Infection with Anaplasma phagocytophilum Activates the Phosphatidylinositol 3-Kinase/Akt and NF-B Survival Pathways in Neutrophil Granulocytes

Arup Sarkar,a Lars Hellberg,a Asima Bhattacharyya,b Martina Behnen,a Keqing Wang,c Janet M. Lord,c Sonja Mller,a Maja Kohler,a Werner Solbach,a and Tams Laskaya
Institute for Medical Microbiology and Hygiene, University of Lbeck, Lbeck, Germanya; National Institute of Science Education and Research, School of Biological Sciences, Bhubaneswar, Odisha, Indiab; and School of Immunity and Infection, University of Birmingham, Birmingham, United Kingdomc

Anaplasma phagocytophilum, a Gram-negative, obligate intracellular bacterium infects primarily neutrophil granulocytes. Infection with A. phagocytophilum leads to inhibition of neutrophil apoptosis and consequently contributes to the longevity of the host cells. Previous studies demonstrated that the infection inhibits the executionary apoptotic machinery in neutrophils. However, little attempt has been made to explore which survival signals are modulated by the pathogen. The aim of the present study was to clarify whether the phosphatidylinositol 3-kinase (PI3K)/Akt and NF-B signaling pathways, which are considered as important survival pathways in neutrophils, are involved in A. phagocytophilum-induced apoptosis delay. Our data show that infection of neutrophils with A. phagocytophilum activates the PI3K/Akt pathway and suggest that this pathway, which in turn maintains the expression of the antiapoptotic protein Mcl-1, contributes to the infection-induced apoptosis delay. In addition, the PI3K/Akt pathway is involved in the activation of NF-B in A. phagocytophilum-infected neutrophils. Activation of NF-B leads to the release of interleukin-8 (IL-8) from infected neutrophils, which, in an autocrine manner, delays neutrophil apoptosis. In addition, enhanced expression of the antiapoptotic protein cIAP2 was observed in A. phagocytophilum-infected neutrophils. Taken together, the data indicate that upstream of the apoptotic cascade, signaling via the PI3K/Akt pathway plays a major role for apoptosis delay in A. phagocytophilum-infected neutrophils.

ecruitment of neutrophil granulocytes to the site of acute infection is a crucial mechanism for the defense against pathogenic microorganisms. In the circulation, neutrophils have a short life span: they undergo spontaneous apoptosis within 6 to 10 h. However, neutrophil apoptosis is delayed after exposure to proinammatory stimuli such as interleukin-8 (IL-8), tumor necrosis factor alpha (TNF-), IL-1, IL-2, gamma interferon (IFN-), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, or lipopolysaccharide (LPS) (3, 25, 28, 39). In addition, several intracellular pathogens such as Anaplasma phagocytophilum, Leishmania major, Chlamydia pneumoniae, and respiratory syncytial virus have developed strategies to manipulate the spontaneous apoptosis of host neutrophils (1, 10, 47). The obligatory intracellular bacterium Anaplasma phagocytophilum is the causative agent of human granulocytic anaplasmosis (HGA) (16). A. phagocytophilum replicates in the parasitophorous vacuole of neutrophil granulocytes and forms microcolonies called morulae. Previous reports show that infection with A. phagocytophilum delays neutrophil apoptosis by upregulating the p38 mitogen-activated protein kinase (MAPK) pathway (10) and by modulating extrinsic and intrinsic pathways of apoptosis (21). The phosphatidylinositol 3-kinase (PI3K)/Akt and NF-B pathways are considered as important survival signaling pathways in neutrophils (54). No data are, however, available as to whether these signaling pathways get activated in A. phagocytophilum-infected neutrophils. Solely the enhanced gene expression of PI3K and Akt in A. phagocytophilum-infected neutrophils has been reported previously (29, 30). PI3K generates phosphatidylinositol triphosphate [PtdIns (3,4,5)P3] from phosphatidylinositol bisphosphate [PtdIns (4,5)P2]. PtdIns(3,4,5)P3 has been shown to inhibit apoptosis

in various cell types (19, 35). PtdIns(3,4,5)P3 activates Akt, an antiapoptotic molecule that can regulate apoptosis by directly controlling members of the apoptotic cascades. Among others, BAD and caspase-9 are regulated by Akt (14, 32, 53). Recently, it has been reported that the deactivation of PI3K/Akt signaling is the mediator of spontaneous neutrophil apoptosis (54). This observation points out the essential role of PI3K/Akt signaling in neutrophil apoptosis. In a number of studies, it has been shown that spontaneous neutrophil apoptosis is delayed upon the activation of NF-B (13, 18, 48, 49). In neutrophils, the activation of NF-B is associated with the release of the CXC chemokine IL-8, which functions as an important factor to delay spontaneous neutrophil apoptosis (25, 47). In the present study, we investigated whether the PI3K/Akt pathway functions as a survival signaling pathway in A. phagocytophilum-infected neutrophils. Here we show for the rst time that infection with A. phagocytophilum activates the PI3K/Akt signaling pathway in primary human neutrophils. The infection prevents downregulation and maintains the expression of Mcl-1 via the PI3K pathway. Infection with A. phagocytophilum also acti-

Received 22 April 2011 Returned for modication 26 May 2011 Accepted 28 December 2011 Published ahead of print 17 January 2012 Editor: B. A. McCormick Address correspondence to Tams Laskay, Tamas.Laskay@uk-sh.de. Copyright 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/IAI.05219-11

0019-9567/12/$12.00

Infection and Immunity

p. 16151623

iai.asm.org

1615

Sarkar et al.

vates NF-B in human neutrophils, which in turn results in the release of IL-8. We provide evidence that IL-8, in an autocrine fashion, delays neutrophil apoptosis.
MATERIALS AND METHODS
Culture of bacteria. The A. phagocytophilum Webster strain (5) was kindly provided by J. S. Dumler (Baltimore, MD) and was propagated in HL-60 cells maintained in RPMI 1640 medium (Sigma, Deisenhofen, Germany) containing 2 mM L-glutamine (Biochrom, Berlin, Germany) and 1% fetal calf serum (FCS; Sigma). Isolation of neutrophils from peripheral blood. Neutrophils were isolated from peripheral blood collected by venipuncture from healthy donors by use of lithium-heparin as described previously (17). Briey, blood was layered on a two-layer density gradient consisting of lymphocyte separation medium 1077 (PAA, Pasching, Austria) and Histopaque 1119 (Sigma) and centrifuged for 5 min at 300 g followed by 20 min at 800 g. The rst interphase layer from the top of the column, rich with lymphocytes and monocytes, was discarded, and subsequent granulocyterich interphase layers were collected in a 50-ml centrifuge tube leaving the erythrocyte pellet and washed with phosphate-buffered saline (PBS) for 10 min at 250 g. The pellet was resuspended in RPMI 1640 medium (Sigma) supplemented with 50 M 2-mercaptoethanol, 2 mM L-glutamine, 10 mM HEPES (all from Biochrome, Berlin, Germany), and 10% fetal calf serum (FCS; Sigma) and layered on a discontinuous Percoll (Amersham Biosciences, Uppsala, Sweden) gradient consisting of fractions with densities of 1.105 g/ml (85%), 1.100 g/ml (80%), 1.093 g/ml (75%), 1.087 g/ml (70%), and 1.081 g/ml (65%) from the bottom to the top. The gradient was centrifuged at 800 g for 25 min. After centrifugation, the interphase between the 80% and 70% Percoll layers was collected, washed with PBS at 250 g for 10 min, and resuspended in RPMI 1640 medium. All procedures were conducted at room temperature. The viability and purity of the cells were checked by trypan blue exclusion and Diff-Quick (Medion Diagonostics, Duedingen, Switzerland) staining of cytocentrifuge (Shandon, Pittsburgh, PA) slides, respectively. The purity of the granulocytes was over 99.9% (31). Preparation of cell-free A. phagocytophilum and coincubation with neutrophils. The infection rate of A. phagocytophilum-exposed HL-60 cells was determined by counting the cells containing morulae in DiffQuick-stained cytospin preparates. When 40% of the cells were found infected, they were used for the preparation of cell-free A. phagocytophilum as described previously (10). Briey, infected HL-60 cells were centrifuged at a speed of 250 g for 10 min, resuspended in 2 ml of PBS, and passed through a 25-gauge needle 10 to 14 times. Cellular debris was removed by pelleting at 750 g for 10 min. The supernatant was collected and centrifuged at 2,500 g for 15 min. Pellets obtained in this way were immediately resuspended in polymorphonuclear leukocyte (PMN) suspension and incubated for various time points. For infection of neutrophils, Anaplasma derived from one infected HL-60 cell was used to infect one PMN. The infection inoculum was quantied by assessing the infection rate of HL-60 cells by using microscopic evaluation of Diff-Quickstained slides of infected HL-60 cells. A quantitative (light cycler) reverse transcription (RT)-real-time PCR analysis was carried out to determine the viable bacterial load in infected HL-60 cells by assessing the gene expression of the Anaplasma 16S rRNA gene (NCBI accession no. DQ458808; forward [F], 5=-GGT ACC TAC AGA AGT CC; reverse [R], 5=-CAG CAC TCA TCG TTT ACA GC). Preliminary studies from our laboratory showed that the human beta-actin gene is not suitable to standardize the Anaplasma gene expression data in infected HL-60 cells (data not shown). Therefore, 1 106 murine cells (YAC-1 cell line) were added to the infected HL-60 cultures immediately prior to RNA isolation. The quantitative assessment of Anaplasma 16S rRNA gene expression was standardized to the expression of the murine L32 gene. The primers used are specic for murine L32 and do not detect human L32 (F, CAGGGTG CGGAGAAGGTTCAAGGG; R, CTTAGAGGACACGTTGTGAGCAA TC). The infection inoculum derived from one Anaplasma-infected

HL-60 cell (determined microscopically) was dened in one preliminary experiment as 1.0 in an arbitrary scale. This quantitative analysis was carried out retrospectively after the experiments in which neutrophils were infected with cell-free Anaplasma. Quantication of the infection inoculum (isolated from one Anaplasma-infected HL-60 cell) in six independent experiments resulted in a value of 0.923 0.260 in the arbitrary scale. The infection inocula used in the various experiments were therefore in a narrow range. These data also show that the microscopic determination gives a reasonably correct quantication of the infection inoculum. Phagocytosis of latex beads. In control experiments, neutrophils (5 105 cells/100 l) were cultured at 37C in RPMI 1640 complete medium in 96-well at-bottom tissue culture plates in the presence of 1-m-diameter latex beads (FluoSpheres; Invitrogen, Karlsruhe, Germany) at a beadsto-neutrophil ratio of 10. The phagocytosis rate of the beads was assessed after 30 min by using ow cytometry. Whole-cell lysates for Western blot analysis were prepared after 30 min of incubation. The apoptosis rate of the cultured neutrophils was assessed after 18 h of incubation. Assessment of apoptosis of neutrophil granulocytes. (i) Morphological analysis. A characteristic feature of neutrophil granulocytes is their spontaneous apoptosis. The typical morphology of the multilobed nucleus with interlobular connections is lost in cells that undergo apoptosis. These morphological changes can be utilized to differentiate between apoptotic and nonapoptotic neutrophils by visual examination as described previously (47). For apoptosis assays, neutrophils (1 106/200 l) were cultured with or without cell-free A. phagocytophilum in RPMI 1640 complete medium (without antibiotics) supplemented with 10% FCS for 18 h. Since cell-free A. phagocytophilum was obtained from infected HL-60 cells, as a negative control, extracts of noninfected HL-60 cells were assessed for their effect on neutrophil apoptosis. Extracts of noninfected HL-60 cells did not induce apoptosis inhibition (Fig. 1B). As a positive control for survival, neutrophils were incubated with GM-CSF (10 ng/ml) for 18 h. Cytocentrifuge preparates were xed and stained with Diff-Quick. A minimum of 200 cells were counted by using oil immersion light microscopy and graded as apoptotic or nonapoptotic. Unlike other cell types, neutrophils are reportedly very difcult to transfect; hence, we opted to use various pharmacological inhibitors in order to decipher the role of different antiapoptotic pathways. Neutrophils were preincubated for 30 min with 25 M LY294002 (Cell Signaling Technology, Beverly, MA), or with 0.5 M (Calbiochem, San Diego, CA) or with 10 M MG-132 (Sigma) before infection with A. phagocytophilum. LY294002 is widely used as specic inhibitor of PI3K. However, LY294002 also inhibits glycogen synthase kinase 3 (GSK-3). BAY 11-7082 is an inhibitor of NF-B, and MG-132 is a universal inhibitor of proteasome activity. MG-132, however, is used to inhibit the NF-B pathway, since it blocks the degradation of inhibitory kappa B (IB) by proteasomes. The applied concentrations of inhibitors had no toxic effects and did not show any inuence on the rate of constitutive apoptosis of neutrophils as revealed by trypan blue dye exclusion and annexin V-binding assay, respectively (data not shown). (ii) Assessment of apoptosis by staining with annexin V. Apoptosis was determined by annexin V Fluos (Roche Diagnostics, Mannheim) binding; briey, cells were stained with annexin V Fluos for 30 min in the dark on ice in the binding buffer (10 mM HEPES [pH 7.4], 140 mM NaCl, 5 mM CaCl2), washed, and resuspended in binding buffer. Propidium iodide (PI) was added at a concentration of 1 g/ml in order to assess the membrane integrity, and the cells were analyzed by ow cytometry (FACSCalibur; BD Biosciences). Western blot analysis. Whole-cell lysates were prepared as described previously (8, 49). Briey, after incubation, 3 106 cells were spun at 350 g for 10 min, and pellets were resuspended in 500 l of 10% trichloroacetic acid (TCA) solution, kept for 5 min on ice, and subsequently centrifuged for 5 min at 14,000 g at 4C. Pellets were washed twice with 500 l acetone at 14,000 g for 5 min at 4C, resuspended in 1 Laemmli sample buffer, and boiled for 5 to 7 min at 100C. Lysates from 0.75 106

1616

iai.asm.org

Infection and Immunity

Anaplasma phagocytophilum Activates PI3K/Akt

FIG 2 Phagocytosis of latex beads does not lead to Akt phosphorylation and
reduced apoptosis in neutrophils. Neutrophils were cultured with cell-free A. phagocytophilum or with 1-m-diameter latex beads. (A) Whole-cell lysates were prepared after 30 min, separated on 10% SDS-PAGE gels, electroblotted, and probed with rabbit anti-human Akt antibody which detects Akt phosphorylated at the Ser473 site. Equal loading was shown by stripping and reprobing the lter with an anti-Akt and anti-human -actin antibody. The blots shown are representative of 3 independent experiments. (B) Cells were cultured for 18 h in the presence of A. phagocytophilum or latex beads. The percentage of apoptotic cells was determined by microscopic evaluation of a minimum of 200 cells from 3 independent experiments. Values given are mean SEM. *, P 0.05 compared to neutrophils cultured in medium alone.

FIG 1 Infection with Anaplasma phagocytophilum activates the PI3K/Akt

pathway in neutrophils. (A) Neutrophils were cultured with or without A. phagocytophilum. Whole-cell lysates were prepared after 30, 60, 90, or 180 min, separated on 10% SDS-PAGE gels, electroblotted, and probed with rabbit anti-human Akt antibody which detects Akt phosphorylated at the Ser473 site. Equal loading was shown by stripping and reprobing the lter with an anti-Akt and anti-human -actin antibody. Neutrophils were treated with fMLP (1 M) for 5 min as a positive control. The experiment shown is representative of 3 independent experiments. (B) Neutrophils were incubated for 30 min with or without the PI3K inhibitor LY294002 (25 M). Cells were then cultured for 18 h in the presence or absence of A. phagocytophilum (A.p.). The percentage of apoptotic cells was determined by microscopic evaluation of a minimum of 200 cells from 4 independent experiments. Values given are mean SEM, #, P 0.05 compared to noninfected neutrophils. *, P 0.05 compared to A. phagocytophilum-infected neutrophils without the inhibitor.

using an anti-IL-8 monoclonal antibody and protein G-Sepharose as described previously (47). Statistical analysis. Statistical analyses were carried out using GraphPad Prism software (version 4.01; GraphPad, San Diego, CA). Data from a minimum of 3 independent experiments are presented as mean standard error of the mean (SEM). Statistical evaluation of differences was determined by Students t test. A P value of 0.05 was considered signicant.

PMNs were electrophoresed on 10% SDS-PAGE gels and transferred to nitrocellulose membrane. After blocking of membranes in 5% bovine serum albumin (BSA) in Tris-buffered salineTween (TBST) for 1 h at room temperature, the membranes were incubated overnight at 4C in the presence of the Ser473 phospho-specic anti-Akt rabbit polyclonal antibody or with anti-Mcl-1 rabbit polyclonal antibody, Ser32/36 phospho-specic IB- mouse monoclonal antibody, or anti-cIAP2 rabbit monoclonal antibody and probed with horseradish peroxidase (HRP)conjugated anti-rabbit IgG antibody or HRP-conjugated anti-mouse IgG antibody. Signal was detected by chemiluminescence (Immobilon Western chemiluminescence HRP substrate; Millipore, Billerica, MA). To assure equal sample loading, membranes were reprobed with rabbit polyclonal anti-beta actin or anti-Akt rabbit polyclonal antibody and probed with HRP-conjugated anti-rabbit IgG. All the antibodies were purchased from Cell Signaling Technology, Beverly, MA. For the quantitative analysis, blots were scanned with an Umax Astra 6700 scanner, and the bands quantied by using the Bioprol-Bio-1D (Vilber Lourmat) software. Cytokine assays. Neutrophils (1 106 cells/200 l) were cultured in 96-well tissue culture plates at 37C under 5% CO2 in the presence or absence of A. phagocytophilum for 18 h, and supernatants were collected and stored at 20C. Cytokine concentrations were determined by performing sandwich enzyme-linked immunosorbent assays (ELISAs) using a commercially available kit for the detection of IL-8 (Biosource, CA). When needed, cells were treated with inhibitor for 30 min prior to infection and supernatants were collected after 18 h and used for the IL-8 assay. IL-8 was depleted from the culture supernatants by immunoprecipitation

RESULTS

Requirement of the PI3K/Akt pathway for the A. phagocytophiluminduced inhibition of neutrophil apoptosis. The PI3K/Akt pathway has been shown to be a critical survival pathway in neutrophil granulocytes, resulting in the delay of spontaneous apoptosis of these short-living cells (12). In the present study, we addressed the question of whether this pathway plays a role in the A. phagocytophilum-induced inhibition of neutrophil apoptosis. The phosphorylation of Akt is a crucial event downstream of PI3K activation. Western blot analysis revealed that infection with A. phagocytophilum resulted in the phosphorylation of Akt in neutrophils (Fig. 1A). Neutrophils were treated with N-formyl-methionyl-leucyl-phenylalanine (fMLP; 1 M) for 5 min as a positive control (Fig. 1A). This observation indicates that infection with A. phagocytophilum results in the activation of the PI3K/Akt pathway in neutrophils. To investigate whether the observed Akt phosphorylation and apoptosis delay are specic for Anaplasma or are part of the phagocytic program, the effect of the phagocytosis of latex beads on Akt phosphorylation and neutrophil apoptosis was investigated. The results indicate that the phagocytosis of latex beads (phagocytosis rate after 30 min, 81% 3%; n 3; data not shown) does not lead to Akt phosphorylation (Fig. 2A) and does not inhibit neutrophil apoptosis (Fig. 2B).

April 2012 Volume 80 Number 4

iai.asm.org 1617

Sarkar et al.

FIG 3 Pretreatment with the PI3K inhibitor LY294002 abrogates the A. phagocytophilum-induced increase of Mcl-1 in neutrophils. Neutrophils were incubated with or without the PI3K inhibitor LY294002 (25 M) for 30 min. Subsequently, the cells were cultured for 18 h with or without A. phagocytophilum. Whole-cell lysates were prepared and separated on 10% denaturing SDS-PAGE gels, electroblotted, and probed with an anti-human Mcl-1 antibody. Equal loading was conrmed by reprobing the blot with rabbit antihuman -actin antibody. GM-CSF (5 ng/ml) was used as a positive control. Representative blots from 3 independent experiments are shown. (B) To quantify the relative changes in the Mcl-1 expression, scanning densitometry was performed. Shown is the Mcl-1 expression relative to A. phagocytophilum (A.p.)-infected neutrophils (1.0). Mean standard deviation (SD) from three independent experiments is shown. *, P 0.05.

To assess whether the activation of this pathway is involved in or required for the apoptosis delay, A. phagocytophilum-infected neutrophils were preincubated with LY294002, an inhibitor of PI3K. Treatment of neutrophils with LY294002 signicantly reversed the A. phagocytophilum-induced apoptosis delay (Fig. 1B). These results suggest that infection with A. phagocytophilum activates the PI3K/Akt pathway and that this event plays a major role in the apoptosis delay caused by the pathogen. The maintenance of Mcl-1 expression in A. phagocytophilum-infected neutrophils is dependent on the PI3K/Akt pathway. As shown in Fig. 1, the PI3K/Akt pathway is involved in apoptosis delay in A. phagocytophilum-infected neutrophils. Previous studies demonstrated that the maintained expression of the antiapoptotic molecule Mcl-1 is an important step to inhibit the apoptotic machinery in A. phagocytophilum-infected neutrophils (10). Therefore, we investigated whether the activation of the PI3K/Akt pathway is an upstream event leading to the maintenance of Mcl-1 expression in A. phagocytophilum-infected cells. Compared to what was seen for neutrophils cultured in medium alone, a high Mcl-1 level was observed in A. phagocytophilum-infected neutrophils and after treatment with GMCSF used as a positive control. The enhanced Mcl-1 level was not observed after pretreatment of the infected neutrophils with the PI3K-inhibitor LY294002 (Fig. 3). This nding indicates a role of the PI3K pathway in the maintenance of Mcl-1 expression in A. phagocytophilum-infected neutrophils. Activation of NF-B depends on the PI3K/Akt pathway in A. phagocytophilum-infected neutrophils. NF-B is a transcription

factor which tightly regulates the expression of numerous genes involved in host immune responses, inammatory reactions, apoptosis, proliferation, and differentiation (2, 6). In its nonactivated state NF-B is localized in the cytoplasm in close association with inhibitory kappa B (IB) (23). During NF-B activation, the inhibitory subunit IB is phosphorylated for polyubiquitination and subsequent degradation and thus allows free NF-B to translocate to the nucleus. The NF-B pathway has been shown to be involved in the delay of neutrophil apoptosis following exposure to the proinammatory cytokines GM-CSF and TNF- (13). In order to decipher whether NF-B is activated in A. phagocytophilum-infected neutrophils, IB phosphorylation was assessed by Western blotting. The results revealed enhanced phosphorylation of IB in A. phagocytophilum-infected neutrophils compared to cells incubated with medium alone (Fig. 4A). The phosphorylation of IkB was evident 1 h after infection and was maintained during the 18 h of incubation time (data not shown). Neutrophils were treated with TNF- (100 ng/ml) for 15 min as a positive control (data not shown). Activation of the PI3K/Akt pathway can regulate NF-B activity (36). Since activation of the PI3K/Akt pathway was observed in A. phagocytophilum-infected neutrophils, we investigated whether the PI3K/Akt pathway has any role in regulating NF-B activation in A. phagocytophilum-infected neutrophils. Neutrophils were preincubated with the PI3K inhibitor LY294002 and subsequently infected with A. phagocytophilum. The activation of NF-B was determined by Western blot analysis of phosphorylated IB. A. phagocytophilum-induced activation of NF-B was markedly diminished in the presence of the PI3K inhibitor (Fig. 4A). This nding suggests the involvement of the PI3K pathway in A. phagocytophilum-mediated NF-B activation. To assess whether NF-B activation is required for A. phagocytophilum-mediated apoptosis delay, infected neutrophils were treated with inhibitors that inhibit NF-B activation by different mechanisms. BAY 11-7082 is an IB kinase inhibitor, whereas MG-132 prevents the degradation of IB by proteasomes and thus inhibits the activation of NF-B. Treatment with either BAY 11-7082 or MG-132 signicantly reversed the A. phagocytophiluminduced apoptosis delay (Fig. 4C). These results strongly suggest the importance of NF-B activation in A. phagocytophiluminduced apoptosis delay in neutrophils. As shown above, activation of the PI3K pathway is an event upstream of NF-B activation. The inhibitors LY294002 or BAY 11-7082 had no effect on the capacity of neutrophils to phagocytose nonopsonized Staphylococcus aureus bacteria (data not shown). Therefore, the observed effect of LY294002 or BAY 11-7082 on A. phagocytophilum-induced apoptosis delay is unlikely a result of the effect of these substances on the ingestion of Anaplasma by neutrophils. Infection with A. phagocytophilum induces the release of IL-8 by neutrophils via an NF-B-dependent pathway. Infection with A. phagocytophilum has been reported to lead to the release of high amounts of IL-8 from neutrophils (10). Neutrophil-derived IL-8 is considered as an amplifying loop to recruit neutrophils to sites of acute infection/inammation (20). However, in addition to its chemotactic effect, IL-8 can delay neutrophil apoptosis (25). Since TNF--induced IL-8 release was reported to depend on the activation of NF-B (13), we hypothesized the involvement of the observed NF-B activation in the IL-8 production from A. phagocytophilum-infected neutrophils. To test this possibility, A. phago-

1618

iai.asm.org

Infection and Immunity

Anaplasma phagocytophilum Activates PI3K/Akt

FIG 4 Infection with A. phagocytophilum activates NF-B in neutrophils via the PI3K/Akt pathway. (A) Neutrophils were incubated with or without the PI3K inhibitor LY294002 (25 M) for 30 min and then cultured with or without A. phagocytophilum (A.p.) for 18 h. Whole-cell lysates were prepared and separated on 10% denaturing SDS-PAGE gels, electroblotted, and probed with mouse anti-human IB antibody which detects phosphorylated IB. Equal loading was conrmed by reprobing the blot with an anti-human -actin antibody. Representative blots from 3 independent experiments are shown. (B) To quantify the relative changes in the IB phosphorylation, scanning densitometry was performed. Shown is the phosphorylated IB expression relative to A. phagocytophiluminfected neutrophils (1.0). Mean SD from three independent experiments is shown. *, P 0.05. (C) Neutrophils were pretreated with 0.5 M BAY 11-7082 or 10 M MG-132 for 30 min. Subsequently, cells were incubated with or without A. phagocytophilum for 18 h. The data show the percentage of apoptotic cells determined by microscopic evaluation of minimum 200 cells from 3 independent experiments. Values given are mean SEM. *, P 0.05 compared to A. phagocytophilum-infected cells without the inhibitor.

cytophilum-infected neutrophils were treated with the NF-B inhibitor BAY 11-7082 (inhibitor for IB phosphorylation). This treatment led to a signicant reduction in IL-8 release from A. phagocytophilum-infected neutrophils (Fig. 5A). Since cell-free A. phagocytophilum was obtained from infected HL-60 cells, as a negative control, neutrophils were treated with extracts of noninfected HL-60 cells. Extracts of noninfected HL-60 cells did not induce IL-8 release (Fig. 5A). IL-8 secreted by A. phagocytophilum-infected neutrophils delays the spontaneous apoptosis of neutrophils. Having observed the release of high amounts of IL-8 by A. phagocytophiluminfected neutrophils, we addressed the question of whether this IL-8, in an autocrine manner, can delay neutrophil apoptosis. To test this possibility, neutrophils were cultured in supernatants of A. phagocytophilum-infected neutrophils. In the presence of these supernatants, a signicant inhibition of neutrophil apoptosis was observed compared to the cells incubated in medium alone (Fig. 5B). No antiapoptotic effect was observed when cells were incubated with supernatants collected from noninfected neutrophils. In order to test whether IL-8 is responsible for the supernatantmediated inhibition of neutrophil apoptosis, IL-8 was depleted from the culture supernatants by immunoprecipitation using anti-IL-8 monoclonal antibody and protein G-Sepharose. This procedure reduced the IL-8 level by 98% (from 41.3 7.2 ng/ml to 0.25 0.11 ng/ml). Coincubation of freshly isolated neutrophils with the IL-8-depleted supernatants did not lead to apoptosis in-

hibition (Fig. 5C). These ndings clearly show that IL-8 secreted by infected neutrophils contributes to apoptosis delay observed after A. phagocytophilum infection. IL-8 exerts its antiapoptotic effect on neutrophils via the PI3K/Akt pathway. We have shown (Fig. 1) that the A. phagocytophilum-mediated apoptosis delay was associated with the activation of the PI3K/Akt survival pathway. Having observed the contribution of IL-8 in this process, we investigated whether IL-8 also acts by activating this survival pathway. Western blot analysis revealed that the exposure of neutrophils to IL-8 results in the phosphorylation of Akt (Fig. 6A). The phosphorylation of Akt depends on PI3K, since the IL-8-induced phosphorylation of Akt was completely attenuated in neutrophils treated with the PI3K inhibitor LY294002 (Fig. 6A). Since IL-8 activates the PI3K/Akt pathway and the maintenance of Mcl-1 expression is dependent on the PI3K/Akt pathway, we tested the effect of IL-8 on Mcl-1 expression. Figure 6B shows that exposure to IL-8 results in an increase of Mcl-1 expression in neutrophils. Data presented in Fig. 6 indicate that IL-8 exerts its antiapoptotic effect via the PI3K/Akt pathway and suggest the involvement of the downstream antiapoptotic molecule Mcl-1 in the apoptosis delay. Infection with A. phagocytophilum leads to the enhanced cIAP2 protein expression in human neutrophils. In addition to Mcl-1, infection with A. phagocytophilum was shown to upregulate the expression of several other antiapoptotic molecules,

April 2012 Volume 80 Number 4

iai.asm.org 1619

Sarkar et al.

FIG 5 IL-8 released by A. phagocytophilum-infected neutrophils inhibits neutrophil apoptosis. (A) Neutrophils were incubated with or without a 0.5-M concentration of the IB inhibitor BAY 11-7082 for 30 min. Cells were then incubated with A. phagocytophilum and the supernatants collected after 18 h. The IL-8 content of the supernatants was measured by ELISA. Data shown are mean SEM from three independent experiments. **, P 0.005. (B) Neutrophils were cultured for 12 h with or without (100 ng/ml) recombinant IL-8 or with culture supernatants collected from A. phagocytophilum (A.p.)-infected neutrophils. The apoptosis rate was determined in 3 independent experiments. Values given are mean SEM. **, P 0.005 compared to neutrophils incubated in medium alone. (C) Neutrophils were incubated with A. phagocytophilum for 18 h and supernatants were collected. IL-8 was depleted from these supernatants using polyclonal anti-IL-8 serum and protein G immunoprecipitation. Freshly isolated neutrophils (5 106/ml) were incubated with the supernatants for 12 h. The apoptosis rate was determined in 3 independent experiments. Values given are mean SEM. *, P 0.05 compared to A. phagocytophilum supernatants prior to IL-8 depletion.

among others cIAP2 (BIRC3) (44), a member of the inhibitor of apoptosis (IAP) family. cIAP2 inhibits apoptosis by binding directly to activated caspases-3 and -7 (41). Since previous studies indicated the involvement of the NF-B pathway in the induction of cIAP2 expression (34, 50), we tested the protein expression of cIAP2 in neutrophils after infection with A. phagocytophilum. As shown in Fig. 7, the expression of cIAP2 protein was strongly enhanced in human neutrophils after infection with A. phagocytophilum.
DISCUSSION

FIG 6 Treatment with IL-8 enhances the phosphorylation of Akt via the PI3Kdependent pathway and increases the Mcl-1 expression. (A) Neutrophils (5 106/ml) were incubated with or without the PI3K specic inhibitor LY294002 (25 M) for 30 min. Cells were then treated with recombinant human IL-8 at different concentrations (100 ng/ml and 500 ng/ml) for 5 min. Whole-cell lysates were prepared and separated on 10% SDS-PAGE gels, electroblotted, and probed with rabbit anti-human Akt antibody which detects Akt phosphorylated at Ser473. Equal loading was conrmed by reprobing the blot with anti-human beta-actin antibody. fMLP (1 M) was used as a positive control. The blots shown are from one experiment and are representative of 3 independent experiments. (B) Neutrophils were incubated with recombinant IL-8 at different concentrations (100 ng/ml and 500 ng/ml) for 5 min. GM-CSF was used as the positive control for Mcl-1stabilization. Whole-cell lysates were analyzed by Western blotting with rabbit anti-human Mcl-1 antibody, and equal loading was conrmed by blotting with a rabbit anti-human beta-actin antibody. The blots shown are from one experiment and are representative of 3 independent experiments.

Infection with A. phagocytophilum results in the extension of the life span of neutrophils by inhibiting their spontaneous apoptosis (10, 21). Previous studies concerning this phenomenon focused on the effect of the infection on the executionary apoptotic cascade, showing that A. phagocytophilum inhibits neutrophil apoptosis by modulating the extrinsic as well as the intrinsic pathway of apoptosis (9). However, it is still poorly understood which signals regulate this process. One previous report described that the pathogen inhibits neutrophil apoptosis by modulating the p38 MAPK pathway (5). However, this study left open the possibility that additional pathways also play major roles in apoptosis delay in A. phagocytophilum-infected neutrophils. In the present study, we addressed the question of which survival pathways upstream of the apoptotic cascade are involved in the A. phagocytophilum-mediated apoptosis delay. The results suggest that the early activation of the PI3K/Akt pathway is a major step for apoptosis inhibition in A. phagocytophilum-infected neutrophils. As a downstream event, we observed the maintained expression of the antiapoptotic factor Mcl-1, which was shown to be dependent on the activation of the PI3K/Akt pathway. Main-

1620

iai.asm.org

Infection and Immunity

Anaplasma phagocytophilum Activates PI3K/Akt

FIG 7 Infection with Anaplasma phagocytophilum (A. p.) results in the protein
expression of cIAP2. Neutrophils were cultured with or without A. phagocytophilum. Whole-cell lysates were prepared from freshly isolated neutrophils (0 h) and after 18 h of culture, separated on 10% denaturing SDS-PAGE gels, electroblotted, and probed with an anti-human cIAP2 antibody. Equal loading was conrmed by reprobing the blot with rabbit anti-human -actin antibody. (A) Representative blots from 3 independent experiments are shown. (B) To quantify the relative changes in the cIAP2 expression, scanning densitometry was performed. Shown is the cIAP2 expression relative to freshly isolated cells (1.0). Mean SD from three independent experiments is shown. *, P 0.05.

tained expression of Mcl-1 has been shown as an event of major importance for apoptosis inhibition in several cell types, including neutrophils (15). A recent report showed that A. phagocytophilum affects host cell functions in a Toll-like receptor 2 (TLR2)-dependent manner (11). Exposure of neutrophils to TLR2 ligands has been shown to induce the release of proinammatory cytokines by activating the PI3K/Akt pathway (43). Therefore, it is reasonable to assume that the interaction of A. phagocytophilum with TLR2 on neutrophils activates PI3K/Akt and NF-B, resulting in apoptosis delay. Our data presented here regarding the activation of PI3K/Akt in A. phagocytophilum-infected neutrophils are in conict with an earlier report in which no evidence was observed for A. phagocytophilum-induced Akt phosphorylation in neutrophils (10). We show that infection with A. phagocytophilum leads to an early and transient Akt phosphorylation. Phosphorylation of Akt, which was seen 30, 60, and 90 min after infection, was not observed anymore after 3 h of infection. Choi et al. (10) assessed Akt phosphorylation 3 h after A. phagocytophilum infection and apparently missed the early Akt activation. Akt has been shown to regulate NF-B activation in J774 macrophages and 293 cells by upregulating the phosphorylation of IB complex (33, 36, 40). NF-B activation leads to enhanced expression of prosurvival genes in several infection models (7, 51, 52). In human neutrophils, NF-B activation regulates spontaneous apoptosis as well as the antiapoptotic effect of TNF-, a cytokine that exerts both pro- and antiapoptotic effects upon these cells (26). Here, we report that infection with A. phagocytophilum activates NF-B in neutrophils. In a previous study, it has been

shown that infection with Anaplasma activates NF-B in peripheral blood leukocytes as well as monocytes (27). Moreover, in this report the authors have shown that pathogen-induced NF-B activation is dependent on protein tyrosine kinase (PTK), protein kinase A (PKA), and p38 MAPK. We have observed that inhibition of PI3K with the pharmacological inhibitor LY294002 partially prevented the activation of NF-B in A. phagocytophiluminfected neutrophils. In addition, we have shown that the inhibition of NF-B can partially reverse the pathogen-induced apoptosis delay, which clearly shows the importance of NF-B signaling in A. phagocytophilum-induced inhibition of neutrophil apoptosis. Our results suggest that activation of NF-B in A. phagocytophilum-infected neutrophils occurs, at least in part, via a PI3K/Akt dependent pathway. Most likely, NF-B activation has inuence on other survival/death pathways in A. phagocytophilum-infected neutrophils, especially upon members of the Bcl-2 family, which comprises both proand antiapoptotic members. In addition, the expression of the antiapoptotic protein cIAP2 depends on the activation of NF-B (34, 50). We showed that inhibition of both the PI3K and NF-B pathways partially reversed the A. phagocytophilum-induced apoptosis inhibition. Although the simultaneous inhibition of these two pathways had a signicantly stronger effect than inhibition of only one of the two pathways, the simultaneous inhibition of PI3K and NF-B pathways did not completely reverse A. phagocytophiluminduced apoptosis inhibition (data not shown). This observation indicates that although both the PI3K and NF-B pathways play major roles in the apoptosis delay, these are not the only pathways involved. Indeed, a previous study showed the involvement of the p38 MAPK pathway (10) in A. phagocytophilum-induced apoptosis inhibition. Upon stimulation, neutrophils produce an array of cytokines, including IL-8 (42). Neutrophils also secrete IL-8 upon infection with A. phagocytophilum (10). Neutrophil-derived IL-8 is considered as an amplication mechanism to be involved in recruitment of high numbers of neutrophils to the site of infection (20). In addition, IL-8 delays the spontaneous apoptosis of neutrophil granulocytes (25). In the present study, a signicant amount of IL-8 was measured in supernatants of A. phagocytophilum-infected neutrophils. We could show the involvement of NF-B and PI3K/Akt pathways in pathogen-induced IL-8 secretion. This suggests that IL-8 release is dependent on the activation of both of these pathways. Furthermore, our depletion experiments revealed that the antiapoptotic effect of A. phagocytophilum is at least partially mediated by the autocrine production of IL-8 by neutrophils. It has been postulated that enhanced production of IL-8 is a dissemination strategy of A. phagocytophilum, since IL-8 recruits neutrophils and enhances their phagocytic potential (4, 9). Here we demonstrate that IL-8 released from A. phagocytophilum-infected neutrophils leads to the extension of the life span of neutrophils. The possibility that the extended life span contributes to the survival of A. phagocytophilum in their host neutrophils, however, remains to be experimentally addressed. It is not clear which factors of the bacterium are responsible for recognition and binding to neutrophils. However, it has been reported that Msp2 or p44 protein is predominant on the bacterial surface, which acts as a adhesion molecule for entering into the granulocytes upon interacting with fucosylated platelet selectin

April 2012 Volume 80 Number 4

iai.asm.org 1621

Sarkar et al.

6. 7. 8. 9. 10. 11.

12. 13.

FIG 8 The involvement of PI3K and NF-B pathways in the apoptosis delay in A. phagocytophilum-infected neutrophils. A. phagocytophilum bacteria are recognized by neutrophils: among other receptors, PSGL-1 possibly plays a role in activating downstream signaling via the PI3K/Akt pathway. Activation of PI3K results in the stabilization of Mcl-1, which in turn leads to apoptosis inhibition. The NF-B pathway is activated in a PI3K-dependent manner. Activation of NF-B leads to the release of IL-8, which in an autocrine manner leads to the delay by activating the PI3K and NF-B pathways.

14. 15.

16. 17.

glycoprotein ligand 1 (PSGL-1) present on the cell membrane (37). Indeed, a number of studies indicated that PSGL-1 functions as a receptor on the host cell surface for the adhesion and entry of A. phagocytophilum (22, 24, 45, 46). PSGL-1 is likely to play a profound role in activating downstream signaling via the PI3K/ Akt pathway. A study showing interactions between PSGL-1 and Akt activation in neutrophils (38) supports the possibility that interactions of p44 protein and PSGL-1 induce PI3K/Akt activation in A. phagocytophilum-infected neutrophils. In the present study, we show that the infection of neutrophils with A. phagocytophilum activates the PI3K/Akt pathway and that the activation of this pathway leads to maintained expression of Mcl-1 (Fig. 8). Furthermore, the activation of PI3K/Akt is required for the activation of NF-B. The activation of NF-B, in addition to its function as an antiapoptotic regulator, leads to the release of IL-8 from infected neutrophils. IL-8 can prolong the life span of neutrophil granulocytes in an autocrine manner (Fig. 8). Taken together, the data indicate that the activation of the PI3K/Akt pathway is involved in apoptosis delay in A. phagocytophilum-infected neutrophils.
REFERENCES
1. Aga E, et al. 2002. Inhibition of the spontaneous apoptosis of neutrophil granulocytes by the intracellular parasite Leishmania major. J. Immunol. 169:898 905. 2. Aggarwal BB. 2000. Apoptosis and nuclear factor-kappa B: a tale of association and dissociation. Biochem. Pharmacol. 60:10331039. 3. Akgul C, Moulding DA, Edwards SW. 2001. Molecular control of neutrophil apoptosis. FEBS Lett. 487:318 322. 4. Akkoyunlu M, Malawista SE, Anguita J, Fikrig E. 2001. Exploitation of interleukin-8-induced neutrophil chemotaxis by the agent of human granulocytic ehrlichiosis. Infect. Immun. 69:55775588. 5. Asanovich KM, et al. 1997. Antigenic diversity of granulocytic Ehrlichia

18.

19.

20.

21. 22.

23. 24. 25. 26. 27.

28.

isolates from humans in Wisconsin and New York and a horse in California. J. Infect. Dis. 176:1029 1034. Barkett M, Gilmore TD. 1999. Control of apoptosis by Rel/NF-kappaB transcription factors. Oncogene 18:6910 6924. Binnicker MJ, Williams RD, Apicella MA. 2004. Gonococcal porin IB activates NF-kappaB in human urethral epithelium and increases the expression of host anti-apoptotic factors. Infect. Immun. 72:6408 6417. Bussmeyer U, et al. 2010. Impairment of gamma interferon signaling in human neutrophils infected with Anaplasma phagocytophilum. Infect. Immun. 78:358 363. Carlyon JA, Fikrig E. 2003. Invasion and survival strategies of Anaplasma phagocytophilum. Cell. Microbiol. 5:743754. Choi KS, Park JT, Dumler JS. 2005. Anaplasma phagocytophilum delay of neutrophil apoptosis through the p38 mitogen-activated protein kinase signal pathway. Infect. Immun. 73:8209 8218. Choi KS, Scorpio DG, Dumler JS. 2004. Anaplasma phagocytophilum ligation to toll-like receptor (TLR) 2, but not to TLR4, activates macrophages for nuclear factor-kappa B nuclear translocation. J. Infect. Dis. 189:19211925. Cowburn AS, Cadwallader KA, Reed BJ, Farahi N, Chilvers ER. 2002. Role of PI3-kinase-dependent Bad phosphorylation and altered transcription in cytokine-mediated neutrophil survival. Blood 100:26072616. Cowburn AS, Deighton J, Walmsley SR, Chilvers ER. 2004. The survival effect of TNF-alpha in human neutrophils is mediated via NF-kappa Bdependent IL-8 release. Eur. J. Immunol. 34:17331743. Datta SR, et al. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231241. Derouet M, Thomas L, Cross A, Moots RJ, Edwards SW. 2004. Granulocyte macrophage colony-stimulating factor signaling and proteasome inhibition delay neutrophil apoptosis by increasing the stability of Mcl-1. J. Biol. Chem. 279:2691526921. Dumler JS, Madigan JE, Pusterla N, Bakken JS. 2007. Ehrlichioses in humans: epidemiology, clinical presentation, diagnosis, and treatment. Clin. Infect. Dis. 45(Suppl. 1):S45S51. Esmann L, et al. 2010. Phagocytosis of apoptotic cells by neutrophil granulocytes: diminished proinammatory neutrophil functions in the presence of apoptotic cells. J. Immunol. 184:391 400. Francois S, et al. 2005. Inhibition of neutrophil apoptosis by TLR agonists in whole blood: involvement of the phosphoinositide 3-kinase/Akt and NF-kappaB signaling pathways, leading to increased levels of Mcl-1, A1, and phosphorylated Bad. J. Immunol. 174:36333642. Gagnon A, Dods P, Roustan-Delatour N, Chen CS, Sorisky A. 2001. Phosphatidylinositol-3,4,5-trisphosphate is required for insulin-like growth factor 1-mediated survival of 3T3-L1 preadipocytes. Endocrinology 142:205212. Gainet J, et al. 1998. Interleukin-8 production by polymorphonuclear neutrophils in patients with rapidly progressive periodontitis: an amplifying loop of polymorphonuclear neutrophil activation. Lab. Invest. 78: 755762. Ge Y, Rikihisa Y. 2006. Anaplasma phagocytophilum delays spontaneous human neutrophil apoptosis by modulation of multiple apoptotic pathways. Cell. Microbiol. 8:1406 1416. Granick JL, Reneer DV, Carlyon JA, Borjesson DL. 2008. Anaplasma phagocytophilum infects cells of the megakaryocytic lineage through sialylated ligands but fails to alter platelet production. J. Med. Microbiol. 57:416 423. Henkel T, et al. 1993. Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature 365:182185. Herron MJ, Ericson ME, Kurtti TJ, Munderloh UG. 2005. The interactions of Anaplasma phagocytophilum, endothelial cells, and human neutrophils. Ann. N. Y. Acad. Sci. 1063:374 382. Kettritz R, et al. 1998. Interleukin-8 delays spontaneous and tumor necrosis factor-alpha-mediated apoptosis of human neutrophils. Kidney Int. 53:84 91. Kilpatrick LE, et al. 2006. Regulation of TNF mediated anti-apoptotic signaling in human neutrophils: role of delta-PKC and ERK1/2. J. Leukoc. Biol. 80:15121521. Kim HY, Rikihisa Y. 2002. Roles of p38 mitogen-activated protein kinase, NF-kappaB, and protein kinase C in proinammatory cytokine mRNA expression by human peripheral blood leukocytes, monocytes, and neutrophils in response to Anaplasma phagocytophila. Infect. Immun. 70: 4132 4141. Klein JB, et al. 2000. Granulocyte-macrophage colony-stimulating factor

1622

iai.asm.org

Infection and Immunity

Anaplasma phagocytophilum Activates PI3K/Akt

29. 30. 31. 32. 33. 34.

35. 36. 37. 38. 39. 40. 41.

delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways. J. Immunol. 164: 4286 4291. Lee HC, Goodman JL. 2006. Anaplasma phagocytophilum causes global induction of anti-apoptosis in human neutrophils. Genomics 88:496 503. Lee HC, Kioi M, Han J, Puri RK, Goodman JL. 2008. Anaplasma phagocytophilum-induced gene expression in both human neutrophils and HL-60 cells. Genomics 92:144 151. Lotz S, et al. 2004. Highly puried lipoteichoic acid activates neutrophil granulocytes and delays their spontaneous apoptosis via CD14 and TLR2. J. Leukoc. Biol. 75:467 477. Manning BD, Cantley LC. 2007. AKT/PKB signaling: navigating downstream. Cell 129:12611274. Mansell A, Khelef N, Cossart P, ONeill LA. 2001. Internalin B activates nuclear factor-kappa B via Ras, phosphoinositide 3-kinase, and Akt. J. Biol. Chem. 276:43597 43603. Mishra S, et al. 2005. Distinct role of calmodulin and calmodulindependent protein kinase-II in lipopolysaccharide and tumor necrosis factor-alpha-mediated suppression of apoptosis and anti-apoptotic cIAP2 gene expression in human monocytic cells. J. Biol. Chem. 280: 37536 37546. Oganesian A, et al. 2003. Protein tyrosine phosphatase RQ is a phosphatidylinositol phosphatase that can regulate cell survival and proliferation. Proc. Natl. Acad. Sci. U. S. A. 100:75637568. Ozes ON, et al. 1999. NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401:82 85. Park J, Kim KJ, Grab DJ, Dumler JS. 2003. Anaplasma phagocytophilum major surface protein-2 (Msp2) forms multimeric complexes in the bacterial membrane. FEMS Microbiol. Lett. 227:243247. Pluskota E, et al. 2008. Expression, activation, and function of integrin alphaMbeta2 (Mac-1) on neutrophil-derived microparticles. Blood 112: 23272335. Power CP, et al. 2004. Bacterial lipoprotein delays apoptosis in human neutrophils through inhibition of caspase-3 activity: regulatory roles for CD14 and TLR-2. J. Immunol. 173:5229 5237. Romashkova JA, Makarov SS. 1999. NF-kappaB is a target of AKT in anti-apoptotic PDGF signalling. Nature 401:86 90. Roy N, Deveraux QL, Takahashi R, Salvesen GS, Reed JC. 1997. The

42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54.

c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specic caspases. EMBO J. 16:6914 6925. Scapini P, et al. 2000. The neutrophil as a cellular source of chemokines. Immunol. Rev. 177:195203. Strassheim D, et al. 2004. Phosphoinositide 3-kinase and Akt occupy central roles in inammatory responses of Toll-like receptor 2-stimulated neutrophils. J. Immunol. 172:57275733. Sukumaran B, Carlyon JA, Cai JL, Berliner N, Fikrig E. 2005. Early transcriptional response of human neutrophils to Anaplasma phagocytophilum infection. Infect. Immun. 73:8089 8099. Thomas V, Fikrig E. 2007. Anaplasma phagocytophilum specically induces tyrosine phosphorylation of ROCK1 during infection. Cell. Microbiol. 9:1730 1737. Troese MJ, Carlyon JA. 2009. Anaplasma phagocytophilum dense-cored organisms mediate cellular adherence through recognition of human Pselectin glycoprotein ligand 1. Infect. Immun. 77:4018 4027. van Zandbergen G, et al. 2004. Chlamydia pneumoniae multiply in neutrophil granulocytes and delay their spontaneous apoptosis. J. Immunol. 172:1768 1776. Walmsley SR, et al. 2005. Hypoxia-induced neutrophil survival is mediated by HIF-1alpha-dependent NF-kappaB activity. J. Exp. Med. 201:105 115. Wang K, et al. 2003. Inhibition of neutrophil apoptosis by type 1 IFN depends on cross-talk between phosphoinositol 3-kinase, protein kinase C-delta, and NF-kappa B signaling pathways. J. Immunol. 171:10351041. Wang Q, Wang X, Evers BM. 2003. Induction of cIAP-2 in human colon cancer cells through PKC delta/NF-kappa B. J. Biol. Chem. 278:51091 51099. Yanai A, et al. 2003. Helicobacter pylori induces anti apoptosis through nuclear factor-kappaB activation. J. Infect. Dis. 188:17411751. Zhang JZ, Sinha M, Luxon BA, Yu XJ. 2004. Survival strategy of obligately intracellular Ehrlichia chaffeensis: novel modulation of immune response and host cell cycles. Infect. Immun. 72:498 507. Zhou H, Li XM, Meinkoth J, Pittman RN. 2000. Akt regulates cell survival and apoptosis at a postmitochondrial level. J. Cell Biol. 151:483 494. Zhu D, et al. 2006. Deactivation of phosphatidylinositol 3,4,5trisphosphate/Akt signaling mediates neutrophil spontaneous death. Proc. Natl. Acad. Sci. U. S. A. 103:14836 14841.

April 2012 Volume 80 Number 4

iai.asm.org 1623