Eur. J. Biochem.

231, 823-830 (1995) 0 FEBS 1995

Isolation and structural characterization of trimeric cyanobacterial photosystem I complex with the help of recombinant antibody fragments
Georgios TSIOTIS ' , 2 , Winfried HAASE', Andreas ENGEL2 and Hartmut MICHEL' Max-Planck-Institut fur Biophysik, Frankfurt am Main, Germany Maurice E. Muller-Institute for Microscopical Structural Biology at the Biozentrum, University of Basel, Switzerland (Received 27 April 1995) - EJB 95 0668/3

A monoclonal antibody was derived from mice immunized with the native trimeric, photosystem I (PSI) complex from the cyanobacterium Synechococcus PCC 7002 which reacts with a conformational epitope of the PSI complex. As seen by immunoelectron microscopy, the mAb bound to the stromal side of the thylakoid membranes. The DNA sequence encoding variable regions of the mAb was cloned into recombinant plasmids, sequenced and expressed in Escherichia coli. ELISA, Western blots and immunoelectron microscopy provided evidence that the expressed paired variable domain (Fv) fragments bind to the antigen in the same way as the parent mAb. A one-step purification was applied to purify the trimeric PSI complex using an affinity tag attached to the Fv fragment. Analysis by gel electrophoresis and N-terminal sequencing revealed the presence of the p s d , psaB, psaC, psaD, psaE, psaF and psaL gene products. The antenna size of the isolated PSI/ Fv was 139 k 9 chlorophyll a/primary electron donor. Flash-induced absorption-change measurements showed that the complex exhibited electron transfer from the primary electron donor, P700,to the Fe-S center, FAIF,. The position of the bound Fv fragment on the trimeric PSI surface was determined by highresolution electron microscopy and digital image processing. Keywords. Monoclonal antibody ; recombinant antibody ; immunoaffinity chromatography ; immuno-gold labeling ; high-resolution electron microscopy.

Photosystem I (PSI) is a pigment-protein complex of the thylakoid membrane which mediates light-driven electron transfer from plastocyanin or cytochrome c553to ferredoxin. The PSI complex in cyanobacteria and higher plants is comprised of at least 12 polypeptides, which are products of the psaA-psaL genes (see Goldbeek and Bryant, 1991, for review). The major component of the photoreaction center is a heterodimer composed of the psaAlpsaB gene products, each of which has a molecular mass of 80 kDa. The heterodimer carries the following components : the antenna chlorophylls, the primary electron donor P700,the primary electron acceptor &, an intermediate acceptor A, and the [4Fe-4S] cluster F, (Lagoute and Mathis, 1989). The molecular masses of the remaining protein subunits are 4-20 kDa. The subunits derived from the p s d , psal, psaK, psaL and psaM genes are hydrophobic and are predicted to possess trans-membrane a helices. Three of the four extrinsic subunits (the psaC, psaD and psaE gene products) are located on the stromal side, whereas the psaF subunit is located on the lumen side of the thylakoid membrane (Wynn and Malkin, 1988; Zanetti and Merati, 1987). Fv fragments [heterodimers consisting of only the variable domain of the heavy chain (V,) and of the light chain (V,)] are
Correspondence to G . Tsiotis, Maurice E. Muller-Institute for Microscopical Structural Biology at the Biozentrum, University of Basel, Klingelbergstr. 70, CH-4056 Basel, Switzerland Abbreviations. Chla, chlorophyll a ; C,,-M, dodecyl-P-D-maltoside; Fv, paired variable domains; V,, heavy-chain variable region; V,, lightchain variable region; PSI, photosystem I; P,, primary electron donor; STEM, scanning transmission electron microscopy.

the minimal fragments of antibodies required for antigen binding. Expression of functional Fv fragments in Escherichia coli has been reported (Skerra and Pluckthun, 1988). Moreover, the generation of affinity peptides which are fused to the recombinant protein at the genetic level permit their detection and purification (Evan et al., 1985; Munro and Pelham, 1986; Schmidt and Skerra, 1993). For example, the streptavidin affinity tag (Strep-tag) of recombinant Fv fragments allows purification by affinity chromatography on streptavidin-Sepharose (Schmidt and Skerra, 1993). The bifunctionality of engineered Fv fragments in binding both the antigen and streptavidin makes a one-step purification of membrane proteins by immune-complex chromatography possible (Kleymann et al., 1995b). Various purification procedures for the trimeric PSI complex from cyanobacterial thylakoid membranes have been developed. These procedures use detergents for extraction of the photosynthetic complexes from the membrane in combination with density gradient fractionation. Additional chromatographic methods or isoelectric focusing have been applied for further purification of the PSI complex (Almog et al., 1991; Rogner et al., 1990; Tsiotis et al., 1993; Witt et al., 1987). Although these procedures allow the isolation of the PSI complex in sufficiently large quantities and purity to permit crystallization, they are time consuming. The major advantage of one-step isolation procedures is the short isolation time and consequently reduced exposure of the protein to denaturing conditions. The one-step purification of the trimeric PSI complex of Synechococcus PCC 7002 described here employs the combination of tagged Fv fragments, which recognize the native trimeric PSI,

824

Tsiotis et al. ( E m J. Biochern. 231)

and streptavidin affinity chromatography. The purified trimeric PSI complexes were examined by electron microscopy and image processing.

The affinity column was prepared by coupling streptavidin to activated Sepharose-CH (Pharmacia). The C,,-M-solubilized membranes, at a protein concentration of 1.5 mg/ml, were first dialyzed against 100 mM Tris/HCl, 1 mM EDTA, 0.1 % NaN,, pH 8, then incubated with the Fv fragment for 2 h at room temMATERIALS AND METHODS perature in the dark. The sample was then loaded onto the strepProduction of mouse monoclonal antibodies. The trimeric tavidin column which had previously been equilibrated with the PSI complex was solubilized and purified as described pre- above buffer to which 0.05% C,,-M had been added. This soluviously (Tsiotis et al., 1993). Balb/c mice were first immunized tion was used to wash the column (5 vol.) and, after the addition with 20 pg PSI complex emulsified in ABM 2 complete adju- of 2 mM diaminobiotin (Sigma), to elute the bound PSI comvants (from Sebak) and subsequently injected with PSI in ABM 1 plex. incomplete adjuvants. Mouse spleen cells were fused with Flash-induced charge separation. The measurement of mouse myeloma cells (P3X63Ag8.653 cell line; Kearney et al., flash-induced charge separation was performed in a home-built 1979), following published procedures (Peters, 1990). The im- system in the the laboratory of Dr Mantele (University of Freimunoglobulin class, subclass and light-chain type were deter- burg, Germany). The measuring beam (tungsten-halogen lamp) mined using the mouse-hybridoma subtyping kit (Boehringer). was passed through a monochromator (model H25, Fa. I. S. A. Antibodies were purified from the supernatant of the hybridoma Jobin Yvon). A shutter placed between the monochromator and culture using a Protein G Sepharose 4 fast-flow column (Phar- the sample avoided sample excitation by the measuring beam. macia) as recommended by the manufacturer. A computer-controlled potentiostat (Sevenich-Gimbel model 11) Binding affinity of the mAbs to the native PSI complex. regulated the potential, and the light was detected by a Silicon The molecular interactions between the mAbs and the PSI com- photodiode combined with an amplifier and an interference filter plex were measured using the BIAcoreTMsystem (Pharmacia). (707 nm). Samples were excitatied with a Xenon flash lamp; a The procedure described by the manufacturer was used for the filter excluded spectral regions complementary to sample excitaimmobilization. The specific interactions were carried out at a tion. The signal was transfered to a computer and analyzed. continuous flow rate of 10mllmin in 20 mM MES, pH 6.5, and Immunoelectron microscopy. To isolate thylakoid mem0.05% dodecyl-P-D-maltoside (C,,-M) of PSI concentrations branes from Synechococcus PCC 7002, cells were suspended varying over 31.5-500 nM. The kinetic constants were deter- in 50 mM potassium phosphate, 1 mM benzamidine, 6-amino-nmined using the software supplied by the manufacturer. caproic acid, 0.1% NaN,, pH 8, and ruptured by passage through Cloning of the gene for the V, and V, regions of mo- a French press twice at 34.5 MP,. The membranes were colnoclonal antibodies. Total RNA was prepared from hybridoma lected by centrifugation at 30000g for 15 min at 4C. For cells (104- lo6 cells) using the guanidinium thiocyanate/cesium electron microscopy, the membranes were diluted 1:10 in chloride procedure (Lanick et al., 1989) and employed for first- 150 mM NaCl, 1.5 mM KH,PO,, 2.5 mM KC1, 6.5 mM strand cDNA synthesis by oligo-dT priming, Amplification and Na,HPO,. 2 H,O, pH 7.3 (NaCW,) and a drop of the membrane cloning of the V, and V, gene domains were performed accord- suspension was placed on a Formvar coated grid. After adsorping to the method of Kleymann et al. (1995b). First, the purified tion for 5 min, grids were rinsed with NaCVP, and the memV, cDNA was cloned into the pASK68 plasmid. On this plas- branes were fixed with 4 % parafomaldeyde, 0.1 % glutaraldemid, the Strep-tag and the Myc-tag were added to the 3' termini hyde in NaCW,. After 5 min, the fixative was washed off and of the segments coding for the V, region and V, region, respec- the grids were incubated with 2% glycine in NaCVP,, followed tively. Clones were sequenced using the -Sequencing Kit from by a blocking step in NaCYP, containing 0.1% bovine serum Pharmacia. Then, the V, gene was inserted downstream of the albumin. Incubation with anti-PSI mAb was for 60 min at room V, sequences and plasmids containing both variable Ig domains temperature. Primary antibodies were labeled with goat antiwere used for expression in E. coli strain JM 83. Expression mouse IgG+IgM antibodies coupled to 10 nm gold particles and purification of the Fv fragment in E. coli were performed (1 :5 - 20, 20 min). After washing, the specimens were again according to the method of Schmidt and Skerra (1993). fixed with 1% glutaraldehyde in NaClP, (10 min), washed with Immunoblot analysis. Gel electrophoresis was carried out water, then negatively stained with 2% uranyl acetate. Specias described by Ikeuchi and Inoue (1988) with 12.5-22.5% polyacrylamide gradient gels containing 3.2 M urea. A Biometra mens were examined in a Philips EM 300 or CM 12 electron fast blot apparatus was used for immunoblotting onto Immobilon microscope. Thylakoid membranes adsorbed to Formvar coated membranes (Millipore). Unspecific binding sites were blocked grids were incubated for 30-120min with the Fv fragments. with 1% bovine serum albumin in 10 mM Tris/HCl, pH 8, Binding of the fragments was detected either by streptavidin150 mM NaCl and 0.05 % Tween-20. The blots were subse- gold (1 : 10) or by sequential labeling with mAb 9E10 (1: 1000quently incubated for 1 h at room temperature with either hybri- 4000), then with goat anti-mouse IgG+IgM (1 :5) coupled to doma supernatant or mAb 9E10 for the detection of the Myc- gold particles. After removing unbound components, specimens tag on V,. Bound antibody was visualized using a goat anti- were fixed, washed and negatively stained, then inspected under mouse-IgG-alkaline-phosphatase conjugate (Sigma), followed the electron microscope. Scanning transmission electron microscopy (STEM) and by incubation with 5-brom-4-chlor-indolyl phosphate and nitroblue tetrazolium chloride. The V,-Strep-tag was detected by in- image processing. Samples were adsorbed to glow-discharged cubation with streptavidin-alkaline-phosphatase conjugate thin carbon films supported by fenestrated films on gold-coated copper grids. After washing with water, samples were stained (1 : 1000 dilution) and developed as described above. Solubilization of membranes and immunoaffinity chro- with uranyl formate (0.75 %) and subsequently placed in a prematography. Thylakoid membranes were purified as described treatment vacuum chamber directly connected to a Vacuum Genpreviously (Tsiotis et al., 1993) and suspended in 20 mM Tris/ erators HB5 STEM. Elastic annular dark-field images were reHCl, 1mM EDTA, 0.1% NaN,, pH 8. Solubilization was per- corded at 100 kV acceleration voltage and doses of 2000-4000 formed by addition of C,,-MIChla at a ratio of 12 : 1, and stirring electrons/nm2. Mass measurement performed with STEM, digigently for 60 min at 4C. The insoluble material was removed tal acquisition of the images and the microscope parameters was by centrifugation at 150000 g for 50 min. carried out as previously described (Miiller et al., 1992).

Tsiotis et al. (Eur. J. Biochem. 231)

825

Fig. Lon-grid immunogold labeling of isolated thylakoid membranes from Synechococeus PCC 7002 with mAb 1E7 (A) and control labeling (B). Contol labeling was performed using only the secondar gold-coupled antibody (goat anti-mouse). On-grid immunogold labeling of isolated thylakoid membranes from Synechococcus PCC 7002 with a mixture of mAbs (1E7, 5Bll) directed against PSI (C).

For single-particle averaging, well preserved particles sampled at 0.35 nm were selected interactively, using the SEMPER image processing system installed on a VAX 3100 work station. 325 particles were selected for the PSI control and 411 particles for the PSVFv complex, each comprising 64x64 pixels. In the first step, the images were aligned with correlation techniques, starting with a single projection as first reference. Intermediate references were constructed from the sums of the best particles as estimated from their correlation with the reference. In the next step, over 60% of the aligned particles were submitted to multivariate statistical analysis and automatic classification (Frank et al., 1987; van Heel, 1984). The six largest classes were then averaged individually and used as references for further refinement.

press) generated a mixture of membrane fragments of various sizes. mAb 1E7 labeled only one side of the thylakoid membrane (Fig. 1A). To identify which surface this was, labeling was carried out with a mixture of mAb (5Bll) against the stroma1 psaD protein (Tsiotis, G., unpublished data), and mAb 1E7 (Fig. 1C). The combined antibodies only reacted with one side of the membranes. Consequently, mAb 1E7 also labeled the stroma1 side of the thylakoid membrane.

RESULTS Characterization of mAbs. ELISA documented the binding of the mAb to the native trimeric PSI. In addition, the kinetic constants k,,, = 1.68X105M-' s-' and K = 8.84X108M-' for the interaction between PSI and mAb were determined by surface plasmon resonance (BIAcorem, Pharmacia). The reactivity of the mAb with the denatured PSI complex was determined by immunoblot analysis of the purified PSI complex, after separation of the subunits by SDSPAGE. The mAb 1E7 did not recognize denatured PSI proteins (data not shown). On electron micrographs, thylakoid membranes appear as flattened vesicles. Mechanical disruption (e.g. using the French

Cloning, sequencing and expression the Fv fragment cDNAs of the mAb. The cDNA coding for the V, and V, domains was prepared from the hybridoma cell line producing the mAb 1E7, and cloned into the expression plasmid pASK68 (Fig. 2). Analysis of the sequences showed that the V, chain of the mAb 1E7 Fv fragment contained an internal restriction site for PstI. As expected, the V, chain and V, chain possessed the two highly conserved cysteine residues in position 23/88 in the light chain and position 22/92 in the heavy chain, which form intramolecular disulfide bonds. In addition, the V, chain and V, chain carried the Myc-tag and the Strep-tag, respectively. Purification of the Fv fragment from the periplasmatic cell supernant of induced transformants was achieved in a single step by streptavidin affinity chromatography (Schmidt and Skerra, 1993). The antigen-binding affinity of the purified Fv fragments was assessed directly by ELISA, revealing the ability of the purified Fv fragment to bind to the trimeric PSI complex. Bound Fv fragments were detected using the binding properties of the Myc-tag and the Strep-tag peptides. Fv fragments

826
1E7 VH (I1 b)

Tsiotis et al. ( E m J. Biochem. 231)

PStI GAAGTTAAACTGCAGGAGTCTGGGGCTGGCCTGGTAAACTGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAGCTATGTTATGCACTG~TGAAG GluValLysLeuGlnGl uSerGlyAlaGlyLeuValLysProGlyAlaSerVa1LysMetSerCysLysAlaSerGlyTyrThrPheThrSerTyrValMetHisTrpVal Lys 1 -CDR1---CAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATATTAATCCTTACAATGATGGTACT~GTACAATGAGAAGTTCAAAGGCAAGGCCACACTGACTTCAGAC~TCCTCC GlnLysProGlyGlnGlyLeuG1uTrpIleGlyTyrIleAsnPro~rAsnAspGl~hrLysTyrAsnGluLysPheLysGlyLysAlaThrLeuThrSerAspLysSerSer

----------------CDRI=======================

AGCACAGCCTACATGGAACTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAGGGACTATAGGTACGACGTATGGTACTATGCTATGGACTACTGGG SerThrAlaryrMetGluLeuSerSerLeuThrSerGluAspSerAlaVal~rTyrCysAlaArgAspTyrArgTyrArg~rAspValTrpTyrTyrAlaMetAsp~rTrpGlyGln CDR3103 BstEIIl GGCACCACGGTCACCGTCTCCTCAGCGTGGAGGCATCCACAGTTCGGAGGCTAA GlyThrThrVal ThrVal SerSerAl aTrpArgHisProGlnPheGlyGlyEnd =3 strep-tag e

lE7 VH
SStI

(K iv)

Pstr GACATCGAGCTCACCCAGTCTCCAGCAATCATGGCTGCATGGCTGCATCTCCC~GGAGAAGATCACTATCACCTGCAGTGTCAGCTC~GTATAAGTTCCAAACTTTCTTGCATTGGTATCAG AspIl eG1 uLeuThrGlnSerProAlaI1eMetAl aAl aSerProGlyG1uLysIl eThrIl eThrCysSerVa1SerSerSerIl eSerSerLysPheLeuHisTrpTyrGln _1 C D R l = -

CAGAAGCCAGGATTCTCCCCTAAACTCTCTTGATTTATAGGACATCCAATCTGGCTTCTGGAGTCCCAGCTCGCTTCAGT~CAGTGGGTCTGGGACCTCTTACTCTCTCACAATT GlnLysProGlyPheSerProLysLeuLeuI1eTyrArgThrSerAsnLeuAlaSerGlyVa1ProAlaArgPheSerGlySerGlySerGl~hrSerTyrSerLeuThrIle _______ -----CJjRz======= XhoI GGCACCATGGAGGCTGAAGATGTTGCCACTTACTACTGCCAGCAGGGTAGTAGTATACCATTCACGTTCGGAGGAGGCACC~G~TCGAG ATCAAACGGGAACAAAAACTCATC GlyThrMetG1uAlaG1uAspVa1AlaThrTyrTyrCysGlnGlnGlySerSerIleProPheThrPheGlyGlyGlyThrLysLeuGluI1eLysArgGluGlnLysLeuI1e -____ CDR3 100 myc-tag

TCAGAAGAGGATCTGAATTAA SerGluG1 uAspLeuAsnEnd

c=

Fig. 2. Nucleotide and deduced amino acid sequences of the V, and V, genes of the mAbs generated against the PSI complex. The complementary-determining regions are indicated by a double stroke. The numbering is according to Kabat et al. (1991). The restriction sites PstI. BstEII, SsrI and XhoI used for cloning of the synthetic gene are shown at the beginning and at the end of each sequence.

bound to the thylakoid membranes were detected by electron microscopy using the mAb 9E10 in combination with anti(mouse 1gG)-gold for visualization of the V, chain and streptavidin-gold for visualization of the V, chain (Kleymann et al., 1995a). The purified Fv fragments were found to specifically label only one side of the thylakoid membrane (Fig. 3), corroborating the results with whole mAbs (see Fig. 1).

Purification of the trimeric PSI and spectroscopic analyses. The effect of pH on the purification of trimeric PSI was examined by solubilizing the thylakoid membrane in different buffers ranging over pH 7-9. pH 8 was found to be optimal for the purification of the complex. Furthermore, the yield of purified PSI complex was doubled by increasing the incubation time to 2 h for the Fv fragment with the solublilized thylakoid at room temperature (in the dark) in 100 mM TrisMCl, 1 mh4 EDTA, pH 8. The resulting protein solution, after incubation with the Fv fragments, was subjected to streptavidin affinity chromatography. Upon elution with diaminobiotin, a specific sharp protein peak was observed (Fig. 4) representing about 38% of the PSI complexes present in the thylakoid membrane. The protein composition of the eluted complex was examined by SDSPAGE (Fig. 5). In the eluted complex (Fig. 5 , lane 3), the same proteins were present as in the trimeric PSI complex isolated by the conventional protocol (Fig. 5A, lane 1) namely the psaA,-B,-C,-D,-E,-F,-L gene products and two smaller proteins (presumably psaJ and psaK subunits). Two additional bands migrated with an apparent molecular mass corresponding to that of the V, and V, chains of the Fv fragment (Fig. 5, lane 2). The identity of these bands was confirmed by immunoblot analysis using antibodies specific for the Myc-tag and the Streptag, respectively (Fig. 5, lanes 4 and 5). Mass analysis of the freeze-dried unstained PSVFv complex by STEM yielded a sin-

gle mass peak at 983 2 74 kDa ( n = 1189). The obtained molar mass is similar to the molar mass of the trimeric control PSI complex which was determinated by gel-filtration HPLC and by sedimentation equilibrium analysis (Tsiotis et al., 1993 ; Tziatzos et al., 1994), thus confirming that the eluted complex is a PSI trimer. The absorption spectrum of the purified PSVFv complex exhibits maxima at 437 nm and 678 nm (Fig. 6). The 437-nm Soret band and the 678-nm band are typical of Chla. The spectrum indicates that no phycobilisome pigments (with peaks at 600650 nm) were present. A value of 123" 10 for the ChlalP,,, ratio of the purified complex was derminated chemically by oxidized-minus-reduced difference spectroscopy. In comparision, the molar ratio of ChlalP,, was 139 -+ 9 by measuring the amplitude of flash-induced absorption changes at 700 nm. The recovery half time of 30 ms observed by this technique is characteristic for the back reaction between the terminal electron acceptor FJF, and the primary electron donor P,, (Ke, 1972).

Structural characterization of the purified PSI complex. Negatively stained complexes were examined by STEM. Topview particles were selected from electron micrographs of isolated trimeric PSI complexes (control, absence of the Fv fragment) and of the PSIEv complexes for image processing. After a first cycle of angular and translational alignments, multivariate statistical analysis and classification of the projections were performed according to the method of van Heel (1984) and Frank et al. (1987). Averages from the six largest classes were used as reference for a subsequent alignment procedure (Figs 7 and 8). Further analysis of the images showed all six classes to have the same handedness in the case of the control PSI complex (Fig. 7). In contrast, in the case of the PSWv complex, while five classes showed the same handedness (Fig. 8a-e), one was of the oppo-

Tsiotis et al. (Eul: J. Biochem. 231)

827

Fig.3. On-grid immunogold labeling of isolated thylakoid membranes from Synechococcus PCC 7002 with Fv fragment from mAb 1E7 fused to c-Myc- or Strep-tag peptides. Detection of binding sites was either by the anti-c-Myc mAb 9E10 and a gold-coupled goat anti-mouse serum (A) or by strep-Av-gold (B). In controls (C and D), the Fv fragments were omitted using either only the anti-c-Myc-tag peptide mAb 9E10 and the gold-coupled goat anti-mouse serum ( C ) or the gold-coupled streptavidin ligand (D).

Fig. 4. Elution profile of the thylakoid extracts with the Fv fragment at 280 nm on a streptavidin-Sepharosecolumn. The immobilized PSI/ Fv complex was specifically eluted by the addition of 2 mM diaminobiotin to the buffer.

Wash

-+ Diarninobiotin

Fig. 5. SDS/polyacrylamide gel electrophoresis of PSI control (lane 1) and of purified and of purified Fv fragment (lane 2) and of purified PSVFv complex stained with Coomassie blue (lane 3). Immunoblot to detect the V,-Strep-tag (lane 4) and V,-Myc-tag (lane 5 ) in the purified PSI/Fv complex.

site handedness (Fig. 80. To visualize the difference between the control PSI complex and the PSVFv complex, the averages of the projections in Fig. 7a-f (control PSI complex), and of the projections in Fig. 8 a-e (PSI/Fv complex) were calculated. The normalized final images (Fig. 9 a,b) were then subtracted to yield a difference map (Fig. 9c). This map exhibits domains of 5.2 nm length and 3.2 nm width. The contour half-maximum of the difference image was superimposed on the image of the control PSI complex to visualize the localization of the Fv fragments with respect to each PSI monomer (Fig. 9d). Accordingly, one Fv fragment is located at the end of the each central domain close to the monomer contact positions. The outermost contours

of both complexes are rather similar and possess a diameter of 18 nm.

DISCUSSION
This study describes the one-step purification of the trimeric PSI complex from the cyanobacterium Synechococcus PCC 7002 using a recombinant antibody Fv fragment containing an affinity tag. The mAb seems to recognize a conformational epitope of the trimeric PSI complex since it did not react with the

828

Tsiotis et al. (Eur: J. Biochem. 231)

<

Fig. 8. Image analysis of top-view projections of the purified PSI/Fv complex. The final classification yields decomposition into six classes (a-f). While classes (a-e) exhibit indentical handedness, class f has the opposite handedness, suggesting that these complexes have adsorbed to the grid in the opposite orientation. Bar represents 5 nm.

500

750

Wavelength (nm)

Fig. 6. Absorption spectrum of the purified PSI/Fv complex. A, relative absorbance.

Fig.9. Final result of single particle averging. Sum of the a-f projections from Fig. 7 of trimeric PSI complex (A). Sum of the a-e from Fig. 8 projections of the PSWv complex (B). Difference image between A and B. The trimetric PSI complex with the half-minimum contour of the difference map ( C ) overlaid.

Fig.7. Image analysis of top-view projections of the trimeric PSI complex. The final classification yields decomposition into six classes (a-f). Bar represents 5 nm.

denatured PSI polypeptides in immunoblots. Immunoelectron microscopy demonstrated that the mAb labels the stromal side of the thylakoid membranes. Furthermore, in situ labeling showed that the distribution of the PSI complex over the stromal side of the thylakoid membrane is relatively uniform. Similar results were obtained in an immunolabeling experiment of thylakoid membranes from the red algae Porhyridium cruentum, in which PSI was labeled with antisera specific for the psaA and psaB proteins (Mustardy et al., 1992). The high density of immunolabeled PSI reflects the relatively high amount of PSI present in thylakoid membranes (Melis, 1991). Expression of Fv fragments and their secretion into the periplasmatic cell compartment in E. coli was achieved using the expression vector pASK68 (Kleymann et al., 1995b). The high expression level and the presence of the Strep-tag in the V, chain allowed us to use the recombinant Fv fragment for the one-step purification of the trimeric PSI complex by immuno-

complex chromatography (Kleymann et al., 1995b). The extremely mild conditions employed for the elution permitted the isolation of the native PSI/Fv complex which exhibited full photoreactivity. The PSUFv complex described here contained 120140 ChlalP,,,. In reports on isolated PSI complexes from Synechoccocus sp. PCC 6301 (Lundell et al., 1985), Synechocystis PCC 6803 (Setif et al., 1987), Synechocystis PCC 6803 (Rogner et al., 1990) and Synechococcus PCC 7002 (Tsiotis et al., 1993), the ChlaP,,, value ranged over 75-130. These results indicate that not only the cell material used, but also the preparation procedures, and the differences in the P700determination methods may have an influence on the measured ChlalP,,, ratios (Goldbeck and Bryant, 1991). The number of subunits in the affinity-purified PSWv complex was the same as that found in PSI complexes isolated by a different and much more time consuming procedure (Tsiotis et al., 1993). According to SDSPAGE and N-terminal sequencing, the latter PSI complex comprised of the p s d , psaB, psaC, psaD, psaE, psaF and the psaL gene products. Therefore, the same proteins were also present in the PSI/Fv complex. As revealed by electron microscopy, both complexes are approximately 18 nm in diameter, which is in excellent agreement

Tsiotis et al. (Eul: J. Biochem. 231)

829

with the value reported previously for trimeric PSI complexes of cyanobacteria (Boekema et al., 1989). Recently, two different top views of the trimeric PSI complex from Synechocytis PCC 6803 have been observed ( h i p et al., 1993). However, so far, the identification of the stromal and the luminal surfaces has not been achieved. The multivariate statistical analysis and subsequent classification of the control PSI and of the PSVFv complex yielded six major classes in each case. For the PSI/Fv complex, these could be subdivided in two classes with different handedness. The projection of the control PSI compkx shows a prominent ridge on one side of the complex. A similar topography has been observed for the PSI complex from the thermophilic Synechococcus sp. clone OD 24 (Ford et al., 1990). The trimeric PSI complex contains three epitopes for recognition by the Fv fragment. Affinity chromatography allows the selective retention of the PSVFv complex from the detergentsolubilized thylakoid extract. The difference image between the PSWv and the PSI complex clearly shows that each monomer binds a single Fv fragment. This underlines the homogeneity of the PSI/Fv complex with respect to the bound Fv fragments. Further evidence for the homogeneity of the PSWv complex is provided by the STEM mass data, which show the existence of a homogenous PSWv species. In addition, the information contained in the trimeric organization of the complex contributes to the epitope, since the trimer was selectively removed from the thylakoid extracts by immuno-affinity purification. The binding of the Fv fragment to thylakoid membranes in situ and the recognization of only the trimeric form from the thylakoid extracts, is evidence that this form of PSI exists in the thylakoid membranes (Hladik and Sovrova, 1991; h i p et al., 1994). Finally, the interactions between the polar surface domains of membrane proteins are responsible for the formation of threedimensional crystals (Michel, 1991). The binding of the Fv fragment to the PSI complex increases the hydrophilic moiety in the PSI complex and so may facilitate crystalIization.
The authors thank F. Lottspeich for performing the amino acid sequencing, G. Kleymann and C. Ostermeier for advisory help regarding hybridoma techniques and the cloning procedure of the Fv fragment, E. Hamacher for the flash-induced P,, measurement, K. Goldie for the electron micrographs, K. Heitmann for immunogold staining, S. Miiller for the STEM mass analysis, and C. A. Schoenenberg for critical reading of the manuscript. The project was supported by the Max-Planck-Gesellschafi, the M. E. Miiller-Foundation of Switzerland and the Department of Education of the Kanton Basel-Stadt.

REFERENCES
Almog, O., Shoham, G., Michaeli, D. & Nechustai, R. (1991) Monomeric and trimeric forms of photosystem I reaction centers of Mastigocladus laminosus : Crystallization and prelimary characterization, Proc. Nut1 Acad. Sci. USA 88, 5312-5316. Boekema, E. J., Dekker, J. P., Rogner, M., Witt, H. T. & van Heel, M. (1989) Refined analysis of the trimeric structure of the isolated photosystem I complex from the thermophilic cyanobacterium Synechococcus sp, Biochim. Biophys. Actu 974, 81 -87. Evan, G. I., Lewis, G. K., Ramsay, G. & Bishop, J. M. (1985) Isolation of monoclonal antibodies specific for the c-myc proto-oncogene product, Mol. Cell. Biol. 5, 3610-3616. Ford, C. R., Hefti, A. & Engel, A. (1990) Ordered arrays of the photosystem I reaction center after reconstitution : Projections and surface reliefs of the complex at 2 nm resolution, EMBO J. 9, 3067-3075. Frank, J., Bretaudiere, J.-P., Carazo, J.-M., Verschoor, A. & Wagenhecht, T. (1987) Classification of images of biomolecular assemblies: A study of ribosomes and ribosomal subuntis of Escherichia coli, J. Microsc. 150, 99-115. Goldbeck, 3. & Bryant, D. (1991) Photosystem I in Current topics in bioenergetics (Lee, C. P., ed.) vol. 16, pp. 83-177, Academic Press, New York.

Hladik, R. & Sovrova, D. (1991) Does the trimeric form of the photosystem I reaction center of cyanobacteria in vivo exist? Photosynth. Res. 29, 171-175. Ikeuchi, M. & Inoue, Y. (1988) A new 4.8 kDa polypeptide intrinssic to Photosystem I1 reaction center, as revealed by modified SDSPAGE with improved resolution of the low molecular-weigth proteins, Plant Cell Physiol. 29, 1233-1239. Kabat, E. A., Wu, T. T., Perry, H. M., Gottsmann, K. S. & Foeller, C. (1991) Sequences of proteins of immunological interest, U. S. Dept. of Health and Human Services, U S . Goverment Printing Office, Washington, DC. Ke, B. (1972) One-way electron dischange subsequent to the photochemical charge separation in photosystem I, Biochim. Biophys. Acta 267, 595 -599. Keamey, J. F., Radbruch, A,, Liesengang, B. & Rajewsky, K. (1979) A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines, J. Immunol. 123, 1548-1551. Kleymann, G., Ostermeier, C., Heitmann, K., Haase, W. & Michel, H. (1995a) Use of Fv fragments in immunochemistry, J. Histochem. Cytochem., in the press. Kleymann, G., Ostermeier, C., Skerra, A., Ludwig, B. & Michel, H. (1995b) Engineered Fv fragments as a tool for one step purification of membrane proteins, Biotechnology 13, 155- 160. Kruip, J., Bald, D., Boekema, E. & Rogner, M. (1994) Evidence for the existence of trimeric and monomeric photosystem I complexes in the thylakoid membranes from cyanobacteria, Photosynth. Res. 40, 279-286. Kruip, J., Boekema, E., Bald, D., Boonstra, A. & Rogner, M. (1993) Isolation and structural characterization of monomeric and trimeric photosystem I complexes (P700FA/F, and P700F,) from the cyanobacterium Synechocystis PCC 6803, J. Biol. Chem. 268, 2335323 360. Lagoute, B. & Mathis, P. (1989) The photosystem I reaction center: structure and photochemistry, Photochem. Photobiol. 49, 833- 844. Lanick, J. W., Danielsson, L., Brenner, C. S . , Wallace, E. F., Abrahamson, M., Fry, K. E. & Borrebaeck, C. A. K. (1989) Polymerase chain reaction using mixed primers: cloning of human monoclonal antibody variable region genes from single hybridoma cells, Biotechnology 7,934-938. Lundell, D. J., Glazer, A., Melis, A. & Malkin, R. (1985) Characterization of a cyanobacterial photosystem I complex, J. Biol. Chem. 260, 646-654. Melis, A. (1991) Dynamics of photosynthetic membrane. Composition and function, Biochim. Biophys. Acra 1058, 87-106. Michel, H. (1991) General and practical aspects of membrane protein crystallization in Crystallization of membrane proteins (Michel, H., ed.) pp. 73-89, CRC press, Boca Raton Ann Arbor, Boston. Miiller, S. A., Goldie, K. N., Buerki, R., Hearing, R. & Engel, A. (1992) Factors influencing the precision of the quantitative scanning transmission electron microscopy, Ultramicroscopy 46, 317 - 334. Munro, S. & Pelham, H. (1986) An hsp-70 like protein in the ER: Identity with the 78 kDa glucose-regulated protein and immunoglobulin heavy chain binding protein, Cell 46, 291-300. Mustardy, L., Cunningham, J. F. X. & Gantt, E. (1992) Photosynthetic membrane topography: Quantitative in situ localization of photosystems I and 11, Proc. Nut1 Acad Sci. USA 89, 10021-10025. Peters, J. H. (1990) Zellfusion zur Herstellung von monoklonalen Antikorper der Maus, in Monoklonale Antikoerper (Baumgarten, H. & Peters, I. H., eds), pp. 150-157, Springer-Verlag, Berlin Heidelberg. Rogner, M., Nixon, P. J. & Diner, B. (1990) Purification and characterization of photosystem I and photosystem I1 core complexes from wild-type and phycocyanin-deficient strains of the cyanobacterium Synechocystis PCC 6803, J. Biol. Chem. 265, 6189-6196. Schmidt, T. & Skerra, A. (1993) The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional Ig Fv fragment, Prot. Eng. 6, 109122. Setif, P., Ikegami, I. & Biggins, J. (1987) Light-induced charge separation in photosystem I at low temperature is not influenced by vitamin K-1, Biochim. Biophys. Acta 894, 146-156. Skerra, A. & Pliickthun, A. (1988) Assembly of a functional immunoglobulin Fv fragment in Escherichia coli, Science 240, 1038-1041.

830

Tsiotis et al. ( E m J. Biochern. 231) Witt, I., Witt, H., Gerken, S., Dekker, J. P. & Rogner, M. (1987) Crystallization of photosystem I of photosynthesis, FEBS Lett. 221, 260264. Wynn, R. M. & Malkin, R. (1988) Interaction of plastocyanin with photosystem I: A chemical cross-linking study of the polypeptide that binds plastocyanin, Biocltemistv 27, 5863-5869, Zanetti, G . & Merati, G . (1987) Interaction between photosystem I and ferrodoxin, Identification by chemical cross-linking of the polypeptides which binds ferrodoxin, Eul: J. Biochem. 169, 143-146.

Tsiotis, G., Nitschke, W., Haase, W. & Michel, H. (1993) Purification and crystallization of photosystem I complex from a phycobilisomeless mutant of the cyanobacterium Synechococcus PCC 7002, Photosynth. Res. 35, 285-297. Tziatzos, C., Schuck, P., Schubert, D. & Tsiotis, G . (1994) The molar mass of an active photosystem I complex from the cyanobacterium Synechococcus PCC 7002, Z. Naturforsch. 49, 220-222. van Heel, M. (1984) Multivariate statistical classification of noise images (Randomly oriented biological macromolecules), Ultrurnicroscopy 13, 165-184.