Sie sind auf Seite 1von 14

Enhanced in vivo fitness of carbapenem-resistant oprD

mutants of Pseudomonas aeruginosa revealed through


high-throughput sequencing
David Skurnika,1,2, Damien Rouxa,1, Vincent Cattoirb,c,3, Olga Danilchankab,3, Xi Lua, Deborah R. Yoder-Himesd,
Kook Hanb, Thomas Guillarda, Deming Jianga, Charlotte Gaultiera, François Guerinc, Hugues Ascharde, Roland Leclercqc,
John J. Mekalanosb, Stephen Loryb, and Gerald B. Piera,2
a
Division of Infectious Diseases, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; bDepartment of
Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115; cÉquipe Antibiorésistance 4655, Faculté de Médecine, Université de Caen
Basse-Normandie, F-14032 Caen, France; dDepartment of Biology, University of Louisville, Louisville, KY 40202; and eDepartment of Epidemiology, Harvard
School of Public Health, Boston, MA 02115

Edited* by Frederick M. Ausubel, Harvard Medical School and Massachusetts General Hospital, Boston, MA, and approved October 11, 2013 (received for
review December 11, 2012)

An important question regarding the biologic implications of Pseudomonas aeruginosa is a classical example of a bacterial
antibiotic-resistant microbes is how resistance impacts the organ- pathogen that is often found associated with extremely difficult-
ism’s overall fitness and virulence. Currently it is generally thought to-treat infections that resist antibiotic therapies. This organism
that antibiotic resistance carries a fitness cost and reduces viru- frequently emerges as a threat to neutropenic, immunosuppressed
lence. For the human pathogen Pseudomonas aeruginosa, treat- patients undergoing treatment for cancer wherein one usually

MICROBIOLOGY
ment with carbapenem antibiotics is a mainstay of therapy that observes the spread of antibiotic-resistant organisms from gas-
can lead to the emergence of resistance, often through the loss of trointestinal (GI) sites into the blood stream. It has also been
the carbapenem entry channel OprD. Transposon insertion-site se- observed in the setting of cystic fibrosis (CF) that reversion or
quencing was used to analyze the fitness of 300,000 mutants of displacement of resident drug-resistant P. aeruginosa strains does
P. aeruginosa strain PA14 in a mouse model for gut colonization
not occur even when antibiotic treatment is intermittent (7). This
and systemic dissemination after induction of neutropenia. Trans-
observation suggests that some mechanisms leading to antibiotic
poson insertions in the oprD gene led not only to carbapenem
resistance could also enhance the fitness of P. aeruginosa in vivo
resistance but also to a dramatic increase in mucosal colonization
and dissemination to the spleen. These findings were confirmed in
and thus contribute to persistent infections.
vivo with different oprD mutants of PA14 as well as with related
Transposon (Tn) insertion-site sequencing (Tn-seq) is a pow-
pairs of carbapenem-susceptible and -resistant clinical isolates. erful analytical method that in various formats has been called
Compared with OprD+ strains, those lacking OprD were more re- “INSeq” (insertion-site sequencing) (8, 9), “Tn-seq” (10), or
sistant to killing by acidic pH or normal human serum and had “high-throughput insertion tracking by deep sequencing” (HITS)
increased cytotoxicity against murine macrophages. RNA-sequenc- (11). These methods allow one to measure the fitness of col-
ing analysis revealed that an oprD mutant showed dramatic lections of insertion mutants under a given growth condition
changes in the transcription of genes that may contribute to the by using deep sequencing to efficiently quantitate the levels of
various phenotypic changes observed. The association between
carbapenem resistance and enhanced survival of P. aeruginosa in Significance
infected murine hosts suggests that either drug resistance or host
colonization can cause the emergence of more pathogenic, drug-re- It is thought antibiotic resistance carries a fitness cost and
sistant P. aeruginosa clones in a single genetic event. reduces microbial virulence. Using high-throughput sequencing
analysis of a transposon insertion bank in Pseudomonas aeru-

S erious political, medical, and public health measures are


being implemented to address the significant problems as-
sociated with drug-resistant pathogens. National and inter-
ginosa, we found enhanced fitness for in vivo mucosal coloni-
zation and systemic spread of strains with transposon insertions
in the oprD gene. This conferred resistance to carbapenem
national campaigns have been instituted to reduce and restrict antibiotics as well as enhanced resistance to killing at acidic pH
antibiotic use to achieve decreases in infections by antibiotic- and by normal human serum along with increased cytotoxicity
against murine macrophages. RNA-sequencing analysis revealed
resistant organisms (1), which have been met with some success
that oprD deficiency led to transcriptional changes in numerous
(2). Although one reason for implementing antibiotic steward-
genes that may contribute to the enhanced in vivo fitness ob-
ship programs is to reduce the selective pressure for emergence of served. Thus, if carbapenem resistance develops during antibi-
drug-resistant microbes, an additional expected consequence is a otic therapy of P. aeruginosa infections, it may lead to enhanced
reduction in extant-resistant microbes from community and hos- fitness and virulence in infected hosts.
pital environments (3). Extensive studies indicate drug-resistant
microbes have decreased fitness and virulence, reflected by an Author contributions: D.S., D.R., V.C., O.D., and G.B.P. designed research; D.S., D.R., V.C.,
O.D., X.L., D.R.Y.-H., K.H., T.G., D.J., C.G., and F.G. performed research; D.S., D.R., O.D., H.A.,
impairment in growth in infected hosts (4), lower transmission
R.L., J.J.M., S.L., and G.B.P. analyzed data; and D.S. and G.B.P. wrote the paper.
rates (5), and reduced virulence manifested by diminished in-
The authors declare no conflict of interest.
vasiveness and higher clearance rates (6). A general decrease in
*This Direct Submission article had a prearranged editor.
the occurrence of drug-resistant organisms can thus potentially be 1
D.S. and D.R. contributed equally to this work.
achieved as the more fit antibiotic-susceptible organisms displace 2
To whom correspondence may be addressed. E-mail: dskurnik@rics.bwh.harvard.edu or
resistant strains over time (6). However, if antibiotic-resistant mu- gpier@rics.bwh.harvard.edu.
tations can lead to enhanced fitness and virulence, this would 3
V.C. and O.D. contributed equally to this work.
challenge the prevailing paradigm that there is a negative fitness This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
cost to drug resistance. 1073/pnas.1221552110/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1221552110 PNAS Early Edition | 1 of 6


junction sequences that mark unique Tn-insertion sites on the neutropenia was considered to indicate fitness for systemic
bacterial chromosome. To test the hypothesis that changes in the dissemination.
antibiotic resistance profile of P. aeruginosa could be associated Tn-seq analysis of the population of organisms derived from
with enhanced host colonization particularly in the context of growing the Tn-insertion bank overnight in LB showed there
immunosuppression (12), we used INSeq to identify P. aerugi- were no Tn insertions mutants that yielded more than 8,000
nosa genes whose inactivation promotes increased fitness in sequencing reads out of 106 normalized reads (0.8%) indicating
neutropenic mice. We constructed a saturated TnSAMDGm (8) that the Tn insertions were relatively evenly distributed in the
insertion library in the well-characterized P. aeruginosa strain genome and no Tn insertions were significantly overrepresented
PA14 (13) and subjected the bank to in vivo selection in a mouse in the bank (Fig. 1A). However, strains with Tn insertions in 13
model for mucosal colonization and dissemination. Tracking of different genes were strongly overrepresented in the output ce-
various mutants indicated that a strong positive selection for the cum samples (Fig. 1B). Twelve of these were in genes resulting in
loss of different gene functions occurred in vivo. Remarkably, loss the loss of type IVa pili (15) comprising 380,000 total reads
of OprD function resulted both in enhanced host colonization and (38%). Strikingly, strains bearing Tn insertions in the oprD gene,
dissemination, as well as resistance to the carbapenem antibiotics. whose loss leads to acquisition of the resistance to the carba-
penem antibiotics, represented 42% of the output cecum pop-
Results and Discussion ulation. The number of sequencing reads of the various oprD
We have recently reported that antibiotic treated mice can be mutants increased from 515 (0.05% of the total reads) in LB to
used in principle to analyze the GI fitness of P. aeruginosa Tn 420,621 in the cecum (Fig. 1B). More dramatically, 94% of the
mutants (9). In brief, to establish P. aeruginosa GI colonization, strains that disseminated to the spleen of neutropenic mice (Fig.
mice received streptomycin and penicillin in sterile drinking 1C) had Tn insertions in the oprD gene (947,397 sequencing
water for 5 d to clear the indigenous commensal GI microbial reads in the spleen output group). Whereas a large number of
flora, after which the PA14 TnSAMDGm insertion bank, grown Tn-insertion mutants showed a significant decrease in their re-
overnight in lysogeny broth (LB, designated “input LB”) con- covery from each in vivo environment, mutants carrying Tn
taining 15 mg gentamicin per L was added to sterile water con- insertions in the oprD gene were dramatically increased in in vivo
taining penicillin and gentamicin. The drinking water containing fitness [Z = 972.29, P < 10-16, Kal’s statistical test (16)]. To avoid
bacteria was renewed after 72 h and administered to mice for any bias due to an overrepresentation of the oprD mutants in
a total of 6 d after which sterile drinking water was given for 24 h water over time, we sequenced the bank of mutants after bacteria
before mice were killed and their ceca removed. During this time, resided in water containing penicillin and gentamicin for 48 h at
the strains with Tn insertions that could colonize and survive in the room temperature. Tn insertions in oprD represented less than
cecum of the GI tract were selected (designated “output cecum”). 0.5% of the viable mutants present in such water samples. As the
Following induction of neutropenia after 6 d of mucosal coloni- drinking water containing bacteria was changed after 72 h, the
zation, the strains with Tn insertions that were able to disseminate lack of overrepresentation of the oprD mutant strains at any time
systemically over 24 h were recovered from the spleen (designated point in the water was confirmed by plating the bank of mutants
“output spleen”) (14). Splenic dissemination after induction of that survived for 72 h in water on plates with or without

Fig. 1. Analysis of in vivo fitness of Tn insertions in the P. aeruginosa PA14 genome. (A) Circos plot of Tn insertions into strains grown overnight in LB with
their ordered representation (inner blue circle). Gray circular lines represent 2,000, 4,000, 6,000, or 8,000 sequencing reads recovered from the input LB
sample. Outermost circle represents the full PA14 genome. (B and C) Analysis of Tn insertions into genes within the PA14 chromosome revealed strains with
increased in vivo fitness. (B) Ordered representation of the in vivo fitness for cecal colonization of all of the strains with Tn insertions able to grow overnight
in LB. (C) Ordered representation of the in vivo fitness for splenic dissemination of all of the strains with Tn insertions able to colonize the output cecum. Total
number of reads recovered from the input LB and output cecum and spleen samples were normalized to 1,000,000.

2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110 Skurnik et al.


carbapenems (3 mg/L). We confirmed by PCR that only strains insertion sequence element IS Pa1328 at nucleotide 50 in the
with a Tn inserted in the oprD gene were able to grow on the oprD gene and the carbapenem-resistant strain 51-2 had a 12-bp
carbapenem-containing plates and they represented only 0.5% of deletion (base pairs 579–590 included) and a single nucleotide
the total strains. In parallel, we observed no difference in the change (G→A at position 1148 leading to a stop codon) in the
growth of an oprD mutant strain in vitro (Fig. S1). oprD gene (Fig. S2B). We further constructed complemented
Increased fitness was not specific for Tn insertions into genes strains for the PA14_Tn-oprD::Spleen strain and the 48-2 and 51-
encoding for all outer membrane proteins (OMPs) although, as 2 strains by conjugating into them a plasmid bearing a full-length
among the Tn insertions in the 262 genes predicted to encode for oprD gene (PoprD). The complemented strains had MICs to
OMPs (17, 18), only 68 were able to colonize the cecum (Fig. imipenem of ≤1 mg/L. Finally, to further study the phenotypes
2A). Among them, only the Tn insertions in the oprD gene dis- associated with oprD deficiency, 22 additional clinical strains
played an enhanced fitness for colonization (Fig. 2A). were selected (CS1–CS22): 10 strains (CS1–CS10) with a normal
To further analyze the comparative colonization and dissemina- level of transcription of the oprD as determined by quantitative
tion abilities of wild-type (WT) P. aeruginosa PA14 and strains with (q)RT-PCR, and 12 strains (CS11–CS22) with a reduced level of
Tn insertions in the oprD gene, we characterized several oprD-de- expression (Dataset S1). The three controls used for the qRT-
ficient variants of strain PA14. Two of these strains, PA14_Tn- PCRs were the PA14 WT strain, a strain with a clean deletion of
oprD:6–4 and PA14_Tn-oprD:8–1, were retrieved from an ordered the oprD gene, and a strain overexpressing oprD.
Tn library (19) and had distinct Tn insertions in the oprD gene. An Analysis of OprD expression using SDS/PAGE showed that
additional PA14 strain, PA14_Tn-oprD::Spleen, was recovered from the 48.4 kDa OprD protein was readily seen in extracts from WT
a neutropenic mouse spleen. All of these oprD Tn-insertion strains PA14, the clinical isolates 48-1 and 52-1 and the corresponding
showed an enhanced resistance to the carbapenem antibiotic imi- transcomplemented strains (Fig. 2B), whereas no evidence of an
penem, with a minimum inhibitory concentration (MIC) of ≥6 mg/L intact OprD protein was found in PA14 ΔoprD strain (used as
compared with 1 mg/L for the WT PA14 strain. a control), the Tn insertions designated 6-4, 8-1, Tn-oprD::
To acquire correlative data from infected human patients, we Spleen, and the clinical strains 48-2 and 51-2 (Fig. 2B). This

MICROBIOLOGY
obtained two additional strains of P. aeruginosa resistant to result was confirmed using a sensitive silver-staining reagent
carbapenems from a collection of clinical isolates. Pulsed-field (Fig. S3) that also showed the lack of difference of expression in
gel electrophoresis (PFGE) (20) was used to identify related the other OMPs under these conditions, and suggested that
pairs of strains from two patients (Fig. S2A) in which earlier OprD-truncated protein was not present in OprD mutant strains
clinical isolates (strains 48-1 and 51-1) were carbapenem sus- (Fig. S3).
ceptible (imipenem MIC < 1 mg/L), and later isolates (48-2 and As Tn insertions unable to produce type IVa pili were also
51-2) carbapenem resistant (imipenem MIC ≥ 32 mg/L). Se- positively selected for enhanced GI colonization, the swarming
quencing of the oprD genes from these strains confirmed that and the twitching motilities of P. aeruginosa PA14 Tn::oprD were
the carbapenem-susceptible isolates had an intact oprD gene, assessed (15). No change in motility was associated with the loss
whereas the carbapenem-resistant strain 48-2 had acquired the of production of OprD (Fig. 2C and Figs. S4 and S5). Therefore,

Fig. 2. Characterization of oprD mutants. (A) Fitness for dissemination of all of the Tn insertions in genes encoding for predicted OMPs that are able to
colonize the cecum. Positive fitness (more than twofold increase) was detected only for Tn insertions into the oprD gene (PA14_51880) (green bar). All of the
insertions in the genes for the remaining OMPs had a reduced fitness (red bars) ranging from a 10-fold to a >10,000-fold decrease in the ratio of reads in the
cecum versus spleen. Black circular lines within the gray circle represents baseline, and thin gray circular lines represent 10-fold changes (i.e., a log10 scale).
Outermost circle represents the full PA14 genome with a 10× magnification of the regions of interest. (B) Analysis of the OMP expression. oprD mutant strains
Tn_oprD (spleen, 6-4, 8-1), clinical isolates (48-2 and 51-2), and PA14 ΔoprD did not express the OprD protein. OprD (arrow) is seen in the OMP extract from
WT PA14, clinical isolates 48-1 and 51-1, and in the complemented (PoprD) strains. M, molecular mass standard. (C) Swarming motility of the oprD mutant
strains. WT PA14, Tn-oprD::Spleen, and Tn-oprD::Spleen (PoprD) strains showed normal motility, whereas the PA14_Tn-pilE strain lacking pili has defective
motility and the PA14_Tn-fliC strain has no motility.

Skurnik et al. PNAS Early Edition | 3 of 6


the basis for enhanced fitness for GI colonization of oprD
mutants in mice is not the result of a defect in the production of
type IVa pili.
Attempts to mark WT P. aeruginosa PA14 with either strep-
tomycin or tetracycline resistance for in vivo tracking resulted in
a diminution in their ability to colonize the murine GI tract in
comparison with unmarked WT P. aeruginosa PA14 (Fig. S6),
emblematic of the fitness cost usually attributed to the acquisi-
tion of antibiotic resistance (6). Thus, to compare the oprD-
deficient strains with WT PA14, the unmarked WT strain and the
oprD-deficient strains (gentamicin resistant) or the WT and
PoprD-complemented strains (also gentamicin resistant) were
mixed together in drinking water at a ratio of ∼1:1 and the rel-
ative levels of WT and mutant strains in the output samples were
determined by plating cultures on LB agar and LB agar with 15
mg gentamicin per L. We subtracted the colony forming units
(cfu) determined from the latter plates from those on the non-
selective plates to obtain the level of colonization with WT
P. aeruginosa PA14. This ratio was further confirmed by sub-
culturing 100 separate colonies that grew on the LB-agar plates
with and without gentamicin. Analysis of the oprD gene by PCR Fig. 3. Analysis of the fitness for cecal colonization and systemic dissemi-
for each gentamicin-resistant colony confirmed that they were nation of the oprD mutant strains. (A) Ratio of cecal colonization between
oprD mutants and not spontaneous gentamicin-resistant strains. indicated oprD mutant strain and a strain with intact oprD. (B and C) In vivo
A similar approach was used to differentiate between oprD-de- competitive index (CI) for GI tract colonization (B) and systemic dissemina-
tion (C) of the PA14 oprD mutants 6-4 and 8-1 versus WT and of the oprD
ficient and PoprD-complemented strains, however, carbapenem
mutant clinical strains 48-2 and 51-2 versus a related strain with intact oprD
plates were used instead of gentamicin plates as both strains (48-1 and 51-1, respectively). Each point represents the CI for a single mouse.
were gentamicin resistant. The medians are shown as a solid line. A CI > 1 indicates increased fitness.
Comparing selective fitness during cecal colonization of the P. aeruginosa strains with an intact oprD gene were rarely recovered (0–5%)
PA14_Tn-oprD::Spleen isolate with the WT PA14 strain and the from the cecum and, consequentially, rarely recovered from the spleen when
complemented PA14_Tn-oprD::Spleen (PoprD) strains revealed in competition with oprD mutants.
that the PA14_Tn-oprD::Spleen strain out-competed both the
WT and complemented strains, constituting >90% of the isolates
recovered from the cecum (Fig. 3A). Comparing the WT PA14 We next evaluated several phenotypes that could be related to
strain and complemented PA14_Tn-oprD::Spleen (PoprD) strains the oprD deficiency and account for the increased in vivo fitness
in the cecal colonization setting showed that both colonized the of the oprD mutants by analyzing in vitro survival of WT PA14 or
mice at comparable levels (Fig. 3A), supporting the conclusion Tn-insertion mutants in the presence of major host innate im-
that the loss of expression of OprD conferred an in vivo GI col- mune factors in the serum (21), as well as survival in the acidic
onization advantage to the PA14_Tn-oprD::Spleen strain over conditions found in the GI tract (pH∼5 in mice) (22). After 180
the WT PA14 (Fig. 3A). No effect of the empty vector used min in 50% serum, all of the strains lacking OprD survived better
for complementation was found in the GI colonization model than their isogenic or related parental or trans-complemented
(Fig. S7). partners containing an intact oprD gene (Fig. 4A). Similarly,
Further confirmation that loss of OprD enhanced GI coloni- except for one strain (CS23 strain), all of the clinical strains with
zation was obtained by evaluating the competitive colonization a low level of oprD transcription were significantly more resistant
efficacies of WT PA14 against the two carbapenem-resistant to serum-mediated killing compared with the clinical strains
strains from the ordered Tn library, PA14_Tn-oprD:6-4 and with a high level of oprD transcription (Fig. 4A). All of the oprD
PA14_Tn-oprD:8-1. The PA14_Tn-oprD:6-4 and PA14_Tn-oprD:8-1 mutant strains tested were found to survive better at pH 5 than
strains were stronger cecal colonizers than the PA14 WT strain. isogenic or related strains with an intact oprD gene (Fig. 4B).
Following induction of neutropenia, more than 90% of the Furthermore, the PA14_Tn-oprD::Spleen strain displayed higher
isolates recovered from the spleen were oprD mutants (Fig. 3 B levels of cytotoxicity against murine macrophages than either this
and C). Comparative analysis of the competitive colonization mutant complemented with PoprD or to the PA14 WT strain
capacities of the P. aeruginosa clinical isolates with an intact (Fig. 4C).
oprD gene, 48-1 and 51-1 with their corresponding related oprD To define a mechanism that could explain all these phenotypes
mutants, 48-2 and 52-2, showed the oprD mutants constituted associated with oprD deficiency, we used RNA-seq (23) to de-
>95% of the recovered strains (Fig. 3 B and C). Thus, in all termine the transcriptional profiles of WT PA14 and PA14_Tn-
circumstances, loss of OprD and the consequent acquisition of oprD::Spleen strains after in vitro growth. As shown Fig. 5, the
carbapenem resistance resulted in enhanced GI colonization PA14 in vitro transcriptome was quite uniform in that it showed
and systemic dissemination during neutropenia. To ascertain little variability throughout the whole genome. In contrast, the
whether the overrepresentation of the oprD mutants was not PA14_Tn-oprD::Spleen transcriptome showed considerable var-
merely due to enhanced survival as opposed to enhanced fitness iability with elevated and reduced transcriptional levels detected
of these strains, we colonized antibiotic-treated mice with in many different chromosomal locations compared with WT
monocultures of either WT PA14 or streptomycin- or tetracy- PA14 (Fig. 5). In total, 97 genes that were clearly transcribed in
cline-resistant variants, or with the PA14_Tn-oprD::Spleen WT PA14 were transcriptionally silent in PA14_Tn-oprD::Spleen
strain, and found no difference in the levels of any of these when grown in vitro (Dataset S2). In contrast, 60 genes had
variants in the ceca after 6 d of colonization (Fig. S8). Thus, in transcription levels increased more than 10-fold in the PA14_Tn-
the absence of competition from the OprD-deficient strains, oprD::Spleen strain compared with WT PA14 (Dataset S3).
WT strains were able to achieve levels of GI colonization com- Interestingly, increases in transcript levels were not found
parable to that of the oprD mutants. for the genes encoding most known virulence factors in the

4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110 Skurnik et al.


MICROBIOLOGY
Fig. 4. Phenotypes associated with increased in vivo fitness of oprD mutant strains. (A) Resistance to the antibacterial action of serum of P. aeruginosa strains
with or without oprD deficiencies. OprD deficiency was confirmed by assessing the level of OprD expression (Fig. 2A) or the level of oprD mRNA transcription
(strains CS1–S23; Dataset S1). The P values were determined by t test. (B) Survival for 60 min at pH 5 of either WT P. aeruginosa strains or those with mutations
in the oprD gene. Bars indicate mean percent survival compared with isogenic or related strains with intact oprD. Error bars indicate a single SD of the data.
*P value of less than 0.05 (t test) between the oprD intact and mutant strains; **P value of less than 0.05 between the oprD mutant and isogenic or related
oprD complemented strain. (C) Role of the oprD gene in the cytotoxicity of PA14 against murine macrophages after 1 h of incubation. Two multiplicities of
infection were tested: 20:1 (Upper) and 100:1 (Lower). The PA14 ΔexoU strain was used as a negative control. Error bars indicate the SD of the data.

P. aeruginosa genomes (www.mgc.ac.cn/VFs/main.htm). To vali- rhamnolipids, pyochelin, pyoverdin, and pyocyanin (Dataset S4).
date RNA-seq results, we performed individual qRT-PCR deter- Overall, transcriptional changes in genes needed for production
minations that confirmed the lack of significant increases in the of well-established P. aeruginosa virulence factors did not ac-
transcription level between the WT PA14 and the PA14_Tn- count for the enhanced fitness of OprD-deficient strains in GI
oprD::Spleen strains for genes representative of the following colonization and dissemination. Thus, either the other tran-
virulence factors: type 1, 2, 3, and 6 secretion systems, type IVa scriptional differences seen in the oprD mutant contributed to
enhanced in vivo fitness or, alternatively, the loss of OprD itself
and IVb pili, exopolysaccharides alginate, PEL, and LPS, as well
causes posttranscriptional changes in phenotypic properties that
as rhl, quinolone quorum-sensing systems and adhesins, flagellins, enhance colonization and dissemination in the host.
We also examined published studies to ascertain if infections
with oprD-mutant, carbapenem-resistant P. aeruginosa strains
were associated with worse clinical outcomes. We hypothesized
that the observed increased fitness of the oprD mutant strains in
laboratory settings could be associated with more severe clinical
outcomes in human infections. Peña et al. (24) reported signifi-
cantly greater mortality after 7 and 30 d of infection in patients
with carbapenem-resistant P. aeruginosa bloodstream infections,
of which ∼95% were due to oprD mutations (25). In a related
analysis, Cabot et al. (26) found that oprD mutations underlay
the acquisition of high-risk infections due to extensively drug-
resistant P. aeruginosa infections. In addition, a recent study
analyzing different mechanisms of antibiotic resistance that oc-
cur in clinical isolates of P. aeruginosa causing severe blood-
stream infections concluded that acquisition of resistance did not
lead to decreased fitness (27). Consistent with the observations
reported here that mutations in the oprD gene in P. aeruginosa
can increase fitness for infection, other studies have reported
that oprD-inactivating mutations can arise in the absence of
carbapenem treatment (28), suggestive of a survival benefit
conferred by OprD loss. Notably, some oprD mutations occur in
Fig. 5. Global analysis of transcript levels in PA14 WT and Pa14_Tn-oprD::
isolates with MICs to imipenem or meropenem of 0.06–4 μg/mL,
Spleen by RNA-seq. Sequencing reads for each of the 5,977 genes of PA14
WT (blue dots) or PA14_Tn-oprD::Spleen (green dots) corresponding to the
considered to be within the susceptible range (25), suggesting
transcript expression of each gene of these two strains grown in LB. A total that increased fitness and full carbapenem resistance may be sep-
of 97 genes expressed in PA14 WT were not expressed in PA14_Tn-oprD:: arable properties of the OprD protein. This might be explained
Spleen strain. by the findings of Eren et al. (29) who reported that multiple

Skurnik et al. PNAS Early Edition | 5 of 6


outer-membrane carboxylate channels (Occ) like OprD with the findings might impact decisions related to infection control
different substrate specificities are found among various Gram- and treatment of P. aeruginosa infections. Thus, a careful evalu-
negative bacteria, raising the possibility that some strains of ation might need to be made regarding the empiric use of car-
P. aeruginosa might possess additional Occ channels involved in bapenems in hospitals, particularly in intensive care units and
carbapenem uptake. hematology departments, if there is a potential that treatment of
Although almost all prior reports indicated no obvious fitness patients with suspected but unconfirmed P. aeruginosa infection
cost for causing severe infections by OprD deficient/carbapenem- might, in the long run, be more harmful than beneficial.
resistant P. aeruginosa, our studies suggest there might be en-
hanced in vivo fitness of P. aeruginosa as a result of acquisition of Materials and Methods
oprD-inactivating mutations. Mechanistically, this is likely due to be The murine model of GI tract colonization and systemic dissemination by
the collective properties of OprD-deficient P. aeruginosa including P. aeruginosa and the DNA preparation for Illumina sequencing were as
enhanced serum resistance, a better ability to survive in hostile described (8, 14). The PFGE was interpreted according to previously used
environments such as the acidic pH of the stomach, increased cy- criteria (20). The bacterial OMPs were detected by SDS/PAGE. Twitching
totoxicity against phagocytes, and other yet-to-be-discovered prop- motility was assessed using 1.5% agar LB plates and swarming assays per-
erties contributing to enhanced fitness. Notably, OprD-deficiency formed using supplemented fresh plates of M9 minimal medium. The serum
does not appear to confer any enhanced fitness in noninfectious killing experiments were performed with pooled human serum. The cyto-
settings, as a previous study (30) on 328 unrelated P. aeruginosa toxicity experiments used RAW264.7 cells. The library for the RNA-seq was
isolates from 69 localities in 30 countries on five continents col- prepared using Encore Complete Prokaryotic RNA-Seq DR Multiplex Systems
lected from diverse clinical (human and animal) and environmental kit (NuGEN), and cDNA fragmentation was done using Qsonica Sonicator
habitats over the last 125 y found no OprD-deficient strains among Q800R. A full description of methods is available in SI Materials and Methods.
environmental isolates. However, the prevalence of OprD-deficient Bacteria, plasmids, and primers used in this study are presented in Tables S1
strains in CF and non-CF patients from the same study was 16% and S2 and Dataset S5.
and 10%, respectively.
In a broader context, our findings imply that carbapenem ACKNOWLEDGMENTS. This work was supported by National Institutes of
treatment and the consequent selection of P. aeruginosa oprD Health Grants R01 AI022535 (to G.B.P.), R37 AI021451 (to S.L.), and
AI26289 (to J.J.M.). D.R. was a recipient of grants from the AXA Research
mutant strains can lead to enhanced in vivo fitness and potentially Fund, the Fondation pour la Recherche Médicale, and the Société de Réan-
to an increase in virulence. If additional studies validate an in- imation de Langue Française. D.R.Y.-H. was a recipient of a postdoctoral
creased fitness and/or virulence of OprD-deficient P. aeruginosa, fellowship from the Cystic Fibrosis Foundation.

1. Kaki R, et al. (2011) Impact of antimicrobial stewardship in critical care: A systematic 17. Montor WR, et al. (2009) Genome-wide study of Pseudomonas aeruginosa outer
review. J Antimicrob Chemother 66(6):1223–1230. membrane protein immunogenicity using self-assembling protein microarrays. Infect
2. Sabuncu E, et al. (2009) Significant reduction of antibiotic use in the community after Immun 77(11):4877–4886.
a nationwide campaign in France, 2002-2007. PLoS Med 6(6):e1000084. 18. Winsor GL, et al. (2011) Pseudomonas Genome Database: Improved comparative
3. Levin BR (2001) Minimizing potential resistance: A population dynamics view. Clin analysis and population genomics capability for Pseudomonas genomes. Nucleic Acids
Infect Dis 33(Suppl 3):S161–S169. Res 39(Database issue):D596–D600.
4. Andersson DI (2006) The biological cost of mutational antibiotic resistance: Any 19. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aerugi-
practical conclusions? Curr Opin Microbiol 9(5):461–465. nosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):
5. Randall LP, et al. (2008) Fitness and dissemination of disinfectant-selected multiple- 2833–2838.
20. Tenover FC, et al. (1995) Interpreting chromosomal DNA restriction patterns pro-
antibiotic-resistant (MAR) strains of Salmonella enterica serovar Typhimurium in
duced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin
chickens. J Antimicrob Chemother 61(1):156–162.
Microbiol 33(9):2233–2239.
6. Andersson DI, Hughes D (2010) Antibiotic resistance and its cost: Is it possible to re-
21. Mishra M, et al. (2012) Pseudomonas aeruginosa Psl polysaccharide reduces neutro-
verse resistance? Nat Rev Microbiol 8(4):260–271.
phil phagocytosis and the oxidative response by limiting complement-mediated
7. Folkesson A, et al. (2012) Adaptation of Pseudomonas aeruginosa to the cystic fibrosis
opsonization. Cell Microbiol 14(1):95–106.
airway: an evolutionary perspective. Nat Rev Microbiol 10(12):841–851. 22. McConnell EL, Basit AW, Murdan S (2008) Measurements of rat and mouse gastro-
8. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish intestinal pH, fluid and lymphoid tissue, and implications for in-vivo experiments.
a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289. J Pharm Pharmacol 60(1):63–70.
9. Skurnik D, et al. (2013) A comprehensive analysis of in vitro and in vivo genetic fitness 23. Cattoir V, et al. (2013) Transcriptional response of mucoid pseudomonas aeruginosa
of pseudomonas aeruginosa using high-throughput sequencing of transposon to human respiratory mucus. mBio 3(6): e00410-e00412.
libraries. PLoS Pathog 9(9):e1003582. 24. Peña C, et al.; Spanish Network for Research in Infectious Diseases REIPI (2012) Pro-
10. Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ (2013) Identification of T6SS-dependent spective multicenter study of the impact of carbapenem resistance on mortality in
effector and immunity proteins by Tn-seq in Vibrio cholerae. Proc Natl Acad Sci USA Pseudomonas aeruginosa bloodstream infections. Antimicrob Agents Chemother
110(7):2623–2628. 56(3):1265–1272.
11. Gawronski JD, Wong SM, Giannoukos G, Ward DV, Akerley BJ (2009) Tracking in- 25. Ocampo-Sosa AA, et al. (2012) Alterations of oprd in carbapenem-intermediate
sertion mutants within libraries by deep sequencing and a genome-wide screen for and -susceptible strains of Pseudomonas aeruginosa isolated from patients with
Haemophilus genes required in the lung. Proc Natl Acad Sci USA 106(38): bacteremia in a Spanish multicenter study. Antimicrob Agents Chemother 56(4):
1703–1713.
16422–16427.
26. Cabot G, et al.; Spanish Network for Research in Infectious Diseases (REIPI) (2012)
12. Tancrède CH, Andremont AO (1985) Bacterial translocation and gram-negative bac-
Genetic markers of widespread extensively drug-resistant Pseudomonas aeruginosa
teremia in patients with hematological malignancies. J Infect Dis 152(1):99–103.
high-risk clones. Antimicrob Agents Chemother 56(12):6349–6357.
13. Lee DG, et al. (2006) Genomic analysis reveals that Pseudomonas aeruginosa virulence
27. Hocquet D, et al. (2007) Pseudomonas aeruginosa may accumulate drug resistance
is combinatorial. Genome Biol 7(10):R90.
mechanisms without losing its ability to cause bloodstream infections. Antimicrob
14. Koh AY, Priebe GP, Pier GB (2005) Virulence of Pseudomonas aeruginosa in a murine
Agents Chemother 51(10):3531–3536.
model of gastrointestinal colonization and dissemination in neutropenia. Infect 28. Wolter DJ, et al. (2008) Emergence of carbapenem resistance in Pseudomonas aeru-
Immun 73(4):2262–2272. ginosa isolates from a patient with cystic fibrosis in the absence of carbapenem
15. Burrows LL (2012) Pseudomonas aeruginosa twitching motility: Type IV pili in action. therapy. Clin Infect Dis 46(12):e137–e141.
Annu Rev Microbiol 66:493–520. 29. Eren E, et al. (2012) Substrate specificity within a family of outer membrane car-
16. Kal AJ, et al. (1999) Dynamics of gene expression revealed by comparison of serial boxylate channels. PLoS Biol 10(1):e1001242.
analysis of gene expression transcript profiles from yeast grown on two different 30. Pirnay JP, et al. (2009) Pseudomonas aeruginosa population structure revisited. PLoS
carbon sources. Mol Biol Cell 10(6):1859–1872. ONE 4(11):e7740.

6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1221552110 Skurnik et al.


Supporting Information
Skurnik et al. 10.1073/pnas.1221552110
SI Materials and Methods that are compared. All P values were adjusted for multiple com-
Murine Model of Gastronintestinal Tract Colonization and Systemic parisons using Bonferroni correction.
Dissemination by Pseudomonas aeruginosa. C3H/HeN mice (female
6–8 wk old) were housed in groups of four in sterilized cages Prevalence of the oprD Mutants in Water After 72 h. The bank of
equipped with filter hoods. As described previously (1), mice PA14 mutants was suspended in water, and after 72 h, an aliquot
(n = 8) received streptomycin (2 mg/mL) and penicillin (1,500 plated on LB with or without 3 μg imipenem/mL. The presence of
UI/mL) in sterile drinking water for 5 d to reduce the levels of a Tn inserted in the oprD gene in the mutants able to grow on
the indigenous microbiota. The plasmid pSAMDGm (2), (3) imipenem-containing media was confirmed by PCR.
derived from pSAMBt (4) was used to create a TnSAMDGm The prevalence of the Tn-oprD mutants in the water after 72 h
transposon (Tn) mutant library of 300,000 mutants in P. aerugi- was determined by determining the ratio of the colony forming units
nosa PA14. One aliquot of the of PA14 Tn insertions library was (cfu) growing on LB to the cfu growing on LB with imipenem.
grown overnight in lysogeny broth (LB) (5) containing 15 mg
Competitive Assays. To assess the in vivo fitness of PA14 mutants, we
gentamicin/L and then added to sterile water containing peni-
obtained selected PA14 mutants from the PA14 Non-Redundant
cillin (1,500 UI/mL) and gentamicin (15 mg/L). The PA14 Tn-
Transposon Insertion Mutant Set (7). The insertion sites for each Tn
insertion population was administered to mice via drinking water were confirmed by PCR. The GI tract decontamination described
for 6 d. To maintain the level of PA14 Tn insertions, the water above using penicillin-streptomycin in the drinking water was used
was changed after 72 h. After 6 d, the drinking water was ex- on four mice for each competition experiment. The drinking water
changed for sterile water containing penicillin (1,500 UI/mL) was replaced with penicillin water containing a 1:1 ratio of WT
and gentamicin (15 mg/L) until the end of the experiment. Mice PA14 and a single PA14 Tn-mutant (5 × 107 cfu/mL for each strain)
were colonized in two different groups: the gastrointestinal (GI) for 6 d. Mice were then given sterile drinking water with penicillin
colonization group and the dissemination group. For ascertaining alone, and 24 h later the mice were euthanized and the ceca har-
the Tn insertions surviving the colonization period, mice (n = 4) vested. Serial dilutions were plated on LB agar with or without
were euthanized and ceca harvested 24 h after the exchange for antibiotics. To evaluate the final ratio of PA14 mutants (gentamicin
sterile water. To induce systemic dissemination, mice (n = 4) were resistant) and WT PA14 (gentamicin susceptible), the samples were
injected on the same day sterile water was provided with 250 μg of plated on LB agar and LB agar with 15 mg gentamicin/L. We
the neutrophil-depleting rat IgG2 monoclonal antibody RB6-8C5 subtracted the cfu determined from the latter plates from those on
that targets the Ly6G antigen. This dose of antibody renders mice the nonselective plates to obtain the level of colonization with WT
severely neutropenic (polymorphonuclear leukocyte counts <100) P. aeruginosa PA14. This ratio was further confirmed by sub-
for 5 d (1). When moribund (or 48 h after antibody injection), culturing 100 individual colonies that grew on the LB-agar plates on
neutropenic mice were killed and spleens harvested, homogenized plates with and without gentamicin. Analysis of the oprD gene by
in LB containing 15 mg gentamicin/L and grown overnight at 37 °C. PCR for each gentamicin-resistant colony confirmed that they were
Genomic DNA was extracted from each sample of the initial and oprD mutants and not spontaneous gentamicin-resistant strains. LB
recovered bacterial populations using QIAamp DNA Mini Kit agar with or without imipenem (3 mg/L) were used to distinguish
(Qiagen), quantified, and stored at −20 °C. between the mutated oprD isolates from the WT oprD isolates,
when complemented strains (gentamicin resistant) were in compe-
DNA Preparation for Illumina Sequencing. Illumina libraries were tition with gentamicin-resistant mutants or when the two pairs of
prepared as described (4) with the following exceptions: 20 μg of clinical P. aeruginosa isolates, confirmed to be related by pulse-field
DNA from all samples were used at the start of library prepa- gel electrophoresis (PFGE) (see section PFGE), were in competi-
ration; DNA was concentrated using a Speed-vac before gel tion. The competitive index (CI) was defined as the ratio of cfu for
loading and extraction; DNA from 1.2 to 1.5 kb was gel-extracted the mutant compared with the cfu obtained for the WT strain in the
for further processing; and Kapa BioSystems High Fidelity output sample.
Polymerase was used in the final PCR amplification step.
Selection of oprD Mutants from the PA14 Random Tn-Insertion Bank.
Determination of the Sequences at the Tn-Insertion Sites. All sequences Homogenized spleens from the neutropenic mice were streaked
retrieved from the Illumina sequencing reactions were trimmed to onto LB plates with gentamicin, and isolated colonies were
eliminate those reads with quality scores less than 0.05 and/or screened for a Tn insertion into the oprD gene by PCR amplifi-
sequences with ambiguous nucleotides. All trimmed sequences from cation of the entire oprD gene. Insertion of TnSAMDGm within
the LB and cecum and spleen output samples were mapped on the the oprD gene would result in a 1.7-kb increase in the size of the
annotated genome of P. aeruginosa strain PA14, from -120 nu- 1.8-kb PCR product obtained from the WT oprD gene. This al-
cleotides (to include promoter regions) to the end of each ORF. lowed us to identify Tn-oprD mutants in the spleen samples.
Ambiguous reads were excluded, and no mismatches were allowed
for the mapping. P. aeruginosa Clinical Isolates. Two pairs of clinical isolates, each
containing an imipenem-susceptible variant and an imipenem-
Statistical Analysis. Data were analyzed using the RNA-sequencing resistant variant, were used. These strains were isolated in 2011 at
(RNA-seq) module of the Bioinformatics Workbench software the University Hospital, Caen, France. One pair was isolated
package (CLC; www.clcbio.com/index.php?id=1240). For each from the same stool specimen of a patient hospitalized in the
Tn insertion, the significance of the difference in proportion of Hematology Department, whereas the second pair was isolated
reads from one environment to the other (LB to cecum and then from the same respiratory-tract specimen of a patient hospital-
cecum to spleen) was estimated using the statistical test defined ized in the medical intensive care unit. Sequencing of the oprD
by Kal et al. (6). The test is based on a statistical score Z that genes confirmed that the imipenem-susceptible strains had a WT
follows a normal distribution under the null hypothesis of no oprD gene, whereas the imipenem-resistant isolates had mutated
difference in proportions of read between the two environments oprD sequences. A total of 22 other clinical strains were also

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 1 of 8


selected from the same Institute. The level of oprD transcription containing the intact oprD gene from WT PA14 using the pri-
in these strains was determined by quantitative (q)RT-PCR. The mers oprD_compF and oprD_compR. The oprD gene was
study was approved by the Institutional Review Board of the cloned into mini-CTX1 (11) as a EcoRI–HindIII fragment, re-
Caen University Hospital, and informed consent was obtained in sulting in CTX1-oprD, and transformed into E. coli Sm10λpir
accordance with the Declaration of Helsinki. with selection on LB agar containing tetracycline (10 mg/L).
Following sequencing, CTX1-oprD was conjugated into the
qRT-PCR. From bacteria grown to late-exponential growth phase in P. aeruginosa oprD mutant strains as described above. The oprD
LB, total RNA was extracted using the ZR Fungal/Bacterial RNA mutants complemented with CTX1-oprD were selected on LB
MiniPrep Kit (Zymo Research) as recommended by the manu- agar containing irgasan (25 mg/L) and tetracycline (75 mg/L).
facturer. Residual chromosomal DNA was removed by treating Complementation was verified by PCR and OMP analysis and
samples with the TURBO DNA-free kit (Life Technologies). tested for imipenem susceptibility by Etest.
DNase-treated RNA samples were quantified using a BioSpec-
nano spectrophotometer (Shimadzu) and the integrity (RNA Overexpression of the OprD in P. aeruginosa. To construct the OprD
Integrity Number > 8) was assessed using the Agilent 2100 Bi- overexpressing vector, the oprD gene from strain PA14 con-
oanalyzer. qRT-PCR experiments were performed using the taining its own Shine–Dalgarno sequences was cloned into
QuantiFast SYBR Green RT-PCR Kit (Qiagen) and the CFX pMMB67EH using In-Fusion HD Cloning Kit (Clontech Labo-
Connect Real-Time PCR Detection System (Bio-Rad Labora- ratories, Inc.), transformed into E. coli DH5α, and mobilized
tories) according to manufacturers’ recommendations. Tran- into P. aeruginosa PA14. OprD protein was overexpressed at late
script levels in each sample were determined using gyrB and oprL exponential growth phase by adding 2 mM (final) of isopropyl
as housekeeping reference genes. Each experiment was per- thiogalactoside for 30 min at 37 °C.
formed in triplicate. Primers used are presented in Dataset S5.
Isolation of Tetracycline- and Streptomycin-Resistant Mutants. To
PFGE. PFGE analysis of genomic DNA fragments of the clinical create a tetracycline-resistant variant of strain PA14, the tetA
isolates was carried out after digestion with the restriction en- gene was inserted between PA14_59170 and PA14_51960 on the
donuclease SpeI, the electrophoresis was performed with a Pseusomonas aeruginosa Pathogenicity Island (PAPI)-1 island.
CHEF-DRIII apparatus (Bio-Rad), and PFGE patterns were The PA14 streptomycin-resistant mutant was obtained by se-
interpreted according to previously used criteria (8). lection during passage on LB agar plates containing increasing
concentrations of streptomycin.
Outer-Membrane Protein Analysis. Bacterial outer-membrane pro-
teins (OMPs) were detected by SDS/PAGE as previously described Measurements of Growth Kinetic. P. aeruginosa strain PA14 WT,
(9). Briefly, bacterial cells were broken by sonication, and mem- Tn insertions in the oprD gene, Tn_oprD-6–4 and Tn_oprD-8–1,
branes were collected by ultracentrifugation at 100,000 × g for 1 h. the Tn_oprD::Spleen strain, and the Tn_oprD::Spleen strain
The inner membrane was solubilized with 1% sodium N-laur- complemented with an empty vector [Tn_oprD::Spleen(EV)] or
oylsarcosinate. Proteins in the outer membrane were separated by with the cloned oprD gene [Tn-oprD::Spleen(PoprD)] were ini-
SDS/PAGE and gels were stained with Comassie blue or Pierce tially grown on LB agar, then cells from these plates were used to
Silver Stain Kit (Thermo) for visualization. inoculate LB medium that was placed at 37 °C with shaking at
250 rpm. The OD650 nm was recorded every 30 min.
Imipenem Etest. Minimal inhibitory concentrations of imipenem
were determined by using the Etest method (BioMérieux) ac- Twitching Motility and Swarming Assays. Twitching motility was
cording to the manufacturer’s recommendations. assessed using 1.5% agar LB plates dried for 3 h at 37 °C. Strains
were inoculated at the very bottom of the LB plates and in-
Construction of the P. aeruginosa PA14 oprD Knock-Out Mutant. The cubated at 37 °C for 24 h and then left at room temperature.
oprD-deletion mutant (PA14 ΔoprD) was derived from WT PA14 Swarming assays were performed using fresh plates of M9 min-
using the replacement vector pEXG2 as described previously imal medium supplemented with amino acids (0.5%), dextrose
(10). Two fragments flanking the oprD gene were amplified by (11 mM), CaCl2 (1 mM), and MgSO4 (1 mM) and solidified with
PCR with oprD_del primers (F1 and R1 for the upstream agar (0.5%).
fragment and F2 and R2 for the downstream fragment; Tables
S1 and S2) using chromosomal DNA of PA14 as template. pH Sensitivity. Strains were grown overnight in LB medium at 37 °C
Overlap-extension PCR was used to assemble these segments in a for 20 h with shaking. Bacteria were diluted 1:200 to an OD650 nm
second reaction mixture by using upstream forward (oprD_del-F1- of 0.4 in HBSS+0.1% gelatin (∼5 × 105 cfu/mL), adjusted to pH 5
HindIII) and downstream reverse primers (oprD_del-R2-XbaI). or pH 7 with HCl or sodium hydroxide, respectively, and in-
The fusion product was cloned into pEXG2 as HindIII–XbaI cubated for 60 min at 37 °C with rotation. Serial dilutions of the
fragment, resulting in pEXG2-oprDdel, and transformed in Es- samples were spread on LB plates and counted after overnight
cherichia coli Sm10λpir with selection on LB agar containing growth at 37 °C.
gentamicin (15 mg/L). For the isolation of a PA14 ΔoprD mutant,
pEXG2-oprDdel was transferred from E. coli Sm10λpir into PA14 Serum Killing. Strains were grows in LB harvested during early
by conjugation, followed by selection of gentamicin-resistant PA14 logarithmic phase (OD650 = 0.4) and adjusted in physiological
colonies on LB agar containing gentamicin (15 mg/L) and irgasan saline to ∼2 × 106 bacteria per mL (dilution ∼1:100). Each strain
(25 mg/L). The merodiploid gentamicin-resistant PA14 strain was was incubated in pooled human serum (final concentration of
then streaked on LB agar containing 6% sucrose. Sucrose-re- the sera: 50%) for 180 min at 37 °C with rotation. Serial dilutions
sistant colonies were tested to confirm gentamicin susceptibility of the different samples were spread onto LB plates and cfu
that confirmed excision from the genome of the pEXG2 back- counted after overnight growth at 37 °C.
bone. The oprD deletion was confirmed by PCR (Tables S1 and
S2), OMP analysis (Outer-Membrane Protein Analysis), and tested Cytotoxicity Experiments. RAW264.7 cells (ATCC TIB-71) were
for imipenem-resistance by Etest (Imipenem Etest). grown in DMEM supplemented with 2 mM L-glutamine, 100 U/mL
penicillin, 100 μg/mL streptomycin, and 10% heat-inactivated FBS.
Single-Copy Complementation of oprD Mutants. Complementation Cells were maintained at 37 °C and 5% CO2. Host cells were
was achieved by amplifying a 1.6-kb EcoRI–HindIII fragment seeded in 24-well plates at a density of 2 × 105 cells per well in

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 2 of 8


drug-free media. The following day the cells were washed two recommendations. DNaseI treatment was performed to remove
times with PBS and infected with P. aeruginosa strains that were DNA traces. The quality of RNA was analyzed using NanoDrop
grown in LB until early logarithmic phase and washed with DPBS. 1000 (Thermo Scientific). An RNA-seq library was prepared
Multiplicity of infection of 20 or 100 were used. Cytotoxicity was using Encore Complete Prokaryotic RNA-Seq DR Multiplex
assessed using CytoTox 96 Non-Radioactive Cytotoxicity Assay Systems kit (NuGEN) according to manufacturer instructions.
(Promega). Uninfected cells, as well as cells infected with the cDNA fragmentation was done using Qsonica Sonicator Q800R.
PA14 ΔexoU strain, were used as negative controls. A positive Sequencing was performed using Illumina HiSeq2000 platform
control (i.e., 100% death) were noninfected macrophages lysed in the Biopolymers core facility at Harvard Medical School. CLC
with Lysis Solution. Experiments were performed in quadruplicate Genomics Workbench software was using to map RNA reads to
and repeated twice. Representative experimental results are shown PA14 genomic DNA.
as means ± SD.
Circos Plot Figures. Circos figures were drawn following the instruc-
RNA Extraction and RNA-Seq of P. aeruginosa PA14 WT and PA14_Tn tions provided at www.circos.ca.
oprD::Spleen. RNA was extracted from three independent repli-
cates of WT P. aeruginosa PA14, and the Tn-oprD::Spleen strain Ethics Statement. All animal studies conducted in this research
grown to early log phase in LB. The RiboPure-Bacterial Kit were approved by the Harvard Medical Area Institutional Animal
(Invitrogen) was used for RNA purification per manufacturer Care and Use Committee under protocol number 02791.

1. Koh AY, Priebe GP, Pier GB (2005) Virulence of Pseudomonas aeruginosa in a murine 7. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aeruginosa
model of gastrointestinal colonization and dissemination in neutropenia. Infect strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):2833–2838.
Immun 73(4):2262–2272. 8. Tenover FC, et al. (1995) Interpreting chromosomal DNA restriction patterns produced
2. Skurnik D, et al. (2013) A comprehensive analysis of in vitro and in vivo genetic fitness by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin Microbiol
of pseudomonas aeruginosa using high-throughput sequencing of transposon libraries. 33(9):2233–2239.
PLoS Pathog 9(9):e1003582. 9. Masuda N, Sakagawa E, Ohya S (1995) Outer membrane proteins responsible for
3. Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ (2013) Identification of T6SS- multiple drug resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother
dependent effector and immunity proteins by Tn-seq in Vibrio cholerae. Proc Natl 39(3):645–649.
Acad Sci USA 110(7):2623–2628. 10. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP (1998) A broad-host-range
4. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish Flp-FRT recombination system for site-specific excision of chromosomally-located DNA
a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289. sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants.
5. Bertani G (2004) Lysogeny at mid-twentieth century: P1, P2, and other experimental Gene 212(1):77–86.
systems. J Bacteriol 186(3):595–600. 11. Hoang TT, Kutchma AJ, Becher A, Schweizer HP (2000) Integration-proficient plasmids
6. Kal AJ, et al. (1999) Dynamics of gene expression revealed by comparison of serial for Pseudomonas aeruginosa: Site-specific integration and use for engineering of
analysis of gene expression transcript profiles from yeast grown on two different reporter and expression strains. Plasmid 43(1):59–72.
carbon sources. Mol Biol Cell 10(6):1859–1872.

Fig. S1. Growth curves in LB medium of WT P. aeruginosa PA14, mutants of PA14 with a Tn inserted in the oprD gene (PA14_Tn-oprD::Spleen, PA14_Tn-
oprD:8-1 and PA14_Tn-oprD:6-4), and PA14 oprD mutant strain complemented with an empty vector [PA14_Tn-oprD::Spleen(EV)] or the oprD gene [PA14_Tn-
oprD::Spleen(PoprD)].

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 3 of 8


Fig. S2. (A) PFGE of clinical strains of P. aeruginosa. (B) oprD sequences from two pairs of isogenic clinical strains. The carbapenem-resistant strain 48-2 has
acquired the insertion sequence element IS Pa1328 (green highlighted portion) and the carbapenem-resistant strain 51-2 has a 12-bp deletion and a single
nucleotide change (yellow highlighted portions) in the oprD gene. M, molecular mass standard.

Fig. S3. Analysis of the OMP expression. OprD protein (arrow) is seen in the outer membrane extracted from WT P. aeruginosa PA14 in the clinical strains 48-1
and 51-1 and in the complemented (PoprD) strains. No difference in expression in the other OMPs from related strains was seen.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 4 of 8


Fig. S4. Swarming of P. aeruginosa strain with intact oprD (strains PA14 WT and clinical strains 48-1 and 51-1), mutated oprD (strains PA14_Tn-oprD:6-4, 8-1,
and clinical strains 48-2 and 51-2), or complemented in trans with the oprD gene (PorpD).

Fig. S5. Twitching motility of P. aeruginosa strains with intact oprD (strains PA14 WT and clinical strains 48-1 and 51-1) mutated oprD (strains PA14_Tn-oprD:6-4, 8-1,
and clinical strains 48-2 and 51-2), or complemented in trans with the oprD gene (PorpD).

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 5 of 8


Fig. S6. Relative competitive fitness of P. aeruginosa PA14 WT strain versus antibiotic-marked PA14 strain for GI tract colonization. Error bars represent the
SD. strep R, streptomycin resistance; tet R, tetracycline resistance.

Fig. S7. Lack of a role for the empty vector in the fitness for the colonization of the GI tract of the mice. Competition in cecal colonization between WT
P. aeruginosa PA14, an oprD Tn-insert recovered from the spleen (PA14_Tn-oprD::Spleen), this oprD_ Tn-insert complemented by an empty vector [PA14_Tn-oprD::
Spleen (EV)], and this oprD Tn insert complemented with oprD gene [PA14_Tn-oprD::Spleen (PoprD)].

Fig. S8. Level of P. aeruginosa present in the ceca of mice singly colonized for 5 d by different strains of P. aeruginosa PA14: PA14WT, PA14 tet R, PA14
streptomycin resistance (strept R), and P14_Tn-oprD::Spleen.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 6 of 8


Table S1. Bacterial strains and plasmids
Strain or plasmid Genotype or phenotype Source

Strains
E. coli
Sm10λpir thi-1 thr-1 leuB26 tonA21 lacY1 supE44 recA integrated RP4-2 Tc::Mu Kmr λpir Ref. 1
P. aeruginosa
PA14 Wild-type strain Ref. 2
PA14 oprD::Tn_6.4 GentR; oprD:: MrT7 at base 318 Ref. 3
PA14 oprD::Tn_6.4 poprD TetR; PA14 oprD::Tn_6.4 attB::CTX1-oprD This study
PA14 oprD::Tn_8.1 Gent; oprD:: MrT7 at base 1144 Ref. 3
PA14 oprD::Tn_8.1 poprD TetR; PA14 oprD::Tn_8.1 attB::CTX1-oprD This study
PA14 oprD::Tn_spleen GentR; oprD::himar, isolated from the spleen output This study
PA14 oprD::Tn_spleen poprD TetR; PA14 oprD::Tn_spleen attB::CTX1-oprD This study
PA14 oprD::Tn_cecum GentR; oprD::himar, isolated from the cecum output This study
PA14 oprD::Tn_cecum poprD TetR PA14 oprD::Tn_cecum attB::CTX1-oprD This study
48.1 ImiS; clinical isolate This study
48.2 ImiR; mutant derived from the strain 48.1, with the ΔISPa1328 inserted at bp 51 This study
relative to the start site of translation
48.2 poprD TetR; 48.2 attB::CTX1-oprD This study
51.1 ImiS; clinical isolate This study
51.2 ImiR-mutant derived from the strain 51.1, with a 12 bp deletion (bases 579–590) This study
and a point mutation at bp 1017 relative to the start site of translation
resulting in a stop codon
51.2 poprD TetR; 48.1 attB::CTX1-oprD This study
PA14ΔoprD PA14 derivative with an in-frame markerless deletion of oprD This study
PA14ΔoprD poprD TetR; PA14ΔoprD attB::CTX1-oprD This study
PA14 pilE::Tn Gent; pilE::MrT7 at base 46 Ref. 3
Plasmids
pSAM_Bt AmpR EryR; suicide delivery vector with mariner transposase himar1c9, Ref. 4
Illumina bridge PCR priming sites (P7), bla, ermG, rp4 oriT/oriR6K
pSAM_DGm AmpR GentR; pSAM_DYH with the gentamicin resistance cassette from pUC19Gm This study
cloned in as a MfeI/XbaI fragment
pEXG2-oprDdel GentR; 1.05 kb fragment composed of sequences flanking 5′ and 3′ ends of oprD, This study
cloned into pEXG2as a HindIII–XbaI fragment
CTX1-oprD TetR; oprD from PA14 cloned into mini-CTX1 at EcoRI–HindIII sites, This study
R R R R S R
Amp , ampicillin resistant; Ery , erythromycin resistant; Gent , gentamicin resistant; Imi , imipenem resistant; Imi , imipenem susceptible; Tet , tetracycline
resistant.

1. Miller VL, Mekalanos JJ (1988) A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in
Vibrio cholerae requires toxR. J Bacteriol 170(6):2575–2583.
2. Rahme LG, et al. (1995) Common virulence factors for bacterial pathogenicity in plants and animals. Science 268(5219):1899–1902.
3. Liberati NT, et al. (2006) An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103(8):2833–2838.
4. Goodman AL, et al. (2009) Identifying genetic determinants needed to establish a human gut symbiont in its habitat. Cell Host Microbe 6(3):279–289.

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 7 of 8


Table S2. Primers
Name Sequence (5′–3′) Position*

Sequencing of oprD and its promoter region


oprD_F CACCTACGCAGATGCGACAT −185
oprD_R GTGACCTCGAACCTGAACAT +1575
oprD-int-F AGACCGCGACCGGCTTCCA +472
oprD-int-R TGGAAGCCGGTCGCGGTCT +491
Deletion of oprD
oprD_del-F1-HindIII AGCGCGAAGCTTAACAGGAGACATGCCGTGGATA −522
oprD_del-R1 TGCCGGGTTTTTTCGTTGCCTGTCGGTCGACACTTTCATTGTGATTGCTCCT +22
oprD_del-F2 AGGAGCAATCACAATGAAAGTGTCGACCGACAGGCAACGAAAAAACCCGGCA +1332
oprD_del-R2-XbaI GCATTGTCTAGAGCCGGTCTGGCTGCGTACAG +1858
Cis complementation of oprD
oprD_compF CCGGAATTCAACTGCTCACCTACGCAGATGCG −192
oprD_compR CGCCCAAGCTTTGGCCCATGTGACCGGTACCTATG +1433
Confirmation of Tn inserts
PA14_pilE_compF CCGGAATTCATGAACCCCTTACGTCTTCTCGCC
PA14_pilE_compR CGCCCAAGCTTTTGCCTTTTTCTTGTCTCGGCGC

Restriction sites are underlined. F, forward; R, reverse.


*Position according to the first nucleotide of the oprD coding sequence.

Other Supporting Information Files

Dataset S1 (XLSX)
Dataset S2 (XLSX)
Dataset S3 (XLSX)
Dataset S4 (XLSX)
Dataset S5 (XLSX)

Skurnik et al. www.pnas.org/cgi/content/short/1221552110 8 of 8