2009-1buffalo Bulletin

International Buffalo Information Center BUFFALO BULLETIN
ISSN : 0125-6726
(IBIC)
Aims Buffalo Bulletin is published quarterly in March,

June, September and December. Contributions on
IBIC is a specialized information center on any aspect of research or development, progress
water buffalo. Established in 1981 by Kasetsart reports of projects and news on buffalo will be
University (Thailand) with an initial financial considered for publication in the bulletin. Manu-
support from the International Development scripts must be written in English and follow the
Research Center (IDRC) of Canada. IBIC aims at instruction for authors which describe at inside of
being the buffalo information center of buffalo the back cover.
research community through out the world.
Main Objectives Editor

S. Sophon
1. To be world source on buffalo
information
2. To provide literature search and Publisher
photocopy services International Buffalo Information Centre,
3. To disseminate information in Main Library, Kasetsart University
newsletter
4. To publish occasional publications
such as an inventory of ongoing Online availible:
research projects http://ibic.lib.ku.ac.th/e-Bulletin
BUFFALO BULLEITN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688
Buffalo Bulletin (March 2009) Vol.28 No.1
HAEMATOLOGICAL ALTERATIONS DURING DIFFERENT AFFECTIONS OF FEMALE

GENITAL ORGANS IN BUFFALOES IN
THE MALWA REGION 0F MADHYA PRADESH
Durgesh Mittal, U.K. Garg, G.P. Jatav*, Supriya Shukla, M. Raipuria and Ashok Walke
ABSTRACT the huge buffalo population, animal husbandry and

dairy sectors do not provide a great percentage of
The blood of 504 buffaloes was examined total agricultural income as low productivity of our
for any affection of female genital organs. The result buffaloes is considerably affected by inherent
of present study indicated that the various problems like late maturity, poor oestrus
pathological conditions of genital organs revealed expressiveness in the female particularly during
alterations in the hematological parameters. The summer, long post partum interval, diseases of the
material was collected from Cantonment Board genital system and infertility. The present
Slaughter House, Mhow (M.P.). The total investigation was carried out on the female genital
erythrocyte count was higher than the normal with organs to investigate the possible relationships of
increased packed cell volume (PCV) and certain haematological values, viz. total erythrocyte
haemoglobin (Hb). There was moderate count (TEC), packed cell volume (PCV),
lymphocytosis, neutrophillia, eosinopenia and a haemoglobin (Hb), mean corpuscular volume
decrease in the monocyte count. Total plasma protein (MCV) and total plasma protein.
values were higher than the normal in all the
affections of the genital organs.
MATERIALS AND METHODS
Keywords: haematology, pathological conditions,
genital organs, buffalo, total erythrocyte count, PCV, The materials for the present study
Hb, total plasma protein. comprised female genital organs and blood samples
obtained from buffaloes which were slaughtered at
the Cantonment Board Slaughter House, Mhow,
INTRODUCTION (M.P.) and which had been brought from the
different parts of the Malwa region as a source of
The buffalo is the predominant domestic meat. The female genital organs of a total of 504
animal for milk and meat production. On average, buffaloes ranging from 3 to 12 years of age were
buffaloes are about four times as productive as examined. To determine the hematological changes,
average indigenous cows in India. India has the the blood samples were collected during slaughter
world’s best dairy buffalo breeds and provides of buffalo in a sterile vials containing anticoagulant,
superior buffalo germplasm to several countries of ethylene diamine tetra acidic acid (EDTA) @ 2 mg/
the world (Kaikini, 1992). In our country, there are ml of blood. The hematological parameters TEC,
93.8 million buffaloes (Anon, 2000), which constitute PCV, Hb, MCV and total plasma protein were
more than half of the total buffalo population (164.9 determined as per the procedures described by Jain
million) in the world. Recently, India has emerged (1986).
as the largest milk producer in the world. In spite of
Department of Veterinary Pathology, College of Veterinary Science and A.H., Mhow, M.P., India
*e-mail: drgpjatav2007@rediffmail.com
1
RESULTS AND DISCUSSION In the present study, the plasma protein

values were much higher (12.26-13.5 g/dl) than the
The hematological changes observed during mean values (6.8-7.7 g/dl) mentioned by Brar et al.
the present study are as shown in Table 1. Total (2000), which reflected a significant increase during
erythrocyte count was observed higher than the the different affections of female genital organs of
normal values but within the range of the different buffaloes as compared to normal. In the present
pathological affections of female genital organ findings, the MCV values were significantly higher
(7.17+0.3 to7.5+0.7) except in case of affections of (60.11-61.78 g/dl) than the normal mean values.
ovary, fallopian tube and tumors of genital organs, These values were much higher than the range (42-
in which the total erythrocyte count was almost same 58 g/dl) given by Brar et al., (2000).
as normal values described by Jain (1986). On the
contrary, the PCV was found to be increased in all
the conditions, ranging from 40+1.35 to 45.5+3.88 REFERENCES
as against the normal value of 31.0 (Jain, 1986).
The values of hemoglobin (Hb) under different Brar R.S., H.S. Sandhu and A. Singh. 2000.
affections of female genital organs encountered in Veterinary Clinical Diagnosis by
the present study were compared with normal Laboratory Methods. Kalyani Publishers,
ranges, and it was evident that the values of Hb New Delhi. p. 28-30.
were higher in all pathological conditions of the Jain, N.C. 1986. Schalms Veterinary Haematology,
genital organs (i.e. 14-14.57g/dl), except in case of 4th ed. Lea and Febiger, Philadelphia.
affections of ovary, fallopian tube and tumors of Kaikini, A.S. 1992. Dimensions of infertility or ste-
genital organs, in which the values were within the rility in cattle and buffaloes. Indian
normal range (9-13.5 g/dl) observed by Jain (1986). J.Anim.Reprod., 13: 10.
Table 1. The mean values of haematological alterations in buffaloes in different affected organ of female
genitalia (Mean + SE).
Affected
No.
female genital PCV TPP Hb TEC MCV
of
organs / Blood (%) (g/dl) (g/dl) (×103/cu.mm) (f l)
cases.
Parameters
13.03±
Ovary 19 42.45±1.08 13.7±0.33 6.88±0.22 61.3±0.65
0.18
Fallopian Tube 7 41±1.53 13.22±0.44 13.4±0.47 6.75±0.3 60.82.±0.79
12.96±
Uterus 20 43.8±1.06 14.57± 0.36 7.28±0.17 60.11± 0.05
0.17
13.17±
Vagina 07 43.57±2.6 14.14± 0.86 7.16±0.36 60.57±0.52
0.30
Cervix 02 45.5±3.88 12.6± 0.14 14± 0.7 7.5±0.7 60.76± 0.54
Broad ligament 15 43.46±1.53 12.26±0.17 14.1±0.46 7.17±0.3 61.78± 1.19
Tumor 05 40±1.35 13.5±0.87 13.1±0.43 6.66±0.22 60
Given by Jain
Normal values (1986) and Mean value
6.8-7.7 9-13.5 5.5-8.5 42-58
for buffaloes Brar et al. 31
(2000)
Jain (1986) and Brar et al. (2000).
2
A CASE OF OSTEOCHONDROMA IN A SHE-BUFFALO
V. Rama Devi1, G. Veeraiah2, P. Annapurna1 and N. Sailaja1
ABSTRACT HISTORY AND OBSERVATIONS
The present paper reports a case of A she buffalo aged about eleven years
osteochondroma of tibia involving the hock joint in a was brought to the Veterinary Dispensary, Pippara,
she buffalo aged about eleven years. The gross and A.P, with a small lemon-sized growth which had
histopathological changes of osteochondroma are been developing for the past three years, on the
discussed. lateral aspect of left hock joint. An accidental fall
on the ground resulted in rupture of the growth from
Keywords: osteochondroma, she buffalo, tibia, which dark blood-colored fluid oozed out (Figure).
lesions On thorough examination, it was found that the
growth involved the distal end of tibia and it was
removed surgically. The tissue samples were sent
INTRODUCTION to NTR College of Veterinary Science, Gannavaram
for histopathological examination. The samples were
Osteochondroma is a cartilage-capped, processed routinely and the tissue sections were
exostotic benign tumor arising from the surface of a stained with H&E stain.
bone (Moulton, 1978). It is an evenly contoured
outgrowth from the surface of a bone with a bony
base and a cap of hyaline cartilage and may form in RESULTS AND DISCUSSION
any bone of endochondral origin. The condition is
more common in dogs, cats and horses and may be On histological examination, the tissue
monostotic or polyostotic ( Jones et al. 1996). Self sections revealed dense cellularity with proliferating
limiting metaplastic proliferations of cartilage sheets of chondrocytes with overlying
occurring in soft tissue may undergo ossification and perichondrium. At some places, endochondral
acquire the biphasic morphology of an ossification was also noticed. These changes
osteochondroma. Osteochondrosarcoma in the suggested the growth as osteochondroma and were
mammary gland of dog was reported by Shekar et similar to the changes described by Moulton (1978).
al. (2004). Clinical disease includes disfigurement, Grossly, osteochondromas appear as multiple bony
lameness, pain, paresis and paralysis. The present nodules near the growth plates. They are located
paper deals with a case of osteochondroma that on the cortical surface in the metaphyseal region or
developed from the distal end of tibia towards the toward the end of the diaphysis of a long bone
lateral aspect of the left hock joint in a she buffalo. (Moulton, 1978). In the present case, the growth
1
NTR Collge of Veterinary Science, Gannavaram, A.P., India
2
Veterinary Dispensary, Pippara, W.G. District, A.P., India
3
developed from the distal tibia and involved the hock inflammation of the hock joint may be the possible
joint. Histologically, osteochondromas are orderly predisposing factor of the osteochondroma.
biphasic growths with an epical margin of hyaline
cartilage and a bony base of cancellous bone and
intervening marrow spaces. A perichondrial REFERENCES
membrane continuous with the periosteum of the
host bone covers the surface of the osteochondroma. Jones, T.C., R.D. Hunt and N.W. King. 1996.
Chondrogenic activity of the membrane, followed Veterinary Pathology, 6th ed. Williams and
by the endochondral ossification, accounts for most Wilkins, Balitimore, USA. 941p.
of the growth of the osteochondroma (Meuten, Shekar, C.S., S.M. Sakthivelan, S.K. Vijayasarathi,
2002). Suguna Rao and M.J. Mahesh Kumar. 2004.
Several theories attempt to explain the Osteochondrosarcoma in the mammary gland
development of osteochondromas (Moulton, 1978). of dog. Indian J. Vet. Pathol., 28:73-74.
Some suggest origin from dysplasia involving the Meuten, D.J. 2002. Tumors in Domestic Animals,
margins of the growth plates. Other theories evoke 4th ed. Iowa State Press, Ames, Iowa, USA.
focal disturbances of the periosteum with 256p.
recrudescence of perichondrial activity by the Moulton, J. E. 1978. Tumors in Domestic Animals,
membrane. In the present case, trauma or 2nd ed. University of California Press, Los
Angeles, USA. 103p.
Figure. She-buffalo: Note the swelling with rupture and oozing of blood colored fluid on the hock joint.
4
ULTRASONOGRAPHY OF THE UDDER AND TEAT IN BUFFALOES
K. Rambabu, Makkena Sreenu, R.V. Suresh Kumar and T.S.C. Rao
ABSTRACT MATERIALS AND METHODS
Ultrasonography of the udder and teats The present study was carried on clinical
revealed various structures with different cases attended to clinic related to affections of udder
echogenecities.Various udder lesions, including and teats and randomly selected following thorough
mammitis, oedema, varicosity, haematoma, abscess, clinical examination by inspection palpation, probing,
atrophy and fibrosis, were diagnosed through and checking the milk flow from the teat.
ultrasonography. Sonographic diagnosis of teat Ultrasonography was conducted for assessing the
lesions included thelitis, intraluminal obstructions, normal and pathological conditions of the udder and
intraluminal foreign bodies, trauma/fistula, teat teat in buffaloes. After proper restraint of the
stenosis, atresia and fibrosis. Foreign bodies such buffaloes, the udder and teats were washed with
as haematoma and pus particles showed similar potassium permanganate lotion thoroughly and dried
echogenecity. with clean cloth for the ultrasonographic
examination. Ultrasonography was conducted in
Keywords: ultrasonography, udder and teats, sagital and transverse planes with GE Logiq
anatomy, lesions ultrasonographic machine with 7.5 MHz linear
transducer using the following gel application and
the images were recorded on Polaroid paper with a
INTRODUCTION thermal printer for interpretation.
Ultrasonography is relatively a unique

imaging modality for soft tissue structures of the RESULTS AND DISCUSSION
body. Its characteristic features are that it is non
invasive and free from radiation hazards, provides The normal appearance of the udder and
quick, instant and dynamic visualization, determines teat are amenable to sonographic imaging because
shape, size and internal consistency of the organ, of their superficial location and the technique has
and allows precise location of biopsy needles or the potential to diagnose different conditions of the
instruments for collection of material from the desired organ. In the present study, the glandular
site or manipulations. Cartee et al. (1986) examined parenchyma of udder on ultrasonographic
the udder and teats in lactating cows with B-mode examination appeared as homogenous and hyper
ultrasonography using 5 MHz or 10 MHz mechanical echoic with anechoic alveoli, which was in
sector transducers. Hoque et al. (2004) evaluated accordance with Ayadi et al. (2003) in cows and
the udder and teat lesions in bovine. The present Gungor et al. (2005) in mares. The gland sinus
study describes the ultrasonographic appearance of appeared as homogenous anechoic area whereas
the udder and teats in normal and pathological Cartee et al. (1986) observed the gland sinus as an
conditions. anechoic area continuous with the teat sinus. The
NTR College of Veterinary Science, Gannavaram-517 502. Sri Venkateswara Veterinary University, Tirupathi
A.P., India
5
lining of wall of the gland sinus appeared as mixed vessels known to be the plexus venousus papilllaris
hyper-hypothetic folds. The lactiferous ducts were and the circulus venosus papillae, respectively, as
anechoic areas within the hypothetic matrix of the described by Nickel et al. (1981).
fold. Gungor et al. (2005) described the lactiferous The present investigation explored
duct as an elongating anechoic branches in hyper- sonographic diagnosis of udder lesions including
echoic mammary parenchyma. Some of the mammitis, oedema, varicosity, haematoma, abscess,
anechoic areas within the glandular parenchyma may atrophy and fibrosis. Mammitis and oedema
have been blood vessels but others certainly were appeared as hyperehoic parenchyma (Figure 1).
lactiferous ducts, because they could be seen Udder haematoma appeared as hypoehoic space
entering the gland sinus. occupying images within the homogenous
The teats on ultrasonographic examination hyperechoic udder parenchyma (Figure 2) while
appeared as hypo-echoic structures with anechoic Flock and Winter (2006) observed haematoma as
lumens as reported by Cartee et al. (1986) and the large septal spaces filled with anechoic to hypoechoic
teat wall showed three distinct layers: a hyper-echoic fluids. Udder abscess, necrosis and gangrene
outer layer, a thicker hypo-echoic middle layer and appeared as hypoehoic space occupying images
a hyper-echoic inner layer as reported by Cartee et within the homogenous hyperechoic udder
al. (1986); Gungor et al. (2005) and Nak et al. parenchyma (Figure 3) as reported by Hoque et al.
(2005). Getty (1975) described four histological (2004). Flock and Winter (2006) observed abscess
layers of the teat wall: an outer layer of skin and as round well-defined structures of varying size with
fibrous tissue, an intermediate layer of smooth a distinct capsule and hypoechoic area. Atresia and
muscle and vessels, an inner fibrous layer, and the fibrosis of the udder could be easily detected by
mucosa. Because of its density difference, fibrous hyperechoic appearance and loss of typical
tissue tends to be more reflective of ultrasound. The echopattern of the udder (Figure 4) and in agreement
outer and inner hyper-echoic layers most likely of Hoque et al. (2004). Varicosity of the udder was
correspond to the two fibrous layers. The hypo- represented by an anechoic elongated vein with in
echoic middle layer correspond to the intermediate homogenous hyperechoic udder parenchyma (Figure
layer. 5) on sagital section and numerous anechoic spaces
The teat sinus appeared as anechoic area, representing the tortuous course of the vein with
and this was in agreement with the reports of the homogenous hyperechoic udder parenchyma on
Hamana et al. (1994) and Motomura et al. (1994). transverse section.
The teat canal appeared as a thin, bright white line Sonographic diagnosis of teat lesions
delineated on each side by parallel thick, dark, gray- included thelitis, intraluminal obstructions, intraluminal
black bands as reported by Franz et al. (2001). foreign bodies, trauma/fistula, teat stenosis, atresia
Hamana et al. (1994), and Motomura et al. (1994) and fibrosis. Thelitis produced thick hyperechoic teat
reported the teat canal as anechogenic areas, lining replacing typical central hypoechoic images
whereas Nak et al. (2005) described the ductus of the teat canal (Figure 6). In thelitis, all layers of
paillaris as a thin anechoic area. The papillary duct the teat wall appeared as hyperehoic as reported by
appeared as thin anechoic area as reported by Cartee Nak et al. (2005). Hoque et al. (2004) described
et al. (1986) within the folds but could not be seen thelitis as thick hyper-echoic teat lining replacing
nearer the teat orifice. The rosette of Furstenberg typical central hypoechoic images of the teat canal.
appeared as hyperechoic circular area in the centre Echo intensity and degree of thickness of the teat
of the teat. Hamana et al. (1994); Motomura et al. lining were directly proportional to the severity of
(1994) and Nak et al. (2005) reported the rosette of the lesions. Intraluminal teat obstructions appeared
Furstenberg as a hyperechogenic area. The papillary as hyperechoic shadow located adjacent to the teat
duct was not seen on most scans. The small mucosa similar to the report of Hoque et al. (2004).
anechoic areas within the middle layer of the teat Intraluminal foreign body appeared as hyperechoic
and in the area of the annular fold observed in the lines in the teat canal (Figure 7) as reported by
present study were consistent with blood filled Hoque et al. (2004). The extent of traumatic tract
6
could be assessed by its hypoechoic tubular bodies such as haematoma and pus particles have
appearance. Atresia and fibrosis of the teat could similar echogenecity, but Hoque et al. (2004)
be easily detected by hyperechoic appearance and described teat fistula as having a thick hypo echoic
loss of the typical echopattern of the teat as reported tubular appearance. A cyst in the teat wall had a
by Hoque et al. (2004). Teat stenosis and obstruction spherical anechoic shape in the teat, similar to the
usually appear as hyperechoic or sometimes observations of Nak et al. (2005).
hypoechoic. Nak et al. (2005) reported that foreign
Figure 1. Ultrasonographic appearance of mammitis in a buffalo. Note the hyper-echoic parenchyma.
Figure 2. Ultrasonographic appearance of haematoma in a buffalo. Note hypo-echoic space occupying image
with sacculations.
7
Figure 3. Ultrasonographic appearance of abscess in a buffalo. Note hypo-echoic space occupying image.
Figure 4. Ultrasonographic appearance of atrophy of the udder in a buffalo. Note hyper-echogenecity with
loss of echo pattern of udder.
Figure 5. Ultrasonographic appearance of varicosity of the udder in a buffalo. Note elongated vein with
homogenous udder parenchyma.
8
Figure 6. Ultrasonographic appearance of Thelitis a buffalo. Note the thick hyper-echoic teat lining.
Figure 7. Ultrasonographic appearance of intraluminal obstructionin a buffalo. Note the hyper-echoic lines of
the teat siphon.
9
REFERENCES and ultrasonic tomography related to milk

quality and bacteria, p. 377-380. In
Ayadi M., G. Caja, X. Such and C.H. Knight. 2003. Proceedings 18 th World Buiatrics
Use of utrasonography to estimate cistern size Congress: 26 th Congress of the Italian
and milk storage at different milking intervals Association of Buiatrics, Bolonga, Italy.
in the udder of dairy cows. J. Dairy Res., 70: Hoque M., R. Jiwary, S.K. Maiti, G.R. Singh, O.P.
l-7. Gupta and N. Kumar. 2004. Ultrasonography
Cartee R.E., A.K. Jbrahim, D. McLeary. 1986. B- of bovine udder and teat. Abstract 11 th
mode ultrasonography of udder and teat. J. Annual Congress of Indian Association for
Amer. Vet. Med. Assn., 188: 1284-1287. Advancement of Veterinary Research
Flock M. and P. Winter. 2006. Diagnostic (IAAVR), IVRIJzatnagar.
ultrasonography in cattle with diseases of the Motomura Y., N. Yasuda, S. Kamimura and K.
mammary gland. The Veterinary Journal, Hamana. 1994. Ultrasonic tomography and
171: 314-321. morphology of the bovine teat. Journal of the
Getty, R. 1975. Sisson and Grossmans, p. 950-953. Japan Veterinary Medical Association, 47
In The Anatomy of the Domestic Animals, (5): 318-321.
5th ed. Philadelphia: WB Saunders co. Nak D., Y. Nak and A. Keskin. 2005. Diagnosis of
Gungor O., S.M. Pancarci and A. Kasrabacak. 2005. various teat lesion in dairy cows by
Examination of equine udder and teat by B- ultrasonography. Indian Vet. J., 82(11): 1163-
mode ultrasonography. Kafkas Universitesi 1166.
Fakultesi Dergisi., 11(2): 107-111. Nickel R., A. Schummer and E. Seiferle. 1981. The
Hamana K., Y. Motomura, N. Yasuda, S. Kamimura Anatomy of the Domestic Animals, Vol 3,
and F. Trenti. 1994. Bovine teat morphology Springer Verlag, New York. 518p.
10
GENETIC TYPING OF THE ALPHA-LACTALBUMIN GENE AND ITS ASSOCIATION WITH

MILK PRODUCTION AND CONSTITUENT TRAITS IN
INDIAN RIVERINE BUFFALOES
Shanker Dayal1*, Tarun Kumar Bhattacharya2, Pursottam Kaushik3 and Siya Ram Singh1
ABSTRACT and rich in higher amounts of various milk

constituents like protein, fat, lactose etc. as
A study was undertaken to investigate the compared to cow’s milk. Total milk protein comprises
genetic polymorphism at alpha-lactalbumin gene of two major groups of constituents, namely, caseins
locus and to elucidate the effect of polymorphism and whey proteins. The major whey proteins which
on milk production and constituent traits in Indian are present in milk are alpha-lactalbumin and beta-
riverine buffaloes, namely, Murrah, Bhadawari, lactoglobulin. Alpha-lactalbumin constitutes about
Mehsana and Surti. A single strand conformation 18 % of the whey protein and 3.5 % of the total
polymorphism study was conducted to reveal the milk protein.
polymorphism at this locus. The study on alpha- Several methods are available to detect
lactalbumin gene revealed the presence of a number polymorphism at the candidate gene level. Single
of alleles, namely, A, B, C, D and E, in the Mehsana strand confirmational polymorphism (SSCP) is one
and Surti breeds of buffalo, whereas the alleles were of the most sensitive techniques available to detect
A, B, C and E in Bhadawari and B, C, D and E in polymorphism at the candidate gene level. This
Murrah Buffalo. All the alleles were sequenced and method is simple compared with other techniques
found to differ at different locations. The alpha- like DGGE and TGGE, which require special
lactalbumin genotypes had a significant effects sophisticated equipment and are tedious to carry out.
(P≤0.05) on fat %, daily fat yield, total fat yield, SSCP is a better approach to study polymorphism,
SNF %, daily solid not fat and total solid not fat since it covers the whole gene sequence to detect
yield in Murrah buffalo, whereas, in the Surti breed, mutations that differ in even one nucleotide as
total milk yield, daily solid yield, total solid, daily solid compared with RFLP, which has a limitation in that
not fat, total solid not fat yield, daily and total protein polymorphism can be detected within the restriction
yield were significantly associated with the sites only.
genotypes. The alpha-lactalbumin gene has been
reported to be polymorphic in cattle by several
Keywords: alpha-lactalbumin, buffalo, milk workers. They have reported two genetic variants
constituent, milk yield, polymorphism, SSCP A and B at this locus (Blumberg and Tombs, 1958;
Osterhoff and Pretorious, 1966; Chianese et al.,
1988). Out of these two variants, the B variant was
INTRODUCTION found to be predominant in Bos taurus breeds
(Blumberg and Tombs, 1958). However, various
Riverine buffalo is the mainstay of the Indian workers have reported the presence of the variant
dairy sector. They are famous for not only higher A in South African cows of European descent
quantity of milk production but also for milk solid (Osterhoff and Pretorious, 1966). In Bos indicus
contents. Moreover buffalo milk is highly nutritious and the droughtmaser (B. indicus x B. Taurus), both
1
Department of Animal Breeding and Genetics, Bihar Veterinary College, Patna, Bihar-800014, India,
*Correspondence author: e-mail: antudayal@gmail.com
2
Project Directorate on Poultry, Rajendranagar, Hyderabad, Andhra Pradesh-500030, India
3
Department of Veterinary public Health, Bihar Veterinary College, Patna, Bihar-800014, India
11
the B and A variants have been reported by several blood by a phenol/chloroform extraction method
workers (Blumberg and Tombs, 1958; Bhattacharya (Sambrook and Russel, 2001).
et al., 1963; Bell et al., 1970) whereas a third
variant, namely, C was reported in Bali cattle (B. Milk samples and analysis
javanicus) by Bell et al. (1981). In buffalo, a few Approximately 50 ml milk was collected
reports of alpha-lactalbumin alleles have been twice each, one on between 30 to 50 days and
reported so far in the literature. While performing another on 180 to 200 days from each animal. The
DNA studies on the alpha-lactalbumin gene, a total protein (TP) percentage and whey protein (WP)
number of workers (Mao, 1993; Cosenza et al., percentage was estimated by a formal titration
2003; Kazmer et al., 2001) depicted the presence method. Fat percentage was estimated by the
of polymorphic sites, or SNPs, at this gene in cattle. Gerber method (ISI, 1977). Lactometer readings
In buffalo, very little information is available in this were taken from all milk samples. Total solid (TS)
regard. As far as an association of polymorphism of and solid not fat (SNF) percentage were calculated
this gene with economic traits is concerned, Bleck using the following formulae:
and Bermel (1993) revealed that the alpha- TS % = CLR/4 + 1.2F + 0.14
lactalbumin (+15) A variant was associated with SNF % = CLR/4 + 0.2F + 0.14
greater milk, protein and fat yields while the α- where CLR is the corrected lactometer
lactalbumin (+15) B allele is related to higher protein reading which is equal to the lactometer reading +
and fat percentage in dairy cows. It was found that 0.5 + temperature difference from 84 oF x 0.1; F is
heifers having the alpha-lactalbumin genotype BB fat %.
were usually at lower age at first calving than The average milk constituent percentages
genotype AA (Jairam and Nair, 1983). Dayal et al. were estimated from these, and daily and total
(2006) reported that that alpha-lactalbumin (Exon constituent yield were calculated. The total milk
1) BC genotype was associated higher milk production record was collected from the animal
production than the AB genotype in Bhadawari register maintained at the farm and from there, daily
buffalo; however, Murrah buffalo showed a non- milk production was calculated. All the animals
significant effect of genotype on milk production. which were in their first parity, were included in the
There is no information available on association of present study.
this gene variant with milk constituent traits in
buffalo. PCR-single strand conformation polymorphism
Thus, the present study was undertaken to (PCR-SSCP)
detect polymorphism at the alpha-lactalbumin gene A 159 bp fragment spanning whole exon 2
by SSCP typing and to estimate the effect of of alpha-lactalbumin gene was amplified for
polymorphism on different milk production and polymorphism study. Primers used for amplification
constituent traits in Indian riverine buffalo. were designed on the basis of cattle and sheep whole
gene sequences with DNASIS Max software
(Hitachi Genetic System, Miraibio Inc., USA). The
MATERIALS AND METHODS primers used for amplification were: forward 5’-
GGG TCT GTA CCG CGT TT-3’ and reverse 5’-
Collection of sample TGTCAC AGG AGA TGT TAC AG-3’. The
The study was carried out on 196 Indian annealing temperature for amplification was 49 oC
riverine buffaloes comprising 50 Murrah, 48 for 1 minute. For SSCP, 12 % native PAGE (50:1,
Bhadawari, 48 Mehsana and 50 Surti lactating Acrylamide and Bis-acrylamide) with 5 % glycerol
buffaloes maintained at different organized herds was used. A total volume of 3 μl of PCR product
located in different parts of India. Samples were was properly mixed with 15 μl formamide dye (95%
taken randomly from each herd for the present Formamide, 0.025 % Xylene cyanol, 0.025 %
endeavor. Genomic DNA was prepared from 5 ml Bromophenol blue, 0.5 M EDTA). The product was
denatured at 95 oC for 5 minutes and snapped cool
12
on ice for 15 minutes. Finally, mixture was loaded in respectively, whereas the allelic frequency was found
polyacrylamide gel and electrophoresis was to be 0.01, 0.56, 0.27, 0.14 and 0.02 for the A, B, C,
performed at 4 oC temperature for 12 h at 200V. D and E allele, respectively. In Bhadawari buffalo,
After electrophoresis, silver nitrate staining was five genotypes, namely AC, BB, BC, BE and CC,
performed to visualize banding patterns associated were obtained through SSCP typing, and
with various SNPs present at this locus (Basam et consequently, there was the presence of four alleles:
al., 1991). A, B, C and E, at this locus. Finally, the frequencies
of AC, BB, BC, BE and CC genotypes and A, B, C
Sequencing and E alleles in the Bhadawari breed were estimated
PCR products belonging to different to be 0.042, 0.271, 0.437, 0.125 and 0.125 and 0.021,
genotypes were eluted from the 1% low melting 0.552, 0.364 and 0.063, respectively. Four genotypes,
agarose gel using a gel elution kit (Invitrogen, USA) namely, BC, BE, CC and CD, and four alleles: B, C,
for purification. The purified PCR-products were D and E, were observed in Murrah buffalo. The
sequenced following the automated dye-terminator frequencies of BC, BE, CC and CD genotypes were
cycle sequencing method with Ampli Taq DNA estimated to be 0.54, 0.16, 0.22 and 0.08,
polymerase in ABI PRIZM 377 DNA sequencer respectively, while the frequencies of the B, C, D
(Perkin-Elmer). and E alleles were 0.35, 0.53, 0.04 and 0.08,
respectively.
Statistical analysis
Gene and genotype frequencies were Sequence analysis
calculated by the gene counting method described All the alleles detected through SSCP were
by Falconer and Mackay (1998). Sequence sequenced and submitted to the NCBI, from which
comparison was performed with “DNASIS MAX” the accession numbers: AY726613 (A allele),
software (Hitachi Genetic System, Miraibio Inc., AY726614 (B allele), AY726615 (C allele),
USA). A general linear model (LSML91 Harvey AY726616 (D allele) and AY726617 (E allele), have
programme) incorporating genotype and season of been obtained. Sequence analysis of the various
calving as fixed effect and sire as random effect alleles revealed that a silent mutation was present
was employed to estimate the effect of genotype in the A allele due to the presence of a thymine
on milk production and composition traits in residue at the 113 th position of the nucleotide
buffaloes. sequence instead of cytosine. The A and B alleles
differ from other alleles by having thymine instead
of cytosine at the 153rd position of the nucleotide
RESULTS AND DISCUSSION sequence, which leads to a change in the polypeptide
sequence by substituting glycine to cysteine (Table
In Mehsana buffalo, six genotypes namely, 1). The C allele had thymine instead of adenine at
AB, AC, BB, BC, BD and BE, were observed in the 71st and 121st positions and guanine instead of
SSCP gel. Consequently, there was presence of five cytosine at the 122 and 146 th positions of the
alleles A, B, C, D and E in this population. Their nucleotide sequence, which resulted in changing the
frequencies were found to be 0.021 for AB, 0.104 amino acid, glutamic acid (GAA) to aspartic acid
for AC, 0.333 for BB, 0.479 for BC, 0.042 for BD (GAU), asparagine (AAC) to methionine (AUG)
and 0.021 for BE genotype and 0.062 for A, 0.615 and asparagine (AAC) to lysine (AAG), respectively,
for B, 0.292 for C, 0.021 for D and 0.01 for E allele. in the polypeptide (Table 1). Sequence analysis of
In the Surti breed, six genotypes: AC, BB, BC, BD, the E alleles showed the presence of guanine instead
BE and CC, as well as five alleles, namely, A, B, C, of cytosine at the 122nd position of the nucleotide
D and E, were observed. The genotype frequencies sequence and this led to conversion of asparagine
were calculated as 0.02, 0.18, 0.44, 0.28, 0.04 and residue (AAC) to lysine (AAG) at the polypeptide
0.04 for AC, BB, BC, BD, BE and CC genotype, sequence. Structural differences in polypeptides
ultimately lead to differences in the biological/
13
physiological functions of the protein. Addeo et al. two genotypes differed non-significantly. In Surti,
(1976) reported that Italian water-buffalo alpha- genotypic variants had non-significant effect on
lactalbumin differs from its cow B counterpart by SNF % whereas they showed significant effects
the presence of two substitutions, one at the 17th (P<0.05) on TSNF and DSNF yield. Order of
position of the mature peptide from asparagine to performance observed amongst different genotypes
glycine and one at an unknown position from either were CC > BC, BD, BE > AC, BB and BC, BD,BE
glutamic acid to glutamine or aspartic acid to > AC, BB, CC, respectively. Non-significant effects
asparagine. However, silent mutation observed in were observed on SNF %, TSNF and DSNF yield
the 37th codon of exon 2 is important since this among animals having different genotypes in
mutated site may be relatively more prone to future Mehsana and Bhadawari buffalo.
mutation or indirectly affect the process of Genotypic variants had non-significant
transcription and translation during the expression effects on TS %, TS yield and DS yield in Murrah,
of protein/polypeptide. Chianese et al. (2004) Mehsana and Bhadawari buffalo (Table 3). In Surti
detected two alpha-lactalbumin protein variants, i.e. buffalo, genotype had significant effects (P≤0.05)
A and B, in Italian water buffalo. Variant A was on daily and total solid yield whereas it had a non-
reported to be different from variant B with the significant effect on TS %. Their order of
presence of a substitution of aparagine to aspartic performance for TS yield was CC>BB, BE, BC,
acid at the 45th position of the mature peptide. They BD>AC and for DS yield, it was BC, BD>BB, BE,
also inferred that amino acid substitution altered the CC>AC.
N-glycosylation of a consensus sequence of Asn45- Genotypic variants had non-significant
X-ser46. They deduced that the protein glycosylation effects on TP %, TP and DP yield in Murrah and
level of alpha-lactalbumin A would decrease. Bhadawari buffalo (Table 5). They showed a non-
significant effect on TP % and significant effects
Effect of alpha-lactalbumin genotypes on milk (P≤0.05) on TP and DP yield in Mehsana and Surti
production and constituents traits buffalo. Their order of performance in this breed
Genotypes showed non-significant effect on for TP yield was CC, BC, BD, BE>AC, BB whereas,
total and daily milk yield for all four breeds of riverine for DP yield it was BC, BD, BE>AC, BB, CC.
buffalo. However, genotypes were found to have Genotypes had non-significant effect on
significant effects (P≤0.05) on SNF %, TSNF and WP %, TWP and DWP yield in Bhadawari,
DSNF yields in Murrah buffalo (Table 2). Their order Mehsana and Murrah buffalo (Table 6). In Surti
of performance for SNF % amongst genotypes buffalo, genotype had non-significant effect on
were CD > BC, CC, BE whereas, for TSNF and WP % but it had significant effects (P≤0.05) on TWP
DSNF yield, it was CD, BC >BE >CC and CD, BC and DWP yield. For TWP yield, the order of
> BE > CC, respectively. Although animals having performance was BC, CC, CD> AC, BB, BE while
genotype CD performed better than animals having for DWP yield, it was BC, CD>AC, BB, BE, CC.
genotype BC, statistically the SNF yield of these
Table 1. Nucleotide and amino acid changes in different alleles of buffalo.

Position of nucleotide variability Position of amino acid variability
Allele
71 113 121 122 146 153 23 37 40 48 51
A A T A C C T Glu Asp Asn Asn Cys
B A C A C C T Glu Asp Asn Asn Cys
C T C T G G G Asp Asp Met Lys Gly
D A C A C C G Glu Asp Asn Asn Gly
E A C A G C G Glu Asp Lys Asn Gly
14
Table 2. Genotype wise (Alpha-lactalbumin) least-square means for solids not fat (SNF).
Genotypes
Breed Character
AC BB BC BD BE CC CD
SNF % 9.35±0.24 9.42±0.21 9.10±0.18 - 8.48±0.18 9.23±0.21 -
Bh a d aw a ri TSNFY (kg) 89.25±17.81 81.68±15.34 95.50±12.97 - 84.64±12.91 87.60±15.08 -
DSNFY (kg/day ) 0.28±0.05 0.28±0.04 - - 0.27±0.03 0.28±0.04 -
SNF % 9.04±0.42 8.92±0.32 9.20±0.31 8.68±0.60 - - -
M eh s a n a TSNFY (kg) 117.49±19.40 126.70±14.82 129.49±14.48 116.76±27.59 - - -
DSNFY (kg/day ) 0.49±0.08 0.41±0.06 0.47±0.06 0.36±0.11 - - -
SNF % 8.54±0.30 8.66±0.25 8.75±0.20 8.64±0.22 - 8.78±0.49 -
Surti TSNFY (kg) 77.05±10.82a 83.25±9.12a 93.15±7.22b 96.22±0.80b - 108.83±17.69c -
DSNFY (kg/ day ) 0.29±0.05a 0.28±0.04a 0.32±0.03b 0.33±0.04b - 0.28±0.08a -
SNF % - - 8.92±0.17a - 8.57±0.28a 8.90±0.26a 9.26±0.26b
Murrah TSNFY (kg) - - 183.70±15.92c - 168.09±25.33b 124.55±23.39a 187.52±23.65c
DSNFY (k g/ day ) - - 0.51±0.47c - 0.35±0.07b 0.26±0.07a 0.49±0.07c
Different superscripts indicate significant differences at the 5 % level. SNF % = Solids not fat %;
TSNFY = Total solids not fat yield; DSNFY = Daily solid not fat yield.
Table 3. Genotype wise (Alpha-lactalbumin) least-square means for total solids.
Genotypes
Breed Character
TS % 17.71±054 18.55±0.46 17.93±0.39 - 18.41±0.38 17.86±0.45 -
Bh a da w ar i TSY (kg) 170.08±35.12 160.15±30.26 188.11±25.58 - 165.93±25.46 170.61±29.74 -
DSY (kg/day) 0.53±0.09 0.54±0.08 0.56±0.07 - 0.53±0.06 0.54±0.07 -
TS % 14.67±0.68 14.58±052 15.23±0.51 14.05±0.97 - - -
Mehsana TSY (kg) 192.75±30.84 208.25±23.55 217.50±23.01 190.55±43.85 - - -
DSY (kg/day) 0.80±0.13 0.68±0.10 0.78±0.09 0.58±0.18 - - -
TS % 12.56±1.43 15.04±1.20 14.80±0.95 14.39±1.06 - 14.88±2.33 -
Surti TSY (kg) 110.52±24.57a 145.22±20.71b 158.44±16.41b 160.56±18.24b - 185.50±40.17c -
D SY ( kg /day ) 0.42±0.10a 0.49±0.08b 0.54±0.06 c 0.55±0.07c - 0.48±0.16b -
TS % - - 16.84±0.34 - 15.84±0.54 15.98±0.51 16.57±0.51
Murrah TSY (kg) - - 3443.33±31.42 - 313.41±49.99 222.38±46.76 332.45±46.67
DSY (kg/day) - - 0.96±0.09 - 0.63±0.14 0.46±0.13 0.87±0.13
Different superscripts indicate significant difference at the 5 % level. TS % = Total solids %;

TSY = Total solid yield; DSY = Daily solid yield.
15
Table 4. Genotype wise (Alpha-lactalbumin) least-square means for total protein.
Genotypes
Breed Character
TP % 4.01±0.19 3.99±0.16 4.01±0.13 - 3.82±0.13 3.97±0.16 -
Bh ad a w ar i TP Y 38.22±7.34 34.65±6.32 41.42±5.35 - 34.21±5.32 38.15±6.21 -
(DPY) (Kg/day) 12.09±1.98 0.12±0.02 0.12±0.01 - 10.99±1.44 12.03±1.68 -
TP % 3.95±0.19 3.84±0.15 3.73±0.14 3.63±0.28 -
Mehsana TPY (Kg) 9.72±1.59a 11.89±1.21b 10.35±1.18a 11.31±2.26b -
DPY (Kg/day) 0.03±0.002a 0.03±0.001a 0.04±0.001b 0.04±0.28 b -
TP % 3.26±0.30 3.44±0.25 3.62±0.20 3.47±0.22 - 3.25±0.49 -
Surti TPY (Kg) 28.74±5.56a 32.96±4.69a 38.82±3.71b 39.30±4.13b - 41.90±9.09b -
DPY (Kg/day) 0.11±0.02a 0.11±0.02a 0.13±0.02b 0.13±0.02b - 0.10±0.04a -
TP % - - 4.02±0.17 - 3.82±0.28 4.22±0.27 4.36±0.26
Mur rah TPY (Kg) - - 80.32±7.59 - 75.84±12.78 62.25±11.15 86.71±11.27
DPY (Kg/day) - - 0.22±0.02 - 0.16±0.03 0.13±0.03 0.23±0.030
Different superscripts indicate significant differences at the 5 % level. TP % = Total protein %;

TPY= Total protein yield; DPY = Daily protein yield.
Table 5. Genotype wise (Alpha-lactalbumin) least-square means for whey protein.
Genotypes
Breed Character
WP % 0.84±0.04 0.83±0.03 0.84±0.02 - 0.80±0.02 0.83±0.03 -
Bh a d aw ar i TWP (kg) 8.02±1.54 7.27±1.32 8.69±1.12 - 7.18±1.11 8.01±1.30 -
DWP (kg/day) 0.02±0.004 0.02±0.003 0.03±0.003 - 0.02±0.003 0.02±0.003 -
WP % 0.82±0.03 0.79±0.02 0.80±0.02 0.79±0.05 - - -
M e hs a na TWP (kg) 11.12±1.82 11.78±1.39 11.04±1.35 12.08±0.25 - - -
DWP (kg/day) 0.08±0.004 0.08±0.003 0.08±0.003 0.08±0.005 - - -
WP % - - 0.84±0.03 - 0.80±0.05 0.88±0.05 0.91±0.05
Murrah TWP (kg) - - 16.86±1.59 - 15.92±2.53 13.07±2.34 18.21±2.36
DWP (kg/day) - - 0.05±0.004 - 0.03±0.006 0.03±0.006 0.05±0.006
WP % 0.68±0.06 0.72±0.05 0.76±0.04 - - 0.68±0.10 0.73±0.40
Surti TWP (kg) 6.03±1.16a 6.92±0.98a 8.15±0.78b - - 8.79±1.92b 8.25±0.86b
DWP (kg/day) 0.02±0.57a 0.02±0.48a 0.03±0.004b - - 0.02±0.009a 0.03±0.004b
Different superscripts indicate significant differences at the 5 % level. WP %= Whey protein percent;
TWP = Total whey protein; DWP = Daily whey protein.
16
ACKNOWLEDGEMENT Primary structure of water buffalo α-

lactalbumin variants A and B. J. Dairy Res.,
We are very much thankful to ADG (Animal 71: 14.
Production & Breeding), ICAR. for providing funds Cosenza G., G. Daniela, I. Rosa, D.G. Paola,
to carry out this work under the ICAR Ad-hoc C.Senese, L. Ferrura and L. Ramunno. 2003.
Scheme Project. A MvaI PCR-RFLP detecting a silent allele
in the goat α-lactalbumin locus. J. Dairy Res.,
70: 355.
REFERENCES Dayal S., T .K. Bhattacharya, V. Vohra, P. Kumar
and A. Sharma. 2006. Effect of Alpha-
Addeo, F., J. Mercier and B. Dumas Ribadeau. 1976. lactalbumin gene polymorphism on milk
Elements de structure primaire de L’α- production traits in water buffalo. Asian
lactalbumine et de la β-lactoglobuline de buffle. Australas. J. Anim. Sci., 19(3): 305.
FEBS letters, 63: 255. Falconer D.S. and T.F.C. Mackay. 1998.
Bassam B.J., G. Caetano-Anolles and Introduction to Quantitative Genetics, 4th
P.M.Gresshoff. 1991. Fast and sensitive silver ed. Addison Wesley Longman Ltd., Essex,
staining of DNA in polyacrylamide gels. Anal England. p. 1-2.
Biochem., 196: 80. ISI. 1977. Determination of fat by Gerber method.
Bell K., K.E. Hopper, H.A. Mckenzie, W.H. Murphy Part I Milk (first revision). Indian Standards
and D.C. Shaw. 1970. A comparison of bovine Institution, Manak Bhavan, New Delhi.
α-lactalbumin A and B of droughtmaster. Jairam B.T. and P.G. Nair. 1983. Genetic
Biochem Biophy Acta., 214: 437. polymorphism of milk protein and economic
Bhattacharya S.D., A.K.Roy Choudhury, N.K.Sinha character in dairy animals. Indian J. Anim.
and A.Sen. 1963. Inherited α-lactalbumin and Sci., 53: 1.
β-lactoglobulin polymorphism in Indian Zebu Kazmer G.W., P. Zhou, J.L. Troyer and L.D.
cattle. Comparison of zebu and buffalo α- Strausbaugh. 2001. Haplotype analysis
lactalbumins. Nature, 197: 797. involving a novel polymorphism in bovine
Bleck T.G. and R.D. Bermel. 1993. Correlation of Alpha-lactalbumin 5’ flanking region. J. Dairy
the α-lactalbumin (+15) polymorphism to milk Sci., 84: 1542.
production and milk composition of Holsteins. Mao F.C. 1993. A bovine α-lactalbumin gene Mnl I
J. Dairy Sci., 76: 2292. restriction fragment length polymorphism. J.
Blumberg B.S. & M.P. Tombs. 1958. Possible Anim. Sci., 72: 529.
polymorphism of bovine α-lactalbumin. Osterhoff D.R. and A.M.G. Pretorius. 1966.
Nature, 181: 683. Inherited biochemical polymorphism in milk
Chianese L., A.DiLuccia, R.Maurielle, L. Ferrara, proteins. Proc. South African Soc. Anim.
G. Zehender and F.Addeo. 1988. Polimorfismo Prod., 5: 166.
biochimico delle proteine del latte in bovine di Sambrook J. and D.W. Russel. 2001. Molecular
razza podolica. Zootec e Nutri Anim., 14: Cloning-A Laboratory Mannual, 3 rd ed.
189. Vol.1, Cold Spring Harbor Laboratory Press,
Chianese L., S. Caira, S. Lilla, F. Pizzolongo, P. New York, USA.
Ferranti, G. Pugliano and F. Addeo. 2004.
17
EFFICACY OF TAPIOCA STARCH AS A FAT REPLACER IN

LOW-FAT BUFFALO MEAT PATTIES
Mohammad Nisar P.U., M.K. Chatli* and D.K. Sharma
ABSTRACT viz., 6.89+0.13. The flavour scores were non-

significantly higher for LFBMP. The juiciness and
The effect of tapioca starch (TS) on the texture scores were significantly (P<0.05) better in
physico-chemical, compositional and sensory all treatment groups than the high-fat control. The
qualities of low-fat (<10 % total fat) buffalo meat maximum values were recorded for LFBMP with
patties (LFBMP) was evaluated and compared with 3.0 % tapioca starch. The maximum overall
high-fat (18.22+0.17 total fat) buffalo meat patties acceptability value was 6.98+0.98 for LFBMP with
(HFBMP). TS used in the study had a composition 3 % incorporation level, which was significantly
of 98.88 % carbohydrates, 0.18 % crude protein, (P<0.05) higher than the control group, the value of
0.08 crude fiber and 0.32 %ash. The buffalo meat which was 6.18+0.16. It is concluded from the study
patties were formulated with 1.5 % table salt, that tapioca starch can be successfully utilized as
2.0 % spice mix, 3.0 % condiments, 0.2 % sugar, fat replacer at 3 % incorporation level with significant
0.3 % sodium tripolyphosphate. The added water improvement in processing, compositional and
and added fat levels in LFBMP were 12 % and sensory properties.
5 %, whereas in HFBMP this were 5 % and 15 %.
Three variants of TS-2.0, 3.0 and 4.0 %-were used. Keywords: Fat replacer, tapioca starch, low-calorie
The moisture content of LFBMP with 3.0 % TS food, health meat foods, low-fat buffalo meat patties
was measured to be maximum (67.15+0.67);
however there was no significant difference
amongst the treatments. The moisture content and INTRTODUCTION
moisture protein ratio were significantly (P<0.05)
higher in LFBMP than in the control irrespective of Buffalo meat is getting recognition world
incorporation level of TS. The cooking yield wide due to its edge over other meats with the unique
increased linearly with the increase in the level of flavour and characteristics of lower intramuscular
TS in the formulation and was significantly (P<0.05) fat, cholesterol and calories, higher units of essential
better than in HFBMP. There was a significant amino acids, biological value and iron content
increase in gain in height in LFBMP. The (Anjaneyulu et al., 1990). Buffalo meat has good
maximum % gain in height was measured functional properties for processing into variety of
32.19+0.46 at 4.0 % incorporation level of TS meat products such as sausages (Sachindra et al.,
whereas in the control sample, minimum % gain in 2005), patties (Suman and Sharma, 2003), and
height was minimal (15.27+0.90). The shrinkage burgers (Modi et al., 2003). India is producing more
percentage decreased significantly (P<0.05) in the than 46 % of the total world’s buffalo meat (FAO,
treatment group compared to the control. The calorie 2005). The low price of buffalo meat and its
content decreased by 30-35 % in LFBMP for each convenience in processing enhanced demand for it
patty as well as per 100 g the product compared to in domestic and international markets.
the control. The colour and appearance scores of The increase in the rate of cardiovascular
LFBMP with 4.0 % TS incorporated were highest, diseases resulting from high dietary intake of
Department of Livestock Products Technology, Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana, India, *e-mail: manishchatlilpt@gmail.com
18
saturated fats and cholesterol has made the health The literature is almost silent on the use of
conscious consumer cautious about the fat content tapioca starch as fat replacer in buffalo meat patties.
of the meat and meat products. In order to check So the present study was conducted to optimize the
the occurrence and chances of cardiovascular level of incorporation of tapioca starch (T.S.) as a
diseases, in the diet, not more than thirty percent of fat replacer in the formulation of low-fat buffalo
calories should be supplied by fats, and not more meat patties. The physico-chemical, compositional
than ten percent of calories should be supplied by and sensory qualities of the product were assessed.
saturated fat (American Heart Association, 1986). Moreover, the calorific value of the prepared product
So the continued interest and demand for low and was estimated.
reduced fat meat products make it imperative to
develop such low-fat products to quench the
consumer’s health concerns. MATERIALS AND METHODS
But simple reduction in the fat content of
processed meat products substantially reduces the Sources of Materials
flavour intensity (Lin and Keeton, 1994), juiciness Adult buffaloes of the 5-7 year age group
and tenderness (Brewer et al., 1992; Pietrasik, 1999), of the Murrah breed were slaughtered by a humane
cooking yield (Barbut and Mittal, 1992), product method using captive bolt pistol stunning after proper
palatability (Kregel et al., 1986) and excessive purge rest in the lairage and ante mortem inspection at a
in packaging (Rahardjo et al., 1994). Therefore, modern abattoir, Punjab Meats Limited, Behra,
various processing and cooking techniques and Derabassi (India). After hygienic dressing and post
reformulation with fat replacers are being employed mortem inspection, the carcasses were hanged in a
for the development of low-fat meat products. These chill room at a temperature of 4+2 oC for 6-8 h.
include variation in particle/grind size, added fat Then they were separated into wholesale cuts:
levels, mixing time, internal cooking temperature; chuck, rib, brisket, loin, sirloin. The rib, loin and sirloin
addition of water, and incorporation of fat replacers/ cuts of the forequarter were chosen for the study,
fat substitutes in the formulation. Various non-meat and these were manually deboned. All the external
ingredients are being used as fat replacers in fascia, blood vessels, and other connective tissues
processed meat such as added water (Kumar and were removed. The boneless meat was packaged
Sharma, 2007), carbohydrates and starches in LDPE films and frozen to -18 oC. The frozen
(Aktasand Genccelep, 2006), vegetable proteins meat was brought into the laboratory of the
(Kumar et al., 2007) and animal proteins Department of Livestock Product Technology in
(Serdaroglu, 2006). insulated boxes within two hours and stored in a
Several types of starches have been used deep freezer at -18 oC till further studies. The
in varying proportions (from 2 % to 5 %) to formulate required portion of the frozen meat for the experiment
reduced fat meat emulsions (Claus and Hunt, 1991; was taken out and kept at refrigeration temperature
Dexter et al., 1993). Bloukas and Paneras (1993) 4+2 oC overnight for thawing and subsequently used.
observed that a 3 percent level of potato starch Tapioca starch was procured from Jemsons Starch
significantly improved lightness, hardness and skin and Derivatives, Alappuzha, Kerala, India. The
strength of low-fat frankfurters. Low-fat ground pork technical specifications of the starch were as follows:
patties with varying levels of barley flour Appearance : white free flowing powder
incorporated had improved cooking yield, moisture Moisture : 10 %
retention, increased moisture content, reduced Total ash : 0.32 %
shrinkage and higher overall acceptability (Kumar Crude protein : 0.18
and Sharma, 2004). Aktas and Genccelep (2006) Crude fibre : 0.08
reported that incorporation of modified starches in Carbohydrates : 98.88
a meat batter improved the emulsion stability and Viscosity (3 % solution) :18 Pascalsec.
reduced the jelly and fat separation. The other ingredients required for the
processing were procured from the local market.
19
retained in the cooked product per 100 g of raw

Formulation and processing sample. It was calculated according to the following
The thawed lean meat was cut into small formula.
chunks and minced in a motor driven mincer of local The thickness and height of the cooked pat-
make through a 6 mm plate followed by a 3 mm ties were measured using Vernier calliper at two
plate. Preliminary trials were conducted to different points and the average thickness and height,
standardize the formulation and processing of respectively, and the percent gain in height and per-
different levels of TS incorporation and high-fat cent decrease in diameter were calculated. After
control (Table1). recording the diameter and thickness of raw and
The ingredients except added water and cooked patties, the percent shrinkage was deter-
added fat were added to the minced meat, and the mined according to the following equation (El-Magoli
mixture was preblended for 18 h. The meat batter et al., 1996).
was prepared by mixing the preblended meat in a
kneader-cum-blender (Inalsa make) for 90 second Physico-chemical analysis
along with slow addition of ice cold water and added Composition: Moisture, fat (ether
fat. Each patty was prepared from 75 g of the mix extractable) and protein content of raw and cooked
and moulded in a moulder of dimensions 75 mm patties were determined according to the standard
diameter and 15 mm height. The moulded raw patties AOAC (1995) procedures using a hot air oven, a
were placed on stainless steel plates pre-smeared soxhlet extraction apparatus and a Kjeldahl assembly,
with vegetable oil to avoid sticking and cooked in a respectively.
pre-heated hot air oven at 185+5 oC until the internal Sensory evaluation: Patties at a
temperature of patties reached 75+2 oC recorded at temperature of 30-35 oC were assessed for their
the geometrical centre of the patties using a probe appearance and colour, flavour, juiciness, texture and
thermometer. Then, the patties were turned upside overall acceptability by a panel of eight experienced
down and cooked for another 5 minutes for adequate judges using an eight-point hedonic scale, where 8
doneness and to improve the appearance and colour. denoted extremely desirable and 1 denoted
The cooked patties were subjected to sensory extremely poor. Tap water was provided between
evaluation at 35+5 oC and the remaining patties were samples to cleanse the palate.
packed in LDPE pouches for further studies. Calorie value: Estimates of total calories
in cooked ground buffalo patties were calculated on
Cooking characteristics the basis of 100 portion using the Atwater values
The cooking yields of the patties were for fat (9 kcal/g), protein (4.02 kcal/g) and
determined by measuring the weight of the patties carbohydrate (4 kcal/g). The calories contributed
for each treatment and were calculated as the ratio by tapioca starch was based on the level of
of cooked weight to raw weight expressed as incorporation and composition. An analysis of the
percentages. The percent cooking loss was percentage of carbohydrate in the meat samples was
calculated as the difference in weight between not performed; the calorie values were estimates
individual raw and cooked patties. The moisture and not actual values.
retention value represents the amount of moisture
Moisture retention = Percent yield x Percent moisture in cooked patties

________________________________________
100
(Thickness of raw patties - Thickness of cooked patties)

+ (Diameter of raw patties - Diameter of cooked patties)
Percent shrinkage = ______________________________________________ x100
Thickness of raw patties + Diameter of raw patties
20
Statistical Analysis: Duplicate samples calculated was maximum for LFBMP with 4.0
were taken for each parameter and the experiment percent TS incorporated i.e. 174.14 Kcal. This may
was repeated three times, the total being six be due to a higher level of incorporation of starch in
observations (n=6) for consistency of the results. the product. The calorie content was 31-34 percent
The results of the experiment were recorded. The less from HFBMP to LFBMP. According to
data obtained were subjected to statistical analysis American Heart Association (1986), in order to
(Snedecor and Cochran, 1994) for one-way analysis check the occurrence and chances of cardiovascular
of variance using randomized block design, critical diseases, a diet in which not more than 30 percent
difference and Duncan’s multiple range tests to test of calories are supplied by fats, and saturated fat
the significance of differences between means should provide no more than 10 percent of calories.
(P<0.05). The observed difference in composition of cooked
high-fat control and low-fat buffalo meat patties with
different levels of tapioca starch incorporated are
RESULTS AND DISCUSSION depicted in the Figure 3.
The cooking yield increased linearly with
The composition and physico-chemical the increasing levels of TS in LFBMP. It was further
properties of the low-fat buffalo meat patties observed that LFBMP had significantly (P<0.05)
(LFBMP) incorporated with different levels of better cooking yield than HFBMP. This could be
tapioca starch (TS) are presented in the Table 2 attributed to the high water binding and stable protein
and Table 3. The moisture content of the LFBMP gel matrix forming property of the TS. The results
with 3.0 percent TS incorporated was measured to of cooking loss were also on the similar lines. Hughes
be maximum; however there was no significant et al. (1998) reported that addition of 3.0 percent
difference amongst the treatments. This may be due TS significantly decreased the cooking loss in
to high moisture retention property of the TS at this frankfurters. Berry and Wergin (1993) also
particular level of incorporation. Carballo et al. documented the improvement in the cooking yield
(1995) and Colmenero et al. (1996) reported that and moisture retention in low-fat ground beef patties
increased levels of starch reduced cooking loss and with 3.0 percent potato starch added. Pietrasik
purge loss. The moisture content of the LFBMP was (1999) observed that the presence of increasing
significantly (P<0.05) higher than that of the than levels of starch significantly affected the cooking
high-fat control patties. This may be due to the loss. Various scientists recorded similar observations:
difference in the level of added water in the Dexter et al. (1993) in reduced fat turkey bologna
formulation. The protein content of the low-fat sausages containing 2 percent modified corn waxy
patties was comparable to that of the high-fat control starch and Carballo et al. (1995) in pork bologna
patties at all levels of TS addition. It was recorded sausages. Knight and Perkin (1991) also reported a
highest in the LFBMP with 2.0 percent TS similar decrease in cooking loss of restructured meat
incorporated, which may have been because of higher products on dry addition of tapioca starch.
proportion of added lean meat. The fat percent in The dimensional parameters, viz., percent
the LFBMP varied from 8.23+0.13 to 8.38+0.25 % decrease in diameter, gain in height and shrinkage
due to selected constant levels of added fat (5 %) in percent were significantly affected by the
the formulation of LFBMP. Hence the product can incorporation of TS irrespective of levels of addition.
be categorized under low-fat meat products (Keeton, The diameter of the LFBMP patties was better
1994). However, the fat content was significantly maintained during cooking, and the percentage of
(P<0.05) higher in high-fat patties i.e. 18.22+0.17 decrease in diameter was reduced from 8.73+0.08
percent. Moisture Protein Ratio (MPR) was to 5.67+0.08 percent. The highest gain in height was
calculated in the same range for all the LFBMP recorded for the LFBMP with 4.0 percent TS as
variables; however, it was significantly (P<0.05) compared to the high-fat control patties. However,
higher than in the high-fat buffalo meat patties. This the percent increase in height was significantly
may be attributable to the higher moisture content (P<0.05) more for LFBMP than HFBMP. Similar
in LFBMP than HFBMP. The calorie content observations were recorded for percent shrinkage,
21
which was 0.37+0.08 and 3.48+0.05 percent for TS of tapioca starch had a positive effect on the physical
inclusion levels of 4.0 and 2.0 percent, respectively. and organoleptic parameters of low-fat sausages
The better maintenance of the dimensional when used alone and in combination with preformed
parameters of the patties during cooking of LFBMP whey protein/ carrageenan gel blends.
may be due to better moisture retention, water binding The flavor scores were non-significantly
capacity of TS, better cooking yield and lower higher for low-fat buffalo meat patties. However,
cooking losses. Similar findings were also recorded various authors observed significantly better flavor
by Berry (1997), who evaluated the combination of scores for meat products in which TS was
sodium alginate and tapioca starch in low-fat beef incorporated. This was attributed to increased water
patties cooked by broiling or grilling at 68 or 74 oC absorption and release of volatile aroma compounds
and found that the combination provided by TS in the meat products (Chevance et al., 2000).
improvement in tenderness, juiciness, and cooking Hughes et al. (1998) reported increased flavor
yields without increasing fat retention or affecting intensity of frankfurters with tapioca starch
beef flavour. The above discussed observations are incorporated. The juiciness scores were highest for
depicted in Figure 4 for better understanding. the patties with 3.0 percent TS amongst the LFBMP.
The mean sensory scores for the cooked However, the juiciness scores were significantly
high-fat control and low-fat buffalo meat patties with (P<0.05) better in all the treatment groups of LFBMP
different levels of tapioca starch incorporated are than the high-fat control. This could be due to the
given in Table 6. The colour and appearance score greater moisture retention and water binding
of the LFBMP with 4 percent TS incorporated was properties of TS. By the inclusion of TS, the texture
found to be the highest, viz., 6.89+0.13. Patties with was found to be improved significantly in LFBMP
2.0 and 3.0 percent TS showed colour scores of from that of HFBMP. Giese (1992) emphasized that
6.69+0.12 and 6.79+0.12, respectively. The panelists modified food starches have been used as binders
gave a significantly (P<0.05) higher overall to maintain juiciness and tenderness in low-fat meat
acceptability score for LFBMP than HFBMP. This products. The sensory panelists rated the product
reflects the fact that decreasing the fat content with 3.0 percent TS incorporation as best with
increases the redness of the product (Hughes et al., respect to overall acceptability and found it
1998). Lyons et al. (1999) reported that dry-addition comparable to the control.
Table 1. Product formulation (g/kg) for control and treatments with added tapioca starch.
Low-Fat Buffalo Meat Patties

Ingredients Control
I II III
Lean Meat 695 705 695 685
Added Fat 150 50 50 50
Added Water 50 120 120 120
Refined Flour 40 40 40 40
Condiments 30 30 30 30
Spice Mix. 15 15 15 15
Salt 15 15 15 15
Sugar 2.0 2.0 2.0 2.0
Sodium
3.0 3.0 3.0 3.0
tripolyphosphate
Sodium Nitrite 120 ppm 120 ppm 120 ppm 120 ppm
Tapioca Starch - 20.0 30.0 40.0
22
Table 2. Proximate composition of cooked high-fat control and low-fat buffalo meat patties with different
levels of tapioca starch incorporated (Mean+SE).
High- Fat Tapioca Starch inclusion levels (%)

Parameters
Control 2.0 3.0 4.0
b a a
Moisture (%) 57.24±0.96 65.38±0.78 67.15±0.67 63.96±1.53a
Fat (%) 18.22±0.17 a 8.23±0.13 b 8.32±0.23 b 8.38±0.25 b
Protein (%) 18.74±0.66 18.89±0.49 18.74±0.54 18.68±0.48
b a a
M:P Ratio 3.05±0.08 3.46±0.04 3.58±0.06 3.42±0.08 a
K calories/100g 250.94 165.63 169.84 174.14
Table 3. Physico-chemical properties of cooked high-fat control and low-fat buffalo meat patties with different
levels of tapioca starch incorporated (Mean+SE).

Parameters
Control 2.0 3.0 4.0
c bc ab
Cooking yield (%) 82.72±0.69 88.31±0.40 89.87±0.36 90.24±0.41 a
Cooking loss (%) 17.28±0.72 a 11.69±0.46 ab 10.13±0.39 bc 9.76±0.43 c
Decrease in diameter (%) 12.01±0.27 a 8.73±0.08 b 6.95±0.05 c 5.67±0.08 d
Gain in height (%) 15.27±0.90 c 21.76±0.49 b 31.29±0.25 a 32.19±0.46 a
Shrinkage (%) 7.46±0.18 a 3.48±0.05 b 0.44±0.02 c 0.37±0.08 c
Moisture retention (%) 41.80±1.06b 58.09±0.84 a 60.39±0.66 a 59.65±0.87 a
K calories/Patty 155.68 109.70 114.48 117.86
Table 4. Sensory evaluation of cooked high- fat control and low-fat buffalo meat patties with different levels
of tapioca starch incorporated (Mean+SE).

Attributes
Control 2.0 3.0 4.0
b ab ab
Appearance /Colour 6.38±0.15 6.69±0.12 6.79±0.12 6.89±0.13 a
Flavour 6.55±0.13 6.60±0.07 6.76±0.09 6.58±0.09
b a a
Juiciness 6.16±0.15 6.62±0.11 6.77±0.13 6.44±0.13 a
Texture 6.06±0.15 b 6.53±0.09 a 6.70±0.10 a 6.42±0.11 ab
Overall acceptability 6.18±0.16 b 6.51±0.09 b 6.98±0.42 a 6.58±0.58 b
23
CONCLUSION modifying ingredients. J. Food Sci., 56: 643-

647, 652.
Since the low-fat buffalo meat patties with Colmenero, F.J., G. Baretto, P. Fernandez and J.
3.0 percent TS incorporated had higher cooking yield, Carballo. 1996. Frozen storage of bologna
better dimensional parameters and substantially sausages as a function of fat content and of
higher scores for sensory attributes in comparison levels of added fat and egg white. Meat Sci.,
to the other low-fat buffalo meat patties and high- 42: 325-332.
fat control patties, this level was selected as the Dexter, D.R., J.N. Sofos and G.R. Schmidt. 1993.
optimum level. Quality characteristics of Turkey bologna
formulated with carrageenan, starch, milk and
soy protein. J. Muscle Foods, 4: 269-289.
REFERENCES El-Magoli, S.B., S. Laroia and P.M.T. Hansen. 1996.
Flavour and texture characteristics of low-fat
American Heart Association. 1986. Dietary ground beef patties formulated with whey
guidelines for healthy adult Americans. Am. protein concentrate. Meat Sci., 42(2): 179-
Heart Assoc. Circulation, 74: 1465-1475-A. 193.
Aktas, N. and Genccelep, H. 2006. Effect of starch FAO. 2005. <www.faostat.org>
type and its modifications on physicochemical Giese, J. 1992. Developing low-fat meat products.
properties of bologna-type sausage produced Food Technol., 46(4): 100-108.
with sheep tail fat. Meat Sci., 74: 404-408. Hughes, E., A.M. Mullen and D.S. Troy. 1998.
Anjaneyulu A.S.R., V. Lakshamanan, N. Sharma Effect of fat level, tapioca starch and whey
and N. Kondiah. 1990. Buffalo meat protein in frankfurters formulated with 5% and
production and meat quality. India Food 12% fat. Meat Sci., 48: 169-180.
Packer, 44(4): 21-31. Keeton, J.T. 1994. Low-fat meat products-
AOAC. 1995. Official Methods of Analysis, 16th technological problems with processing. Meat
ed. Association of Official Analytical Chemists, Sci., 36: 261-276.
Washington D.C.. Knight, M. and J. Perkin. 1991. The use of
Bloukas, J.G and E.D. Paneras. 1993. Substituting tapiocaline in British sausages. Meat
olive oil for pork back affects quality of low- Manufacturing and Marketing, 5(4): 29-30.
fat frankfurters. J. Food Sci., 58: 705-709. Kregel, K.K., K.J. Pursa and K.V. Hughes. 1986.
Brewer, M.S., F.K. McKeith and K. Britt. 1992. Cholesterol content and sensory analysis of
Fat, soy and carrageenan effects on sensory ground beef as influenced by fat level, heating
and physical characteristics of ground beef and storage. J. Food Sci., 51: 1162-1165.
patties. J. Food Sci., 57(5): 1051-1052, 1055. Kumar, M. and B.D. Sharma. 2004. Efficacy of
Berry, B.W and W.P. Wergin. 1993. Modified barley flour as fat substitute on processing
pregelatinized potato starch in low-fat ground quality and storage stability of low-fat ground
fat ground beef patties. J. Muscle Foods, 4: pork patties. J. Food Sci. Technol., 41(5):
305-320. 496-502.
Berry, B.W. 1997. Sodium alginate plus modified Lin, K.W. and J.T. Keeton. 1994. Determination of
tapioca starch improves properties of low-fat optimum size for low-fat, precooked ground
beef patties. J. Food Sci., 62 (6): 1245-1249. beef patties. J. Muscle Foods, 5: 63-76.
Carballo, J., G. Baretto and F.J. Colmenero. 1995. Lyons, P.H., J.F. Kerry, P.A. Morrissey and D.J.
Starch and egg white influence on properties Buckley. 1999. The influence of added whey
of bologna sausage as related to fat content. protein/carrageenan gels and tapioca starch
J. Food Sci., 60(4): 673-677. on the textural properties of low-fat pork
Claus, J.R. and M.C. Hunt. 1991. Low-fat, high- sausages. Meat Sci., 51(1): 43-52.
added bologna formulated with texture
*Continued on page 28
24
INFLUENCE OF BUFFALO OESTRUS SERUM (BES) AND FETAL BOVINE SERUM (FBS) IN
THE PRESENCE OF OESTRADIOL (E2) AND FOLLICLE STIMULATING HORMONE (FSH)
ON NUCLEAR MATURATION OF BUFFALO OOCYTES
S.A. Adlak, K.P. Khillare, C.H. Pawshe and S.W. Mude
ABSTRACT For the successful fertilization and

subsequent development, the medium must contain
The influence of buffalo oestrus serum a blood serum or extract because full oocyte
(BES) and fetal bovine serum (FBS) in the presence maturation involves not only acquisition of meiotic
of oestradiol and follicle stimulating hormone on competency but also cytoplasmic maturation (Motlik
nuclear maturation of buffalo oocytes was and Fulka, 1986). The most common serum
evaluated. The oocytes matured in the presence of preparations used for bovine oocyte maturation are
10 % BES or 10 % FBS showed higher maturation fetal calf serum (FCS), oestrus cow serum (ECS)
rates than those matured in the medium alone. The and bovine serum albumin (BSA). Recent studies
addition of follicle stimulating hormone (FSH) and have shown that blood serum was slightly superior
oestradiol (E2) in the presence of serum to the than BSA (Cross and Brinster, 1970). Blood serum
medium improved maturation rate over that of the enhanced cumulus and corona cell survival and it
serum alone. However, the maturation rate was was likely that it has beneficial effects on meiosis
higher (71.05 %) in Ham’s F-10 + FBS + E2 + 10 resumption, which was indirectly mediated through
μg /ml FSH than in Ham’s F-10 + BES + E2 + 10 μg corona cells.
/ml FSH i.e. 51.16 %, but no significant difference Supplementation of media supplemented
was observed. with blood serum resulted in a high frequency of
In the present study, FBS was found to be nuclear maturation and cumulus expansion when
a more suitable protein supplement for in vitro FSH was added (Leibfried et al., 1987). The addition
maturation of buffalo oocytes in comparison with of FSH, LH and oestradiol cause synergistic
BES. Therefore Ham’s F-10 supplemented with enhancement of nuclear maturation of buffalo
10 % FBS in combination with E2 and 10 μg /ml oocytes (Totey et al., 1993)
FSH proved to be the most efficacious medium for Our study was to determine the effect of
maturation of buffalo oocytes. bovine oestrus serum (BES) and fetal bovine serum
(FBS) in the presence of follicle stimulating hormone
Keywords: buffaloes, hormone, FSH, oocytes, (FSH) and oestradiol on nuclear maturation of
oestradiol, oestrus, FBS, BES buffalo oocytes.
INTRODUCTION MATERIALS AND METHODS
In mammals during in vitro maturation Buffalo ovaries were collected from the
(IVM), the basic medium is supplemented with local slaughterhouse and transported to the laboratory
serum and hormones. The selection of protein in normal saline at 30-35 oC within 1-2 h of slaughter.
supplements and hormones for in vitro maturation Cumulus oocyte complexes (COCs) were isolated
(IVM) play an important role in subsequent in vitro from the follicles by a slicing method. Only the
fertilization (IVF) and in vitro development (IVD). oocytes with more than four layers of compact
Department of Animal Reproduction, Post Graduate Institute of Veterinary and Animal Sciences, Akola 444104,
India
25
cumulus cells (COC S) with evenly distributed The maturation rate was further increased
cytoplasm were used for maturation. The isolated after the addition of different concentrations of FSH
oocytes were washed thrice with TL-Hepes and oestradiol (E2). The increases with addition of
medium. The final two washings were given in the oestradiol to the medium in the presence of BES
maturation medium. The maturation was studied in and FBS were 40.00 % and 41.66 %, respectively.
two different groups: 1) Ham’s F-10+10 % BES. When the medium was supplemented with
2) Ham’s F-10+10 % FBS. Each group consisted BES + E2 (1 μg)+FSH (10 μg), the metaphase II
of six different treatments i) medium only (control) percentage was about 51.16 %. Whereas, when the
ii) medium+10 % serum (BES or FBS) iii) medium medium was supplemented with FBS + E2 (1 μg) +
+ 10 % serum + 1 μg/ml oestradiol (E2) iv) medium FSH (10 μg), the metaphase II percentage was about
+ 10 % serum +1 μg/ml oestradiol (E2)+1 μg/ml FSH. 71.05 %. The metaphase II percentage was higher
v) medium+ 10 % serum + 1 μg/ml oestradiol (E2) + in FBS than BES, but the difference was not
10 μg/ml FSH. vi) medium + 10 % serum + significant.
10 μg/ml oestradiol (E2) + 20 μg /ml FSH. In the present study, the medium (Ham’s
The COC S were randomly allocated to F-10) containing FBS showed a dramatic
different treatments within an individual group, and improvement in oocyte maturation in presence of
three replicates were carried out separately for each oestradiol and FSH (10 μg) as compared to those in
group. The COCS were cultured for 24 h in air at Ham’s F-10 containing BES + E2 (1 μg) + FSH
39 oC, 95 % humidity, and 5 % CO2 and, at the end (10 μg)
of the culture period, the cumulus cells of oocytes In the present study, we found that
were removed by repeated pipetting using a fine maturation also took place in the medium alone;
bore pipette. The oocytes were fixed overnight with however, although maturation took place in the
ethanol and acetic acid (3:1) and stained with 1 % medium without any supplementation, oocytes
aceto orecin stain. The oocytes were then evaluated matured under such conditions, fail to form normal
for germinal vesicle (GV), metaphase I (MI), pronuclei after sperm penetration due to incomplete
metaphase II (MII) stage and degeneration. The cytoplasmic maturation (Thibault, 1977; Bavister,
number of oocytes in the different stages were 1987). To improve the cytoplasmic maturation of
evaluated in different treatments. cattle oocytes, some biological fluids like serum are
essential (Saeki et al., 1990). The addition of sera
to the culture medium during the maturation of
RESULTS AND DISCUSSION oocytes promotes the rupture of the germinal vesicle
and facilitates the oocyte maturation (Sanbuissho et
The buffalo oocytes were isolated from the al., 1990).
ovaries and distributed among different treatment In the present study, we found that addition
groups. The effect of sera (BES and FBS) in the of 10 % FBS in the presence of 1 μg E2 and 10 μg
presence of follicle stimulating hormone (FSH) and FSH gave an improved maturation rate as compared
oestradiol on nuclear maturation was evaluated. The with 10 % BES supplemented group, but no
results are presented in Tables 1 and 2. significant difference was observed. Fetal calf
The percentage of oocytes reaching serum improves the maturation and fertilization over
metaphase II in medium alone in the two groups those of BES because it contains some unidentified
was 33.33 %. The addition of protein supplement in growth promoting components that were absent in
the form of BES improved metaphase II percentage the serum of adult animals or because fetal calf
(36.36 %) over control but no significant difference serum lacks components (hormones and
was observed. However, FBS showed improved immunoglobulins) present in the adult serum that
metaphase II percentage (39.47 %) over the control retard the in vitro development of the cells
group. (Mochizuki et al., 1991).
Allen et al. (1982) suggested that FCS is
advantageous for use because it has some growth
26
Table 1. Influence of buffalo oestrus serum (BES) in the presence of oestradiol (E2) and follicle stimulating
hormone (FSH) on nuclear maturation of buffalo oocytes.
Stages of Maturation
Hormone Total no. of
S.N. Media Sera GV MI MII Deg
concentration oocyte
(%) (%) (%) (%)
Ham's 9 5 10 6
1 - - 30
F-10 (30.00) (16.66) (33.33) (20.00)
Ham's 9 6 12 6
2 BES - 33
F-10 (27.27) (18.18) (36.36) (18.18)
Ham's 8 5 12 5
3 BES E2 (1 μg) 30
F-10 (26.66) (16.66) (40.00) (16.66)
Ham's 6 7 17 9
4 BES E2 +FSH (1 μg) 39
F-10 (15.38) (17.94) (43.58) (23.07)
Ham's 6 8 22 7
5 BES E2 +FSH (10 μg) 43
F-10 (13.95) (18.60) (51.16) (16.27)
Ham's 5 7 18 7
6 BES E2 + FSH (20 μg) 37
F-10 (13.51) (18.91) (48.64) (18.91)
Note: Means bearing similar superscripts show non-significant differences.

GV – Germinal Vesicle stage. MI – Metaphase I stage.
MII – Metaphase II stage. Deg –Degenerated oocyte.
Table 2. Influence of buffalo oestrus serum (BES) in the presence of oestradiol (E2) and follicle stimulating
hormone (FSH) on nuclear maturation of buffalo oocytes.
Total Stages of Maturation (%)

Hormone
S.N. Media Sera no. of GV MI MII Deg
concentration
oocyte (%) (%) (%) (%)
Ham's 9 5 10 6
1 - - 30
F-10 (30.00) (16.66) (33.33) (20.00)
Ham's 7 8 15 8
2 FBS - 38
F-10 (18.42) (21.05) (39.47) (21.05)
Ham's 4 4 10 6
3 FBS E2 (1 μg) 24
F-10 (16.66) (16.66) (41.66) (25.00)
Ham's 4 4 15 9
4 FBS E2 +FSH (1 μg) 32
F-10 (12.50) (12.50) (46.87) (28.12)
Ham's 27 5
5 FBS E2 +FSH (10 μg) 38 3 (7.89) 3 (7.89)
F-10 (71.05) (13.15)
Ham's 6 9 21 5
6 FBS E2 +FSH (20 μg) 41
F-10 (14.63) (21.95) (51.21) (12.19)
Note: Means bearing similar superscripts show non-significant differences.

GV – Germinal Vesicle stage. MI – Metaphase I stage.
MII – Metaphase II stage. Deg –Degenerated.
27
promoting components such as fetuin, which is higher culture medium for in vitro maturation,
in FCS than in adult oestrus serum. fertilization and development of bovine
Our results were in concurrence with the oocytes. Theriogenology, 36: 973-986.
observations of Fukui and Ono (1989) who did not Motlik, J. and J. Fulka. 1986. Factors affecting
observe any significant difference between FCS and meiotic competence in pig oocytes.
oestrus cow serum on bovine oocyte maturation. Theriogenology, 25: 87-96.
In conclusion, the results of this experiment Saeki, K., M.L. Leibfried-Rutledge and N.L. First.
showed that medium alone supported the maturation 1990. Are fetal calf serum and hormones
of buffalo oocytes only partially. The type of serum necessary during in vitro maturation of cattle
used during in vitro maturation also plays a oocytes for subsequent development.
significant role in the improvement of maturation rate Theriogenology, 33(1): 316.
of buffalo oocytes. In the present study, FBS was Sanbuissho, A and W.R. Threlfall. 1990. The
found to be more suitable protein supplement for in influence of serum and gonadotropins on in
vitro maturation of buffalo oocytes in comparison vitro maturation and fertilization of bovine
with BES. oocytes. Theriogenology, 34(2): 341-348.
Snedecor, G.W. and W.G. Cochran. 1994. Statistical
Methods, 8th ed. lowa State University Press,
ACKNOWLEDGEMENT USA, Oxford and IBH Publication, New
Delhi. 591p.
Authors are thankful to Dr. D.B. Sarode, Thibault, C. 1977. Are follicular maturation and
Associate Dean, Post Graduate Institute of oocyte maturation independent processes. J.
Veterinary and Animal Science of Akola, for Reprod. Fertil., 51: 1-15.
providing all necessary facilities. Totey S.M., C.H. Pawshe and G.P. Singh. 1993. In
vitro maturation and fertilization of buffalo
oocytes (Bubalus bubalis): Effects of media,
REFERENCES hormones and sera. Theriogenology, 39:
1153-1171.
Allen, R.L., K.R. Bondioli and R.W. Wright Jr..
*Continued from page 24
1982. The ability of fetal calf serum, newborn
calf serum and normal steer serum to promote Modi V.K., N.S. Mahendraker, D. Narasimha Rao
in vitro development of bovine morulae. and N.M. Sachindra. 2003. Quality of buffalo
Theriogenology, 18: 185-189. meat burger containing legume flour as
Bavister, B.D. 1987. Appendix I, p. 341-356. In binders. Meat Sci., 66: 143-149.
Bavister B.D. (ed). The mammalian Pietrasik, Z. 1999. Effect of content of protein, fat
preimplantation embryo. Plenum, New York. and modified starch on binding textural
Cross, P.C. and R.L. Brinster. 1970. In vitro characteristics and colour of comminuted
development of mouse oocytes. Biol Reprod., scalded sausages. Meat Sci., 51: 17-25.
3: 298-307. Rahardjo, R., L.A. Wilson and J.G. Subranek. 1994.
Fukui, Y. and H. Ono. 1989. Effect of sera, hormones Spray dried soymilk used in fat pork sausage
and granulosa cells added to culture medium patties. J. Food Sci., 59: 1286-1290.
for in-vitro maturation, fertilization, cleavage Sachindra N.M., P.Z. Sakhare, K.P. Yashoda and
and development of bovine oocytes. J. D. Narsimha Rao. 2005. Microbial profile of
Reprod. Fertil., 86: 501-506. buffalo sausages during processing and
Leibfried, M.L., E.S. Critser, W.H. Eyestone, D.L. storage. Food Control, 16(1): 31-35.
Northey and N.L. First. 1987. Developmental Suman S.P. and B.D. Sharma. 2003. Effect of grind
potential of bovine oocytes matured in vitro size and fat level on the physico-chemical and
or in vivo. Biol. Reprod., 36: 376-383. sensory characteristics of low-fat ground
Mochizuki, H., Y. Fukui and H. Ono. 1991. Effect buffalo meat patties. Meat Sci., 65(3): 973-
of the number of granulosa cells added to 976.
28
CLONING AND SEQUENCING OF THE LEPTIN GENE IN GIR CATTLE

AND MEHSANA BUFFALO
N. B. Jhala, D. N. Rank, P. H. Vataliya, C. G. Joshi, C. D. Bhong, H. H. Mehta and A. V. Patil
ABSTRACT of which only two exons (exon-2 and 3) are

translated into proteins. The leptin gene has been
The leptin gene is considered as a potential mapped to chromosome 4 in bovine (Stone et al.,
candidate gene influencing different production traits 1996; Pomp et al., 1997) and chromosome 8 in
in dairy cattle, for example, milk performance and buffalo (Vallinato et al., 2004). Variation in the
reproduction. Mutations in its sequences may alter exonic region of a gene may lead to changes in amino
animal performance as well as their breeding values. acids which alter the expressed protein. Therefore,
PCR products of Gir cattle and Mehsana buffalo the present study was undertaken to detect
were purified and ligated to pTZ57R/T vector sequence variation in leptin gene exon-3 by cloning
supplied with the InsT/A cloneTM cloning kit. The and sequencing in Gir cattle and Mehsana buffalo.
cloned PCR products (695 bp) of leptin gene exon- Cloning of the targeted region is preferred
3 were sequenced. The consensus sequence prior to sequencing, as it facilitates sequencing,
obtained was 508 bp in Gir cattle and 517 bp in allowing the use of primers in the vector, thus
Mehsana buffalo. There was sequence variation enabling us to determine the sequence of the whole
between cattle and buffalo at 11 positions. The insert without losing the sequence information of the
sequence obtained from Gir showed two point initial stretch of the amplicon. DNA fragments of
mutations (at positions 264 and 318), while the the leptin gene has been cloned in most domestic
sequence obtained from Mehsana buffalo showed animal species such as sheep (Dyer et al., 1997),
three point mutations (at positions 42, 44 and 250) cow (Ji et al., 1998), swine (Ramsay et al., 1998),
as compared to published sequence. dog (Iwase et al., 2000), cat (Sasaki et al., 2001),
and horse (Buff et al., 2002). The leptin gene is
Keywords: cloning, consesus sequence, ligation, highly conserved among vertebrates (Houseknecht
mutation and Portocarrero, 1998).
Further, once the PCR product is cloned into
a vector, it creates an almost indefinite resource of
INTRODUCTION the amplified material. To prove the specificity and
authenticity of the PCR product (538 bp), the
Milk production, the major economic trait fragment of leptin gene exon-3 amplified by gene
of dairy animals, is a quantitative trait governed by specific primers was subjected to sequencing.
polygenic inheritance. Leptin is a 16-kDa protein
synthesized by adipose tissue and is involved in
regulation of feed intake, energy balance, fertility, MATERIALS AND METHODS
and immune functions (Itossner, 1998; Fruhbeck et
al., 1998). Leptin is also responsible for the Primer set (L) (F: 5' GGGAAGGGCAG-
regulation of body weight and energy homeostasis AAAGATAGG 3', R: 5' GCCGCAACATGTCC-
(Friedman et al., 1998). The bovine leptin gene is TGTAGT 3') for exon 3 of the leptin gene was
organized into three exons separated by two introns, designed using Primer 3.0 and Primer Express
Department of Animal Genetics and Breeding, College of Veterinary Science and Animal Husbandry, Anand
Agricultural University, Anand, Gujarat-388001, India
29
softwares on the basis of gene sequences available 508 bp in Gir cattle and 517 bp in Mehsana buffalo
in the GenBank (NCBI) data base (Accession no. were obtained. These consensus sequences were
EU313203). Polymerase chain reaction (PCR) was then further used for alignment with the published
performed using primer set (L) to amplify the exon- sequence of leptin gene in Genbank using NCBI
3 region of the leptin gene as per conditions Blast and CLUSTAL W (1.82) software. The DNA
comprised of initial denaturation at 95 oC for 5 sequence of leptin gene exon-3 in Gir cattle (508
minutes followed by 30 cycles of denaturation at bp) and Mehsana buffalo (517 bp) obtained in this
95 oC for 45 sec, annealing at 55 0C for 45 sec, study were deposited in GeneBank under accession
extension at 72 oC for 45 sec and final extension at no. EU888290 and EU888289 respectively.
72 oC for 10 minutes. Amplified PCR products were
electrophoresed on 2 % agarose gel at 80 V and Sequence Analysis
visualized under gel documentation system. The size The nucleic acid sequences obtained using
of the PCR amplicon (538 bp) was ascertained by forward and reverse primer were aligned with
100 bp ladder. known sequences AY495586S2 (Accession no.
The PCR product generated by using gene AY495587.1), EU313203 (Accession no.
specific primers was purified and ligated to pTZ57R/ EU313203.1), BTU50365 (Accession no.
T vector supplied with the InsT/AcloneTM PCR U50365.1) of the leptin gene published in GenBank.
product cloning kit. The ligated mixture was used to Nucleotide (nt) sequence alignment of the leptin gene
transform E. coli (DH5-α) and the transormants of Gir cattle and Mehsana buffalo and published
were screened by blue white selection on X-gal/ sequences showed variable percentage of homology
IPTG/LB agar plates containing Ampicillin. After (96 % to 99 %), as depicted in Table 1.
12-15 h of incubation, blue and white colonies were The 508 nt sequence also showed 99%
seen on plates. All the white colonies which might homology with Accession No. AJ512639.1,
contain the insert were streaked on a fresh plate for Y11369.1, AJ132764.1 and 98 % homology with
further analysis. The white colonies were screened Accession No. U65793.1 of Bos taurus leptin gene
for the presence of the correct PCR product by partial cds. Similarly, 508 nt sequence of Gir cattle
colony PCR using M13 primers. Colony PCR showed 98 % homology with AF387814, AF387813
revealed the expected 695 bp product size in the of Bubalus bubalis and 97 % homology with
transformed colonies. The cloned PCR product was Accession No. AY338973.2 leptin gene exon-3,
subjected to sequencing by ABI PRISM O R
310 partial cds of Murrah buffalo.
Genetic Analyzer (Applied Biosystems, USA), using The 517 nt sequences of Mehsana buffalo
BigDyeO R
Terminator v3.1 Cycle sequencing Kit. showed 99 % homology with Accession No.
AF387814 and AF387813 of Bubalus bubalis and
98 % homology with Accession No.U65793.1 of Bos
RESULTS taurus, DQ831143.1 of Nili-Ravi, and AY338973.2
leptin gene, exon-3 partial cds of Murrah buffalo.
The sequences determined for the 538 bp Similarly, 518 nt sequence showed 97 % homology
segment within exon-3 of leptin gene from the with DQ831142.1 of Surti buffalo and 96 %
samples were assembled using SeqScape v2.5 homology with Accession No.Y11369 leptin gene,
software programme and consensus sequences of exon-3, partial cds of Bos taurus.
30
Table 1. Score table for alignment of 508 bp and 518 bp sequence of Gir cattle and Mehsana buffalo sequence
with the published sequences in Genbank.
Query
Subject sequence
sequence Homology
Seq Seq Accession Score (%)
Name Species Region
A B No.
Bos indicus Exon-3,complete
1 gir/lep 2 EU313203.1 99 %
cds
Exon-3,complete
1 gir/lep 3 U50365.1 Bos taurus 99 %
cds
Bubalus Exon-2,3, complete
1 gir/lep 4 AY495587.1 97 %
bubalis cds
Bos indicus Exon-3,complete
2 mb/lep 2 EU313203.1 97 %
cds
Exon-3,complete
2 mb/lep 3 U50365.1 Bos taurus 97 %
cds
Bubalus Exon-2,3, complete
2 mb/lep 4 AY495587.1 99 %
bubalis cds
Plate 1. Alignment of 508 bp and 518 bp sequence of leptin gene exon-3 from Gir cattle and Mehsana buffalo
with the sequence published in GenBank.
EU313203 AGCCCAGGAGACCAGCTTGGAAACATGGTGGTCACGTGGGCACAAGAAGTAAGGGCCCAG 60
U50365 AGCCCAGGAGACCAGCTTGGAAACATGGTGGTCACGTGGGCACAAGAAGTAAGGGCCCAG 60
gir ----------ACCAGCTTGGAAACATGGTGGTCACGTGGGCACAAGAAGTAAGGGCCCAG 50
AY495587 AGCCCAGGAGACCAGCTTGGAAACATGGTGGTCACATGGGCACAAGAAGTAAGGGCCCAG 60
mb AGCCCAGGAGACCAGCTTGGAAACATGGTGGTCACATGGGCGCGAGAAGTAAGGGCCCAG 60
************************* ***** * ****************
EU313203 GGAGGATGGTGTGGAAGCGGGGGAGGAAGCACCTCTACGCTCTAGGGAAAGGCGGAGTCA 120
U50365 GGAGGATGGTGTGGAAGCGGGGGAGGAAGCACCTCTACGCTCTAGGGAAAGGCGGAGTCA 120
gir GGAGGATGGTGTGGAAGCGGGGGAGGAAGCACCTCTACGCTCTAGGGAAAGGCGGAGTCA 110
AY495587 GGAGGATGGTGTGGAAGTGGGG-AGGAAGAACCTCTATGCTCTAGGGAAAGGCAGAGTCA 119
mb GGAGGATGGTGTGGAAGTGGGG-AGGAAGAACCTCTATGCTCTAGGGAAAGGCAGAGTCA 119
***************** **** ****** ******* *************** ******
EU313203 GGGGAGCTCTGAGGAGCTGCCCTCTCTCCCACTGAGCTCTTGCTCTCCCCTTCCTCCTGC 180
U50365 GGGGAGCTCTGAGGAGCTGCCCTCTCTCCCACTGAGCTCTTGCTCTCCCCTTCCTCCTGC 180
gir GGGGAGCTCTGAGGAGCTGCCCTCTCTCCCACTGAGCTCTTGCTCTCCCCTTCCTCCTGC 170
AY495587 GGGGAGCTCTGAGGAGCTGCCCTCTCTCCCACTGAGCTCTTGCTCTCCCCTTCCTCCTGC 179
mb GGGGAGCTCTGAGGAGCTGCCCTCTCTCCCACTGAGCTCTTGCTCTCCCCTTCCTCCTGC 179
************************************************************
EU313203 ATAGCAGTCCGTCTCCTCCAAACAGAGGGTCACTGGTTTGGACTTCATCCCTGGGCTCCA 240
U50365 ATAGCAGTCCGTCTCCTCCAAACAGAGGGTCACTGGTTTGGACTTCATCCCTGGGCTCCA 240
gir ATAGCAGTCCGTCTCCTCCAAACAGAGGGTCACTGGTTTGGACTTCATCCCTGGGCTCCA 230
AY495587 ATAGCAGTCCGTCTCCTCCAAACAGAGGGTCACTGGTTTGGACTTCATCCCTGGGCTCCA 239
mb ATAGCAGTCCGTCTCCTCCAAACAGAGGGTCACTGGTTTGGACTTCATCCCTGGGCTCCA 239
************************************************************
31
EU313203 CCCTCTCCTGAGTTTGTCCAAGATGGACCAGACATTGGCGATCTACCAACAGATCCTCAC 300

U50365 CCCTCTCCTGAGTTTGTCCAAGATGGACCAGACATTGGCGATCTACCAACAGATCCTCAC 300
gir CCCTCTCCTGAGTTTGTCCAAGATGGACCAGACGTTGGCGATCTACCAACAGATCCTCAC 290
AY495587 CCCTCTCCTGAGTTTGTCCAAGATGGACCAGACATTGGCGATCTACCAACAGATCCTCAC 299
mb CCCTCTCCTGGGTTTGTCCAAGATGGACCAGACATTGGCGATCTACCAACAGATCCTCAC 299
********** ********************** **************************
EU313203 CAGTCTGCCTTCCAGAAATGTGGTCCAAATATCCAATGACCTGGAGAACCTCCGGGACCT 360
U50365 CAGTCTGCCTTCCAGAAATGTGGTCCAAATATCCAATGACCTGGAGAACCTCCGGGACCT 360
gir CAGTCTGCCTTCCAGAAATGTGGTCCAGATATCCAATGACCTGGAGAACCTCCGGGACCT 350
AY495587 CAGTCTGCCTTCCAGAAATGTGGTCCAAATATCTAATGACCTGGAGAACCTCCGGGACCT 359
mb CAGTCTGCCTTCCAGAAATGTGGTCCAAATATCTAATGACCTGGAGAACCTCCGGGACCT 359
*************************** ***** **************************
EU313203 TCTCCACCTGCTGGCCGCCTCCAAGAGCTGCCCCTTGCCGCAGGTCAGGGCCCTGGAGAG 420
U50365 TCTCCACCTGCTGGCCGCCTCCAAGAGCTGCCCCTTGCCGCAGGTCAGGGCCCTGGAGAG 420
gir TCTCCACCTGCTGGCCGCCTCCAAGAGCTGCCCCTTGCCGCAGGTCAGGGCCCTGGAGAG 410
AY495587 TCTCCACCTGCTGGCCGCCTCCAAGAGCTGCCCCTTGCCACAGGTCAGGGCCCTGGAGAG 419
mb TCTCCACCTGCTGGCCGCCTCCAAGAGCTGCCCCTTGCCACAGGTCAGGGCCCTGGAGAG 419
*************************************** ********************
EU313203 CTTGGAGAGCTTGGGCGTTGTCCTGGAAGCTTCCCTCTACTCCACCGAGGTGGTGGCCCT 480
U50365 CTTGGAGAGCTTGGGCGTTGTCCTGGAAGCTTCCCTCTACTCCACCGAGGTGGTGGCCCT 480
gir CTTGGAGAGCTTGGGCGTTGTCCTGGAAGCTTCCCTCTACTCCACCGAGGTGGTGGCCCT 470
AY495587 TTTGGAGAGCTTGGGCGTCGTCCTGGAAGCCTCCCTCTACTCCACCGAGGTGGTGGCCCT 479
mb TTTGGAGAGCTTGGGCGTCGTCCTGGAAGCCTCCCTCTACTCCACCGAGGTGGTGGCCCT 479
***************** *********** *****************************
EU313203 GAGCCGGCTGCAGGGGTCACTACAGGACATGTTGCGGC 518
U50365 GAGCCGGCTGCAGGGGTCACTACAGGACATGTTGCGGC 518
gir GAGCCGGCTGCAGGGGTCACTACAGGACATGTTGCGGC 508
AY495587 GAGCCGGCTGCAGGGGTCACTACAGGACATGTTGCGGC 517
mb GAGCCGGCTGCAGGGGTCACTACAGGACATGTTGCGGC 517
**************************************
Note: DISCUSSION
“*” sign indicates nucleotides in that column
are identical in all the sequences in the alignment. Vallinoto et al. (2004) analysed 49 Carabao,
Yellow colour indicates nucleotide variations 52 Murrah, 27 Mediterraneo and 17 Jafarabadi
in the sequence of cattle and buffalo. buffaloes for SNP in leptin gene exon-3 region. PCR
Green colour indicates point mutations in the products were purified using DNA Gel-Extraction
sequence obtained in the present study as compared kit (Qiagen) and analysed using a ThermoSequenase
with the conserved regions of published sequence. Fluorescence Labelled Cycle Sequencing kit.
Approximately 6 kb of the bubaline leptin gene was
The nucleotide sequence variation between sequenced including the 5' region, and the sequence
cattle and buffalo was present at 11 positions (36, was submitted in Genbank under Accession No.
78, 83, 90, 98, 114, 333, 399, 420, 438 and 450). Leptin AY495586. The three SNPs were identified. One
gene sequence of 508 bp in Gir cattle revealed two in promoter at 137 and two SNPs were identified in
point mutations at 264 and 318 positions in exon-3 at positions 276 and 384 (both G A). Only
comparison with the published sequences. Leptin swamp buffaloes had the SNP at position 384, while
gene sequence of 517 bp in Mehsana buffalo all river types (Murrah and Jafarabadi) showed a
revealed three point mutations at 42, 44 and 250 guanine. The frequencies of the SNP137 G allele
positions in comparison with the published sequences were 0.18, 0.69, 0.52 and 0.03 in the Carabao,
(As shown in Plate 1). Murrah, Mediterraneo and Jafarabadi respectively.
32
CONCLUSION Fruhbeck, G., S. A. Jebb and A. M. Prentice. 1998.

Leptin: physiology and path physiology. Clin.
The PCR products (538 bp) of leptin gene Physiol., 18: 399-419.
exon-3 from Gir cattle and Mehsana buffalo were Houseknecht, K. L. and C. P. Portocarrero. 1998.
cloned into pTZ57R/T vector and sequencing by Leptin and its receptors: regulators of whole-
ABI PRISM O R
310 Genetic Analyzer. The partial body energy homeostasis. Domest. Anim.
leptin gene exon-3 sequence data obtained were Endocrinol., 15: 457-475.
analyzed in silico by employing software tools, viz. Itossner, K. L. 1998. Cellular, molecular and
NCBI BLAST, SeqScape and ClustalW, to access physiological aspects of leptin: Potential
the genetic variation. Gene sequencing of the cloned application in animal production. J. Anim. Sci.,
PCR product 538 bp yielded leptin gene partial 26: 463-480.
sequences of 508 bases in Gir cattle and 517 bases Iwase, M., K. Kimura, N. Sasaki, R. Komagome,
in Mehsana buffalo which showed variable degrees K. Ishioka, M. Morimatsu, T. Murakami and
of homology (96 % to 99 %) with published M. Saito. 2000. Canine leptin: cDNA cloning,
sequences AY495586S2 (Accesion no. expression and activity of recombinant protein.
AY495587.1), EU313203 (Accesion no. Res Vet Sci., 68: 109-114.
EU313203.1), BTU50365 (Accesion no. U50365.1) Ji, S., G. M. Willis, R. R. Scott and M. E. Spurlock.
and were deposited in GeneBank under accession 1998. Partial cloning and expression of the
nos. EU888290 and EU888289 respectively. bovine leptin gene. Anim. Biotechnol., 9: 1-
The nucleotide sequence variation between 14.
cattle and buffalo was present at 11 positions, and Pomp, D., T. Zou, A. C. Clutter and W. Barendse.
the sequence of the leptin gene obtained in present 1997. Rapid communication: Mapping of leptin
study showed two point mutations at positions 264 to bovine chromosome 4 by linkage analysis
and 318 in Gir cattle and three point mutations at of a PCR-based polymorphism. J. Anim. Sci.,
positions 42, 44 and 250 in Mehsana buffalo. 75: 1427.
Ramsay, T. G., X. Yan and C. Morrison. 1998. The
obesity gene in swine: sequence and
REFERENCES expression of porcine leptin. J. Anim. Sci., 76:
484-490.
Buff, P. R., A. C. Dodds, C. D. Morrison, N. C. Sasaki, N., H. Shibata, T. Honjoh, K. Kimura, M.
Whitley, E. L. McFadin, J. A. Daniel, J. Djiane Saito and I. Ohishi. 2001. cDNA cloning of
and D. H. Keisler. 2002. Leptin in horses: feline leptin and its mRNA expression in
tissue localization and relationship between adipose tissue. J. Vet. Med. Sci., 63: 1115-
peripheral concentrations of leptin and body 1120.
condition. J Anim Sci., 80: 2942-2948. Stone, R. T., S. M. Kappes and C. W. Beattie. 1996.
Dyer, C. J., J. M. Simmons, R. L. Matteri and D.H. The bovine homologue of the obese gene maps
Keisler. 1997. cDNA cloning and tissue- to chromosome 4. Mamm. Genome., 7: 399-
specific gene expression of ovine leptin, NPY- 400.
Y1 receptor, and NPY-Y2 receptor. Domest. Vallinoto, M., M. P. C. Schneider, A. Silva, L.
Anim. Endocrinol., 14: 295-303. Iannuzzi and B. Brenig. 2004. Molecular
Friedman, J. M. 1998. Leptin, leptin receptors, and cloning and analysis of the swamp and river
the control of body weight. Nutr. Rev. 56: 38- buffalo leptin gene. Anim. Genet., 35 (6): 462-
46. 463.
33
STRUCTURAL FEATURES OF THE 5' -FLANKING REGION OF THE β-LACTO GLOBULIN

GENE OF BUFFALO (BUBALUS BUBALIS)
A.M. Kotresh1, G.B. Arunkumar2, C. Kanthraj2, Meeta Saxena3, Bhaskar Sharma3
ABSTRACT INTRODUCTION
β-lactoglobulin is an abundant globular milk- β-lactoglobulin (β-LG) is the major globular

whey protein expressed in glandular epithelium of milk whey protein of ruminant species and is also
the mammary gland of ruminants and some other secreted in the milk of some but not all other species.
species. The expression of β-lactoglobulin is (Habling et al.,1992). β-LG belongs to the protein
controlled by different regulatory elements which family of lipocalins and is a 18 kDa polypeptide
act through its promoter. The present study was capable of binding small hydrophobic compounds
designed to clone and characterize the sequence of (Flower et al., 2000). β-LG affects milk composition
promoter region of β-lactoglobulin gene. The genomic and product functionality and can be present in up
DNA was isolated from buffalo white blood cells to eight genetic variant forms. (Paterson et al.,
(WBCs). The promoter region of β-lactoglobulin 1995). The variation in the concentrations of β-LG
gene was amplified using PCR, then cloned and variants has profound influence on the mechanical
sequenced. The sequence has been submitted to the strength and coagulation kinetics of the rennet-
nucleotide database of the National Centre for induced casein gels, the knowledge of which helps
Biological Information (NCBI)/GenBank with the in better control and optimization of processing
accession number AM 238696. Computational conditions during the manufacturing of cheese and
analysis of the sequence showed the presence of cheese analogs (Meza-Nieto et al., 2007). It is
highly conserved core putative transcription factors expressed in the mammary gland during late
(presented in the TRANSFAC database) binding pregnancy and lactation, and its expression, as with
sites, viz., signal transduction and activator of all other milk proteins, is stimulated by synergetic
transcription (STAT V), insulin response element, action of three lactogenic hormones: insulin,
glucocorticoid response elements, pregnancy specific glucocorticoids, and prolactin, and attenuated by
mammary nuclear factor, yin and yang factor (YY1) progesterone (Vonderhaar and Ziska, 1989).
and CCAAT/enhancer binding protein (C/EBP). Studies using both transgenic mice and
Homologies of 86.4, 75.1, and 80.3 %, were found transfected mammary epithelial cells have
with bovine, sheep, and goat, respectively. A established that composite response elements
phylogenetic tree constructed on the basis of containing multiple binding sites for several
sequence comparisons showed that the buffalo is transcription factors mediate the hormonal and
evolutionarily more closely related to cattle with developmental regulation of milk protein gene
respect to this gene. expression (Rosen et al., 1999). There are eight
transcription factors important for expression of milk
Keywords: β-lacto globulin, 5'-flanking region, protein genes, and the locations of their binding sites
buffalo, promoter analysis, milk protein genes in some of these genes promoters have been
1
Department of Veterinary Biochemistry, Veterinary College, Nandinagar, Bidar, Karnataka, India. 585401
2
Biotechnology Division. IVRI Izatnagar, UP. India
3
Division of Biochemistry, IVRI Izatnagar, UP. India
34
described: 1. MGF/STAT5 (signal transduction and software and Exome (Mascon Life Sciences,
activator of transcription 5) (Wakao et al., 1994); 2. India).The primer sequences designed were
Mammary cell activating factor (Welte et al., 1994); forward, 5'-TAC CGA ATA AAA GTG GCA AGA
3. PMF (pregnancy specific nuclear factor) (Lee GTG G-3' and reverse, 5'-AGG GAG TGG AGG
and Oka, 1992 ); 4. C/EBP (CCAAT/enhancer GCT GAG ACA.-3'.
binding protein) (Raught et al., 1995); 5. CTF/NF1
(nuclear factor 1) (Li and Rosen, 1995); 6. AP-1 Polymerase Chain Reaction (PCR)
(activator protein 1); 7. YY1 (yin and yang factor PCR reactions were carried with a reaction
1) (Meier and Groner, 1994); 8. GRE (glucocorticoid mixture composed 5 μl of 10X Taq buffer
response element) (Welte et al., 1993). (Mg+free) (MBI Fermentas) , 4 μl of 25 mM MgCl2
The buffalo is an economically important (MBI Fermentas), 2 μl of 10 mM dNTP’s)(MBI
livestock species in Asia. Animal bioassays have Fermentas), 1 μl of each primer (25 pmoles/μl),
shown the protein efficiency ratio (PER) value of one μl of template DNA (100 ng), 0.5 μl of Taq
buffalo milk proteins to be 2.74 while that of cow DNA polymerase(5U/μl MBI Fermentas), and
milk is 2.49. Buffalo milk has about 11.42 percent double distilled autoclaved water up to 50 μl. An
more protein than cow’s milk. Despite its economic initial denaturation at 94 oC for 10 minutes was done,
importance of milk, studies of the molecular and subsequently denaturation and primer extension
mechanisms regulating expression of milk protein were carried out at 94 oC for one minute and at
genes in the buffalo have not been initiated. There 72 oC for one minute, respectively. The annealing
are many systemic studies on the structure of 5' - temperature and time were determined by using
flanking sequences of milk protein genes in other gradient PCR and standardized at 66.5 oC for one
species (Coll.A. et al., 1995; Tadeusz Malewski, minute. The number of cycles was kept constant at
1998; Akos Gerencser et al., 2001). In this study 30. After the last cycle, a final primer extension was
we characterize the 5' regulatory region of the β- carried out at 72 oC for ten minutes, and the samples
LG for putative transcription factors binding sites were then cooled to 4 oC until retrieved.
which may be involved in lactoglobulin expression in
the mammary gland. We are interested in finding Cloning of PCR product
out whether the known set of consensus sequences The amplified product of 5'-flanking region
to regulate the milk protein gene expression in other of β-lactoglobulin gene was run on a 0.4 %
species also applies to the buffalo β-LG. preparative LMP agorose gel and extracted using a
MinElute Gel Extraction Kit (Quagen) following the
manufacturer’s instructions. The concentration was
MATERIALS AND METHODS checked on 1 % agarose gel electrophoresis in
Alpha Imager Gel documentation system by
Isolation of genomic DNA densitometry. The fragment was ligated to pGLOW
The genomic DNA was isolated by lysis of TOPO promoter less cloning vector (Invitrogen) with
blood cells following the method described by a ligation mixture composed of 1 μl of salt solution
Sambrook and Russel (2001).The purity of the high (1.21 NaCl; 0.06 M MgCl2), 1 μl of Vector DNA
molecular weight DNA was checked on a (50 ng/μl), 1.5 μl of Insert DNA (30-40 ng/μl) and
conventional 0.6 % agarose gel. nuclease free water to a final volume of 10 μl. The
ligation was carried out for 5 minutes. The ligation
Designing of primers mix was used for transformation following the
To amplify the 3.45 Kb 5'-flanking region method described by Sambrook and Russel (2001)
of the β-lactoglobulin gene, the primers were using one shot TOPO chemically competent E. coli
designed from the published bovine, sheep, and goat on LB ampicillin plates with X-gal and IPTG. The
sequences available from the NCBI Gene Bank colonies were visualized after incubation for 12-16
(Acc. No. X14710, Z3381, X68105) with the help h at 37 oC. After transformation, the plates were
of the Primer Select Programme of Laser software screened for the presence of blue/white colonies.
DNASTAR (Madison, USA) and Gene Tool Lite The recombinant clones were identified by white
35
color on indicator plates. The positive samples were sequence was submitted to the NCBI Gene Bank
reconfirmed by restriction enzyme digestion of the and the accession number obtained was AM 238696.
plasmid DNA with Xba 1 and Spe1 enzymes as Vertebrate genes contain regulatory regions with a
both enzymes have cutting sites on either side of high G+C content, designated as CpG islands. When
multiple cloning sites in pGLOW TOPO cloning a large number of sequences of vertebrate genes
vector. were screened for the presence of CpG islands, the
5' CpG islands extended through the 5'-flanking
Sequencing and analysis of 3.41kb fragment DNA, exons and introns, generally found in the same
in pGLOW TOPO cloning vector position relative to the transcription unit of equivalent
Sequencing was performed by an genes in different species, with some notable
automated sequencer (ABI prism) using Sanger’s exceptions (Gardiner-Garden M and Frommer M.
dideoxy chain termination method. The cloned PCR 1987). The occurrence of an elevated GC content
products were submitted in the form of the stab in the β-LG promoter region, even though there was
culture of transformed cells to the University of Delhi not much sequence homology, suggests that this 5'
South Campus for sequencing. The sequence flanking region has all the characteristics of high
obtained was first blasted (www.ncbi.nlm.nih.gov/ CpG islands and may be important for this milk
BLAST) to ascertain that the sequence was of the protein gene function.
5'-flanking region of β-lactoglobulin gene. The The 5'-flanking region of β-LG was
nucleotide sequence was then aligned with those of subjected to BLAST analysis at the NCBI to
the reported β-lactoglobulin gene sequences of retrieve the sequences of the related species, like
different species using the clustalW method of bovine, goat and sheep. The multiple alignment study
MegAlign Programme of Lasergene Software by ClustalW method revealed 86.4, 75.1, 80.3 %
(DNASTAR). To search for putative transcription similarity, respectively, with bovine, goat and sheep.
factors binding sites the sequence was also analyzed Milk protein genes are shown to have high rate of
for homology match with the consensus sequences divergence. Homologies of 5' flanking regions are
of transcription factors present in the TRANSFAC less than those of coding sequences and it has been
database. speculated that the homology region corresponds to
motifs typical of some regions of promoters
(Malewski, 1998.). The phylogenitic tree constructed
RESULTS AND DISCUSSION on the basis of nucleotide sequence of the 5'-flanking
regions of β-LG genes of bovine, goat, and sheep
The 5'-flanking region of the β-lactoglobulin shows the evolutionary relationship among
gene of the buffalo (Bubalus bubalis), or the ruminants. The buffalo and the bovine form one
promoter region amplified was 3.457 kbp (Figure 1) cluster having closest relation while sheep and goat
and had 20.6 % A, 25.7 % G, 25.6 % G, 28.1 % G; maintain closest relation in the other cluster. This
A+T was 46.2 % and G+C was 53.8 %. The suggests that bovine and buffalo might have evolved
from the same ancestor.
Figure 2. A phylogenetic tree constructed based on the nucleotide sequences of 5'-flanking regions of β-LG
genes of different species.
36
Table 1.
Position in 5′-flanking
Transcription factors Consensus sequences
regions of β-LG gene
NF-kappa B binding site NGGGACTTTCCA -2870…-2859
-2920…-2912
STAT x TTCCCRKAA
-91…-83
CCAAT/enhancer -3163…-3151
NNTKTGGWNANNN
binding protein
-2648…-2639
Activator protein 4 CWCAGCTGGN -2127…-2117
Insulin Response -1654…-1660

CCGCCTC
Element
Glucocarticoid TGTTCT
-795-813
responsive element
-539…-534
Yin and Yang CCATNT -2534…-2529
Pregnancy specific
TGAATN 4-7 ATCA -2350…-2339
mammary nuclear factor
Mammary cell
GRRGSAAGK -2925…-2917
activating factor
CCAAT-binding
GCCAAT -1380….-1375
factor/Nuclear Factor 1
TATAA signal TATAA -33…-29

mRNA(BLG gene) +1…..
The nucleotides are designated in one letter code: A=Adenine; C=Cytosine; G=Guanine; R=A/G; K=G/T;
N=A/C/G/T; W=A/T; S=G/C
37
Putative transcription factor binding sites Pan et al. (1997) have demonstrated that the sheep
were identified (Table 1) in the promoter sequence beta LG transgenes containing only the 406-bp 5'-
from both the literature (Akos et al., 2002; Tadeusz, flanking sequences were efficiently expressed in the
1998; Tadeusz and Lech, 2002) and a search of mouse mammary gland at a high level. The factors
transcription factor databases like the TRANSFAC characterized in the β-LG 5' flanking region involved
database, which contains information on transcrip- in the transcriptional control of this gene could be
tion factors and their origins, functional properties utilized in the construction of transgenic vector with
and sequence-specific binding activities. The β-LG β-LG promoter for expression of heterologous
promoter of buffalo is shown to have all the protein in the buffalo milk. Further studies are
necessary elements dispersed on a fairly necessary to evaluate the importance cloned buffalo
reasonable length of the 5' flanking region. The β-LG 5' flanking region in driving transgene
analysis showed the presence of highly conserved expression in animals and to reveal the significance
putative transcription factors like, NF-kappa B of the differences compared with other milk protein
binding site, STAT x, CCAAT/ CCAAT enhancer genes.
binding protein, insulin response element,
glucocorticoid response elements, yin and yang
elements, pregnancy specific mammary nuclear ACKNOWLEDGMENT
factor, mammary cell activating factor, CCAAT-
binding factor/nuclear factor 1 (Table 1). The 5'- The authors are grateful to the Director,
flanking region of the β-lactoglobulin gene of the Indian Veterinary Research Institute, Izatnagar,
buffalo includes the putative TATA box that has been Bareilly, India, for providing facilities to conduct this
described for the bovine sequence (Alexander et study.
al., 1988). Table 1 shows that the buffalo has 1 C/
EBP (CCAAT/enhancer binding protein), 1 CTF/
NF1 (nuclear factor 1), 2 MGF/STAT5 (signal REFERENCES
transduction and activator of transcription 5), 1 PMF
(pregnancy specific nuclear factor) and 2 YY1 (yin Akos Gerencser, Endre Barta, Simon Boa, Petros
and yang factor 1) and 1 insulin response element Kastanis, Zsuzsanna Bosze, C. Bruce and
consensus sequences in the sequenced part of the A.Whitelaw. 2001. Comparative analysis on
region. Two of the sites (C/EBP, CTF/NF1 and the stuctural features of the 5' flanking region
MGF) found were identified as common motifs in of k-casein genes from six different species.
28 milk protein gene promoters (Tadeusz, 1998.) In Genet.Sel Evol., 34: 117-128.
addition, some similarities with other milk protein pro- Alexander, L.J., A.F. Stewart, A.G. Mackinlay, T.V.
moters were identified. For example, the frequently Kapelinskaya, T.M. Tkach and S.I.
studied β-casein gene promoter harbors two lacto- Gorodetsky. 1998. Isolation and characteri-
genic hormone response regions (LHRR), which are zation of the bovine kappa-casein gene. Eur.
characterized by the presence of multiple C/EBP J. Biochem., 178: 395-401.
sites with at least one binding site for MGF/STAT5 Coll. A., J.M. Folch and A. Sanchez. 1995. Structural
(Doppler et al., 2000). In addition, an insulin response features of the 5' flanking region of the caprine
element (IRE) and glucocarticoid response element k-casein gene. J. dairy Sci., 78: 973-977.
(GRE) sequences are present and these sequences Flower, D.R., A.C.T. North, and C.E. Sansom.
have complete homology with the consensus se- 2000. The lipocalin protein family-structural
quences found in other milk protein gene promot- and sequence overview. Biochim. Biophys.
ers. This shows that insulin and glucocarticoids have Acta. 1482: 9-24.
high influence on the expression of beta lactoglobu- Gardiner-Garden M. and M. Frommer. 1987. CpG
lin. islands in vertebrate genomes. J. Mol. Biol.,
Several studies have used β-LG 5' flanking 196(2): 261-282.
sequences to drive transgene expression in animals.
38
Hambling, S.G., A.S. McAlpine, and L. Sawyer. influence β-casein gene expression. Mol.
1992. β-Lactoglobulin, p. 140-191. In P.F. Fox, Endocrinol., 9: 1223-1232.
(ed.). Advanced Dairy Chemistry-I: Rosen, J.M., C. Zahnow, A. Kazansky and B.
Proteins. Elsevier, London, UK. Raught. 1998. Composite response elements
Lee, Ch.S. and T. Oka. 1992. A pregnancy-specific mediate hormonal and developmental
mammary nuclear factor involved in the regulation of milk protein gene expression.
repression of mouse β-casein gene Biochem. Soc. Symposium, 63: 101-113.
transcription by progesterone. J. Biol. Chem., Rosen, J.M., S. Li, B. Raught and D. Hadsell. 1999.
267: 5795-5801. The mammary gland as a bioreactor: factors
Li, S. and J.M. Rosen. 1995. Glucocorticoid regulating the efficient expression of milk
regulation of rat whey acidic protein gene protein-based trans-genes. Amer. J. Clin.
expression involves hormone induced Nutr., 63: 6275-6325.
alterations of chromatin structure in the distal Sambrook J. and D.W. Russell. 2001. Molecular
promoter region. Mol. Endocrinol., 8: 1328- Cloning: A Laboratory Manual, 3rd ed. Cold
1335. Spring Harbor Laboratory Press, New York,
Meier,V.S. and Groner. 1994. The nuclear factor USA.
YY1 participates in repression of the β-casein Tadeusz Malewski. 2002. Computer analysis of
gene promoter in mammary epithelial cells and distribution of putative cis- and trans regulatory
is countered by mammary gland factor during elements in milk protein gene promoters.
lactogenic hormone induction. Mol. Cell. Biosystems, 45: 29-44.
Biol., 14:128-137. Tadeusz Malewski and Lech Zwierzchowski. 2002.
Meza-Nieto M.A., B. Vallejo-Cordoba, A.F. Genes expressed in cattle mammary gland-
/ / /
Gonzalez-Cordova, L. Felix and F.M. computational analysis of 5'-upstream
Goycoolea. 2007. Effect of beta-lactoglobulin sequences in search for factors conferring a
A and B whey protein variants on the rennet- tissue and stage-specific transcription. Animal
induced gelation of skim milk gels in a model Sciences Papers and Reports, 20(1): 5-20.
reconstituted skim milk system. J. Dairy Sci., Vonderhaar, B.K. and S.E. Ziska. 1989. Hormonal
90(2): 582-93. regulation of milk protein gene expression.
Pan L., J. Chen and C. Chen. 1997. Cloning and Ann. Rev. Physiol., 51: 641-649.
sequence analysis of the 5'-flanking region of Welte, T., K. Garimorth, S. Philipp and T. Doppler.
goat beta-lactoglobulin gene. Chin. J. 1994. Pralactin dependent activation of a
Biotechnol., 13(2): 79-83. tyrosine phosphorylated DNA binding factor
Paterson G.R, J.P. Hill and D.E. Otter. 1995. in mouse mammary epithelial cells. Mol.
Separation of beta-lactoglobulin A, B and C Endocrinol., 8: 1091-1102.
variants of bovine whey using capillary zone Welte, T., S. Philipp, C. Cairns, J.A. Gustafson and
electrophoresis. J. Chromatogr. A., 700(1- T. Doppler. 1993. Glucocorticoid receptor
2): 105-110. binding sites in the promoter region of milk
Roaut, B., W.S.L. Liao and J.M. Rosen. 1995. protein genes. J. Steroid Biochem. Mol.
Developmentally and hormonally regulated Biol., 47: 75-81.
CCAAT/enhancer-binding protein iosforms
39
EFFECTS OF INCLUSION OF COTTON STEM IN THE DIETS OF BUFFALO (BUBALUS

BUBALIS) CALVES ON HAEMATOLOGICAL PARAMETERS
Ch.Srinivasa Prasad, R.M.V. Prasad, D. Srinivas Kumar, K. Aswani Kumar, P. Jaya Lakshmi,
K. Suresh and G.V. Krishna Reddy
ABSTRACT were observed in Group II compared to Group I

(14.99+1.26 pg) and non-significantly higher values
Cotton stem, a by-product of cotton growing, were observed in Group III (20.42+1.58 pg)
is rich in protein and can be incorporated in the diets compared to Group I. It was concluded that feeding
of animals. However, its use is restricted due to the of complete diets incorporating cotton stem with or
presence of a toxic principle, gossypol. Buffaloes without urea treatment as a roughage component
have the ability to detoxify gossypol as it binds to along with 10 % legume hay was found to be
microbial protein in the rumen. However, this ability superior without resulting in any deleterious effects
is reduced at higher levels of cotton crop feeding. when compared to the conventional way of feeding
Further, the hemoglobin and hematocrit values in the with paddy straw and a limited amount of
animals fed cotton crop are reduced even before concentrate mixture in growing buffalo calves.
the animals exhibit symptoms of gossypol toxicity.
Hence, in the present study, the effects of inclusion Keywords: cotton stem, gossypol, compete diets,
of cotton stem in the diets of buffalo calves on haematological parameters, buffalo calves
haematological parameters were evaluated. Fifteen
buffalo bull calves were divided into three groups of
five animals each. Group I (control) were fed with
diet comprising of conventional feed (paddy straw INTRODUCTION
and concentrate). Group II were fed with diet
comprising urea-treated cotton stem, legume fodder Cotton is one of the major crops grown in
and concentrate feed (50(40+10):50) and Group India. Cotton stem is a by-product of cotton growing
III were fed with diet comprising untreated cotton and is generally used as firewood. It is rich in protein
stem, legume fodder and concentrates and can be incorporated in the diets of animals by
(50(40+10):50). The blood samples collected after subjecting it to suitable processing methods.
120 days of feeding were analyzed for However, its use is restricted due to the presence
haematological parameters such as haemoglobin of a toxic principle, gossypol. Gossypol (C30H30O8),
(Hb), packed cell volume (PCV), total erythrocyte a polyphenolic substance which is a natural toxin
count (TEC), total leucocyte count (TLC), mean present in the cotton plant that protects it from insect
corpuscular volume (MCV), mean corpuscular damage. Gossypol in free form is toxic and in bound
haemoglobin (MHC) and mean corpuscular form is non-toxic. Gossypol primarily affects the
haemoglobin concentration (MCHC). Significantly heart and liver. The reproductive system,
higher levels of Hb and PCV were found in Groups abomasums, and kidney are also affected. Simple
II (12.2+0.40 gm % and 32.6+2.40 %) and III stomached (monogastric) animals such as pigs have
(13.64+0.55 gm % and 31.8+2.76 %) compared to long been known to be susceptible to gossypol
Group I (9.2+0.62 gm % and 23.2+2.29 %). No toxicity. Young calves and lambs are also quite
significant difference was observed between the susceptible to gossypol toxicity. Ruminants have the
groups with regard to TEC, TLC, MCV and MCHC. ability to detoxify gossypol as the gossypol binds to
Significantly higher levels of MCH (21.70+1.43 pg) microbial protein in the rumen and is not absorbed.
Department of Veterinary Physiology N.T.R. College of Veterinary Science, Gannavram, India-521 102
40
Thus, buffaloes are not normally affected at normal RESULTS AND DISCUSSION
levels of feeding cotton plant. However, this ability
is reduced at higher levels of cotton stem feeding. The mean values of Hb, PCV, TEC, TLC,
Further, the hemoglobin and haematocrit reduce even MCV, MHC and MCHC are presented in Table 2.
before the animals exhibit symptoms of gossypol In the present study, significantly higher
toxicity. Hence, the present study was carried out levels of Hb and PCV were found in Groups II and
to compare the effect of diets containing cotton stem III, fed cotton stem, compared to Group I, fed
with conventional feed and to assess gossypol conventional feed. No significant difference was
toxicity, if any, by studying hematological parameters. observed between the groups with regard to TEC,
TLC, MCV and MCHC. Significantly higher levels
of MCH were observed in Group II compared to
MATERIALS AND METHODS Group I and non-significantly higher values were
observed in Group III compared to Group I. The
Fifteen buffalo bull calves aged about 10 hemoglobin and haematocrit values were higher in
months were procured from a local market and Groups II and III compared to Group I and are
divided into three groups of five each and subjected contrary to the earlier reports (Herman, 1970; Randel
to three dietary treatments for a period of 120 days. et al., 1996; Brocas et al., 1997; Dabrowski et al.,
Group I (control) was fed a diet comprising 2000), where lower levels of hemoglobin and
conventional feed (paddy straw and concentrate), hematocrit were observed upon feeding by-products
Group II was fed with a diet comprising urea treated of cotton. This indicates that no gossypol toxicity
cotton stem (UTCS) and legume fodder and Group was observed in Groups II and III fed with diets
III with a diet comprising untreated cotton stem (CS) containing cotton stem as the gossypol that was
and legume fodder. The diets and their crude protein present in the cotton stem was neutralized by
(CP) and crude fiber (CF) levels (AOAC, 1995) of microbial protein in rumen. Further, cotton stem,
the three groups are presented in Table I. Dried being a rich source of nitrogen, helps in the synthesis
cotton stem was chaffed by a specially made chaff of microbial protein, which in turn increased the
cutter cum grinder manufactured for the purpose. haemoglobin synthesis and hematocrit (Jain, 1993).
The blood samples were collected after 120 Gossypol toxicity causing primarily heart
days of feeding and were analyzed for damage and death due to heart failure has been
haematological parameters such as haemoglobin reported (Poore and Rogers, 1995). Cytotoxic
(Hb), packed cell volume (PCV), total erythrocyte effects of gossypol are frequently associated with
count (TEC), total leucocyte count (TLC), mean decreased hematocrit and hemoglobin and increased
corpuscular volume (MCV), mean corpuscular red blood cell fragility (Randel et al., 1996; Brocas
haemoglobin (MHC) and mean corpuscular et al., 1997). Herman (1970) observed a nearly
haemoglobin concentration (MCHC). The samples 50 % decrease in hematocrit and blood plasma
were collected in EDTA @1 mg/ml and processed protein concentrations in rainbow trout fed a casein-
with in 2-4 h. TEC and TLC were done by the gelatin diet supplemented with 1000 ppm of free
haemocytometric method. PCV was done by the gossypol. Dabrowski et al. (2000) reported the
Wintrobe method. Haemoglobin concentration was decline in both hematocrit and hemoglobin that
estimated by Sahli’s Haemoglobinometer method. probably reflected the increase in gossypol
The erythrocyte indices such as MCV, MCH and concentration in food and concentration in food and
MCHC were calculated based on TEC, Hb consequently in blood plasma.
concentration and PCV values. The data obtained Skutches et al. (1974) reported that the
were analyzed statistically as per Snedecor and serum iron-binding capacity and total serum protein
Cochran (1994). were reduced by approximately 20 %; this was
attributed to the effect of gossypol on protein
synthesis. They further stated that gossypol might
41
form a complex with iron in the liver and the Dabrowski, K., J. Rinchard, K-J. Lee, J.H. Blom,
secretion of gossypol-iron via bile decreased the liver A. Ciereszko, and J. Ottobre. 2000. Effects
iron concentration of diets containing gossypol on reproductive
In the present study, the increase in Hb and capacity of rainbow trout (Oncorhynchus
PCV in Group II and Group III may be attributed to mykiss). Biol. Reprod., 62: 227-234.
protein rich feed compared to conventional feed Herman, R.L. 1970. Effects of gossypol on rainbow
containing paddy straw. Further, feeding of chaffed trout Salmo gairdneri Richardson. J. Fish
cotton stem as roughage did not show any adverse Biol., 2: 293-303.
effect on haematological parameters as is evident Jain, N.C. 1993. Essentials of Veterinary
by increases in both hematocrit and hemoglobin. The Hematology, 5 th ed. Lea & Febiger,
present study revealed that the blood remained Philadelphia.
normocytic and normochromic indicating the non- Morgan, S.E. 1989. Gossypol as a toxicant in
significant effect of gossypol in cotton stem on livestock, p. 251-263. In Burrows GE (ed):
erythropoiesis. The Veterinary Clinics of North America:
It was concluded that feeding of complete Food Animal Practice. Philadelphia. W.B.
diets containing cotton stem with or without urea Saunders, USA.
treatment as a roughage source along with 10 % Poore, M. and G.M. Rogers. 1995. Potential for
legume hay was found to be superior without resulting Gossypol toxicity when feeding whole
in any deleterious effects on health status when cottonseed. Animal Husbandry Newsletter
compared to the conventional way of feeding with June/July 1995 Published by North Carolina
paddy straw and a limited amount of concentrate Cooperative Extension Service, North
mixture in growing buffalo calves. Carolina State University, Raleigh, North
Carolina.
Randel, R.D., S.T. Willard, S.J. Wyse and L.N.
REFERENCES French. 1996. Effects of diets containing free
gossypol on follicular development embryo
AOAC. 1995. Official methods of Analysis, 16th recovery and corpus luteum function in
ed. Association of Official Analytical Chemists, Brangus heifers treated with bFSH.
Washington D.C. Theriogenology, 45: 911-922.
Brocas, C., R.M. Rivera, F.F. Paula-Lopes, L.R. Skutches, C.L., D.L. Herman and F.H. Smith. 1974.
McDowell, M.C. Calhoun, C.R. Staples, N.S. Effect of dietary free gossypol on blood
Wilkinson, A.J. Boning, P.J. Chenoweth and components and tissue iron in swine and rats.
P.J. Hansen. 1997. Deleterious actions of J. Nutr., 104(4): 415-422.
gossypol on bovine spermatozoa, oocytes and Snedecor, G. W and W.G. Cochran. 1994. Statistical
embryos. Biol. Reprod., 57: 901-907. Methods, 8th ed. Iowa State University Press,
USA.
42
Table 1. Diet pattern of buffalo calves.
Treatment Diet pattern C.P.(%

%) C.F.(%
%)
Control
I (Conventional feeding of paddy straw and conc. 7.73 19.10
mixture).
R:C::50:50
II (UTCS 40 % + legume hay 10 % + conc. mixture 12.92 24.15
(18 % C.P) 50 %)
R:C::50:50
III (CS 40 % + legume hay 10 % + conc. mixture (18 % 12.51 25.94
C.P) 50 %)
Table 2. Hematological values of buffalo calves fed diets containing cotton stem.
S. No. Parameter Feed1 Feed2 Feed2

1 Haemoglobin (gm %)* 9.2 a 12.2 b 13.64 b
2 Packed Cell Volume (%)** 23.2 a 32.6 b 31.8 b
3 RBC Count (millions/µl) 6.14 a 5.62 a 6.68 a
4 WBC Count (number/µl) 9580 a 10510 a 9560 a
5 MCV (fl) 37.81 a 57.99 a 47.60 a
6 MHC (pg) 14.99 a 21.70 b 20.42 ab
7 MCHC (%) 39.66 a 37.42 a 42.89 a
• The data shown were means of five experimental animals.
• Means with different superscripts, within a row differ significantly.
*P < 0.01
*P < 0.05
43
EFFECT OF FEEDING VARIOUS LEVELS OF PROTEIN ON MILK UREA NITROGEN (MUN)

CONCENTRATION AS A MANAGEMENTAL POINTER IN LACTATING RIVERINE
BUFFALOES (BUBALUS BUBALIS)
Sanjay Sharma, Aklank Jain and P.K. Pankaj
ABSTRACT the maximum the genetic potential has resulted in

higher average milk production.
The present research work was carried out A key to efficient feed utilization is to
at a livestock farm, Adhartal, JNKVV, Jabalpur, formulate a ration that optimizes microbial protein
Madhya Pradesh from the 17th February to 16th May synthesis and also supplies an optimum amount of
2008 by taking eighteen lactating Murrah buffaloes rumen undegradable or bypass protein that provides
having similar body weight, parity and stage of additional protein to meet milk production
lactation and offering them three dietary treatments requirements. The urea concentration in milk is
(T 1, T 2 and T 3) of different nutrient values to readily affected by the protein intake, type of protein,
investigate the possibility of using milk urea as a protein quality and protein energy balance of the
managemental pointer for feeding and to detect the diet (Campanile et al., 1998). Excess nitrogen
possible level of milk urea under Indian conditions. supplied to the rumen increases the concentration
Milk samples were collected fortnightly from each of urea in milk above baseline values and suggests
group to determine the milk urea concentration nitrogen wastage and inefficiency of protein feeding
(MUN) by an automatic blood analyzer and milk (Roy et al., 2005). High endogenous concentrations
protein (MP) by Lactoscan, on the same day. of urea have been associated with impaired fertility,
Overall, MUN of T3 group was higher than T2 and reduced energy availability and economic losses
T1 groups; however, the milk protein percentage of (Wittwer et al., 1999).
all the groups were similar with the trend in opposite Currently, the problem of adulteration with
direction. The correlation between MUN and MP synthetic milk creates a big problem to the dairy
concentration was very poor. Under Indian industry. Urea is one of the ingredients used in
conditions, the optimum value for milk urea was found manufacturing synthetic milk. The urea in adulterated
to be between 42 to 45 mg/100 ml. milk can be determined by measuring the urea level
in milk. But, whenever any legal action was initiated
Keywords: lactating buffaloes, milk protein, milk against synthetic milk adulterators on that basis, they
urea nitrogen, protein feeding frequently claimed that high level of urea in milk is
coming through non-protein nitrogen feeding
systems, i.e., urea. This situation demands the
INTRODUCTION development of certain national standards for urea
content in milk. Against this backdrop, it is very
India has the privilege of having best breeds urgent to investigate the possible level of urea in the
of buffaloes, of which Murrah is most popular milk of buffaloes.
because of their superiority on commercial grounds. Keeping in view the above facts, the present
During past 10-15 years, selection for higher milk study was designed to investigate the possibility of
production has been intensified and indiscriminate using milk urea as a managemental pointer for
inclusion of a variety of proteins in diets to exploit to feeding and detecting the possible level of milk urea
under Indian conditions in lactating Murrah buffaloes
Department of Livestock Production and Management, College of Veterinary Science & A.H., Jabalpur-
482001 (M.P.) India
44
with different feeding systems normally practiced Collection of Milk

by our farmers. Milk samples were collected fortnightly
from each group to determine the milk urea nitrogen
(MUN) concentration. For individual animals,
MATERIALS AND METHODS morning and evening samples were collected
separately in capped plastic bottles. The samples
The present investigation was carried out were collected after complete milking and thorough
at a livestock farm, Adhartal, under the Department mixing from the milk weighing bucket. After
of Livestock Production and Management, College collection, samples were kept in a refrigerator at
of Veterinary Science and Animal Husbandry, 4 oC and were analysed on the same day for MUN
JNKVV, Jabalpur, Madhya Pradesh, India from the by an automatic blood analyzer. The protein content
17th February to 16th May 2008. Eighteen lactating of the milk samples were also estimated fortnightly
Murrah buffaloes were selected and were offered with the help of Lactoscan.
three dietary treatments of different nutrient value.
The animals were selected by considering their Digestion trial
average body weight, parity and stage of lactation. A digestion trial of 7 days was conducted in
The concentrate mixture was prepared the last week of the three months of the experiment
according to the availability of the feed ingredients to learn the utilization of nutrients; during this, entire
at L.S.F., Adhartal, to fulfill their nutrient requirement faeces were collected separately in well-labeled
(ICAR, 1998). The three different dietary treatments containers for each buffalo. Round the clock strict
are displayed in Table 1. The concentrate mixture vigilance was kept to ensure that entire amount of
was offered at 3.00 AM, 9.00 AM and 3.00 PM, dung was collected. Every day, at 9.00 h, the dung
whereas the chaffed mixed roughage was offered voided out during 24 h was weighed accurately. Out
at 9.00 AM and 5.30 PM. of the total faeces voided by each animal, 1/50th
part was weighed in a galvanized iron tray and
immediately transferred to the hot air oven for dry
matter estimation. For determination of nitrogen in
Table 1. Ingredient composition of concentrate mixtures.
Parts in different dietary treatments

S. No. Ingredients
T1 T2 T3
1 Maize 38 25 24
2 Groundnut cake 18 21 29
3 Mustard cake 12 19 20
4 Wheat bran 18 15 14
5 Arhar chuni 11 17 10
6 Mineral mixture 2 2 2
7 Salt 1 1 1
Overall DCP 16 % 18.4 % 20.8 %
Overall TDN 71 % 71 % 71 %
45
fresh faeces, 1/100th part of the total faeces voided Statistical analysis
was weighed in a watch glass (Mehta et al., 1977). The data obtained during experiment were
It was transferred to a previously weighed and analyzed by using analysis of variance (Snedecor
labelled well-stoppered wide mouth glass bottle. At and Cochran, 1994).
the end of the collection period, the preserved
samples were thoroughly mixed and aliquots from
this in duplicate was used for nitrogen estimation. RESULTS AND DISCUSSION
Proximate analysis of feeds and faeces The chemical composition of experimental

Dry matter, crude fibre, crude protein (N x diets (concentrate mixtures) and mixed roughage
6.25), ether extract, nitrogen free extract and ash offered to experimental animals are presented in
were estimated as per AOAC (1990). Table 2. The concentrate mixture for the T1 group
contained 16 % DCP and 71 % TDN while that for
T 2 contained 15 % extra DCP and that for T 3
contained 30 % extra DCP than the T1 group.
Table 2. Chemical composition of concentrate mixtures and mixed roughage on DM basis (%).
Concentrate mixtures
Particular Mixed roughage
T1 T2 T3
DM 92.81 91.86 92.52 39.86
CP 19.24 22.48 25.62 6.24
EE 5.28 5.14 5.63 2.23
CF 6.98 7.12 7.36 30.29
Ash 12.82 12.63 12.75 9.76
NFE 55.68 52.63 48.64 51.48
Table 3. Average milk urea concentration (mg/100 ml) at fortnightly interval.
MUN concentration at fortnightly interval

Groups
I II III IV V VI Overall
30.33 33.00 33.66 35.66 37.00A 36.60A 34.37
T1
± 0.95 ± 0.85 ± 0.61 ± 1.20 ± 0.85 ± 1.03 ± 0.92
30.30 34.30 40.00B 43.30b 43.00B 43.60B 39.08
T2
± 0.61 ± 0.61 ± 0.73 ± 0.84 ± 0.85 ± 0.61 ± 0.71
31.30 35.00 41.00B 48.60c 52.30C 52.30C 43.42
T3
± 1.11 ± 0.85 ± 0.85 ± 0.84 ± 0.95 ± 0.80 ± 0.90
30.66 34.11 38.22 42.55 44.11 44.00 38.94
Overall
± 0.51 ± 0.47 ± 0.88 ± 1.39 ± 1.60 ± 1.68 ± 1.09
a, b : figures with different super scripts in a column differ different significantly (P< 0.05)
A, B : figures with different super scripts in a column differ different significantly (P< 0.01)
46
Concentration of urea in milk blood and milk is not itself an indication of protein,
Urea is the initial form of the metabolic end but also should be considered in relation to the type
product of protein metabolism in the body, which of the protein. Low MU values indicate deficiency
equilibrates rapidly throughout body fluids, including either in total protein or in the protein: energy ratio.
milk. The level of urea may increase or decrease in Roy et al. (2005) reported milk urea concentrations
milk with the efficiency of nitrogen and energy between 40.10 to 49.15 mg/100 ml in buffaloes,
utilization. This largely depends on the dietary which were very close to those in the present
nitrogen source, level of dietary energy and individual investigation. The protein excess and energy
animal factors. The concentration of milk urea under deficiency increased milk urea concentration to more
different diets and groups at fortnightly intervals is than 25 mg/100 ml, while protein deficiency or energy
presented in Table 3. excess decreased the values to less than 15 mg/100
Overall, fortnightly MUN concentrations ml (Paulicks, 1992).
(mg/dl) of all the groups followed similar trends as The present experiment indicates that the
per its initial dietary CP concentration and CP intake adaptive period for exhibition of urea in milk for this
per Mcal of ME, i.e., MUN of T1 group was least type of diet is 30 days; however the manifestation
followed by T2 group and T3 group. There was no became stable after a further lapse of 15 days.
significant difference with regards to the milk urea Similarly, Oltner and Wiktorsson (1983) reported that
concentration at first and second fortnight; thereafter, the change in milk urea content in response to an
the differences were manifested at p<0.01 and 0.05 altered dietary condition is very rapid, and after a
levels. lapse of few days the urea levels become stabilized
The MUN (mg/dl) values were comparable at the new concentration.
with the findings of Campanile et al. (1998); In the present study, CP intake in relation to
moreover, Sarubbi et al. (2000) reported a slightly ME was higher in the T2 and T3 groups as compared
higher MUN i.e. 50 mg/100 ml and suggested that to the T 1 group, and MU concentration was
this may be due to higher CP content in the diets significantly higher in T2 and T3. This may be due to
than the animal requirement. the fact that diets in the T2 and T3 groups were
The main factor influencing the MU content formulated with higher protein concentration by
was not only the amount of protein ingested in relation keeping the energy source constant.
to requirements, but also the relationship between Oltner and Wiktorsson (1983) and
the protein and energy in the ration. In the present Campanile et al. (1998) also reported that increasing
study, milk urea concentration was higher in higher the protein energy ratio in the diet also increased
CP content groups, i.e. T2 and T3, as compared to the MU concentration. Whereas Oltner et al. (1985)
standard ICAR feeding T1 group. These findings are reported that extra protein supply increases the MU
in close agreement with the reports of Oltner and concentration in dairy cows.
Wiktorsson, 1983; Bertoni et al. 1990; Paulicks,
1992; Roseler et al., 1993; Frank and Swensson, Correlation between milk protein and milk
2002; Davidson et al., 2003; Broderick, 2003; urea
Nousiainen et al., 2004; Wattiaux and Karg, 2004; From the correlation studies it was observed
Roy et al., 2005 and Colmenero and Broderick, 2006. that MUN was weakly correlated (r=0.097) with
Oltner and Wiktorsson (1983) reported that the MU milk protein concentration. The result was supported
concentration altered only slightly when the amount by the findings of Pestevsek et al. (1990) in cattle
of protein ingested was increased as long as the and Roy et al. (2005) in Murrah buffaloes. Whereas,
ratio between protein and energy was held constant. no correlation was found between MU and milk
When this ratio was changed, the MU concentration protein by Pecorari et al. (1993). Godden et al.
either decreased to around 4 mmol/lit or increased (2001) and Rajala-Schultz and Saville (2003).
to between 6.5 to 7.6 mmol/lit. Further, Bertoni et However, Pestevsek et al. (1990) and Zadnik et al.
al. (1990) suggested that an increased urea level in (1993) reported positive correlation of milk protein
content with that of milk urea content. Johnson and
47
Young (2003) and Hojman et al. (2004) found a (1992) derived a mean milk urea of 28.60 to 33.00
negative association between MU and milk total mg/dl using the Japanese feeding standard. Using
protein. An inverse relationship was found between the NRC (1989) feeding standard for dairy cattle in
the milk protein content and urea content in blood India, Dhali (2001) obtained milk protein 3.18 to
and milk of dairy goats as reported by Sauvant et 3.33 % and MU 34.21 to 35.14 mg/dl. Oltner and
al., 1992. Dhali (2001) reported a negligible Wiktorsson (1983) obtained a MU value of 31.13
correlation between urea and protein content in milk mg/dl using the Swedish feeding standard. Most of
(r=0.03). the above findings were reported from cows. Usually,
buffalo milk has a higher milk protein content (about
Variation in Milk Protein Concentration 3.8 %) than cow milk (about 3.6 %) (Schmidt, 1971).
The variations of milk protein content (%) Scanty reports are available as regards the reference
in different groups and on different fortnightly value for MU in buffaloes. The values obtained in
intervals have been presented in Table 4. present study were slightly higher than values
No significant difference was found reported from cows. This may be due to species
regarding milk protein content between the groups, differences. Roy et al. (2005) also found higher
but there was an increasing trend in the protein percentage when animal were fed
concentrations from T1 to T2 and T3 groups. The leguminous and non leguminous diet, values obtained
protein content of the milk also did not differ for milk protein were 3.88 to 3.93 % and milk urea
significantly among the fortnightly intervals. Similerly 42.54 to 44.83 mg/dl in buffaloes and the protein
a very weak positive correlation was found between content of milk did not differ significantly between
MU and milk protein content. the diets and groups.
The standard range in Germany for milk Observation recorded during the course of
protein and milk urea nitrogen is 3.2 to 3.6 % and current study also reveals the higher values of 3.65,
15.40 to 30.80 mg/dl (Nagel, 1994b). In the United 3.77 and 3.79 % of milk protein in the T1, T2 and T3
States, the reference is 3.0 to 3.2 % milk protein groups, respectively. The higher values may be due
and 24.20+3.74 mg/dl milk urea (Hutjens and to imbalance of protein energy ratio in the diet. Nagel
Barmore, 1995). In Japan, the values are 3.0 % for (1994a) reported that MU levels with below 3 %
milk protein and 17.6 to 44.0 mg/dl for serum urea milk protein may indicate a deficient energy intake
(Ougi, 1994). These workers believed that MU and in a dairy herd. Conversely, milk protein greater than
milk protein could be used as a monitor for the protein 3 % indicates an adequate energy intake. Hwang et
and energy intake of dairy herds. Using the NRC al. (2000) concluded that milk protein less than 3 %
(1989) feeding standard for dairy cattle in the United and MU less than 24.2 mg/dl indicate a diet deficient
States, Baker et al. (1995) obtained milk protein 3.1 in protein and energy in the case of cattle. Since
to 3.2 % and 33.22 to 34.32 mg/dl MU. Sato et al. this study was conducted on buffaloes under Indian
Table 4. Protein % at fortnightly interval.

Fortnights T1 T2 T3
I 3.97 3.97 3.87
II 3.73 4.05 3.83
III 3.57 3.65 3.70
IV 3.60 3.71 3.87
V 3.34 3.55 3.74
VI 3.70 3.71 3.77
Overall 3.65 3.77 3.80
48
conditions used very small number of animals, it is lactating dairy cows. J Dairy Sci., 89(5):
very difficult to reach on any conclusion as regards 1635-1643.
the milk protein and MU concentration, but from Davidson, S., B.A. Hopkins, D.E. Diaz, S.M. Bolt,
the study of Roy et al. (2005) and our findings, it C. Brownie, V. Fellner and L.W. Whitlow.
can be concluded that milk protein between 3.65 to 2003. Effects of amounts and degradability
3.93 % and MU concentration between 42 to 45 of dietary protein on lactation, nitrogen
mg/dl can be used as indicator of protein energy utilization, and excretion in early lactation
ratio in the diet. Holstein cows. J. Dairy Sci., 86(5): 1681-
So, MU can serve as metabolic indicator in 1689.
lactating Murrah buffaloes which is manifested by Dhali, A. 2001. Studies on the effect of feeding
obtaining different levels of MU from different diets. management systems on blood and milk
The MU can be used as a valid parameter to highlight urea concentration in dairy cattle. Ph.D.
the existence of an alteration in the protein energy Thesis, National Dairy Research Institute
ratio of the diet. Deemed University, Karnal, India.
Frank, B. and C. Swensson. 2002. Relationship
between content of crude protein in rations
CONCLUSION for dairy cows and milk yield, concentration
of urea in milk and ammonia emissions. J.
Under Indian conditions, the optimum value Dairy Sci., 85: 1829-1838.
for milk urea is between 42 to 45 mg/100 ml, when Godden, S.M., K.D. Lissemore, D.F. Kelton, K.E.
buffaloes are fed with the usual amounts of fodder Leslie and J.H. Lumsden. 2001. Relationship
and concentrate mixture. between milk urea concentrations and
nutritional management, production and
economic variables in Ontario dairy herds. J.
REFERENCES Dairy Sci., 84: 1128-1139.
Hojman, D., O. Kroll, G. Adin, M. Gips, B. Tavori
A.O.A.C. 1990. Official Methods of Analysis, 15th and E. Ezra. 2004. Relationships between milk
ed. Association of Official Analytical Chemists. urea and production, nutrition and fertility traits
Arlington, Va. USA. in Israeli dairy herds. J. Dairy Sci., 87: 1001-
Baker, L.D., J.D. Ferguson and W. Chalupa. 1995. 1011.
Responses in urea and true protein of milk to Hutjens, M.F. and J.A. Barmore. 1995. Milk urea
different feeding schemes for dairy cows. J. test gives us another tool. Hoard’s Dairyman,
Dairy Sci., 78: 2424-2434. 25: 401.
Bertoni, G., P. Bani and L. Calamari. 1990. Study of Hwang, S.Y., M.J. Lee and P.W.S. Chiou. 2000.
urea and ketone bodies in blood and milk as Monitoring nutritional status of dairy cows in
indicators of energy and protein requirement. Taiwan using milk protein and milk urea
Praxis Veterinaria (Milano), 11: 16-19 nitrogen. Asian-Australian J. Anim. Sci., 13:
(Cited: Dairy Sci. Abstr., 54: 1057). 1667 1673.
Broderick, G.A. 2003. Effects of carrying dietary ICAR. 1998. Nutrient requirement of livestock and
protein and energy levels on the production of poultry, 2nd ed. Indian Council of Agriculture
lactating dairy cows. J. Dairy Sci., 86: 1370- Research, Krishi Anusandhan Bhawan,
1381. PUSA. New Delhi, India.
Campanile, G., C. De-Filippo, R. DiPolo, W. Taccone Johnson, R.G. and A.J. Young. 2003. The association
and L. Zicarelli. 1998. Influence of dietary between milk urea nitrogen and DHI
protein on urea levels in blood and milk of production variables in western commercial
buffalo cows. Livest. Prod. Sci., 55: 135-143. dairy herds. J. Dairy Sci., 86(9): 3008-3015.
Colmenero, J.J.O. and G.A. Broderick. 2006. Effect Mehta, P.K., R.S. Gill, B.K. Shangari and S.S. Gill.
of amount and ruminal degradability of 1977. Preservation of faeces for nitrogen
soybean meal protein on performance of estimation. Indian Vet. J., 48: 1047.
49
Nagel, S. 1994a. Controlled feeding based on protein Roseler, D.K., J.D. Ferguson, C.J. Sniffen and J.
and urea contents in the milk, p. 1-20. In Heremma. 1993. Dietary protein degradability
Mecklenburg-Vonpommern Dairy Herd effects on plasma and milk urea nitrogen and
Improvement Association, Guestrow, milk non protein nitrogen in Holstein cows. J.
Germany. Dairy Sci., 76: 525-534.
Nagel, S. 1994b. Feeding diagnosis from milk. Dairy Roy, B., R.K. Mehla and S.K. Sirohi. 2005. Effect
Sci. Abstr., 58: 91. Neue Landwirtschaft, 5: of dietary feeding regimens on urea and
63 65. protein concentration of milk in Murrah
Nousiainen, J., K.J. Shingfield and P. Huhtanen. buffaloes. Asian-Australasian J. Anim. Sci.,
2004. Evaluation of milk urea nitrogen as a 18 (7): 973-979.
diagnostic of protein feeding. J. Dairy Sci., Sarubbi, F., T. Lella, G. Galiero, F. Infascelli, F.
87(2): 386-398. Bovera and G. Durante. 2000. Feeding diets
NRC. 1989. Pages 90-110 in Nutrient Requirements varying in crude protein concentration and
of Dairy Cattle, 6th ed. Natl. Acad. Sci., ruminal degradability to lactating
Washington, DC. Mediterranean buffalo cows. Zootecnica e
Oltner, R. and H. Wiktorsson. 1983. Urea Nutrizione Aimale, 26(4/5): 181-188 (Cited:
concentration in milk and blood as influenced Dairy Sci. Abstr., 63: 2660).
by feeding varying amounts of protein and Sato, H., S. Hanasaka and M. Matsunoto. 1992.
energy to dairy cows. Livest. Prod. Sci., 10: Relationships among plasma metabolite levels,
457-467. nutrient intakes, milk urea, fat and protein
Oltner, R., M. Emanuelson and H. Wiktorsson. 1985. levels in dairy cattle. Anim. Sci. Tech., (Japan),
Urea concentrations in milk in relation to milk 63: 1075 1080.
yield, live weight, lactation number and amount Sauvant, D., P. Bas, M.F. Mahe, P. Morand-Fehr
and composition of feed given to dairy cows. and N. Mandran. 1992. Relationship between
Livest. Prod. Sci., 12: 47-57. the type of casein and the urea content of blood
Ougi, T. 1994. Description of urea nitrogen in blood and milk of goat. Ann. Zootech., 41: 103 104
and milk. Dairy Japan, 39: 26 29. (Cited: Dairy Sci. Abstr., 54: 933).
Paulicks, B. 1992. When is the urea test useful. Schmidt, G.H. 1971. Biology of Lactation, W.H.
Tierzuchter, 44: 36-38 (Cited: Dairy Sci. Freeman and Company, San Francisco, USA.
Abstr., 55: 913). Snedecor, G.W. and W.G. Cochran. 1994. Statistical
Pecorari, M., M.S. Mariani, M.G. Calzolari and G. Methods, 8th ed. Oxford and IBH, New Delhi,
Tedeschi. 1993. Urea content in milk: pp. 312-317.
Variations and relationships with technological Wattiaux, M.A. and K.L. Karg. 2004. Protein level
parameters. Scienzae Tecnica Lattiero- for alfalfa and corn silage-based diets.
Casearia, 44: 144-154 (Cited: Dairy Sci. lactational response and milk urea nitrogen.
Abstr., 55: 1001). J. Dairy Sci., 87(10): 3480-3491.
Pestevsek, U., D. Likosar, J. Zust and A. Vengust. Wittwer, F.G., P. Gallardo, J. Reyes and H. Opitz.
1990. Use of milk urea test to detect 1999. Bulk milk urea concentrations and their
malnutrition in dairy cows. Zbornik relationship with cow fertility in grazing dairy
Veterinarske Fakultete Univerza herds in Southern Chile. Prev. Vet. Med.,
Ljubljana, 27: 139-148 (Cited: Dairy Sci. 38(2-3): 159-166.
Abstr., 54: 5). Zadnik, T., M. Nemec, V. Cadonic-Spelic and M.
Rajala-Schultz, P. J. and W. J. A. Saville. 2003. Klinkon. 1993. Urea concentration in samples
Sources of variation in milk urea nitrogen in of bulk tank milk. In Prvi Slovenski
Ohio dairy herds. J. Dairy Sci., 86: 1653- Veterinarski Kongrbvyues, Portoroz, 18-P20
1661. November, (Cited: Dairy Sci. Abstr., 57: 223).
50
Instructions for Authors Reference cited format
Buffalo Bulletin is published by International Buffalo Manuscripts should follow the name-year reference format.
Information Center under the authorization of Office of University Cite only necessary publications. Primary rather than secondary
Library, Kasetsart University, Thailand. Contributions on any aspect references should be cited, when possible. It is acceptable to cite work
of research or development, progress report of projects and news on that is “in press” (i.e., accepted but not yet published) with the pertinent
buffalo will be considered for publication in the bulletin. year and volume number of the reference.
In text. Cite publications in text with author name and
General editorial policies
year. Three or more authors use “et al.”. In parenthetical citations,
separate author and year with a comma. Use suffixes a, b and c to
Authorship criteria
separate publications in same year by the same author. Semi-colon
Authorship is restricted to those who (1) have contributed
separate citations of different authors. Cite two or more publications
substantially to one or more of the following aspects of the work and (2)
of different authors in chronological sequence, from earliest to latest.
are willing to assume public responsibility for the validity of the
work. For example:
Copyright ….used liquid nitrogen vapour freezing technique from Verma et al.
Copyright to published manuscripts becomes the sole (1975)
property of International Buffalo Information Center. ….liquid nitrogen vapour freezing technique (Verma et al., 1975)
…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;
Criteria for manuscript acceptance Pant et al., 2002)
Manuscript acceptability is based on clarity of objectives;
In reference cited. List only those literature cited in the text.
originality; appropriateness of the experimental design, methods and
References should be listed alphabetically by the first author’s last
statistical analysis; substance of the results; thoroughness with which the
name. Single author precedes same author with co-authors. Type
results are discussed; and appropriateness of the conclusions.
references flush left as separate paragraphs. Do not indent manually.
Following acceptance of a paper and prior to publication, the
Write the name of book or journal in italic letters. Use the following
author will be received the acceptance letter.
format.
Manuscript requirements • Journal articles: Author(s). Year. Article title. Journal title,
volume number: inclusive pages.
Manuscripts preparation Example: Citation in text: Chaudhary et al. (1981)
Manuscripts on original research in English language should Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of
include at least the following elements. rumen liquor in the treatment of chronic alkaline indigestion in
Title cows. Indian J. Anim. Sci., 51: 356-360.
• Full title (be concise) • Books: Author(s) or editor(s). Year. Title. Publishername,Place
• Name(s) of author(s) and the first author of publication. Number of pages.
affiliation with complete address. Example: Citation in text: Snedecor and Cochram. (1980)
Abstract Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7 th ed.
• An abstract not exceeding 250 words; all The Iowa State University Press, Ames, Iowa, USA. 593p.
acronyms and abbreviations defined; no Sattar, A. 1995. Studies on the effect of immunopotentiation of
references cited. State what, where and how it vaccinated pregnant buffaloes and cows on neonatal antibody
was done, major results. titre and hematological profile. Ph. D. thesis, University of
• Five key words. Agriculture, Faisalabad, Pakistan. 208p.
Introduction. Review pertinent work, cite key references, • Chapter: Author(s) of the chapter. Year. Title of the chapter,
explain importance of the research, and state objectives of pages of the chapter. In author(s) or editor(s). Title of the book.
your work. Publisher name, Place of publication.
Example: Citation in text: Sloss and Dufty. (1980)
Materials and Methods. Provide sufficient detail so work Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy,
can be repeated. Describe new methods in detail; accepted p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine
methods briefly with references. Obstetrics. Williams and Wilkins, Baltimore, U.S.A.
Use of trade names. Trade names are to be Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical
avoided in defining products whenever possible. review of buffalo research and development activities in
Use of abbreviations and acronyms. At first text Indonesia. Past performanceand future strategies, p. 78-89. In
use, define in parentheses. Do not use abbreviations and Proceedings of 1 st Asian Buffalo Association Congress,
acronyms in titles. Thailand.
Results and discussion. Present results concisely using Submission manuscript
figures and tables as needed. Do not present the same Submit the following items.
information in figures and tables. Discuss principles and Cover letter. Identify the corresponding author and provide his/her
relationship, point out exception. Show agreement with full name, address, numbers for telephone and fax, and e-mail address.
published research work. The significances of work or Manuscript. In 12 point Times or Times New Roman. Type on one
conductions should be presented in the end of discussion. side of A4 paper. Use one inch margins. Number all pages. Send an
Tables. Number each table with Arabic numerals. Place a original manuscript and 1 photocopy.
Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,
descriptive caption at the top of each table.
containing the manuscript in Microsoft Word.
Figures. (graphs, charts, line drawings, photographs) Mail manuscript to:
Number each figure with Arabic numerals under the
By post: International Buffalo Information Center
illustration. Lettering, data lines and symbols must be
Office of University Library
sufficiently large so as to be clearly visible when the figure
Kasetsart University,
is reduced to a size commonly used in the journal. 50 Pahonyothin Road, Chatuchak,
References. List only those references cited in the text. Bangkok 10900, Thailand
Required format of described below. Tel. 66-2-942-8616
By e-mail: libibic@ku.ac.th
CONTENTS
Page
Haematological alterations during different affections of female genital organs
in buffaloes in the Malwa Region of Madhya Pradesh.
Durgesh Mittal, U.K. Garg, G.P. Jatav, Supriya Shukla,
M. Raipuria and Ashok Walke……………….................……………………....…………...1
A case of osteochondroma in a she-buffalo.

V. Rama Devi, G. Veeraiah, P. Annapurna and N. Sailaja…………...……………....……..3
Ultrasonography of the udder and teat in buffaloes.

K. Rambabu, Makkena Sreenu, R.V. Suresh Kumar and T.S.C. Rao…………............…...5
Genetic typing of the alpha-lactalbumin gene and its association with

milk production and constituent traits in Indian riverine buffaloes.
Shanker Dayal, Tarun Kumar Bhattacharya, Pursottam Kaushik
and Siya Ram Singh………………………………..........................................…………...11
Efficacy of tapioca starch as a fat replacer in low-fat buffalo meat patties.

Mohammad Nisar P.U., M.K. Chatli and D.K. Sharma…………………..................….....18
Influence of buffalo oestrus serum (BES) and fetal bovine serum (FBS)
in the presence of oestradiol (E2) and follicle stimulating hormone (FSH)
on nuclear maturation of buffalo oocytes.
S.A. Adlak, K.P. Khillare, C.H. Pawshe and S.W. Mude……………………..........…...….25
Cloning and sequencing of the leptin gene in gir cattle and Mehsana buffalo.
N. B. Jhala, D. N. Rank, P. H. Vataliya, C. G. Joshi,
C. D. Bhong, H. H. Mehta and A. V. Patil........................................................................29
Structural features of the 5'-flanking region of the β-lacto globulin gene

of buffalo (Bubalus bubalis).
A.M. Kotresh, G.B. Arunkumar, C. Kanthraj, Meeta Saxena,
Bhaskar Sharma………………………………………………….....................……….…..34
Effects of inclusion of cotton stem in the diets of buffalo (Bubalus bubalis)

calves on haematological parameters.
Ch.Srinivasa Prasad, R.M.V. Prasad, D. Srinivas Kumar, K. Aswani Kumar,
P. Jaya Lakshmi, K. Suresh and G.V. Krishna Reddy….........................................………40
Effect of feeding various levels of protein on milk urea nitrogen (MUN)

concentration as a managemental pointer in lactating riverine buffaloes (Bubalus bubalis).
Sanjay Sharma, Aklank Jain and P.K. Pankaj…………..................................................44
BUFFALO BULLETIN
IBIC, KASETSART UNIVERSITY, P.O. BOX 1084
BANGKOK 10903, THAILAND
URL : http://ibic.lib.ku.ac.th
E-mail : libibic@ku.ac.th
Tel : 66-2-9428616 ext. 344
Fax : 66-2-9406688

2009-1buffalo Bulletin

Hochgeladen von

Dokumentinformationen

Originalbeschreibung:

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

2009-1buffalo Bulletin

Hochgeladen von

Copyright:

Verfügbare Formate

International Buffalo Information Center BUFFALO BULLETIN

Aims Buffalo Bulletin is published quarterly in March,

Main Objectives Editor

HAEMATOLOGICAL ALTERATIONS DURING DIFFERENT AFFECTIONS OF FEMALE

ABSTRACT the huge buffalo population, animal husbandry and

RESULTS AND DISCUSSION In the present study, the plasma protein

A CASE OF OSTEOCHONDROMA IN A SHE-BUFFALO

V. Rama Devi1, G. Veeraiah2, P. Annapurna1 and N. Sailaja1

ABSTRACT HISTORY AND OBSERVATIONS

ULTRASONOGRAPHY OF THE UDDER AND TEAT IN BUFFALOES

K. Rambabu, Makkena Sreenu, R.V. Suresh Kumar and T.S.C. Rao

ABSTRACT MATERIALS AND METHODS

Ultrasonography is relatively a unique

Figure 1. Ultrasonographic appearance of mammitis in a buffalo. Note the hyper-echoic parenchyma.

REFERENCES and ultrasonic tomography related to milk

GENETIC TYPING OF THE ALPHA-LACTALBUMIN GENE AND ITS ASSOCIATION WITH

ABSTRACT and rich in higher amounts of various milk

Table 1. Nucleotide and amino acid changes in different alleles of buffalo.

Table 3. Genotype wise (Alpha-lactalbumin) least-square means for total solids.

Different superscripts indicate significant difference at the 5 % level. TS % = Total solids %;

Table 4. Genotype wise (Alpha-lactalbumin) least-square means for total protein.

Different superscripts indicate significant differences at the 5 % level. TP % = Total protein %;

Table 5. Genotype wise (Alpha-lactalbumin) least-square means for whey protein.

ACKNOWLEDGEMENT Primary structure of water buffalo α-

EFFICACY OF TAPIOCA STARCH AS A FAT REPLACER IN

Mohammad Nisar P.U., M.K. Chatli* and D.K. Sharma

ABSTRACT viz., 6.89+0.13. The flavour scores were non-

retained in the cooked product per 100 g of raw

Moisture retention = Percent yield x Percent moisture in cooked patties

(Thickness of raw patties - Thickness of cooked patties)

Low-Fat Buffalo Meat Patties

High- Fat Tapioca Starch inclusion levels (%)

High- Fat Tapioca Starch inclusion levels (%)

High- Fat Tapioca Starch inclusion levels (%)

CONCLUSION modifying ingredients. J. Food Sci., 56: 643-

S.A. Adlak, K.P. Khillare, C.H. Pawshe and S.W. Mude

ABSTRACT For the successful fertilization and

INTRODUCTION MATERIALS AND METHODS

Note: Means bearing similar superscripts show non-significant differences.

Total Stages of Maturation (%)

Note: Means bearing similar superscripts show non-significant differences.

CLONING AND SEQUENCING OF THE LEPTIN GENE IN GIR CATTLE

N. B. Jhala, D. N. Rank, P. H. Vataliya, C. G. Joshi, C. D. Bhong, H. H. Mehta and A. V. Patil

ABSTRACT of which only two exons (exon-2 and 3) are

EU313203 CCCTCTCCTGAGTTTGTCCAAGATGGACCAGACATTGGCGATCTACCAACAGATCCTCAC 300

CONCLUSION Fruhbeck, G., S. A. Jebb and A. M. Prentice. 1998.

STRUCTURAL FEATURES OF THE 5' -FLANKING REGION OF THE β-LACTO GLOBULIN

A.M. Kotresh1, G.B. Arunkumar2, C. Kanthraj2, Meeta Saxena3, Bhaskar Sharma3

β-lactoglobulin is an abundant globular milk- β-lactoglobulin (β-LG) is the major globular

NF-kappa B binding site NGGGACTTTCCA -2870…-2859

Insulin Response -1654…-1660

TATAA signal TATAA -33…-29

EFFECTS OF INCLUSION OF COTTON STEM IN THE DIETS OF BUFFALO (BUBALUS

ABSTRACT were observed in Group II compared to Group I

Table 1. Diet pattern of buffalo calves.

Treatment Diet pattern C.P.(%

S. No. Parameter Feed1 Feed2 Feed2

EFFECT OF FEEDING VARIOUS LEVELS OF PROTEIN ON MILK UREA NITROGEN (MUN)

Sanjay Sharma, Aklank Jain and P.K. Pankaj

ABSTRACT the maximum the genetic potential has resulted in

with different feeding systems normally practiced Collection of Milk

Table 1. Ingredient composition of concentrate mixtures.