW, Jr. 2007. In situ copolyesters containing poly (L-lactide) and poly (hydroxyalkanoate) units. Biomacromolecules 8:11311137. Jung YK, Kim TY, Park SJ, Lee SY. 2010. Metabolic engineering of Escherichia coli for the production of polylactic acid and its copolymers. Biotechnol Bioeng 105:161171. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RMn, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175176. Lee SY. . Bacterial polyhydroxyalkanoates. Biotechnol Bioeng 49:114. chel A. 1994. Comparison of recombiLee SY, Lee KM, Chan HN, Steinbu nant Escherichia coli strains for synthesis and accumulation of poly-(3hydroxybutyric acid) and morphological changes. Biotechnol Bioeng 44:13371347. Lim SC, Kim SW, Jung MH, Cho M, Kim JH, Cho HS, Ok JH. 2008. Complete NMR spectral assignments of siloxanol based copolycarbonate including the congurational copolymer structure and the determination of each monomer conversion. J Mol Struct 886:166174. Matsumoto K, Takase K, Aoki E, Doi Y, Taguchi S. 2005. Synergistic effects of Glu130Asp substitution in the type II polyhydroxyalkanoate (PHA) synthase: Enhancement of PHA production and alteration of polymer molecular weight. Biomacromolecules 6:99104. Matsumoto K, Aoki E, Takase K, Doi Y, Taguchi S. 2006. In vivo and in vitro characterization of Ser477X mutations in polyhydroxyalkanoate (PHA) synthase 1 from Pseudomonas sp. 61-3: Effects of benecial mutations on enzymatic activity, substrate specicity, and molecular weight of PHA. Biomacromolecules 7:24362442. Matsusaki H, Manji S, Taguchi K, Kato M, Fukui T, Doi Y. 1998. Cloning and molecular analysis of the Poly(3-hydroxybutyrate) and Poly(3-

hydroxybutyrate-co-3-hydroxyalkanoate) biosynthesis genes in Pseudomonas sp. strain 61-3. J Bacteriol 180:64596467. Mehta R, Kumar V, Bhunia H, Upadhyay SN. 2005. Synthesis of poly (lactic acid): A review. J Macromol Sci Polym Rev 45:325349. Noda I, Satkowski MM, Dowrey AE, Marcott C. 2004. Polymer alloys of Nodax copolymers and poly(lactic acid). Macromol Biosci 4:269 275. Park SJ, Park JP, Lee SY. 2002. Metabolic engineering of Escherichia coli for the production of medium-chain-length polyhydroxyalkanoates rich in specic monomers. FEMS Microbiol Lett 214:217222. Park SJ, Yang TH, Kang HO, Lee S-H, Lee EJ, Kim TW, Lee SY. 2008. Mutants of PHA synthase from Pseudomonas sp. 6-19 and method for preparing lactate homopolymer or copolymer using the same. WO/ 2008/062999. Rehm BH. 2003. Polyester synthases: Natural catalysts for plastics. Biochem J 376:1533. Schreck KM, Hillmyer MA. 2007. Block copolymers and melt blends of polylactide with NodaxTM microbial polyesters: Preparation and mechanical properties. J Biotechnol 132:287295. Selmer T, Willanzheimer A, Hetzel M. 2002. Propionate CoA-transferase from Clostridium propionicum. Cloning of gene and identication of glutamate 324 at the active site. Eur J Biochem 269:372380. rd A, Stolt M. 2002. Properties of lactic acid based polymers and derga So their correlation with composition. Progr Polym Sci 27:1123 1163. Song AJ. 2004. Cloning of new Pseudomonas sp. MBEL 6-19 polyhydroxyalkanoate synthase genes and their use in the development of recombinant microorganisms. M.S. Thesis, KAIST: Korea. Spiekermann P, Rehm BH, Kalscheuer R, Baumeister D, Steinbuchel A. 1999. A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch Microbiol 171:7380. chel A, Valentin HE. 1995. Diversity of bacterial polyhydroxyalkSteinbu anoic acids. FEMS Microbiol Lett 128:219228. Taguchi S, Yamada M, Matsumoto K, Tajima K, Satoh Y, Munekata M, Ohno K, Kohda K, Shimamura T, Kambe H, Obata S. 2008. A microbial factory for lactate-based polyesters using a lactate-polymerizing enzyme. Proc Natl Acad Sci USA 105:1732317327. Takase K, Taguchi S, Doi Y. 2003. Enhanced synthesis of poly(3-hydroxybutyrate) in recombinant Escherichia coli by means of error-prone PCR mutagenesis, saturation mutagenesis, and in vitro recombination of the type II polyhydroxyalkanoate synthase gene. J Biochem 133:139 145. Takase K, Matsumoto K, Taguchi S, Doi Y. 2004. Alteration of substrate chain-length specicity of type II synthase for polyhydroxyalkanoate biosynthesis by in vitro evolution: In vivo and in vitro enzyme assays. Biomacromolecules 5:480485. chel A. 1994. Application of enzymatically synthesized Valentin HE, Steinbu short-chain-length hydroxy fatty acid coenzyme A thioesters for assay of polyhydroxyalkanoic acid synthases. Appl Microbiol Biotechnol 40:699709. Vink ETH, Rabago KR, Glassner D, Gruber PR. 2003. Applications of life cycle assessment to NatureWorksTM polylactide(PLA) production. Polym Degrad Stab 80:403419. Yamada M, Matsumoto K, Nakai T, Taguchi S. 2009. Microbial production of lactate-enriched poly[(R)-lactate-co-(R)-3-hydroxybutyrate] with novel thermal properties. Biomacromolecules 10:677681. Yuan W, Jia Y, Tian J, Snell KD, Muh U, Sinskey AJ, Lambalot RH, Walsh CT, Stubbe J. 2001. Class I and III polyhydroxyalkanoate synthases from Ralstonia eutropha and Allochromatium vinosum: Characterization and substrate specicity studies. Arch Biochem Biophys 394:87 98. Zhang S, Kamachi M, Takagi Y, Lenz RW, Goodwin S. 2001. Comparative study of the relationship between monomer structure and reactivity for two polyhydroxyalkanoate synthases. Appl Microbiol Biotechnol 56: 131136.

160

Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010