Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes

C. H. Widberg, F. S. Newell, A. W. Bachmann, S. N. Ramnoruth, M. C. Spelta, J. P. Whitehead, L. J. Hutley and J. B. Prins

Am J Physiol Endocrinol Metab 296:E121-E131, 2009. First published 21 October 2008; doi: 10.1152/ajpendo.90602.2008 You might find this additional info useful... This article cites 35 articles, 17 of which you can access for free at: http://ajpendo.physiology.org/content/296/1/E121.full#ref-list-1 This article has been cited by 5 other HighWire-hosted articles: http://ajpendo.physiology.org/content/296/1/E121#cited-by Updated information and services including high resolution figures, can be found at: http://ajpendo.physiology.org/content/296/1/E121.full Additional material and information about American Journal of Physiology - Endocrinology and Metabolism can be found at: http://www.the-aps.org/publications/ajpendo This information is current as of January 31, 2013.
Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

American Journal of Physiology - Endocrinology and Metabolism publishes results of original studies about endocrine and metabolic systems on any level of organization. It is published 12 times a year (monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2009 the American Physiological Society. ISSN: 0193-1849, ESSN: 1522-1555. Visit our website at http://www.the-aps.org/.

Am J Physiol Endocrinol Metab 296: E121E131, 2009. First published October 21, 2008; doi:10.1152/ajpendo.90602.2008.

Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes
C. H. Widberg,* F. S. Newell,* A. W. Bachmann, S. N. Ramnoruth, M. C. Spelta, J. P. Whitehead, L. J. Hutley, and J. B. Prins
Diamantina Institute for Cancer, Immunology, and Metabolic Medicine, University of Queensland, Princess Alexandra Hospital, Brisbane, Queensland, Australia
Submitted 16 July 2008; accepted in nal form 20 October 2008

Widberg CH, Newell FS, Bachmann AW, Ramnoruth SN, Spelta MC, Whitehead JP, Hutley LJ, Prins JB. Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes. Am J Physiol Endocrinol Metab 296: E121E131, 2009. First published October 21, 2008; doi:10.1152/ajpendo.90602.2008. Cell number is an important determinant of adipose tissue mass, and the coordinated proliferation and differentiation of preadipocytes into mature lipid-laden adipocytes underpins the increased adipose tissue mass associated with obesity. Despite this, the molecular cues governing such adipose tissue expansion are poorly understood. We previously reported that broblast growth factor-1 (FGF-1) promotes both proliferation and differentiation of human preadipocytes and that the major adipogenic effect of FGF-1 occurs during proliferation, priming the cells for adipose conversion. In the current study, we examined whether this effect was linked to the mitogenic action of FGF-1 by investigating the mitogenic and adipogenic potential of other growth factors, platelet-derived growth factor (PDGF; AA and BB) and vascular endothelial growth factor. Although PDGF-AA and PDGF-BB showed comparable mitogenic potential to FGF-1, only FGF-1 treatment resulted in priming and subsequent differentiation. Pharmacological inhibition of FGF receptor (FGFR) tyrosine kinase activity, using the FGFR-specic inhibitors PD-173074 and SU-5402, revealed an obligate requirement for FGFR activity in these processes. A combination of biochemical and genetic approaches revealed an important role for FGFR1. Knock down of FGFR1 expression by small-interfering RNA reduced FGF-1-stimulated signaling events, proliferation, and priming. Together these data highlight the unique nature of the role of FGF-1 during the earliest stages of adipogenesis and establish a role for FGFR1 in human adipogenesis, identifying FGFR1 as a potential therapeutic target to reduce obesity. preadipocyte; obesity; adipogenesis
THE INCIDENCE OF OBESITY, along with its comorbidities, has increased dramatically over the last few decades, and research into the cellular mechanisms governing excessive accumulation of adipose tissue is critical for development of effective antiobesity strategies. Although increased volume of mature adipocytes plays a role in expansion of fat mass, recent evidence demonstrates the importance of increasing adipocyte number in development of human obesity (32). Work by Spalding et al. (32) suggests that inhibiting the generation of new fat cells may provide a basis for innovative therapies for established obesity; however, for this to be a reality, further understanding of the molecular regulation of adipocyte number is required. Because mature adipocytes do not divide, the

capacity for new adipocyte generation resides in mesenchymal stem cells [preadipocytes (PAs)] contained within adipose tissue (27). These cells undergo a process of commitment to the adipocyte lineage and, following a period of proliferation, differentiate into mature adipocytes. Collectively, PA commitment, proliferation, and differentiation are termed adipogenesis. Although considerable insight into the nal differentiation stage of adipogenesis has been achieved, little is known of the earliest stages, including commitment of these stem cells to the adipocyte lineage and their subsequent proliferation. These processes are critical in maintaining a pool of cells capable of adipocyte conversion and thus underpin cellular expansion of adipose tissue. Our work, focusing on the adipogenic process in human PA, identied a novel regulatory role for broblast growth factors (FGF) in the development of human adipose tissue. Findings demonstrated that FGF-1, and to a lesser extent FGF-2, promote adipogenesis in two human models, primary human preadipocytes (phPA) and the Simpson Golabi Behmel syndrome (SGBS) PA cell strain (isolated from an infant with SGBS) (15, 25). A physiological role for FGF signaling in human adipose tissue metabolism and development in vivo is supported by expression of various FGF ligands and cognate FGF receptors in this tissue (12, 15), as well as data showing increased levels of FGF-2 in PAs from obese subjects (35). FGF-1 and -2 are members of a large family of structurally related polypeptide growth factors functioning primarily through high-afnity tyrosine kinase FGF receptors (FGFR) (5). Four major types of FGFR (FGFR1-4) have been identied, and while several FGFs have different binding afnities for these receptors, FGF-1 and -2 are capable of binding all four FGFR (26). In the phPA and SGBS PA models of adipogenesis, longterm treatment with either FGF-1 or -2 during proliferation was not only mitogenic but also resulted in a marked increase in the differentiation capacity of these cells; thus, these growth factors primed cells for differentiation during their proliferative stage of development (15, 25). This priming effect was characterized by increased expression of the adipogenic transcription factor peroxisome proliferator-activated receptor (PPAR)- before induction of differentiation, signifying increased commitment of PA to the adipocyte phenotype (24, 25). The mechanism by which FGF acts in the early stages of PA development to promote mitogenesis and commitment to the adipocyte phenotype is unknown.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. E121

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

* C. H. Widberg and F. S. Newell contributed equally to this work. Address for reprint requests and other correspondence: Johannes Prins, Centres for Health Research, Level 2, Bldg. 35, Princess Alexandra Hospital, Ipswich Rd, Woolloongabba 4102, Brisbane, Australia (e-mail: j.prins@uq. edu.au). http://www.ajpendo.org

0193-1849/09 $8.00 Copyright 2009 the American Physiological Society

E122

FGFR-MEDIATED ADIPOGENIC EFFECTS

Because receptor tyrosine kinase growth factors other than FGFs have not been investigated in the context of priming human PA for differentiation, we assessed the effect of several of these factors on PA proliferation and priming in phPA and SGBS PA. Growth factors examined in this study included members of the platelet-derived growth factor (PDGF) family, which have been reported to act as inducers of PA proliferation (6, 7) and vascular endothelial growth factor (VEGF), which is expressed throughout adipogenesis (8). Here we demonstrate that, while PDGF-AA and -BB efciently stimulated human PA proliferation, only FGF-1 primed the cells for differentiation. VEGF did not inuence either PA proliferation or differentiation. Because priming was specic to FGF-mediated proliferation, we examined the role of FGFR in these effects and determined that FGFR activity is required for FGF-1-stimulated proliferation and priming and that FGFR1 plays a key role in these early adipogenic events.
MATERIALS AND METHODS

Materials. Reagents were obtained from Sigma-Aldrich (Castle Hill, Victoria, Australia), unless otherwise stated. Tissue culture reagents were obtained from Invitrogen (Mount Waverley, Victoria, Australia). Cell isolation and culture. To obtain phPA, subcutaneous adipose tissue biopsies were obtained from 4 male [average age 65 yr (range 5378); average body mass index (BMI) 29 kg/m2 (range 26 34)] and 10 female [average age 42 yr (range 26 59), average BMI 38 kg/m2 (range 2179)] patients undergoing elective open-abdominal surgery. None of the patients had diabetes, severe systemic illness, or were taking medications known to affect adipose tissue mass or metabolism. The protocol was approved by the Research Ethics Committees of the Princess Alexandra Hospital and the University of Queensland. phPA were isolated, cultured, and differentiated as previously described (14, 25) and used for experiments at passage 2. The SGBS PA strain (36) was cultured as described (25) for 30 generations or 6 wk. FGFR1-4-overexpressing HEK-293 cells were generated using the Flp-In T-Rex tetracycline-inducible cell system according to the manufacturers instructions (Invitrogen). The cells were passaged in DMEM supplemented with 100 g/ml hygromycin and 5 g/ml blasticidin. To induce expression of FGFR, cells were treated overnight with 1 g/ml tetracycline. FGF-1 treatment. Recombinant human FGF-1 was produced as described (37). Unless otherwise stated, 1 ng/ml FGF-1 in the presence of 90 g/ml heparin was used to treat SGBS PA and phPA. Growth factor treatment of PA. Based on preliminary dose-response studies, SGBS PA or phPA were treated with equimolar (60 pM) concentrations of FGF-1 (90 g/ml heparin), PDGF-AA, PDGF-BB (R&D Biosystems, Minneapolis, MN), or VEGF (10 g/ml heparin) (Upstate Biotechnology, Lake Placid, NY) in 10% FCS DMEM-F-12. Proliferation was assessed using SYTO 60 assay. For assessment of priming and differentiation, SGBS PA were grown to conuence in the presence or absence of growth factors. phPA were pretreated with growth factors from isolation until experimental use and subjected to the same treatments as SGBS PA with the exception of longer growth periods. Pharmacological inhibition of FGFR activation. PD-173074 and SU-5402 were obtained from Merck (Kilsyth, Victoria, Australia). For treatment of tetracycline-induced HEK-293 cells, serum-starved cells were pretreated for 30 min with 250 nM PD-173074 or 20 M SU-5402 before 50 ng/ml FGF-1 (90 g/ml heparin) was added for 5 min (in continued presence of inhibitor). For acute FGF-1 treatment of SGBS PA or phPA, cells were serum-starved for 8 16 h in DMEMF-12 containing 0.1% BSA and preincubated with 50 250 nM PDAJP-Endocrinol Metab VOL

173074 or 520 M SU-5402 for 30 min before 150 ng/ml FGF-1 (90 g/ml heparin) stimulation for 510 min. For longer-term inhibitor treatment, SGBS PA and phPA were grown to conuence with or without FGFR inhibitors 50 100 nM PD-173074 or 10 M SU-5402. SYTO 60 assay. Cell number was assessed using SYTO 60 (Invitrogen) assay. SGBS PA or phPA were plated in 48-well plates at 1,500 or 2,500 cells/well, respectively. Cells were allowed to adhere overnight before treatment for 4 5 days. Cells were xed in 3.7% formaldehyde-PBS and permeabilized in 0.1% Triton X-100-PBS before blocking in Odyssey blocking buffer (OBB; LI-COR Biosciences, Lincoln, NE) and incubation in SYTO 60 (1:10,000) in a 1:1 solution of OBB-PBS. Cells were washed in 0.1% Tween 20-PBS, and the plate was subsequently scanned on the LI-COR Odyssey Infrared Imaging System. The relative intensities of the wells were calculated using Odyssey image analysis software (version 1.2), and results were expressed as the change in uorescence units (above or below) relevant controls. The SYTO 60 assay was validated against direct cell counts, and results showed a strong positive correlation with cell number in human PA (r2 0.9948). Assessment of differentiation. Lipid accumulation was assessed morphologically using phase-contrast microscopy (100 magnication) (Nikon Eclipse TE300). Differentiation was also assessed by enzymatic assay of glycerol 3-phosphate dehydrogenase (G3PDH) activity as previously described (16, 25) using a Fluostar Optima spectrophotometer (BMG Labtech; Mornington, Victoria, Australia). Results are expressed as milliunits per square centimeter of culture area. Real-time RT-PCR. Total RNA was obtained using RNeasy kits (Qiagen, Doncaster, Victoria, Australia) and concentration and quality were determined using a spectrophotometer (Nanodrop ND-1000; Biolab, Clayton, Victoria, Australia). Total RNA (500 ng-1 g) was reverse transcribed using random hexamers (Promega, Annandale, NSW, Australia) and Superscript III reverse transcriptase according to the manufacturers instructions (Invitrogen). The primers used in this study, listed in Table 1, were designed using Primer 3 software (29) and purchased from Geneworks (Hindmarsh, SA, Australia). Realtime RT-PCR was performed using the SyBr Green detection protocol (reaction mix: SYBR Premix Ex Taq from Takara Bio USA; Madison, WI, USA) as per the manufacturers instructions on the RotorGene 3000 instrument (Corbett Research, Sydney, Australia). The absence of contaminating genomic DNA was veried by no reverse transcriptase control samples. 2Ct values were calculated relative to the expression of cyclophilin and further calibrated to the expression of a control sample. Tunicamycin treatment and subcellular fractionation. Proliferating SGBS PA or phPA were treated with 10 g/ml tunicamycin for 48 h

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Table 1. Primer sequences for real-time RT-PCR in Simpson Golabi Behmel syndrome preadipocytes and primary human preadipocytes
Gene Name Primer Sequences (5 to 3)

PPAR FGFR1 FGFR2 FGFR3 FGFR4 Cyclophilin

Forward: GAAACTTCAAGAGTACCAAAGTGCAA Reverse: AGGCTTATTGTAGAGCTGAGTCTTCTC Forward: CCTGGTGACAGAGGACAATG Reverse: AGATCCGGTCAAATAATGCC Forward: AACGGGAAGGAGTTT AAGCA Reverse: CTTGTCAGATGGGACCACAC Forward: AGGCCATCGGCATTGACA Reverse: GCATCGTCT TTCAGCATCTTCAC Forward: GCGTCCACCACATTGACTAC Reverse: GTGTGTACACCCGGTCAAAC Forward: CGCGTCTCCTTTGAGCTGTT Reverse: TCTCCAGTGCTCAGAGCACG

PPAR, peroxisome proliferator-activated receptor; FGFR, broblast growth factor receptor. www.ajpendo.org

296 JANUARY 2009

FGFR-MEDIATED ADIPOGENIC EFFECTS

E123

before partial fractionation. Cells were washed with 20 mM HEPES, 0.25 M sucrose, and 1 mM EDTA (HES buffer), scraped in HES supplemented with 1 mM Na3VO4 and protease inhibitors [1 g/ml aprotinin, 1 g/ml antipain, 1 g/ml pepstatin, 1.5 g/ml leupeptin, and 0.5 mM 4-(2-aminoethyl)benezenesulfonyl uoride hydrochloride], and homogenized using a 22-gauge needle. Nuclei and other cellular debris were pelleted by centrifugation at 1,600 g, and the nuclear pellet was puried as described (2). Plasma membrane and other cellular membranes were isolated by centrifugation at 170,000 g for 75 min. This high-speed pellet was resuspended in HES supplemented with protease inhibitors and 1% Triton. Western blot analysis. Cell lysates were prepared in 20 mM HEPES, 1% Triton X-100, 150 mM NaCl, 1 mM EDTA, and phosphatase inhibitors (1 mM Na3VO4, 1 mM Na4P2O7, and 10 mM NaF), and protein concentrations were determined using BCA protein assay (Pierce Biotechnology, Rockford, IL). Laemmli sample buffer [500 mM dithiothreitol (DTT)] was added, and the samples were resolved by SDS-PAGE and transferred to Immobilon-P or Immobilon-FL polyvinylidene diuoride membrane (Millipore, Bedford, MA). Immobilon-FL membrane was probed with phospho (p)-extracellular signal-regulated kinase (ERK) 1/2 (Thr202/Tyr204), ERK1/2 (Cell Signaling Technology, Danvers, MA), or -tubulin (Sigma-Aldrich) antibodies and visualized using LI-COR Odyssey as described (25). Enhanced chemiluminescence (Supersignal West Dura Extended Duration Substrate) was used for detection of FGFR1 (C15) (Santa Cruz Biotechnology, Santa Cruz, CA), p-FGFR (Tyr653/654) (R&D Biosystems), and p-FGF receptor substrate (FRS) 2Tyr196 (Cell Signaling Technology) on Immobilon-P membrane. In-cell Western. SGBS PA were seeded on a 48-well plate at a density of 1 104 cells/well and incubated for 72 h. The cells were serum-starved before treatment with FGF-1 or PDGF-BB (both at 3 nM), FGFR kinase inhibitors (0 250 nM PD-173074 or 0 10 M SU-5402), or the mitogen-activated protein kinase kinase inhibitor U-0126 (25 M) for 7.5 min at 37C. Cells were washed with PBS (containing phosphatase inhibitors), xed in 0.5% paraformaldehyde (PFA)-PBS (phosphatase inhibitors), and permeabilized with 0.1% Triton X-100-PBS. Cells were blocked and incubated with primary antibodies, p-ERK1/2 (1:100) and -tubulin (1:1,500), in OBB-PBS. Cells were washed with 0.1% Tween 20-PBS and incubated with secondary antibodies, goat anti-rabbit800 (1:600; Rockland Immunochemicals, Gilbertsville, PA)/goat anti-mouse680 (1:500; Invitrogen), in OBB-PBS. Cells were washed a further three times. The data were analyzed using a grid-sheet in Odyssey version 1.2 software. The U-O126 value (background) was subtracted, and data were normalized to tubulin (in the same well) and expressed as uorescence units. Immunouorescence. SGBS PA or phPA grown on cover slips were xed in 2% PFA, washed three times in PBS, and quenched in 50 mM NH4Cl-PBS. The cover slips were further washed with PBS, blocked in 2% BSA-0.1% saponin, and incubated with FGFR1 antibody (1:100) in blocking solution. Cells were washed three times in PBS, covered, and incubated with Alexa-488 or -594 secondary antibodies (1:200 in blocking solution; Invitrogen) and 4,6-diamidino-2-phenylindole. Finally, cells were washed (as above) and mounted in Vectashield mounting media (Vector Laboratories, Burlingame, CA) for viewing in a Zeiss (Axioskop 2 plus) light microscope with 63 oil objective. Immunoprecipitation. FGF-1-pretreated SGBS PA or phPA were incubated in heparin-containing medium for 5 h, serum starved overnight, and stimulated with 10 ng/ml FGF-1 and 90 g/ml heparin for 5 min at 37C. Cells were washed with PBS (containing 0.5 mM Na3VO4) and scraped in 25 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.1% 2-mercaptoethanol, and 1% Nonidet P-40, with phosphatase and protease inhibitors (HEB buffer). Cells were lysed using 22- and 27-gauge needles and solubilized for 30 min, and insoluble material was pelleted by centrifugation at 10,000 g for 10 min at 4C. The protein lysates were precleared with a 1:1 mix of protein A (ProtA)-protein G (ProtG) beads, incubated with 3 g of
AJP-Endocrinol Metab VOL

FGFR1 or phosphotyrosine (Py99; Santa Cruz) antibodies overnight, captured on ProtA-ProtG beads for 12 h before beads were harvested, washed with HEB buffer (10 20 bed volume), and resuspended in an equal volume of 2 Laemmli sample buffer (200 mM DTT). FGFR1 knock down. Validated small-interfering RNA (siRNA) against FGFR1 and a scrambled control (AllStars Negative control siRNA) were used (Qiagen). SGBS PA or phPA were seeded on six-well plates at 7.5 104 cells/well in serum-containing medium. Transfections were carried out 24 h later using OligofectamineOptiMEM, Oligofectamine [0.6% (vol/vol)], and FGFR1 or negative control siRNA (50 nM) according to the manufacturers instructions (Invitrogen). Cells were transfected a second time 24 h after the initial transfection, and knock down was assessed 48 h posttransfection by real-time RT-PCR of FGFR1 mRNA and Western blot analysis of FGFR1 protein. Transfected cells were trypsinized 48 h posttransfection and reseeded for subsequent experiments essentially as described above. Statistics. Statistical analyses were performed using the following tests as appropriate: Students t-test in Microsoft Excel 2002 Data Package (this analysis was used unless otherwise stated); one-way ANOVA (repeated measures) for differences across experimental groups in conjunction with Tukeys post hoc test to compare differences between the respective treatment groups in GraphPad Prism 4.02. Data are expressed as means SE. P values 0.05 were considered to be statistically signicant.
RESULTS

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Priming for differentiation is FGF specic. To determine whether proliferation-priming in human PA was specic to FGF or common to other mitogenic growth factors that act via tyrosine kinase receptors, we performed experiments to examine proliferation of human PA in response to several mitogens, including PDGF-AA and -BB and VEGF at concentrations spanning 30 pM-2 nM. These concentrations were based on previous reports in other models of adipogenesis (11, 13) and aimed to determine a concentration of PDGF and VEGF that gave a similar mitogenic response as FGF-1 at 60 pM. This is a previously optimized and published concentration of FGF-1 for use on human PA to increase adipogenesis (15, 25). PDGF-AA and -BB both increased PA proliferation in a dose-dependent manner, whereas VEGF was not mitogenic at any concentration tested (data not shown). Similar results on proliferation were achieved in both human PA models, with Fig. 1A demonstrating the mitogenic effect of FGF-1, PDGFAA, and PDGF-BB in SGBS PA at equimolar growth factor concentrations. VEGF and FGF-1 are both heparin-binding growth factors, and, when heparin is added alone (or together with VEGF), there is a nonsignicant reduction in PA proliferation (Fig. 1A). We next aimed to determine if the increased proliferation of human PA in response to PDGF-AA and -BB also resulted in priming of the cells for differentiation as observed in response to FGF. All growth factors were used at the concentration previously determined to have equal proliferative effects (60 pM). VEGF (60 pM) was included to determine effects of a nonproliferative growth factor in these experiments. The expression of PPAR mRNA, at conuence, was used as a marker for cell priming (25). In agreement with our published data (25), FGF-1-treated human PA exhibited a two- to threefold increase in PPAR expression compared with cells treated with heparin alone (Fig. 1B). In contrast, PDGF-AA and -BB and VEGF treatment had no effect on PPAR expression in
www.ajpendo.org

296 JANUARY 2009

E124

FGFR-MEDIATED ADIPOGENIC EFFECTS

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Fig. 1. Fibroblast growth factor (FGF)-1 priming effects on human preadipocytes (PA) are specic for this growth factor compared with platelet-derived growth factor (PDGF) and vascular endothelial growth factor (VEGF). A: Simpson Golabi Behmel syndrome (SGBS) PA were cultured in either 60 pM FGF-1, PDGF-AA, PDGF-BB, or VEGF (heparin where appropriate), and effects were determined on cell number by SYTO 60 assay. Results are expressed as arbitrary units compared with no growth factor control (ctrl) [serum-containing media (SCM)] cells set as 0 (n 5 experiments, ANOVA **P 0.01; Tukey **P 0.01 for FGF-1, PDGF-AA, and PDGF-BB cf. controls). B: priming assessed by peroxisome proliferator-activated receptor (PPAR)- mRNA expression at conuence using real-time RT-PCR. Results are expressed as fold compared with ctrl (SCM) cells (n 3, ANOVA **P 0.01; Tukey **P 0.01 for FGF-1 cf. control). Differentiation by lipid accumulation (100 magnication; C) and glycerol 3-phosphate dehydrogenase (G3PDH) activity (D) following growth in the presence and differentiation in the absence of growth factors. Results are expressed as activity units/cm2 (n 3, ANOVA **P 0.01; Tukey **P 0.01 for FGF-1 cf. control). Primary PA were cultured in either 60 pM FGF-1, PDGF-AA, or PDGF-BB (heparin where appropriate), and effects determined on differentiation by lipid accumulation (100 magnication; E) and G3PDH activity (F) following growth in the presence and differentiation in the absence of growth factors. Results are expressed as activity units/cm2 (n 23, ANOVA **P 0.01; Tukey **P 0.01 for FGF-1 cf. ctrl).

either the SGBS PA model (Fig. 1B) or in the phPA model (data not shown). Priming was further assessed in both SGBS and phPA (Fig. 1, CF) by determining differentiation capacity of the cells following growth factor (60 pM) treatment during the proliferation stage only. As expected, FGF-1 treatment primed human PA for subsequent differentiation, as judged by
AJP-Endocrinol Metab VOL

increased lipid accumulation (Fig. 1, C and E) and increased activity of the differentiation marker G3PDH (Fig. 1, D and F) following exposure to a differentiation induction medium. In these experiments, neither the mitogenic PDGF-AA and -BB nor nonmitogenic VEGF (in the SGBS PA model) had an effect on PA differentiation (Fig. 1, CE). It is notable that the
www.ajpendo.org

296 JANUARY 2009

FGFR-MEDIATED ADIPOGENIC EFFECTS

E125

primary PAs, in contrast to the SGBS PA model, do not differentiate in the absence of FGF-1 (compare lipid accumulation in Fig. 1, C and E, respectively). Thus, despite a similar mitogenic effect to FGF-1, PDGF-AA and -BB had no effect on lipid accumulation and differentiation in the SGBS or phPA model of adipogenesis. Inhibition of FGFR activation during proliferation decreases FGF-1-priming and differentiation potential of human PA. Although there is some evidence suggesting a role for FGFR activation during the nal stages of adipocyte development (28), little is known of the role of FGFR signaling in regulation of human PA proliferation and priming. Therefore, we next assessed the involvement of FGFR in these early adipogenic processes using the ATP-competitive FGFR inhibitors PD-173074 and SU-5402 (22, 23). To conrm the efcacy of the inhibitors, HEK-293 cells stably overexpressing each of the four receptors were treated with PD-173074 or SU-5402, and FGF-1 signaling events were examined by Western blot

analysis using p-FGFR (Tyr653 654), p-FRS2Tyr196, and p-ERK1/2 antibodies. Figure 2A shows phosphorylation of a 150-kDa FGFR1 band, as well as phosphorylation of the adaptor protein FRS2 and ERK1/2 in response to acute FGF-1 treatment. In the presence of either PD-173074 or SU-5402, there was a decrease in the phosphorylation of FGFR1, FRS2, and ERK1/2. Similar results were observed in cells overexpressing FGFR2, FGFR3, or FGFR4 (data not shown), indicating that the inhibitors prevent signaling through all four FGFRs. The ability of these inhibitors to affect FGFR activation in human PA was assessed by Western blot analysis. General FGFR activation was conrmed in proliferating PA using the p-FGFR antibody (Fig. 2B). Several FGF-1 responsive bands, spanning 90 150 kDa (Fig. 2B) were routinely observed in human PA. Whereas the 90- and 150-kDa p-FGFR bands were the most robustly detected and were completely absent in the presence of PD-173074 or SU-5402 treatment, the

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Fig. 2. Characterization and validation of pharmacological FGF receptor (FGFR) inhibitors PD-173074 and SU-5402 in FGFR1-overexpressing cells and human PA. A: HEK-293-FGFR1 cells were stimulated 50 ng/ml FGF-1 and 10 g/ml heparin and 250 nM PD-173074 or 20 M SU-5402. Phosphorylation of FGFR1, FRS2, and extracellular signal-regulated kinase (ERK) 1/2 was analyzed by Western blot. ERK1/2 and tubulin protein were analyzed and used as expression and loading controls (n 3). B: proliferating primary human (ph) PA were stimulated 10 ng/ml FGF-1 and 90 g/ml heparin and 250 nM PD-173074 or 20 M SU-5402 and analyzed by Western blot as described in A (n 3). C: In-cell Western of FGF-1and PDGF-BB-stimulated ERK1/2 phosphorylation (growth factors at 3 nM) in SGBS PA FGFR inhibitors (0 250 nM PD-173074 and 0 10 M SU-5402). Results are expressed as uorescence units over control cells (n 3 4).

AJP-Endocrinol Metab VOL

296 JANUARY 2009

www.ajpendo.org

E126

FGFR-MEDIATED ADIPOGENIC EFFECTS

p-FGFR antibody also recognized 120- and 130-kDa bands that were partially FGF-1 responsive and sensitive to FGFR inhibitor treatment. As expected, FGFR inhibitor treatment also decreased FGF-1-induced phosphorylation of FRS2 and ERK1/2 in PA (Fig. 2B). To assess the specicity of these FGFR inhibitors for FGF-1 signaling compared with PDGF-BB signaling, we employed an In-Cell Western assay for the detection of ERK1/2 phosphorylation in human PA (Fig. 2C). There was a dose-dependent decrease in FGF-1-stimulated ERK1/2 phosphorylation in the presence of 0 250 nM PD-173074 or 0 10 M SU-5402; however, there was no effect on PDGF-BB-stimulated ERK1/2 phosphorylation (Fig. 2C). These data conrm the efcacy and relative specicity of PD-173074 and SU-5402 for the FGFRs under the experimental conditions. Next, we determined the effects of the FGFR inhibitors on human PA proliferation. FGF-1-stimulated proliferation was completely abrogated (100 nM PD-173074) or signicantly reduced (10 M SU-5402) in both SGBS PA (Fig. 3A) and

phPA (data not shown). FGF-1-stimulated priming of human PA was also completely abolished (PD-173074) or inhibited (SU-5402) by these compounds, as demonstrated by a reduction in PPAR mRNA expression at conuence (Fig. 3B). We routinely observed differences in morphology between FGF1-treated (primed) and non-FGF-1-treated (unprimed) cells. The primed cells are small, uniform in shape, and achieve high cell density at conuence while, in comparison, the unprimed cells are larger, more spread out, and grow in a less-ordered pattern. Treatment with the FGFR kinase inhibitors resulted in either reversal to the unprimed morphology in previously FGF-1-primed cells (Fig. 3C) or failure to achieve the primed morphology when growth factor and inhibitor treatment commenced concurrently in FGF na ve cells. To determine if these observed effects of FGFR inhibition during proliferation resulted in decreased differentiation potential of human PA, the inhibitor-treated cells were induced to differentiate using a standard cocktail in the absence of FGFR inhibitors. Data showed that both SGBS PA and phPA treated

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Fig. 3. Effects of pharmacological FGFR inhibition on FGF-1-mediated adipogenic events. A: SGBS PA were grown FGF-1 and 100 nM PD-173074 or 10 M SU-5402, and effects were determined oncell number by SYTO 60 assay. Results are expressed as arbitrary units compared with heparin ctrl cells, set as 0 (n 3, ANOVA **P 0.01; Tukey **P 0.01 for FGF-1 cf. PD-173074 and *P 0.05 cf. SU-5402). B: priming by PPAR mRNA expression at conuence using real-time RT-PCR. Results are expressed as fold over heparin ctrl cells (n 35, ANOVA *P 0.05; Tukey *P 0.05 for FGF-1 cf. PD-173074 and *P 0.05 cf. SU-5402). C: morphology (100 magnication) (n 3). D: differentiation by G3PDH activity following growth 100 nM PD-173074 or 10 M SU-5402 and differentiation in the absence of inhibitors (n 4 5, *P 0.05). E: phPA differentiation was assessed by G3PDH activity following growth 50 nM PD-173074 or 10 M SU-5402 and differentiation in the absence of inhibitors (n 3, *P 0.05). AJP-Endocrinol Metab VOL
296 JANUARY 2009

www.ajpendo.org

FGFR-MEDIATED ADIPOGENIC EFFECTS

E127

with FGF-1 and either PD-173074 (100 nM SGBS or 50 nM phPA) or SU-5402 (10 M) during proliferation exhibited signicantly decreased differentiation, as measured by G3PDH activity assay (Fig. 3, D and E). We used 50 nM PD-173074 in the phPA cells due to marked growth inhibitory effects of this compound at 100 nM in this model. Overall, these studies demonstrate that the phPA model is more sensitive than the SGBS PA model to the effects of FGFR inhibitors. This is in agreement with our previously published data showing a greater dependence on FGF-1 priming for differentiation (compare Fig. 1, C and E) in the primary cells compared with the SGBS PA strain (25). FGFR expression and activation in human PA. To determine the role of individual FGFRs in this system, the relative expression levels of each receptor were assessed in proliferating cells using real-time RT-PCR (Fig. 4A). FGFR1 was the most abundantly expressed receptor in both SGBS PA and

phPA, being 1,000- to 10,000-fold higher than FGFRs 2 4. FGFR1 expression was unchanged by FGF-1 treatment. FGFR2 was more abundant than FGFR3 and FGFR4, and expression of FGFR2 was decreased upon FGF-1 treatment (Fig. 4A, inset). Expression levels of FGFR4 were low but detectable in both SGBS PA and phPA, whereas FGFR3 was only detectable in phPA (data not shown). Because FGFR1 was the predominant receptor expressed in proliferating PA, the expression of this receptor was investigated further by Western blot and immunouorescence analysis (Fig. 4, B and C). A number of protein bands, which were similar in size to previously described FGFR1 species (33, 34), were recognized by the FGFR1 antibody in proliferating, conuent, and differentiated human PA (Fig. 4B). Expression of the 90- and 150-kDa FGFR1 species increased throughout differentiation and in response to FGF-1 treatment. N-glycosylation of FGFR1 gives rise to several FGFR species of

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Fig. 4. FGFR1 is abundantly expressed and activated in response to FGF-1 in human PA. SGBS PA were grown and differentiated FGF-1. A: FGFR1-4 mRNA expression during proliferation was assessed by real-time RT-PCR. Results are shown as fold expression compared with the non-FGF-1-treated FGFR4 mRNA, set as 1 (n 3). Inset: FGFR2-4 mRNA expression. B: FGFR1 protein expression during proliferation, conuence, and differentiation by Western blot. Tubulin was used as a loading control (n 3). P, proliferation; 0, conuence; 2, 4, and 14, days of differentiation. Inset, FGFR1 expression in a membrane-enriched cellular fraction during proliferation following treatment with 10 g/ml tunicamycin (tunica), analyzed as above (n 3). C: immunouorescence analysis (63 oil objective) of FGFR1 during proliferation, conuence, and differentiation. Images are representative of duplicate cover slips in two (differentiation) or more independent experiments. Bottom, FGFR1 expression in a nuclei enriched cellular fraction during proliferation, conuence, and differentiation. Lamin A/C was used as a loading control (n 3). D: proliferating PA were serum-starved and treated 10 ng/ml FGF-1 and 90 g/ml heparin. Lysates were immunoprecipitated using the FGFR1 or phospho (p)-Tyr (Py99) antibodies and subjected to Western blot analysis for phosphorylation of FGFR, FRS2, ERK1/2, FGFR1, and tubulin. Data are representative of 3 independent experiments. AJP-Endocrinol Metab VOL
296 JANUARY 2009

www.ajpendo.org

E128

FGFR-MEDIATED ADIPOGENIC EFFECTS

different molecular weight, starting at the predicted unmodied FGFR1 weight of 90 kDa (9, 10). We found that tunicamycin inhibition of N-glycosylation resulted in selective loss of the high-molecular-weight FGFR1 species (120 150 kDa) and an increase in the 90-kDa band (Fig. 4B), further establishing the identity of these bands as FGFR1. It is also notable that the multiple FGFR1 species detected in PA are similar in size to the FGF-1-responsive phosphorylated FGFR species detected by the p-FGFR antibody in Fig. 2B. Immunouorescence analysis demonstrated a peripheral cytoplasmic/membrane and strong nuclear localization of FGFR1 in proliferating SGBS PA, in the absence or presence of FGF-1 (Fig. 4C). Upon reaching conuence, there was a marked translocation of FGFR1 from the nucleus only in FGF-1treated cells. These FGFR1 translocation data were further conrmed biochemically using Western blot of the nuclei enriched fraction from subcellular fractionation experiments (Fig. 4C, bottom). FGFR1 staining was also observed in differentiated SGBS (Fig. 4C) and primary cells (data not shown), with predominantly intracellular membrane and plasma membrane localization. The ability of FGF-1 to acutely activate FGFR1 in proliferating SGBS PA was further assessed by immunoprecipitation (IP) and Western blot analysis. Figure 4D demonstrates FGF1-responsive FGFR bands (90, 120, 130, and 150 kDa) and downstream activation of FRS2 and ERK1/2 in the SGBS PA lysate. FGFR1 and general tyrosine phosphorylated proteins were immunoprecipitated from the lysate and subjected to

Western blot analysis. FGF-responsive bands of 120, 130, and 150 kDa were observed in the FGFR1 IPs following Western blot with the p-FGFR antibody. In addition, following general phosphotyrosine (Py99) IP, a 120- to 130-kDa FGF-responsive band was subsequently detected by the FGFR1 antibody. Collectively, these data provide evidence for a potential role of FGFR1 in mediating some of the effects of FGF-1 in PA. FGFR1 is required for FGF-1-stimulated human PA proliferation and priming. To investigate a putative role for FGFR1 in FGF-1-mediated proliferation and priming of PA, we performed transient transfections using a validated FGFR1 siRNA in phPA (Fig. 5). Primary PAs were the model of choice for these FGFR1 knock down experiments, since we have previously demonstrated that these cells are more sensitive to the effects of FGFR inhibition (Fig. 3) than SGBS PA. In phPA, transfection of FGFR1 siRNA resulted in decreased FGFR1 mRNA and protein, assessed at 48 h posttransfection, compared with cells transfected with a scrambled control siRNA (Fig. 5, A and B). Our results did not show any adverse effects using the scrambled control siRNA compared with untransfected phPA (data not shown). Subsequent experiments determined that knock down of FGFR1 in phPA resulted in both decreased FRS2 and ERK1/2 phosphorylation following FGF-1 stimulation (Fig. 5B) as well as a signicant decrease in FGF-1-induced proliferation (Fig. 5C). These reductions in FGF-1-mediated signaling events and proliferation correlated with the degree of FGFR1 mRNA knock down at 48 h posttransfection (60%, P 0.05). Furthermore, siRNA

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

Fig. 5. FGFR1 small-interfering RNA (siRNA) knock down inhibits FGF-1-mediated proliferation and priming in phPA. phPA were transfected with FGFR1 siRNA or a scrambled negative ctrl siRNA, and effects of knock down were assessed on FGFR1 mRNA expression using real-time RTPCR 48 h posttransfection, fold compared with ctrl siRNA (n 4, *P 0.05; A). B: FGFR1 protein expression (nuclei-enriched fraction) and FGFR1mediated signaling (whole cell lysate) by Western blot analysis. The phosphorylation of FRS2 and ERK1/2 was determined in response to acute FGF-1 stimulation. Lamin A/C, tubulin, and ERK1/2 were used as loading controls. Data are representative of 3 independent experiments. C: cell number by SYTO 60 assay. Results are expressed as arbitrary units over non-FGF-1-treated heparin ctrl cells, set as 0 (n 4, **P 0.01). D: morphology (100 magnication) (n 3). E: priming by PPAR mRNA expression at conuence using real-time RT-PCR. Results are fold compared with ctrl siRNA (n 6, **P 0.01).

AJP-Endocrinol Metab VOL

296 JANUARY 2009

www.ajpendo.org

FGFR-MEDIATED ADIPOGENIC EFFECTS

E129

knock down of FGFR1 attenuated FGF-1 priming, as judged by reversal of FGF-1-induced changes in cell morphology (Fig. 5D) and a signicant reduction (41%, P 0.01) in FGF-1mediated PPAR mRNA expression at conuence (Fig. 5E). This reduction in FGF-1-stimulated PPAR mRNA correlated with the degree of FGFR1 mRNA knock down at this later time point, conuence (42%, P 0.01).
DISCUSSION

This study extends our current understanding of the molecular mechanisms underpinning the earliest stages of human adipogenesis and demonstrates the importance of the FGF signaling pathway in regulating these events. Earlier work from our laboratory demonstrated a novel priming for differentiation effect of FGF-1 that occurred concurrently with increased proliferation of human PA. It was unknown, however, whether these effects on early adipogenic events were specic to FGF-1 signaling or whether any mitogen might also increase the capacity for human PA adipose conversion. To address this question, we compared the effects of FGF-1 with that of other mitogenic growth factors, in particular PDGF-AA and -BB and VEGF, in two human models of adipogenesis. Results demonstrated a signicant proliferative effect in human PA of both PDGF-AA and -BB that was comparable to that mediated by FGF-1 at similar molar concentrations. However, in contrast to the adipogenic events associated with FGF-1-stimulated proliferation, no increase in commitment or differentiation capacity was observed in cells treated with either of the PDGFs. VEGF had neither a proliferative nor adipogenic effect in human PA. These results demonstrate that early adipogenic events in human PA are not due to 1) increased mitogenesis per se, 2) increased cell-cell contact at conuence, or 3) signaling through general receptor tyrosine kinase pathways. Although the scope of this study did not allow a more comprehensive analysis of a wider range of growth factors, preliminary experiments also showed no effect of epidermal growth factor, nerve growth factor, and insulin-like growth factor-I on differentiation potential of human PA in this system (unpublished observations). Because FGF-1 and -2 are the only growth factors known to stimulate these early events in human adipogenesis (15, 24), it is tempting to speculate that the molecular mechanisms may be unique to the FGF family. These data, however, do not rule out the possibility that FGF-mediated adipogenesis is not a direct consequence of FGF-stimulated proliferation and could, for example, be associated with specic kinetics of ERK1/2 activation previously reported to be important in adipose conversion (19, 25). A dening feature of the FGF family of growth factors is the high-afnity FGFR tyrosine kinases. Our data using two structurally distinct FGFR kinase inhibitors, PD-173074 and SU5402, demonstrated that FGFR activation is essential for FGF1-mediated human PA proliferation and priming for differentiation. In accordance with previous reports, we found that PD-173074 was more efcient at blocking FGF-1-mediated effects than SU-5402 (22). Overall, these results demonstrate the importance of FGFR activity in adipogenesis, but, as the FGFR kinase inhibitors efciently blocked signaling through all four FGFR, further work was needed to determine the role of specic FGFRs.
AJP-Endocrinol Metab VOL

Based on our ndings that FGFR1 mRNA was the most abundantly expressed isoform in proliferating PA and was activated in response to FGF-1 during this developmental stage, a detailed study of the specic role of this receptor in FGF-1 adipogenic effects was undertaken. Using an siRNA knock down approach, we determined a key regulatory role for FGFR1 in human adipogenesis with decreases in FGF-1mediated proliferation and priming (at the level of both cell morphology and PPAR mRNA expression). These inhibitory effects on FGF-1-mediated adipogenesis were closely correlated to the observed decrease in FGFR1 mRNA and were substantiated using two further oligonucleotide sequences targeting different regions of the FGFR1 gene (unpublished observations). Although signaling via FGFR1 accounts for a large proportion of the observed FGF-1 adipogenic actions, further work is required to determine whether other FGFR(s) may also play a role. This may be either individually or as heterodimers, since FGFR1 has previously been shown to form functional heterodimers with other FGFR subtypes (3). Interestingly, FGFR2 expression was reduced in proliferating PA in response to FGF-1 treatment, suggesting that FGFR2 may play an inhibitory role in human PA proliferation or priming. Another possibility is that priming of human PA by the FGF/FGFR axis may be dependent on specic interactions in the nucleus. FGF-1, FGF-2, and FGFR1 have all been detected in the nucleus (4) and have been reported to play a role in cellular mitogenesis from this locale (1, 17, 18, 37), possibly through formation of functional receptor-ligand complexes (33, 34). In the current study, immunouorescence analysis clearly demonstrated a nuclear localization for FGFR1 during the proliferative stage in both FGF-treated and control cells. Furthermore, we showed that FGFR1 moved out of the nucleus at conuence in FGF-1-treated cells. Because nuclear localization of FGFR1 may be important for proliferation, one consequence of priming could be the translocation of FGFR1 from the nucleus, resulting in a growth-arrested state permissive for adipocyte differentiation. This hypothesis agrees with previous reports demonstrating the importance of nuclear translocation of FGFRs in regulation of different cellular developmental stages (30, 33). Ultimately, FGF-1 priming results in altered gene expression in a manner that allows for efcient PA differentiation. This is evidenced by increased expression of the master adipogenic transcription factor PPAR in the primed cells. In addition, GATA2, which acts as a negative regulator of PPAR expression, is downregulated in phPA in response to FGF-1 (unpublished observation). The increased expression of PPAR in response to FGFs indicates increased commitment of these mesenchymal stem cells to the adipocyte lineage. FGFs have previously been reported to play a role in commitment of mesenchymal stems cells to other lineages, including osteoblast and chondrocyte (20, 21, 31). Therefore, further experiments are required to determine specic mechanisms by which this signaling system promotes the adipocyte phenotype in human FGF-treated PA. In conclusion, this work provides further evidence for the role of FGFs as key regulators of human adipogenesis and demonstrates that the FGF/FGFR axis regulates early adipogenic events that may be important in maintaining a pool of stem cells responsible for hyperplastic expansion of adipose tissue mass. These effects appear specic to FGFs relative to a
www.ajpendo.org

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

296 JANUARY 2009

E130

FGFR-MEDIATED ADIPOGENIC EFFECTS 13. Hauner H, Rohrig K, Petruschke T. Effects of epidermal growth factor (EGF), platelet-derived growth factor (PDGF) and broblast growth factor (FGF) on human adipocyte development and function. Eur J Clin Invest 25: 90 96, 1995. 14. Hutley L, Newell F, Suchting S, Prins J. Adipose tissue. In: Primary Mesenchymal Cells (1st ed.), edited by M. R. Koller, B. O. Palsson, and J. R. W. Masters. Dordrecht, The Netherlands: Kluwer, 2001, vol. 5, p. 173187. 15. Hutley L, Shurety W, Newell F, McGeary R, Pelton N, Grant J, Herington A, Cameron D, Whitehead J, Prins J. Fibroblast growth factor 1: a key regulator of human adipogenesis. Diabetes 53: 30973106, 2004. 16. Hutley LJ, Herington AC, Shurety W, Cheung C, Vesey DA, Cameron DP, Prins JB. Human adipose tissue endothelial cells promote preadipocyte proliferation. Am J Physiol Endocrinol Metab 281: E1037E1044, 2001. 17. Imamura T, Engleka K, Zhan X, Tokita Y, Forough R, Roeder D, Jackson A, Maier JA, Hla T, Maciag T. Recovery of mitogenic activity of a growth factor mutant with a nuclear translocation sequence. Science 249: 15671570, 1990. 18. Joy A, Moffett J, Neary K, Mordechai E, Stachowiak EK, Coons S, Rankin-Shapiro J, Florkiewicz RZ, Stachowiak MK. Nuclear accumulation of FGF-2 is associated with proliferation of human astrocytes and glioma cells. Oncogene 14: 171183, 1997. 19. Kortum RL, Costanzo DL, Haferbier J, Schreiner SJ, Razidlo GL, Wu MH, Volle DJ, Mori T, Sakaue H, Chaika NV, Chaika OV, Lewis RE. The molecular scaffold kinase suppressor of Ras 1 (KSR1) regulates adipogenesis. Mol Cell Biol 25: 75927604, 2005. 20. Martin I, Muraglia A, Campanile G, Cancedda R, Quarto R. Fibroblast growth factor-2 supports ex vivo expansion and maintenance of osteogenic precursors from human bone marrow. Endocrinology 138: 4456 4462, 1997. 21. Mastrogiacomo M, Cancedda R, Quarto R. Effect of different growth factors on the chondrogenic potential of human bone marrow stromal cells. Osteoarthritis Cartilage 9, Suppl A: S36 S40, 2001. 22. Mohammadi M, Froum S, Hamby JM, Schroeder MC, Panek RL, Lu GH, Eliseenkova AV, Green D, Schlessinger J, Hubbard SR. Crystal structure of an angiogenesis inhibitor bound to the FGF receptor tyrosine kinase domain. Embo J 17: 5896 5904, 1998. 23. Mohammadi M, McMahon G, Sun L, Tang C, Hirth P, Yeh BK, Hubbard SR, Schlessinger J. Structures of the tyrosine kinase domain of broblast growth factor receptor in complex with inhibitors. Science 276: 955960, 1997. 24. Neubauer M, Fischbach C, Bauer-Kreisel P, Lieb E, Hacker M, Tessmar J, Schulz MB, Goepferich A, Blunk T. Basic broblast growth factor enhances PPARgamma ligand-induced adipogenesis of mesenchymal stem cells. FEBS Lett 577: 277283, 2004. 25. Newell FS, Su H, Tornqvist H, Whitehead JP, Prins JB, Hutley LJ. Characterization of the transcriptional and functional effects of broblast growth factor-1 on human preadipocyte differentiation. FASEB J 20: 26152617, 2006. 26. Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G, Goldfarb M. Receptor specicity of the broblast growth factor family. J Biol Chem 271: 1529215297, 1996. 27. Otto TC, Lane MD, Cox MM. Adipose development: from stem cell to adipocyte. Crit Rev Biochem Mol Biol 40: 229 242, 2005. 28. Patel NG, Kumar S, Eggo MC. Essential role of broblast growth factor signaling in preadipoctye differentiation. J Clin Endocrinol Metab 90: 1226 1232, 2005. 29. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365386, 2000. 30. Schmahl J, Kim Y, Colvin JS, Ornitz DM, Capel B. Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development 131: 36273636, 2004. 31. Solchaga LA, Penick K, Porter JD, Goldberg VM, Caplan AI, Welter JF. FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow-derived mesenchymal stem cells. J Cell Physiol 203: 398 409, 2005. 32. Spalding KL, Arner E, Westermark PO, Bernard S, Buchholz BA, Bergmann O, Blomqvist L, Hoffstedt J, Naslund E, Britton T, Concha H, Hassan M, Ryden M, Frisen J, Arner P. Dynamics of fat cell turnover in humans. Nature 453: 783787, 2008. 33. Stachowiak EK, Maher PA, Tucholski J, Mordechai E, Joy A, Moffett J, Coons S, Stachowiak MK. Nuclear accumulation of broblast growth factor receptors in human glial cellsassociation with cell proliferation. Oncogene 14: 22012211, 1997. www.ajpendo.org

range of other receptor tyrosine kinase growth factors, and our data establish an important role for FGFR1 in mediating the early stages of human adipogenesis. Understanding the adipose tissue-specic mechanisms underlying FGF/FGFR-mediated adipogenesis may lead to identication of novel targets for intervention in development of obesity.
ACKNOWLEDGMENTS We thank the volunteers and surgeons at the PAH for providing tissue. We also thank previous laboratory members Bronwyn Bevan and Wenda Shurety for their contributions. GRANTS This work was supported by grants from the National Health and Medical Research Council of Australia (NHMRC), PAH Foundation, Diabetes Australia Research Trust, and Adipogen Pharmaceuticals Ltd. F. S. Newell held an NHMRC Biomedical Postgraduate Scholarship and a Queensland Government Smart State PhD funding grant. L. J. Hutley was the recipient of a Smart State Fellowship. J. P. Whitehead was the recipient of a Lions Senior Medical Research Fellowship. DISCLOSURE L. J. Hutley and J. B. Prins are inventors on USA PCT AU03/00826 and Australia PCT AY2005/000008. F. S. Newell, L. J. Hutley, J. P. Whitehead, and J. B. Prins have equity interests in Verva Pharmaceuticals, Ltd. REFERENCES 1. Arese M, Chen Y, Florkiewicz RZ, Gualandris A, Shen B, Rifkin DB. Nuclear activities of basic broblast growth factor: potentiation of lowserum growth mediated by natural or chimeric nuclear localization signals. Mol Biol Cell 10: 1429 1444, 1999. 2. Behrmann I, Smyczek T, Heinrich PC, Schmitz-Van de Leur H, Komyod W, Giese B, Muller-Newen G, Haan S, Haan C. Janus kinase (Jak) subcellular localization revisited: the exclusive membrane localization of endogenous Janus kinase 1 by cytokine receptor interaction uncovers the Jak receptor complex to be equivalent to a receptor tyrosine kinase. J Biol Chem 279: 35486 35493, 2004. 3. Bellot F, Crumley G, Kaplow JM, Schlessinger J, Jaye M, Dionne CA. Ligand-induced transphosphorylation between different FGF receptors. Embo J 10: 2849 2854, 1991. 4. Bryant DM, Stow JL. Nuclear translocation of cell-surface receptors: lessons from broblast growth factor. Trafc 6: 947954, 2005. 5. Burgess WH, Maciag T. The heparin-binding (broblast) growth factor family of proteins. Annu Rev Biochem 58: 575 606, 1989. 6. Butterwith SC, Goddard C. Regulation of DNA synthesis in chicken adipocyte precursor cells by insulin-like growth factors, platelet-derived growth factor and transforming growth factor-beta. J Endocrinol 131: 203209, 1991. 7. Butterwith SC, Peddie CD, Goddard C. Regulation of adipocyte precursor DNA synthesis by acidic and basic broblast growth factors: interaction with heparin and other growth factors. J Endocrinol 137: 369 374, 1993. 8. Claffey KP, Wilkison WO, Spiegelman BM. Vascular endothelial growth factor. Regulation by cell differentiation and activated second messenger pathways. J Biol Chem 267: 1631716322, 1992. 9. Dionne CA, Crumley G, Bellot F, Kaplow JM, Searfoss G, Ruta M, Burgess WH, Jaye M, Schlessinger J. Cloning and expression of two distinct high-afnity receptors cross-reacting with acidic and basic broblast growth factors. Embo J 9: 26852692, 1990. 10. Feige JJ, Baird A. Glycosylation of the basic broblast growth factor receptor. The contribution of carbohydrate to receptor function. J Biol Chem 263: 1402314029, 1988. 11. Fukumura D, Ushiyama A, Duda DG, Xu L, Tam J, Krishna V, Chatterjee K, Garkavtsev I, Jain RK. Paracrine regulation of angiogenesis and adipocyte differentiation during in vivo adipogenesis. Circ Res 93: e88 e97, 2003. 12. Gabrielsson BG, Johansson JM, Jennische E, Jernas M, Itoh Y, Peltonen M, Olbers T, Lonn L, Lonroth H, Sjostrom L, Carlsson B, Carlsson LM, Lonn M. Depot-specic expression of broblast growth factors in human adipose tissue. Obes Res 10: 608 616, 2002. AJP-Endocrinol Metab VOL

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

296 JANUARY 2009

FGFR-MEDIATED ADIPOGENIC EFFECTS 34. Stachowiak MK, Maher PA, Joy A, Mordechai E, Stachowiak EK. Nuclear accumulation of broblast growth factor receptors is regulated by multiple signals in adrenal medullary cells. Mol Biol Cell 7: 1299 1317, 1996. 35. Teichert-Kuliszewska K, Hamilton BS, Deitel M, Roncari DA. Augmented production of heparin-binding mitogenic proteins by preadipocytes from massively obese persons. J Clin Invest 90: 1226 1231, 1992.

E131

36. Wabitsch M, Brenner RE, Melzner I, Braun M, Moller P, Heinze E, Debatin KM, Hauner H. Characterization of a human preadipocyte cell strain with high capacity for adipose differentiation. Int J Obes Relat Metab Disord 25: 8 15, 2001. 37. Wiedlocha A, Falnes PO, Madshus IH, Sandvig K, Olsnes S. Dual mode of signal transduction by externally added acidic broblast growth factor. Cell 76: 1039 1051, 1994.

Downloaded from http://ajpendo.physiology.org/ by guest on January 31, 2013

AJP-Endocrinol Metab VOL

296 JANUARY 2009

www.ajpendo.org