JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Available at www.sciencedirect.com

ScienceDirect
journal homepage: www.elsevier.com/locate/jff

Short-term daily intake of 6 billion live probiotic cells can be insufcient in healthy adults to modulate the intestinal bidobacteria and lactobacilli
Valentina Taverniti, Christian Scabiosi, Stefania Arioli, Diego Mora, Simone Guglielmetti*
` degli Department of Food, Environmental and Nutritional Sciences (DeFENS), Division of Food Microbiology and Bioprocessing, Universita Studi di Milano, Italy

A R T I C L E I N F O

A B S T R A C T

Article history: Received 6 July 2013 Received in revised form 1 November 2013 Accepted 20 November 2013 Available online xxxx Keywords: Probiotic Bidobacterium Lactobacillus Intestinal microbiota qPCR

Most intervention studies on probiotics or prebiotics consist of several-week feeding periods and focus on specic host dysfunctions. However, probiotics are often consumed by healthy people and time can be limited; the efcacy of such dietary intervention, however, has only rarely been considered. In this paper, we report the results of a short-term (1 week) study, in which 11 healthy subjects consumed a commercial probiotic food supplement, resulting in a daily intake of about 6 billion viable cells of 10 bacterial species. We measured by quantitative real-time PCR (qPCR) the impact that this product had on faecal Bidobacterium and Lactobacillus spp. Faecal lactobacilli and bidobacteria, whose number in the gut is a commonly considered parameter to assess the efcacy of a probiotic/prebiotic intervention, were not signicantly affected by the intervention. The only signicant increase was observed for intestinal Lactobacillus acidophilus group. However, the signicance of this change disappeared after only few days, indicating that it was plausibly due to DNA carryover from the ingestion of a large number of L. acidophilus cells. According to this study, short-term intake of a quite high number of live probiotics can be ineffective in healthy humans on the faecal concentration of bidobacteria and lactobacilli. 2013 Elsevier Ltd. All rights reserved.

1.

Introduction

According to the United Nations Food and Agricultural Organization (FAO), probiotics are live microorganisms which when administered in adequate amounts confer a health benet on the host (FAO/WHO, 2002). In addition, in the mid-90s, the concept of prebiotics was introduced with the meaning of non-digestible food ingredients that benecially affect the host by selectively stimulating the growth and/or activity of one or a limited number of bacterial species already

resident in the colon, and thus attempt to improve host health (Gibson & Roberfroid, 1995). The use of probiotic microorganisms or prebiotic molecules in foods and pharmaceutical formulations is becoming increasingly popular and resulting in a wide variety of products being marketed with specic or generic claims of health benets. Several studies have shown that probiotics and prebiotics can be effective in treating and managing specic pathologies and physiologic dysfunctions, such as allergic diseases (Johannsen & Prescott, 2009; Taverniti & Guglielmetti,

* Corresponding author. Address: Department of Food, Environmental and Nutritional Sciences (DeFENS), Microbiology Section, ` degli Studi di Milano, Via Celoria 2, 20133 Milan, Italy. Tel.: +39 02 503 19136; fax: +39 02 503 19292. Universita E-mail address: simone.guglielmetti@unimi.it (S. Guglielmetti). 1756-4646/$ - see front matter 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jff.2013.11.014

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

2011), irritable bowel syndrome (Brenner & Chey, 2009; Guglielmetti, Mora, Gschwender, & Popp, 2011), inammatory bowel diseases (Fujimori et al., 2009; Mack, 2011; Wiese, Lashner, Lerner, DeMichele, & Seidner, 2011), acute diarrhoea in infants (Henker et al., 2007), constipation (Valerio et al., 2010), and atopic dermatitis (Wu, Li, & Peng, 2012). Yet most probiotic and prebiotic products (especially foods) are likely to be consumed by healthy subjects. Substantiating a health benet related to the consumption of such products in healthy people is a challenge often met by monitoring indirect biomarkers of disease predisposition or general wellbeing. In this context, one commonly considered parameter is the impact a specic probiotic or prebiotic can have on the composition of the human gut microbiota (Al-Sheraji, Amin, Mohd, & Shuhaimi, 2013; Delzenne, Neyrinck, Cani, & metabolic syndrome, 2011; Sanders, 2011; Taverniti & Guglielmetti, 2012). In fact, scientic studies are increasingly seeking to establish a link between human intestinal microbiota and human health or disease, and modulation of the gut microbiota has now been widely accepted as affecting the hosts physiology (Turnbaugh et al., 2007). For example, certain groups of intestinal bacteria, mainly bidobacteria and lactobacilli, are commonly recognized as health promoting components of the human intestinal microbiota. Therefore, the capability of specic foods or pharmaceutical products to increase the number of these bacteria in the gut is often claimed as a benecial property for health (Davis & Milner, 2009; Delzenne et al., 2011; OToole & Cooney, 2008; Vendrame et al., 2011). Lactobacilli are strictly fermentative bacteria that live in a variety of environmental niches. Even though their role at intestinal level is considered important for the maintenance of host health, lactobacilli form marginal populations in the human gut, which account for less than 0.01% of the total bacteria (Walter et al., 2008). Particularly, certain lactobacilli, including species commonly used as probiotics (e.g. Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus paracasei, Lactobacillus rhamnosus, Lactobacillus delbrueckii, Lactobacillus brevis, Lactobacillus johnsonii, Lactobacillus plantarum, and Lactobacillus fermentum), although described as real indigenous inhabitants of the human intestinal tract, are likely to be more properly autochthonous of the oral cavity and fermented foods and do not form stable populations in the gut (Walter, 2008). Bidobacteria are gram-positive, anaerobic bacteria that represent up to 90% of the total gut microbiota in breast-fed babies (Fanaro, Chierici, Guerrini, & Vigi, 2003) and up to 5% in healthy adults (Mueller et al., 2006). Generally, they are considered as a homogenous group of microorganisms. Nonetheless, the genus Bidobacterium comprises several different species with different capabilities of interacting with the host (Guglielmetti et al., 2008; Young et al., 2004). For instance, certain species of Bidobacterium, such as Bidobacterium bidum, Bidobacterium breve or Bidobacterium longum subsp. infatis, are typically associated with breast-fed infants, whereas other species (Bidobacterium adolescentis, B. longum subsp. longum) are mainly isolated from adults. Furthermore, Bidobacteriums capacity to stimulate immunity has been nard, Butel, demonstrated in mice to be species-specic (Me Gaboriau-Routhiau, & Waligora-Dupriet, 2008). Accordingly, several clinical studies have shown a link between allergic diseases and gut microbiota, evidencing qualitative

differences in bidobacterial colonization (He et al., 2001; Ouwehand et al., 2001; Watanabe et al., 2003). Consequently, it is interesting to examine not only a prebiotics or probiotic products ability to modify the total number of bidobacteria, but also their effects on specic bidobacterial populations in the host intestine, as we did in a recent study, in which wild blueberry consumption resulted in an increase on only certain populations of bidobacteria (Guglielmetti et al., 2013). This paper reports the results of a short-term (1 week) study on 11 healthy human subjects consuming a pharmaceutical product containing viable cells of 10 different probiotic bacterial species and prebiotic molecules. We measured by quantitative real-time PCR (qPCR) the impact the consumption of this product had on the faecal distribution of lactobacilli and several species belonging to the genus Bidobacterium. We sought to verify if a short-term administration of a popular commercial probiotic/prebiotic formulation could affect bidobacteria and lactobacilli populations, which are microorganisms generally recognized as the most important health promoting intestinal bacteria.

2.

Material and methods

2.1. Description and microbiological characterization of the commercial probiotic/prebiotic product

The commercial product (C.P.) used in this study was purchased from a drug store during the year 2009. The study was completed during the same year. The C.P. is commercially distributed in Western Europe with the following health claim: biological and vitamin food supplement of probiotic milk enzymes to help maintain intestinal microbic ora balance. Helps safeguard levels of benecial bacteria, particularly important at times when a diet may be lacking due to incorrect eating habits or after antibiotics. The information sheet reported the following product description: 7 billion live probiotic bacteria and 7.5 mg of prebiotic bre in every capsule, vitamins (B1, B5, B2, B6, B12, B3, C, E), trace elements (calcium, phosphorous, magnesium, manganese, iron, zinc) (Table 1). Ten bacterial species are indicated on the label: L. acidophilus, L. rhamnosus, L. plantarum, L. casei, Lactococcus lactis, Streptococcus thermophilus, B. bidum, Lactobacillus helveticus, Propionobacterium shermani, Lactobacillus bulgaricus (here indicated in the same order in which they appear on the label). The consumption of 13 capsules per day is suggested on the label. Total viable microbial count of the C.P. was determined by serial dilutions and plating on agarized Brain Heart Infusion (BHI, Difco, Detroit, MI, USA) supplemented with 0.3% yeast extract. We chose this medium since we previously veried that it can support the growth of all the bacterial species claimed to be included in the product. Colonies were counted after anaerobic incubation at 37 C for 5 days. The same protocol was adopted to carry out the viable count of bidobacteria, by using Bidus Selective Medium (BSM; SigmaAldrich, St. Louis, MO, USA), and lactobacilli, by using MRS (Difco) pH 5.5. We performed viable microbial counts on three capsules taken from three different packages of a single production batch. The total number of cells for lactobacilli, bidobacteria and L. acidophilus group was estimated after isolating the DNA from capsules with the QIAamp DNA stool Mini kit (Qiagen, Hilden, Germany), by means of quantitative real-time

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Table 1 Composition of the commercial product employed in the study. With the only exception of microbial counts, the amount of each capsule ingredient was according to producers information sheet. *, mean viable count carried out on three samples coming from three different packages of the single production batch. Ingredient
Inulin Acacia bre Dried baobab fruit pulp Vitamins B1 B2 B3 B5 B6 B12 Microorganisms (viable microbial count)* Bidobacteria

instructions. The DNA was then quantied using a SmartSpec Plus Spectrophotometer (Bio-Rad Laboratories S.r.l., Segrate, Italy). We also determined 260/280 and 260/230 absorbance ratios to exclude major contaminations. DNA samples were subsequently diluted with nuclease-free water to reach a DNA concentration of 5 ng ll1 and stored at 20 C.

Per capsule
4.7 mg 4.7 mg 4.7 mg

2.4.

Real-time quantitative PCR

0.7 mg 0.8 mg 9 mg 3 mg 1 mg 0.5 lg 9.51 0.06 log10 CFU 3.41 0.12 log10 CFU

Other ingredients: calcium hydrogen phosphate, gelatin (capsule), magnesium stearate (anti-caking agent), calcium pantothenate, ferrous gluconate, manganese gluconate, zinc gluconate, titanium dioxide.

polymerase chain reaction (qPCR) as described in the following paragraphs.

2.2.

Human subjects, study design, and sample collection

Twelve healthy volunteers participated in this study (equally distributed between females and males), with 11 of them completing it (5 females and 6 males). The volunteers were 2443 years old (average 29.6 years). The inclusion criteria for this study were that subjects were adults with good health, absence of medical treatments, no known allergies or intolerance to dairy foods and had not consumed probiotic, prebiotic or synbiotic foods or formulations for at least 1 months prior to the start of the study. Subjects were asked to maintain their usual diet during the study, with no intake of products explicitly containing probiotic bacteria or prebiotic molecules. The volunteers were instructed to swallow two capsules per day with a glass of water for a 1-week feeding period: the rst capsule was ingested 30 min before breakfast and the second capsule 3 h after lunch and 30 min before the consumption of any other food. A few grams of faecal samples were collected in a sterile plastic container during the 24 h before the ingestion of the rst capsule (time point T0) and during the rst defecation from the day after the ingestion of the last capsule (T1). A faecal sample was also collected at the third or fourth defecation after the consumption of the last capsule (Tf), corresponding to a time point of 46 days after the feeding period, depending on the subject. All specimens were frozen within 18 h from collection.

2.3.

DNA extraction and quantication

DNA was extracted from 230 mg of faeces using the QIAamp DNA stool Mini kit (Qiagen) following the manufacturers

The quantication of bidobacteria and lactobacilli in faecal samples was carried out by generating standard curves for each bacterial group through qPCR using a SsoFast EvaGreen Supermix (Bio-Rad Laboratories) on a CFX96 thermocycler (Bio-Rad Laboratories). The analyses were performed in duplicate in at least two independent experiment using 10 different pairs of primers targeting Bidobacterium genus, 7 intra-generic bidobacterial taxonomic groups, Lactobacillus genus and L. acidophilus group (Table 2). A gradient PCR was initially performed to standardize the qPCR conditions. qPCR amplications were carried out in a nal volume of 15 ll containing 7.5 ll of EvaGreen Supermix and 0.3 lM of each primer for bidobacteria and L. acidophilus group quantication. For the analysis of Lactobacillus spp., a concentration of 0.5 lM for each primer was used, according to literature (Rinttila , Kassinen, & Malinen, 2004). We used 30 ng of faecal DNA template in each reaction. Samples were amplied with following programs: for bidobacteria, we used an initial denaturation at 95 C for 3 min, followed by 45 cycles of denaturation for 10 s at 95 C, annealing for 30 s at 55.9 C (with the only exception of Bac primers, which were used at 58 C) and elongation for 40 s at 72 C; for lactobacilli: initial denaturation at 95 C for 5 min, followed by 50 cycles of denaturation for 15 s at 95 C, annealing for 20 s at 58 C (with the exception of L. acidophilus primers, which were used at 60 C), elongation for 45 s at 72 C, and a nal step at 72 C for 5 min. Melting curve analyses were nally performed to conrm the specicity of the amplication products. To generate standard curves, DNA was extracted from a mixture of pure cultures of different strains. In brief, overnight cultures from appropriate different strains (see below) were mixed in equal proportion and the total bacterial concentration was determined microscopically with Neubauer Improved counting chamber (Marienfeld GmbH, Lauda-Ko nigshofen, Germany). DNA was then isolated through QIAamp DNA stool Mini kit (Qiagen) from 109 bacterial cells, subsequently diluted up to six 10-fold serial dilutions (thus ranging from an original theoretical number of 109 cells ml1 until 103 cells ml1) and used as the template in qPCR. Regression analysis was performed by plotting the Ct values obtained from the amplication of each DNA dilution against the corresponding number of bacterial cells. The calibration curve, which was generated using a scatter plot and linear regression (Data not shown), was nally used to calculate the number of bacterial cells in the faecal samples. The strains used for the construction of calibration curves were: B. adolescentis DSM 20083T and B. adolescentis MIMBa24 (for BiADO primers), B. bidum DSM 20456T and B. bidum MIMBb75 (BiBIF primers), B. breve DSM 20213T and B. breve BBR02 (BiBRE primers), Bidobacterium catenulatum ATCC 27539T, B. catenulatum MIMBc15, Bidobacterium pseudocatenulatum DSM20438T and B. pseudocatenulatum MIMBp287 (BiCAT

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Table 2 List of primers used in qPCR experiments (all primers target ribosomal operon). *, it includes species B. catenulatum and B. pseudocatenulatum. **, primers Acid-F and Acid-R detects L. acidophilus, L. amylovorus, L. amylolyticus, L. crispatus, L. gasseri and L. johnsonii. Target
Bidobacterium spp.

Primer
g-Bid-F g-Bid-R BiADO-1 BiADO-2 BiBIF-1 BiBIF-2 BiBRE-1 BiBRE-2 BiLON-1 BiLON-2 BiINF-1 BiINF-2 BiCATg-1 BiCATg-2 Bac-2 Bac-5 gnLact-F gnLact-R Acid-F Acid-R

Sequence (5 0 3 0 )
CTCCTGGAAACGGGTGG GGTGTTCTTCCCGATATCTACA CTCCAGTTGGATGCATGTC CGAAGGCTTGCTCCCAGT CCACATGATCGCATGTGATTG CCGAAGGCTTGCTCCCAAA CCGGATGCTCCATCACAC ACAAAGTGCCTTGCTCCCT TTCCAGTTGATCGCATGGTC GGGAAGCCGTATCTCTACGA TTCCAGTTGATCGCATGGTC GGAAACCCCATCTCTGGGAT CGGATGCTCCGACTCCT CGAAGGCTTGCTCCCGAT GTGGAGACACGGTTTCCC CACACCACACAATCCAATAC AGCAGTAGGGAATCTTCCA CACCGCTACACATGGAG AGAGGTAGTAACTGGCCTTTA GCGGAAACCTCCCAACA

Product size (bp)

550

References
Matsuki et al., 2002

B. adolescentis

279

Matsuki et al., 1999

B. bidum

278

Matsuki et al., 2004

B. breve

288

Matsuki et al., 2004

B. longum subsp. longum

831

Matsuki et al., 2004

B. longm subsp. infantis

828

Matsuki et al., 2004

B. catenulatum group*

285

Matsuki et al., 2004

B. animalis subsp. lactis

680

Ventura et al., 2001

Lactobacillus spp.

341

Rinttila et al., 2004

L. acidophilus group**

391

Malinen et al., 2003

primers), Bidobacterium lungum subsp. longum DSM 20219T, B. lungum subsp. longum MIMBl8 (BiLON primers), B. lungum subsp. infantis ATCC 15697T and B. lungum subsp. infantis BNF01 (BiINF primers), Bidobacterium animalis subsp. lactis Bb12 and B. animalis subsp. lactis BLC01 (Bac primers), L. acidophilus DSM20079 for Acid primers, L. rhamnosus GG, L. helveticus MIMLh5, L. paracasei DG and L. acidophilus DSM20079 for gnLact primers. The calibration curves with g-Bid primers and gnLact primers were prepared by mixing the overnight cultures of all the above mentioned Bidobacterium and Lactobacillus strains before bacterial counting.

2.6.

Data analyses

Statistical analysis was performed using STATISTICA software (Statsoft Inc., Tulsa, OK, USA). Signicant differences between group values were determined by paired Students t test, considering time (before and after treatment) as dependent factor. Results were considered signicant at a P value 60.05.

3.

Results and discussion

2.5. Source of Bidobacterium and Lactobacillus pure cultures and culture conditions
Type strains of bacterial species were from the American Type Culture Collection (ATCC, Manassas, VA, USA) and the German Collection of Microorganisms and Cell Cultures (DSMZ GmbH, Braunschweig, Germany). Strains BBR02, BLC01 and BNF01 were from Clerici Sacco S.r.l. (Cadorago, Italy). Strains designated with a MIM code were from Industrial Microbiol` degli Studi di ogy culture collection (DeFENS, Universita Milano, Italy). L. paracasei DG and L. rhamnosus GG were isolated in our laboratory from the commercial probiotic product Enterolactis PLUS (Sofar S.p.A., Trezzano Rosa, Italy) and Dicoor 80 (Dicofarm S.p.A., Roma, Italy). Lactobacilli were grown overnight in MRS (Difco, Detroit, MI, USA) at 37 C, whereas bidobacteria were grown with a supplementation of 0.05% L-cysteine hydrochloride and incubated overnight at 37 C anaerobically.

An increasing proportion of the healthy population consumes commercial products containing probiotic microorganisms or prebiotic molecules. The intake of such products could be occasional, discontinuous and limited in time. For instance, the consumption of pharmaceutical probiotic or prebiotic preparations could be restricted to the number of doses in a single pack. For these reasons, we carried out a short-term trial, in order to understand if even an occasional and brief intake of a commercial probiotic/prebiotic pharmaceutical product can have an effect on the consumers microbiota. In this study, we employed one of the most popular probiotic formulations in Italy, which is also available in the other Western European countries. Furthermore, we focused our attention on bidobacteria and lactobacilli, since they are health promoting intestinal microorganisms (Chiu et al., 2013; Monte nard et al., 2008), which many agudo-Mera et al., 2012; Me reports showed to be increased by the administration of probiotic and prebiotic products (Bosscher, van Loo, & Franck, 2006;

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Saito, Hamanaka, Saito, Takizawa, & Benno, 2002; Saulnier, Kolida, & Gibson, 2009; Tuohy et al., 2007). We used a pharmaceutical product in capsules, which contained, according to the information sheet, 7 billion live probiotic bacteria and 7.5 mg of prebiotic bre (Table 1). Conventionally, a product that contains both prebiotic and probiotic elements is indicated with the term synbiotic. However, we did not designate as synbiotic the product used in our trial, because of the very limited content in prebiotic molecules. Furthermore, FAO recommends that the term synbiotic should only be used if the net health effect has been demonstrated to be synergistic (Pineiro et al., 2008). The producer itself did not mention the word synbiotic on the label or in the information sheet. Two days before the beginning of the feeding period, we performed the enumeration of viable bacteria in the product. We calculated an average total viable count of 9.51 0.06 log(10) (i.e. about 3.2 billion) CFU per capsule, which is lower than the 7 billion (i.e. 9.85 Log(10)) bacterial cells per capsule declared on the label. The survival of microbial cells is a mandatory requirement of probiotic products, which is often disregarded (Aureli, Fiore, Scalfaro, Casale, & Franciosa, 2010; Lin, Hwang, Chen, & Tsen, 2006), due to the sensitivity of certain probiotic microorganisms (especially bidobacteria) to technological and environmental stresses or consequently to incorrect storage conditions. As an example, a comprehensive survey on commercial food supplements in Italy revealed that only 25 out of 41 tested products (61%) contained a number of microorganisms in accordance with those claimed in the labels (Aureli et al., 2010). Nonetheless, in this study, it should be taken into consideration that we performed the microbial cell counts through a protocol developed in our laboratory and not according to any ofcially recognized protocol for the quantication of probiotic bacteria. In the paper by Aureli and collaborators (2010), the authors assessed the presence of B. bidum in 25 probiotic supplements which declared the presence of this species. They found viable cells of B. bidum exclusively in 4 products. Also the product employed in our study listed B. bidum among the species included in the capsules. Nevertheless, we failed to detect the presence of both cells and DNA of B. bidum. The only Bidobacterium cells that we were able to isolate from the capsules were identied as B. animalis subsp. lactis. The isolate, according to molecular ngerprinting (BOX and RAPD analyses), was identical to the well-known probiotic strain B. animalis subsp. lactis BB-12 (Chr. Hansens culture collection, Copenhagen, Denmark) (Data not shown). The total viable count of bidobacteria was calculated to be on average 3.41 log(10) CFU, which is particularly low, also considering the sensitivity that bidobacteria have to gastrointestinal transit. By means of qPCR with Bac and g-Bid primers, we calculated a concentration of about 7 log(10) bidobacterial cells per capsule, indicating that the limited number of viable bifidobacteria in the product is very probably a consequence of a drastic microbial mortality during the production and/or the shelf-life of the C.P. Real time quantitative PCR was also employed to quantify the total number of lactobacilli in the C.P. Our experiments revealed a total number of lactobacilli and L. acidophilus group corresponding to 10.2 and 9.6 log(10) cells per capsule,

respectively. Even though this quantication exceeds the bacterial cell quantities declared in the C.P. label, it should be taken in account that it comprehends also nonviable cells and that, in fact, bacteria are usually added in probiotic formulation by producers in excess in order to overcome/counterbalance bacterial mortality that normally occur during shelf life. The viable count of lactobacilli in the C.P., in fact, was calculated to be lower than what we calculated through qPCR and resulted on average 6.40 0.06 log(10) CFU per capsule. In this study, we performed the analysis of bidobacteria and lactobacilli present in the faecal samples collected 1 day before and 1 day after the 1-week feeding period (Table 3; Figs. 1 and 2). To enumerate bacterial cells in faecal samples we used calibration curves, which showed good correlation between Ct and the number of cells over the considered range (regression coefcients r2 between 0.9636 and 0.9994; data not shown). The calculated concentrations of bidobacterial taxonomic groups were in accordance with literature (Matsuki et al., 2004; Turroni et al., 2009). Our study, in fact, conrmed that B. adolescentis and B. longum subsp. longum are the dominant bidobacterial groups in healthy adults (Table 3A; Fig. 1) (Turroni et al., 2009). We also detected the presence of B. animalis subsp. lactis, which is generally not considered an autochthonous member of the human intestinal microbiota. The concentration of this species was however quite low (4.8 0.6 log CFU g1 of faeces) compared to the other bidobacterial groups tested. Considering that B. animalis subsp. lactis was found also before the feeding period and that the volunteers did not take any product containing probiotic microorganisms during at least 1 month before the beginning of the trial, these data support the hypothesis that B. animalis subsp. lactis, plausibly deriving from previous food intake, can survive gastrointestinal transit and persist in the human gut, as previously demonstrated (Rochet et al., 2008). The bidobacterial taxonomic clusters investigated were detected in all analysed samples, with the only exception of B. bidum and B. lungum subsp. infantis, which are microorganisms typically associated to infants intestinal tract (Turroni et al., 2009). Concerning the effect of the C.P. consumption on bidobacterial populations, we did not nd any statistically significant difference between the faecal concentrations of bidobacterial groups before and after the feeding period (Table 3A; Figs. 1 and 2). The total number of bidobacteria remained substantially identical, whereas the variability observed for the single bidobacterial groups did not correlate with the consumption of the C.P. and could be ascribed to an intrinsic uctuation of the microbial populations during time in a subject, rather than a subject to subject variation of the effects produced by the C.P. consumption. The prebiotic molecules in the C.P. were very plausibly in a too small amount to determine any signicant effect. The inability of the product under investigation to modify bidobacterial populations is however partially unexpected, in light of the relatively high number of live probiotic bacterial cells ingested per day by volunteers (2 capsules, consisting of a total of more than 6 billion cells). Furthermore, reportedly, the consumption of probiotic products containing L. casei, L. helveticus or L. acidophilus (which are species present in the C.P.)

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Table 3 Mean log(10) number of bidobacteria (A) and lactobacilli (B) cells per g of faeces (standard deviation) calculated on two replicates before (T0) and following (T1) the 1-week feeding period and after a 3/6-days washout (Tf). u.d.l., under detection limit. Subject
1

Time point
T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1 T0 T1

Bidobacterium spp.
9.5 0.1 9.7 0.1 10.2 0.1 10.1 0.1 9.9 0.1 10.1 0.1 10.3 0.2 10.5 0.1 9.3 0.1 8.9 0.1 9.7 0.1 9.7 0.1 10.0 0.1 9.7 0.1 10.3 0.1 10.5 0.2 9.8 0.1 10.0 0.1 9.0 0.1 9.4 0.1 10.0 0.1 10.1 0.1 9.8 0.4 9.9 0.5

B. adolescentis
9.3 0.0 9.5 0.0 9.3 0.0 9.2 0.0 9.5 0.0 9.8 0.0 9.5 0.0 9.1 0.0 6.4 0.0 5.6 0.0 9.4 0.0 9.4 0.0 8.7 0.0 8.6 0.0 9.2 0.0 9.8 0.0 9.3 0.0 9.1 0.0 9.1 0.0 9.4 0.0 9.9 0.0 9.9 0.0 9.1 0.9 9.0 1.2

B. longum
8.4 0.0 8.8 0.1 9.0 0.0 8.9 0.0 8.4 0.0 9.6 0.0 9.0 0.0 9.3 0.0 8.4 0.0 8.2 0.0 8.1 0.0 8.2 0.1 9.1 0.0 9.1 0.0 9.6 0.0 9.5 0.0 8.5 0.0 9.0 0.1 7.7 0.0 7.9 0.1 9.2 0.0 8.6 0.1 8.7 0.5 8.8 0.6

B. catenulatum group
8.2 0.1 8.3 0.1 7.4 0.0 7.6 0.2 7.7 0.0 8.4 0.0 7.7 0.0 7.7 0.1 6.4 0.0 6.2 0.0 6.8 0.0 6.9 0.1 6.1 0.0 6.8 0.0 8.3 0.0 8.7 0.0 8.3 0.1 8.4 0.0 8.1 0.0 8.3 0.1 8.7 0.0 8.1 0.1 7.6 0.8 7.8 0.8

B. bidum
u.d.l. u.d.l. 8.2 0.0 8.4 0.1 7.8 0.0 8.6 0.1 5.1 0.0 5.2 0.0 u.d.l. u.d.l. 7.5 0.0 7.7 0.1 7.1 0.0 7.4 0.0 7.5 0.1 7.2 0.0 7.6 0.0 7.2 0.1 8.1 0.1 7.8 0.0 7.8 0.0 8.4 0.2 7.4 0.9 7.5 1.0

B. breve
7.4 0.0 7.5 0.2 6.7 0.0 7.1 0.1 6.3 0.0 7.5 0.0 7.1 0.0 6.8 0.1 6.4 0.1 6.0 0.0 7.0 0.0 7.0 0.1 5.7 0.0 6.4 0.0 6.9 0.1 6.0 0.1 6.9 0.0 6.1 0.0 6.7 0.1 7.1 0.2 8.5 0.0 7.5 0.1 6.9 0.7 6.8 0.6

B. infantis
6.4 0.0 6.5 0.0 6.4 0.0 6.6 0.1 u.d.l. 6.7 0.2 6.9 0.0 6.0 0.0 6.3 0.0 u.d.l. 5.8 0.1 6.1 0.0 u.d.l. u.d.l. 6.2 0.1 5.6 0.0 6.6 0.2 u.d.l. 7.4 0.1 6.8 0.3 9.0 0.0 8.2 0.1 6.9 1.0 6.6 0.8

B. animalis subsp. lactis

4.7 0.0 4.9 0.1 5.2 0.0 5.2 0.0 4.4 0.2 4.9 0.0 4.7 0.0 4.5 0.1 4.3 0.0 3.8 0.1 4.2 0.0 5.0 0.0 u.d.l. u.d.l. 4.5 0.0 4.5 0.0 4.4 0.0 4.0 0.1 5.8 0.0 5.8 0.0 5.7 0.0 5.5 0.0 4.8 0.6 4.8 0.6

10

11

Average

have been associated to an increment of bidobacteria in human gut (Chen, Wu, Lee, Huang, & Wu, 1999; Saito et al., 2002; Savard et al., 2011; Tuohy et al., 2007). By means of qPCR with gnLact primers, we calculated that the C.P. contains 10.4 0.5 log(10) Lactobacillus cells. For this reason, it was unexpected that also the faecal concentration of total lactobacilli was not signicantly modied by C.P. (Table 3B, Fig. 2). In a following experiment, we used Acid qPCR primers (Malinen, Kassinen, Rinttila , & Palva, 2003) for the quantication of a group of species phylogenetically related to L. acidophilus. This cluster includes homofermentative lactobacilli (L. acidophilus, Lactobacillus amylovorus, Lactobacillus amylolyticus, Lactobacillus crispatus, Lactobacillus gasseri and L. johnsonii), which are considered typical human intestinal lactobacilli often associated to health promoting properties (Koninkx, Toovin-Le Moal & Servin, 2006; Omar, ten, & Malago, 2010; Lie 2013) and include several commercial probiotic strains (e.g., L. acidophilus LA5 and L. johnsonii La1). When we compared L. acidophilus counts before and after the consumption of the product, we found a statistically signicant increase in bacterial concentration between T0 and T1 (P < 0.01, Fig. 2). We calculated that the C.P. used in this study contained a concentration of 9.6 0.3 log(10) L. acidophilus cells per capsule (as determined through qPCR with Acid primers). Therefore, the observed increase in the concentration of DNA from L. aci-

dophilus group of bacteria could nd several possible explanations: (i) a (transient) colonization of the lactobacilli ingested from the C.P., (ii) the increased proliferation of the intestinal resident bacteria of the L. acidophilus group, or (iii) a mere transit of the Lactobacillus cells ingested with the C.P. during the feeding period. To test these hypotheses, we carried out cell quantication through qPCR with Acid primers on faecal samples collected after a period ranging from 4 to 6 days (depending on the subject) from the end of the product consumption (time Tf), as performed in previous studies to test the bacterial colonization ability (Tuohy et al., 2007). The collected samples corresponded to the third or fourth evacuation of each subject after the end of the feeding period. We considered these nal faecal samplings at a time point sufcient for a complete wash out of inert (i.e., non-proliferating and noncolonizing) bacterial cells ingested with the C.P. and sufciently short to detect potential (transient) colonization of the intestine by C.P. lactobacilli. As compared to T1, we found a signicant decrease in L. acidophilus counts (P < 0.01), and we did not detect signicant differences between T0 and Tf (Fig. 2). This result leads to rule out the hypotheses of an effective impact of the C.P. on the modulation gut microbiota or a proliferation of C.P. lactobacilli in the gut. More plausibly, the observed signicant L. acidophilus increase at T1 can be explained by an effect of DNA carryover dependent on the

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Table 3 (continued) Subject

1

Time point
T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF T0 T1 TF

Lactobacillus spp.
7.5 0.1 7.7 0.0 n.d. 7.8 0.0 8.6 0.0 n.d. 8.0 0.0 7.1 0.1 n.d. 6.9 0.1 7.4 0.1 n.d. 7.8 0.0 7.7 0.0 n.d. 7.2 0.1 9.1 0.1 n.d. 7.3 0.1 7.6 0.0 n.d. 7.4 0.0 7.4 0.2 n.d. 7.9 0.0 8.0 0.1 n.d. 9.0 0.1 9.4 0.1 n.d. 7.6 0.0 7.5 0.0 n.d. 7.4 0.4 7.4 0.7 n.d.

L. acidophilus group
5.2 0.2 5.8 0.1 4.9 0.1 4.4 0.0 6.6 0.1 5.3 0.2 5.8 0.1 6.4 0.1 6.1 0.1 4.6 0.2 5.5 0.1 5.1 0.1 5.5 0.1 5.3 0.2 5.4 0.0 5.7 0.2 7.4 0.1 4.9 0.0 5.3 0.1 7.3 0.1 4.9 0.1 5.1 0.1 7.1 0.0 5.6 0.3 7.3 0.0 7.2 0.0 7.3 0.1 4.9 0.2 6.7 0.1 5.3 0.2 6.1 0.0 6.9 0.1 5.5 0.2 5.3 0.8 6.7 0.7 5.3 0.7

10

11

Average

ingestion of a large number of L. acidophilus cells during the C.P. feeding period. The small duration of the feeding period in our study is surely of importance to explain the results. Even if there are some indications that bidobacteria and lactobacilli can be modulated already after 7- (Savard et al., 2011; Tuohy et al., 2007) or 10-days probiotic intake periods (Chen et al., 1999), conventionally, intervention studies are based on a 4-weeks supplementation period in order to assess the potential effects of a probiotic or prebiotic product (Apostolou et al., 2001; Lomax et al., 2012; Saito et al., 2002; Savard et al., 2011). The inability of a probiotic supplementation to modify the faecal composition of bidobacteria and lactobacilli, however, has been reported in literature (Kekkonen et al., 2011; Larsen et al., 2006; Savard et al., 2011). Kekkonen and collaborators, for instance, showed that, after 2 weeks of dietary intervention, probiotics alone did not affect faecal bidobacteria,

whereas only probiotics with galacto-oligosaccharides increased the number of these bacteria in faeces compared with baseline and with probiotics alone (Kekkonen et al., 2011). The Italian Ministry of Health recommends a daily dose of at least 109 viable probiotic cells (www.salute.gov.it/imgs/ C_17_pubblicazioni_1016_ulterioriallegati_ulterioreallegato_0_alleg.pdf). Therefore, it is plausible to consider the daily intake of about 6 billion probiotics in our study a quite high number of viable cells. Nonetheless, the short term (1-week) daily ingestion of such number of live bacteria, belonging to several species that are generally-recognized as probiotics, can be insufcient in healthy humans to modulate the intestinal concentration of bidobacteria and lactobacilli. This conclusion, however, must be interpreted taking into account the limitations of this study. The rst limitation consists in the fact that we focused our attention exclusively on two bacterial populations of the intestinal microbiota. It is however

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

Bifidobacterium spp.
10 9

B. longum subsp. longum

9
8

B. adolescentis
8

B. catenulatum

log(10) cell per g of feces

6
5

7
0.5

1 T0

1.5

2 T1

2.5

6
0.5

4
1 T0 1.5 2 T1 2.5 0.5

1 T0

1.5

2 T1

5
2.5 0.5

1 T0

1.5

2 T1

2.5

B. bifidum log(10) cell per g of feces

8 8

B. breve
8

B. animalis subsp. lactis

8

B. longum subsp. infantis

7 7

6 6

4
0.5

4
1 T0 1.5 2 T1 2.5 0.5

1 T0

1.5

2 T1

2.5

5
0.5

1 T0

1.5

2 T1

4
2.5 0.5

1 T0

1.5

2 T1

2.5

Fig. 1 Faecal concentration of bidobacterial taxonomic groups in 11 healthy volunteers before (T0) and after (T1) the 1-week feeding period. Dotted lines refer to the median value of data.

Lactobacillus spp.
9.0
8.0 Log (10) cells per g of feces)

L. acidophilus group ** **

log(10) cell per g of feces

8.0

7.0

consider important non-microbiological effects that can describe the benets of probiotic consumption on host health. Particularly, certain benets have been reported also for short term supplementations, as recently reviewed by Rabot et al. (2010), including reducing breath H2 and improved lactose digestion.

7.0

6.0

4.

Conclusions

5.0

6.0 4.0

T0

T1

0.0050

T0

T1

Tf

(A)

(B)

Fig. 2 Faecal concentrations of Lactobacillus spp. (A) and Lactobacillus acidophilus group of species (B) in healthy subjects before (T0) and after (T1) the 1-week feeding period. The concentration of L. acidophilus group was also determined in a faecal sample collected from each subject after 4/6 days of washout (i.e., 4/6 days after the end of the feeding period). **, statistically signicant difference (P < 0.01). Dotted lines refer to the median value of data.

plausible that other important health-promoting microbial groups could have been altered by the probiotic intervention. For instance, other modications of the microbiota have been reported to be of benet for the host such as the increase in the number of Faecalibacterium prausnitzii (Sokol et al., 2008) and Akkermansia sp. (Everard et al., 2013), or the decrease of intestinal pathobionts (Devkota & Chang, 2013). Another limitation of this study consists in the fact that we did not

The ability of a short-term intervention with a popular multispecies probiotic commercial product to affect the faecal populations of bidobacteria and lactobacilli in healthy individuals was assessed. Several aws were found in the products, such as the presence of a different Bidobacterium species than that indicated in the information sheet and a very limited concentration of viable bidobacteria. Beyond these limitations, the products contained an elevated number of live bacterial cells. Nonetheless, we failed to observe any signicant effect on faecal lactobacilli and bidobacteria, whose number in the gut is commonly considered important for establishing the efcacy of a probiotic/prebiotic intervention. As attention was paid exclusively on lactobacilli and bifidobacteria, new studies are needed to assess if short-term consumption of probiotic microorganisms can affect any other potential health-related parameters in the consumers, such as other microorganisms with known health-related activities, the production of short-chain fatty acids, or the level of immunologic mediators.

Acknowledgement
This work was supported by Fondazione Cariplo Grant 20100678.

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

R E F E R E N C E S

Al-Sheraji, S. H., Amin, I., Mohd, Y. M., & Shuhaimi, M. (2013). Prebiotics as functional foods: A review. Journal of Functional Foods, 5, 15072030. Apostolou, E., Pelto, L., Kirjavainen, P. V., Isolauri, E., Salminen, S. J., & Gibson, G. R. (2001). Differences in the gut bacterial ora of healthy and milk-hypersensitive adults, as measured by uorescence in situ hybridization. FEMS Immunology and Medical Microbiology, 30, 217221. Aureli, P., Fiore, A., Scalfaro, C., Casale, M., & Franciosa, G. (2010). National survey outcomes on commercial probiotic food supplements in Italy. International Journal of Food Microbiology, 137, 265273. Bosscher, D., van Loo, J., & Franck, A. (2006). Inulin and oligofructose as prebiotics in the prevention of intestinal infections and diseases. Nutrition Research Reviews, 19, 216226. Brenner, D., & Chey, W. (2009). Bidobacterium infantis 35624: A novel probiotic for the treatment of irritable bowel syndrome. Reviews in Gastroenterological Disorders, 9, 715. Chen, R., Wu, J., Lee, S., Huang, A., & Wu, H. (1999). Increase of intestinal Bidobacterium and suppression of coliform bacteria with short-term yogurt ingestion. Journal of Dairy Science, 82, 23082314. Chiu, Y.-H., Lin, S.-L., Ou, C.-C., Lu, Y.-C., Huang, H.-Y., & Lin, M.-Y. (2013). Anti-inammatory effect of lactobacilli bacteria on HepG2 cells is through cross-regulation of TLR4 and NOD2 signalling. Journal of Functional Foods, 5, 820828. Davis, C. D., & Milner, J. A. (2009). Gastrointestinal microora, food components and colon cancer prevention. The Journal of Nutritional Biochemistry, 20, 743752. Delzenne, N. M., Neyrinck, A. M., & Cani, P. D. (2011). Modulation of the gut microbiota by nutrients with prebiotic properties: Consequences for host health in the context of obesity and metabolic syndrome. Microbial Cell Factories, 10(Suppl. 1), 10. Devkota, S., & Chang, E. B. (2013). Diet-induced expansion of pathobionts in experimental colitis: Implications for tailored therapies. Gut Microbes, 4, 172174. Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J. P., Druart, C., Bindels, L. B., et al. (2013). Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proceedings of the National Academy of Sciences of the United States of America, 110, 90669071. Fanaro, S., Chierici, R., Guerrini, P., & Vigi, V. (2003). Intestinal microora in early infancy: Composition and development. Acta Paediatrica (Oslo, Norway: 1992). Supplement, 91, 4855. FAO/WHO (2002). Report of a joint FAO/WHO expert consultation on guidelines for the evaluation of probiotics in food. London Ontario, Canada: World Health Organization and Food and Agriculture Organization of the United Nations. Fujimori, S., Gudis, K., Mitsui, K., Seo, T., Yonezawa, M., Tanaka, S., et al. (2009). A randomized controlled trial on the efcacy of synbiotic versus probiotic or prebiotic treatment to improve the quality of life in patients with ulcerative colitis. Nutrition, 25, 520525. Gibson, G. R., & Roberfroid, M. B. (1995). Dietary modulation of the human colonic microbiota: Introducing the concept of prebiotics. The Journal of Nutrition, 125, 14011412. Guglielmetti, S., Fracassetti, D., Taverniti, V., Del Bo, C., Vendrame, S., Klimis-Zacas, et al. (2013). Differential modulation of human intestinal Bidobacterium populations after consumption of a wild blueberry (Vaccinium angustifolium) drink. Journal of Agriculture and Food Chemistry, 61, 81348140. Guglielmetti, S., Mora, D., Gschwender, M., & Popp, K. (2011). Randomised clinical trial: Bidobacterium bidum MIMBb75 signicantly alleviates irritable bowel syndrome and improves

quality of life-a double-blind, placebo-controlled study. Alimentary Pharmacology & Therapeutics, 33, 11231132. Guglielmetti, S., Tamagnini, I., Mora, D., Minuzzo, M., Scarafoni, A., Arioli, S., et al. (2008). Implication of an outer surface lipoprotein in adhesion of Bidobacterium bidum to Caco-2 cells. Applied and Environmental Microbiology, 74, 46954702. He, F., Ouwehand, A. C., Isolauri, E., Hashimoto, H., Benno, Y., & Salminen, S. (2001). Comparison of mucosal adhesion and species identication of bidobacteria isolated from healthy and allergic infants. FEMS Immunology and Medical Microbiology, 30, 4347. Henker, J., Laass, M., Blokhin, B., Bolbot, Y., Maydannik, V., & Elze, M. (2007). The probiotic Escherichia coli strain Nissle 1917 (EcN) stops acute diarrhoea in infants and toddlers. European Journal of Pediatrics, 166(2007), 311318. Johannsen, H., & Prescott, S. (2009). Practical prebiotics, probiotics and synbiotics for allergists: How useful are they. Clinical and Experimental Allergy: Journal of the British Society for Allergy and Clinical Immunology, 39, 18011814. Kekkonen, R. A., Holma, R., Hatakka, K., Suomalainen, T., Poussa, T., Adlercreutz, H., & Korpela, R. (2011). A probiotic mixture including galactooligosaccharides decreases faecal bglucosidase activity but does not affect serum enterolactone concentration in men during a 2-week intervention. The Journal of Nutrition, 141, 870876. Koninkx, J. F. J. G., Tooten, P. C. J., & Malago, G. G. (2010). Probiotic bacteria induced improvement of the mucosal integrity of enterocyte-like Caco-2 cells after exposure to Salmonella enteritidis 857. Journal of Functional Foods, 2, 225234. Larsen, C., Nielsen, S., Kaestel, P., Brockmann, E., Bennedsen, M., Christensen, H., et al. (2006). Doseresponse study of probiotic bacteria Bidobacterium animalis subsp. lactis BB-12 and Lactobacillus paracasei subsp. paracasei CRL-341 in healthy young adults. European Journal of Clinical Nutrition, 60, 12841293. vin-Le Moal, V. L., & Servin, A. L. (2006). The front line of enteric Lie host defense against unwelcome intrusion of harmful microorganisms: Mucins, antimicrobial peptides, and microbiota. Clinical Microbiology Reviews, 19, 315337. Lin, W., Hwang, C., Chen, L., & Tsen, H. (2006). Viable counts, characteristic evaluation for commercial lactic acid bacteria products. Food Microbiology, 23, 7481. Lomax, A. R., Cheung, L. V., Tuohy, K. M., Noakes, P. S., Miles, E. A., & Calder, P. C. (2012). b2-1 Fructans have a bidogenic effect in healthy middle-aged human subjects but do not alter immune responses examined in the absence of an in vivo immune challenge: Results from a randomised controlled trial. The British Journal of Nutrition, 108, 18181828. Mack, D. R. (2011). Probiotics in inammatory bowel diseases and associated conditions. Nutrients, 3, 245264. Malinen, E., Kassinen, A., Rinttila , T., & Palva, A. (2003). Comparison of real-time PCR with SYBR Green I or 5 0 -nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantication of selected faecal bacteria. Microbiology, 149, 269277. Matsuki, T., Watanabe, K., Fujimoto, J., Kado, Y., Takada, T., Matsumoto, K., & Tanaka, R. (2004). Quantitative PCR with 16S rRNA-gene-targeted species-specic primers for analysis of human intestinal bidobacteria. Applied and Environmental Microbiology, 70, 167173. Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., et al. (2002). Development of 16S rRNA-genetargeted group-specic primers for the detection and identication of predominant bacteria in human faeces. Applied and Environmental Microbiology, 68, 54455451. Matsuki, T., Watanabe, K., Tanaka, R., Fukuda, M., & Oyaizu, H. (1999). Distribution of bidobacterial species in human intestinal microora examined with 16S rRNA-gene-targeted

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014

10

JOURNAL OF FUNCTIONAL FOODS

x x x ( 2 0 1 3 ) x x x x x x

species-specic primers. Applied and Environmental Microbiology, 65, 45064512. nard, O., Butel, M., Gaboriau-Routhiau, V., & Waligora-Dupriet, Me A. (2008). Gnotobiotic mouse immune response induced by Bidobacterium sp. strains isolated from infants. Applied and Environmental Microbiology, 74, 660666. Monteagudo-Mera, A., Rodrguez-Aparicio, L., Rua, J., MartinezBlanco, H., Navasa, N., Garcia-Armesto, R. M., & Ferrero, M. A. (2012). In vitro evaluation of physiological probiotic properties of different lactic acid bacteria strains of dairy and human origin. Journal of Functional Foods, 4, 531541. Mueller, S., Saunier, K., Hanisch, C., Norin, E., Alm, L., Midtvedt, T., et al. (2006). Differences in faecal microbiota in different European study populations in relation to age, gender, and country: A cross-sectional study. Applied and Environmental Microbiology, 72, 10271033. Omar, J. M., Chan, Y.-M., Jones, M. L., Prakash, S., & Jones, P. J. H. (2013). Lactobacillus fermentum and Lactobacillus amylovorus as probiotics alter body adiposity and gut microora in healthy persons. Journal of Functional Foods, 5, 116123. OToole, P. W., & Cooney, J. C. (2008). Probiotic bacteria inuence the composition and function of the intestinal microbiota. Interdisciplinary Perspectives on Infectious Diseases, 2008. Ouwehand, A. C., Isolauri, E., He, F., Hashimoto, H., Benno, Y., & Salminen, S. (2001). Differences in Bidobacterium ora composition in allergic and healthy infants. The Journal of Allergy and Clinical Immunology, 108, 144145. Pineiro, M., Asp, N., Reid, G., Macfarlane, S., Morelli, L., Brunser, O., & Tuohy, K. (2008). FAO technical meeting on prebiotics. Journal of Clinical Gastroenterology, 42(Suppl. 3 Pt 2), S156S159. Rinttila , T., Kassinen, A., & Malinen, E. (2004). Development of an extensive set of 16S rDNA-targeted primers for quantication of pathogenic and indigenous bacteria in faecal samples by real-time PCR. Journal of Applied Microbiology, 97, 11661177. Rochet, V., Rigottier-Gois, L., Ledaire, A., Andrieux, C., Sutren, M., Rabot, S., et al. (2008). Survival of Bidobacterium animalis DN173 010 in the faecal microbiota after administration in lyophilised form or in fermented product a randomised study in healthy adults. Journal of Molecular Microbiology and Biotechnology, 14, 128136. Saito, Y., Hamanaka, Y., Saito, K., Takizawa, S., & Benno, Y. (2002). Stability of species composition of faecal bidobacteria in human subjects during fermented milk administration. Current Microbiology, 44, 368373. Sanders, M. E. (2011). Impact of probiotics on colonizing microbiota of the gut. Journal of Clinical Gastroenterology, 45(Suppl.), S115S119. Saulnier, D. M., Kolida, S., & Gibson, G. R. (2009). Microbiology of the human intestinal tract and approaches for its dietary modulation. Current Pharmaceutical Design, 15, 14031414. ., & Savard, P., Lamarche, B., Paradis, M., Thiboutot, H., Laurin, E Roy, D. (2011). Impact of Bidobacterium animalis subsp. lactis BB-12 and, Lactobacillus acidophilus LA-5-containing yoghurt, on faecal bacterial counts of healthy adults. International Journal of Food Microbiology, 149, 5057. Sokol, H., Pigneur, B., Watterlot, L., Lakhdari, O., Bermu dez n, L. G., Gratadoux, J. J., et al. (2008). Faecalibacterium Humara prausnitzii is an anti-inammatory commensal bacterium identied by gut microbiota analysis of Crohn disease

patients. Proceedings of the National Academy of Sciences of the United States of America, 105, 1673116736. Taverniti, V., & Guglielmetti, S. (2011). The immunomodulatory properties of probiotic microorganisms beyond their viability (ghost probiotics: Proposal of paraprobiotic concept). Genes & Nutrition, 6, 261274. Taverniti, V., & Guglielmetti, S. (2012). Health-promoting properties of Lactobacillus helveticus. Frontiers in Microbiology, 3, 392. Tuohy, K. M., Pinart-Gilberga, M., Jones, M., Hoyles, L., McCartney, A. L., & Gibson, G. R. (2007). Survivability of a probiotic Lactobacillus casei in the gastrointestinal tract of healthy human volunteers and its impact on the faecal microora. Journal of Applied Microbiology, 102, 10261032. Turnbaugh, P. J., Ley, R. E., Hamady, M., Fraser-Liggett, C. M., Knight, R., & Gordon, J. I. (2007). The human microbiome project. Nature, 449, 804810. Turroni, F., Foroni, E., Pizzetti, P., Giubellini, V., Ribbera, A., Merusi, P., et al. (2009). Exploring the diversity of the bidobacterial population in the human intestinal tract. Applied and Environmental Microbiology, 75, 15341545. Valerio, F., Russo, F., de Candia, S., Riezzo, G., Orlando, A., Lonigro, S. L., & Lavermicocca, P. (2010). Effects of probiotic Lactobacillus paracasei-enriched artichokes on constipated patients: A pilot study. Journal of Clinical Gastroenterology, 44(Suppl. 1), S49S53. Vendrame, S., Guglielmetti, S., Riso, P., Arioli, S., Klimis-Zacas, D., & Porrini, M. (2011). Six-week consumption of a wild blueberry powder drink increases bidobacteria in the human gut. Journal of Agricultural and Food Chemistry, 59, 1281512820. Ventura, M., Reniero, R., & Zink, R. (2001). Specic identication and targeted characterization of Bidobacterium lactis from different environmental isolates by a combined multiplex-PCR approach. Applied and Environmental Microbiology, 67, 27602765. Walter, J. (2008). Ecological role of lactobacilli in the gastrointestinal tract: Implications for fundamental and biomedical research. Applied and Environmental Microbiology, 74, 49854996. Watanabe, S., Narisawa, Y., Arase, S., Okamatsu, H., Ikenaga, T., Tajiri, Y., & Kumemura, M. (2003). Differences in faecal microora between patients with atopic dermatitis and healthy control subjects. The Journal of Allergy and Clinical Immunology, 111, 587591. Wiese, D. M., Lashner, B. A., Lerner, E., DeMichele, S. J., & Seidner, D. L. (2011). The effects of an oral supplement enriched with sh oil, prebiotics, and antioxidants on nutrition status in Crohns disease patients. Nutrition in Clinical Practice: Ofcial Publication of the American Society for Parenteral and Enteral Nutrition, 26, 463473. Wu, K., Li, T., & Peng, H. (2012). Lactobacillus salivarius plus fructooligosaccharide is superior to fructo-oligosaccharide alone for treating children with moderate to severe atopic dermatitis: A double-blind, randomized, clinical trial of efcacy and safety. The British Journal of Dermatology, 166, 129136. Young, S. L., Simon, M. A., Baird, M. A., Tannock, G. W., Bibiloni, R., Spencely, K., et al. (2004). Bidobacterial species differentially affect expression of cell surface markers and cytokines of dendritic cells harvested from cord blood. Clinical and Diagnostic Laboratory Immunology, 11, 686690.

Please cite this article in press as: Taverniti, V. et al., Short-term daily intake of 6 billion live probiotic cells can be insucient in healthy adults to modulate the intestinal bidobacteria and lactobacilli, Journal of Functional Foods (2013), http://dx.doi.org/10.1016/j.j.2013.11.014