ORIGINAL ARTICLE: GASTROENTEROLOGY

Expression of Microbiota, Toll-like Receptors, and Their Regulators in the Small Intestinal Mucosa in Celiac Disease

Marko Kallioma ki, yReetta Satokari, zHannu La hteenoja, Sanna Va ha miko, Juhani Gro nlund, Taina Routi, and Seppo Salminen

ABSTRACT
Objectives: Less than one-tenth of the carriers of the risk genes HLA-DQ2 or HLA-DQ8 develop celiac disease, suggesting that other genetic and environmental factors are important in the pathogenesis. The role of gut microbiota has been addressed previously with inconsistent ndings. Our aim was to evaluate microbiota, its receptors (Toll-like receptors [TLRs]), and regulators of the TLRs in the small intestinal mucosa in celiac disease. Methods: Microbiota was analyzed by quantitative polymerase chain reaction (total bacteria and 10 bacterial group- and species-specic primers) and gene expression of interleukin-8 (IL-8), TLR2, TLR3, TLR4, TLR5, TLR9, and regulators of TLRs, Toll-interacting protein (TOLLIP), and single immunoglobulin IL-1Rrelated molecule, by relative quantitative reverse transcription-polymerase chain reaction in 10 children with celiac disease (untreated celiacs), 9 children with normal small intestinal mucosa (controls), and 6 adults with celiac disease with normal small intestinal mucosa after following a gluten-free diet (treated celiacs). Results: Small intestinal microbiota was comparable among controls, untreated celiacs, and treated celiacs. Expression of IL-8 mRNA, a marker of intestinal inammation, was signicantly increased in untreated celiacs as compared with treated celiacs (P 0.002) and controls (P 0.001). Expression of TLR-2 mRNA was signicantly decreased in untreated (P 0.001) and treated (P 0.03) celiacs, whereas expression of TLR-9 mRNA was increased in untreated celiacs (P 0.001) as compared with controls. Expression of TOLLIP mRNA was downregulated in untreated celiacs as compared with controls (P 0.02). Conclusions: Altered gene expression of TLR2, TLR9, and TOLLIP in small intestinal biopsies in celiac disease suggests that microbiotaassociated factors may be important in the development of the disease. Key Words: celiac disease, interleukin-8, microbiota, Toll-interacting protein, Toll-like receptors

(JPGN 2012;54: 727732) eliac disease is a common autoimmune disorder of the small intestine, triggered and maintained by gluten in genetically predisposed individuals. The presence of human leukocyte antigen (HLA)-DQ2 or HLA-DQ8 is necessary for the initiation of the intestinal inflammation that ultimately results in total villous atrophy coupled with crypt hyperplasia (1). These HLA class II molecules are expressed in approximately one-third of the populations in which celiac disease is prevalent; however, less than one-tenth of the gene carriers develop celiac disease, implying that other genetic and environmental factors are involved in the pathogenesis (2). Children with celiac disease have an almost 2-fold likelihood of being born by cesarean section when compared with healthy controls (3). Children born by cesarean section harbor different gut microbiota than those born vaginally (4). It is thus plausible to suggest that gut microbiota may have a role in the development of celiac disease. Studies addressing the issue have yielded inconsistent results so far (511). A single layer of epithelial cells borders the small and large intestines as a barrier between commensal bacteria and the rest of the body. Toll-like receptors (TLRs) are located in intestinal epithelial cells and lamina propria, where they recognize different bacterial molecular patterns. This interplay promotes epithelial cell proliferation, secretion of immunoglobulin A, and expression of antimicrobial peptides (12). Dysregulation of this delicate microorganism-induced program of epithelial cell homeostasis results in chronic inflammatory responses seen, for example, in inflammatory bowel disease (12). Because the expression of microbiota and TLRs in celiac disease has not been studied concurrently, we evaluated microbiota, TLRs, and their regulators in the small intestinal biopsies from patients with celiac disease. In addition, the gene expression of interleukin-8 (IL-8), a chemokine recently suggested to play a crucial role in the intestinal inflammation in celiac disease, was characterized (13).

Received July 16, 2011; accepted November 11, 2011. From the Department of Pediatrics, the yDepartment of Veterinary Biosciences, University of Helsinki, Helsinki, Finland, the zDepartment of Internal Medicine, University of Turku, Turku, and the Functional Foods Forum. Address correspondence and reprint requests to Dr Marko Kallioma ki, Department of Pediatrics, University of Turku and Turku University Hospital, PO Box 52, FI-20521 Turku, Finland (e-mail: marko. kalliomaki@utu.). The authors received funding from the ESPGHAN Infant Nutrition Award, ivikki and Sakari Sohlberg Foundation, the Paediatric Research the Pa Foundation, and the Hospital District of Southwest Finland. The authors report no conicts of interest. Copyright # 2012 by European Society for Pediatric Gastroenterology, Hepatology, and Nutrition and North American Society for Pediatric Gastroenterology, Hepatology, and Nutrition DOI: 10.1097/MPG.0b013e318241cfa8

METHODS Patients
Three groups of patients were included in the study: 10 children (mean age 9.5 years, range 314 years) with newly diagnosed celiac disease before implementation of a gluten-free diet (untreated celiacs), 6 adults (46 years, range 3060 years) who had been on a gluten-free diet at least for 1 year (treated celiacs), and 9 control children (8.5 years, range 416 years) (controls). All of the untreated celiacs had positive celiac serology markers (anti-tissue transglutaminase antibodies and/or anti-endomysium antibodies) and villous atrophy and crypt hyperplasia (Marsh III

JPGN

Volume 54, Number 6, June 2012

727

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.

Kallioma ki et al lesions) in small intestinal biopsy, whereas all of the treated celiacs and controls had negative celiac serology and normal small intestinal mucosa (Marsh 0 lesions) (14). The group of treated celiacs included adults only because a response to a gluten-free diet is ordinarily controlled in children in Finland merely by celiac serology. If celiac serology markers turn negative within the first year after the diagnosis, as was the case in all of the children with celiac disease in the study, then a follow-up endoscopy is omitted. Written informed consent was obtained from all of the study patients or their parents. The study was accepted by the ethical committee of the Hospital District of Southwest Finland.

JPGN

Volume 54, Number 6, June 2012

formulas provided by the manufacturer (Applied Biosystems) by normalization of sample Ct to the endogenous control (DCt) and further to the control RNA (DDCt). Relative changes in gene expressions were then calculated using the formula 2DDCt.

DNA Extraction From Biopsy Samples by Using Bead Beating and the Qiagen Column
DNA was extracted essentially as described by Nylund et al (15) with some modifications to the protocol. The biopsy was weighed and immersed in 180 mL of enzymatic lysis buffer containing 20 mg/mL of lysozyme in 20 mmol/L Tris-HCl-2 mmol/L ethylenediaminetetraacetic acid-1.2% (w/v) Triton X-100 (Sigma-Aldrich, St Louis, MO). The sample was incubated for 30 minutes at 378C. Subsequently, 25 mL of proteinase K and 200 mL of buffer AL (Qiagen) were added and the sample was mixed by vortexing and incubated at 568C for 30 minutes. The sample was then transferred into a 2-mL screw-cap tube with 0.25 g of zirconia beads (0.1 mm, Biospec Products, Bartlesville, OK) and homogenized with 3 minutes of bead beating with FastPrep-24 (FP120230; Bio 101 ThermoSavant, Holbrook, NY). Lysate fraction obtained from the homogenization step was transferred into a new tube and the DNA was isolated by using the Qiagen DNeasy mini-spin column (Qiagen) and following the manufacturers protocol for Gram-positive bacteria. Finally, the DNA was eluted into 100 mL of buffer AE (Qiagen). The DNA concentration was measured with a NanoDrop ND-1000 spectrophotometer. The DNA extractions were stored at 208C until use.

RNA Isolation, Reverse Transcription Reactions, and Gene Expression Assays

Biopsy samples were washed with RNAase-free water and then immediately submerged in RNAlater RNA stabilization reagent (Qiagen, Hilden, Germany). After the incubation at 48C for 1 day, the samples were stored at 208C in RNAlater until RNA isolation. Before RNA isolation, the sample was weighed and subsequently homogenized using Ika Ultra Turrax T8 high-performance disperser (Wolf Laboratories, York, UK). RNA isolation was performed using RNeasy Plus Mini-kit (Qiagen) according to the kits manual. Isolated RNA was eluted to a new RNAase-free tube with 30 mL of RNAase-free water and stored at 708C. RNA concentration was measured by NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE), and the quality of RNA was analyzed with Bio-Rad Experion System (BioRad Laboratories, Hercules, CA). Only high-quality RNA was used in reverse transcription reactions, which were performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems/Life Technologies Corporation, Carlsbad, CA) according to the kits manual. Two micrograms of RNA was used in the total reaction volume of 40 mL. Thermal cycler conditions used were 258C for 10 minutes, 378C for 120 minutes, 858C for 5 seconds, and 48C to the end of the run. The concentration of cDNA was calculated on the basis of the concentration of RNA. cDNA was stored at 208C until gene expression assays. Gene expression assays were performed using the comparative threshold cycle (Ct) method with the ABI 7300 Real-Time PCR System (Applied Biosystems). Taqman Gene Expression Assays (Applied Biosystems) used in analyses were IL-8, assay ID Hs00174103_m1; TLR2, assay ID Hs00610101_m1; TLR3, assay ID Hs00152933_m1; TLR4, assay ID Hs00152939_m1; TLR5, assay ID Hs00152825_m1; TLR9, assay ID Hs00152973_m1; Toll-interacting protein (TOLLIP), assay ID Hs00184085_m1; single immunoglobulin IL-1Rrelated molecule, assay ID Hs00222347_m1. Gene expression assays were performed according to the kits protocol. Reactions were run in 3 replicates in a total volume of 50 mL with 25 ng of cDNA in each. Thermal cycler conditions used were 508C for 2 minutes, 958C for 10 minutes, 958C for 15 seconds, and 608C for 1 minute. Steps 3 and 4 were repeated 40 times. Gene expression of 18S RNA was used as an endogenous control (a housekeeping gene) because of its invariable expression in all of the samples used in the study. Negative control and Universal Human Reference RNA (Agilent Technologies, Santa Clara, CA) as a control RNA were included in every polymerase chain reaction (PCR) run. Results were analyzed with the RQ Study software program (Applied Biosystems) to receive Ct values for all of the samples. Threshold levels were first set automatically by the program, but in a few cases, the threshold level was corrected manually to be equal to all of the samples within the analyses of 1 gene, ensuring the comparative analysis of the samples. The relative expressions of genes were calculated according to the

Quantitative PCR
Quantitative PCR (qPCR) for bacteria, archaea, and different bacterial groups and species were performed with a set of specific primers, which have been described previously (Table 1) (1625). qPCR analysis was carried out in a Applied Biosystems 7300 Fast Real-Time PCR System in a 96-well format and using SYBR Green chemistry (Power SYBR Green PCR Master Mix; Applied Biosystems). The total volume of qPCR reaction was 25 mL, using 1 mL of DNA sample or standard as a template. The primer concentrations and thermocycling programs were optimized for each specific PCR reaction. The optimized primer concentrations were between 0.1 and 0.5 mmol/L for each primer. The thermocycling programs were 958C for 10 minutes, 40 cycles of 508C to 658C for 20 to 60 seconds, 728C for 30 to 50 seconds, and 958C for 15 to 20 seconds. Standards were prepared by amplifying the target DNA fragment from a pure culture of corresponding target organism and subsequently purifying the amplified fragment by using the QIAquick PCR purification kit (Qiagen). The concentration of the purified fragment was quantified by using the NanoDrop ND-1000 spectrophotometer, and the preparation was diluted appropriately for use as standards with a known number 16S rRNA, nuc or tuf gene fragment copies. Biopsy samples were assayed in duplicate and the results were analyzed using Applied Biosystemss 7300 Fast Real-Time PCR System SDS Software (version 1.4.0). Melting curve analysis was performed after the PCR to confirm the specificity of amplification. The amount of 16S rRNA, nuc or tuf gene copies of the specific bacterial groups or species in biopsy samples, was determined by comparing the Ct values of samples with those of the standard curves.

Statistical Analysis
Due to non-normal distribution of the data, bacterial counts and relative gene expressions are presented as medians with 25th and 75th percentiles. Kruskall-Wallis 1-way analysis of variance www.jpgn.org

728

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.

JPGN

Volume 54, Number 6, June 2012

Microbiota and Toll-like Receptors in Celiac Disease

TABLE 1. Microbial group- and species-specic PCR primers used in the study Primers 50 to 30 Target group/species Bacteria Bidobacterium genus Bidobacterium adolescentis Bidobacterium catenulatum group Bidobacterium longum subsp infantis Bidobacterium longum Staphylococcus aureus Bacteroides-PrevotellaPorphyromonas group Bacteroides fragilis group Streptococcus genus Lactobacillus group Forward AGAGTTTGATCCTGGCTCAG GATTCTGGCTCAGGATGAACGC GGATCGGCTGGAGCTTGCTCCG GCCGGATGCTCCGACTCCT TTCCAGTTGATCGCATGGTC TTCCAGTTGATCGCATGGTCTTCT GCGATTGATGGTGATACGGTT GGTGTCGGCTTAAGTGCCAT ATAGCCTTTCGAAAGRAAGAT GTACAGTTGCTTCAGGACGTATC AGCAGTAGGGAATCTTCCA Reverse GGCTGCTGGCACGTAGTTAG CTGATAGGACGCGACCCCAT CCCCGAAGGCTTGCTCCCAGT ACCCGAAGGCTTGCTCCCGAT GGAAACCCCATCTCTGGGAT GGCTACCCGTCGAAGCCACG AGCCAAGCCTTGACGAACTAAAGC CGGAYGTAAGGGCCGTGC CCAGTATCAACTGCAATTTTA ACGTTCGATTTCATCACGTTG CACCGCTACACATGGAG Reference (16,17) (18,19) (20) (20) (21) (20) (22) (23) (24) (25) (23)

PCR polymerase chain reaction; R A or G; Y C or T.

was used in comparisons of untreated celiacs, treated celiacs, and controls. Comparisons between 2 different groups were made by the Mann-Whitney U test. A P value <0.05 was considered statistically significant. All of the statistical analyses were made by SPSS version 11.0.2 for Mac OS X (SPSS Inc, Chicago, IL).

RESULTS Microbiota in the Small Intestinal Biopsies

Counts of total bacteria were 1723 (5922692) 16S rRNA gene copies per milligram of tissue. The total bacterial counts were similar between untreated celiacs, treated celiacs, and controls (P 0.31, data not shown). Different bacterial groups found in all of the subjects are presented in Table 2. All of these counts were comparable between the groups. The Bacteroides fragilis group, Bifidobacterium catenulatum group, B longum, and Streptococcus genus were found in a small number of biopsies, whereas Lactobacillus group, Staphylococcus aureus, and B longum subsp infantis were found in none of the biopsies (data not shown). There were no significant differences in the amounts or frequencies of these bacteria between the study groups.

mRNA was increased in untreated and treated celiacs as compared with controls (Figs. 2 and 3). In pairwise comparisons with controls, the gene expression of TLR2 was significantly decreased in both untreated and treated celiacs (Fig. 2), whereas that of TLR9 was significantly increased in untreated but not in treated celiacs (Fig. 3). The expression of TOLLIP mRNA, an inhibitor of TLR signaling, tended to be upregulated in controls as compared with untreated and treated celiacs (Fig. 4). In pairwise comparisons with controls, the gene expression of TOLLIP was significantly decreased in untreated (P 0.02) but not in treated celiacs (P 0.75). Transcripts of TLR3, TLR4, TLR5, and single immunoglobulin IL-1Rrelated molecule were also found in the small intestinal biopsies, but their expressions were comparable among untreated celiacs, treated celiacs, and controls (data not shown).

DISCUSSION
By analyzing gene expression profiles in small intestinal biopsies in celiac disease, we have found IL-8 to be a solid indicator of intestinal inflammation and altered expressions of TLR2, TLR9, and TOLLIP as suggestive of the importance of microbiota-associated factors in the development of celiac disease, although we could not find any differences in the small intestinal microbiota by the methods used in the study. Previous studies evaluating fecal and gut microbiota in celiac patients have yielded partly conflicting results. Although increased bacterial diversity and changes in several bacterial groups in the microbiota of Spanish and Italian pediatric patients with celiac disease have been reported in various studies (56,811), a Swedish study failed to show microbiota difference between children with

Gene Expression in the Small Intestinal Biopsies

The gene expression of IL-8, as a marker of intestinal inflammation, was significantly increased in untreated celiacs as compared with treated celiacs and controls (Fig. 1). The expression of TLR-2 mRNA was decreased and the expression of TLR-9

TABLE 2. Bacterial groups found in the small intestinal biopsies of all of the subjects Bacteria Bacteroides-Prevotella-Porphyromonas group Bidobacterium genus Bidobacterium adolescentis Untreated celiacs 834 (2722062) 234 (152430) 10 (417) Treated celiacs 1682 (467760) 140 (25336) 5 (211) Controls 684 (4342396) 190 (67621) 14 (1234)

Bacterial counts are presented as medians (25th75th percentile) of 16S rRNA gene copies per miligram of tissue. All of the bacterial counts are comparable among the groups (P > 0.05, Kruskal-Wallis analysis of variance).

www.jpgn.org

729

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.

Kallioma ki et al
P = 0.001* P = 0.002# .024 .020 IL-8 mRNA .016 .012 .008 .004 TLR9 mRNA P = 0.001# .18 .15 .12 .09 .06 .03

JPGN

Volume 54, Number 6, June 2012

P = 0.001*

P = 0.12# P = 0.001#

Controls

Untreated celiacs

Treated celiacs

Controls

Untreated celiacs

Treated celiacs

FIGURE 1. The relative expression of interleukin-8 (IL-8) mRNA in small intestinal biopsies. The column represents median, and the error bar represents interquartile range. Kruskal-Wallis analysis of variance, #Mann-Whitney U test. and without celiac disease (7); however, small intestinal biopsies from children with celiac disease born during the Swedish celiac disease epidemic in the late 1980s and early 1990s were enriched with rod-shaped bacteria, suggesting that early dietary patterns may play an important role in both the development of celiac disease and small intestinal colonization (7). Correspondingly, a Spanish study found that early milk-feeding practices influence early gut colonization process in infants at risk for celiac disease (26); however, it remains to be elucidated whether differences in early dietary patterns or some other factors may explain the above-mentioned discrepancy between our study, the Swedish study, and those conducted in Southern Europe. Expression of TLRs in the small intestinal biopsies in patients with celiac disease has been variable in previous studies. Szebeni et al (27) found increased expressions of TLR2 and TLR4 in untreated and treated celiacs as compared with controls at both mRNA and protein levels. A Finnish study without a group of treated celiacs demonstrated a decreased gene expression of TLR2 and higher densities of TLR4-positive cells by immunohistochemistry in untreated celiacs in comparison with controls (28). A study, again lacking a group of treated celiacs, showed increased expression of TLR2 mRNA only in gluten-sensitive patients but not in patients with celiac disease (29). Our finding of decreased gene expression of TLR2 in untreated celiacs is in accordance with the above-mentioned Finnish study (28). It is noteworthy that exactly
P = 0.003* P = 0.03# 6 5 TLR2 mRNA 4 P = 0.001#

FIGURE 3. The relative expression of Toll-like receptor 9 (TLR9) mRNA in small intestinal biopsies. The column represents median, and the error bar represents interquartile range. Kruskal-Wallis analysis of variance, #Mann-Whitney U test. the same probe and primers for TLR2 analysis were used in these 2 studies. Discrepancies of our findings with other studies are probably the result of differences in patient selection and methods. We found that TOLLIP mRNA was decreased in untreated but not in treated celiacs. To our knowledge, the altered gene expression of TOLLIP has not been described in patients with celiac disease. TOLLIP is an intracellular protein that inhibits TLR signaling (12). Overexpression of TOLLIP in intestinal epithelial cells in vitro has been shown to inhibit TLR activation after stimulation with lipopolysaccharide or lipotechoic acid, a phenomenon termed lipopolysaccharide tolerance (30). Intestinal epithelial cells from patients with inflammatory bowel disease have been demonstrated to fail to upregulate TOLLIP expression that may boost chronic inflammation (31). Our finding of the decreased expression of TOLLIP transcript in untreated celiacs suggests that a loss of tolerance to gut microbiota may be a contributory factor in gluten-driven inflammation in celiac disease. We demonstrated for the first time increased gene expression of TLR9 in the small intestinal mucosa in untreated celiacs. TLR9 recognizes unmethylated 20 -deoxyribo (cytidine-phosphate-guanine) dinucleotides, which are found with 20-fold greater frequency in bacterial DNA than in mammalian DNA (12). A previous experimental study described a significant protective role of TLR9 activation with cytidine-phosphate-guanine DNA in necrotizing enterocolitis (32), suggesting that TLR9 signaling may have

P = 0.06* 1.8 1.5 TOLLIP mRNA 1. 2 .9 .6 .3

3 2 1

Controls

Untreated celiacs

Treated celiacs Controls Untreated celiacs Treated celiacs

FIGURE 2. The relative expression of Toll-like receptor 2 (TLR2) mRNA in small intestinal biopsies. The column represents median, and the error bar represents interquartile range. Kruskal-Wallis analysis of variance, #Mann-Whitney U test.

FIGURE 4. The relative expression of Toll-interacting protein (TOLLIP) mRNA in small intestinal biopsies. The column represents median, and the error bar represents interquartile range. Kruskal-Wallis analysis of variance. www.jpgn.org

730

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.

JPGN

Volume 54, Number 6, June 2012

Microbiota and Toll-like Receptors in Celiac Disease

rstedt P, et al. Proximal small intestinal microbiota 7. Ou G, Hedberg M, Ho and identication of rod-shaped bacteria associated with childhood celiac disease. Am J Gastroenterol 2009;104:305867. 8. Collado MC, Donat E, Ribes-Koninckx C, et al. Specic duodenal and faecal bacterial groups associated with paediatric coeliac disease. J Clin Pathol 2009;62:2649. 9. De Palma G, Nadal I, Medina M, et al. Intestinal dysbiosis and reduced immunoglobulin-coated bacteria associated with coeliac disease in children. BMC Microbiol 2010;10:63. nchez E, Donat E, Ribes-Koninckx C, et al. Intestinal Bacteroides 10. Sa species associated with celiac disease. J Clin Pathol 2010;63: 110511. 11. Schippa S, Iebba V, Barbato M, et al. A distinctive microbial signature in celiac pediatric patients. BMC Microbiol 2010;10:175. 12. Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 2010; 10:13143. 13. Lammers KM, Khandelwal S, Chaudhry F, et al. Identication of a novel immunomodulatory gliadin peptide that causes interleukin-8 release in a chemokine receptor CXCR3-dependent manner only in patients with celiac disease. Immunology 2011;132:43240. 14. Marsh M. Gluten, major histocompatibility complex, and the small intestine: a molecular and immunological approach to the spectrum of gluten sensitivity (celiac sprue). Gastroenterology 1992;102: 33054. 15. Nylund L, Heilig HG, Salminen S, et al. Semi-automated extraction of microbial DNA from feces for qPCR and phylogenetic microarray analysis. J Microbiol Methods 2010;83:2315. 16. Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt ER, Goodfellow M, eds. Nucleic Acid Techniques in Bacterial Systematics. Chichester, UK: John Wiley & Sons; 1991:11575. 17. Kullen MJ, Sanozky-Dawes RB, Crowell DC, et al. Use of the DNA sequence of variable regions of the 16S rRNA gene for rapid and accurate identication of bacteria in the Lactobacillus acidophilus complex. Appl Microbiol 2000;89:5116. 18. Kaufmann P, Pfefferkorn A, Teuber M, et al. Identication and quantication of Bidobacterium species isolated from food with genusspecic 16S rRNA-targeted probes by colony hybridization and PCR. Appl Environ Microbiol 1997;63:126873. J, et al. Comparative study of bacterial 19. Marteau P, Pochart P, Dore groups within the human cecal and fecal microbiota. Appl Environ Microbiol 2001;67:493942. ki M, et al. Similar bidogenic 20. Rinne MM, Gueimonde M, Kallioma effects of prebiotic-supplemented partially hydrolyzed infant formula and breastfeeding on infant gut microbiota. FEMS Immunol Med Microbiol 2005;43:5965. 21. Matsuki T, Watanabe K, Tanaka R, et al. Distribution of bidobacterial species in human intestinal microora examined with 16S rRNA-genetargeted species-specic primers. Appl Environ Microbiol 1999;65: 450612. 22. Fang H, Hedin G. Rapid screening and identication of methicillinresistant Staphylococcus aureus from clinical samples by selectivebroth and real-time PCR assay. J Clin Microbiol 2003;41:28949. T, Kassinen A, Malinen E, et al. Development of an extensive 23. Rinttila set of 16S rDNA-targeted primers for quantication of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol 2004;97:116677. 24. Matsuki T, Watanabe K, Fujimoto J, et al. Development of 16S rRNAgene-targeted group-specic primers for the detection and identication of predominant bacteria in human feces. Appl Environ Microbiol 2002; 68:544551. 25. Picard FJ, Ke D, Boudreau DK, et al. Use of tuf sequences for genusspecic PCR detection and phylogenetic analysis of 28 streptococcal species. J Clin Microbiol 2004;42:368695. nchez E, De Palma G, Capilla A, et al. Inuence of environmental 26. Sa and genetic factors linked to celiac disease risk on infant gut colonization by Bacteroides species. Appl Environ Micorbiol 2011;77: 531623. 27. Szebeni B, Veres G, Dezso A, et al. Increased mucosal expression of Toll-like receptor (TLR) 2 and TLR4 in coealic disease. J Pediatr Gastroenterol Nutr 2007;45:18793.

anti-inflammatory properties in the intestine. Therefore, our finding of increased expression of the TLR9 gene in the inflamed small intestine of untreated celiacs is unexpected and suggests either another function of the TLR9 gene or a defect in the downstream signaling of the gene in these patients. Concerning the increased IL-8 mRNA response in the small intestine in untreated celiacs, we propose a scenario in which gluten acts as a trigger. Gliadin, a complex glycoprotein present in glutencontaining grains, exists in 3 variants: a-, g-, and v-gliadin, the first being most prevalent. a-Gliadin is a multifunctional protein that contains multiple motifs, which accounts for its reported cytotoxic, immunogenic, and intestinal permeability effects via different peptides (reviewed in (33)). A 17-mer peptide responsible for the chemokine receptor CXCR3-dependent production of IL-8 in celiac disease was discovered (13). Gluten was able to induce greater IL-8 production in peripheral blood mononuclear cells from patients with celiac disease than from healthy controls. Interestingly, CXCR3 antibody was able to block the gluten-induced IL-8 production in patients with celiac disease but not in healthy controls, indicating that IL-8 production is differently regulated in these 2 groups (13). Intestinal mucosal expression of the chemokine receptor CXCR3, located in both intestinal epithelia and lamina propria, has been shown to be upregulated in untreated celiac disease (34). The receptor CXCR3 was also involved in the gliadin-induced increase in intestinal permeability and zonulin release (34). Serum IL-8 concentrations, which correlate significantly with tissue transglutaminase immunoglobulin A titers (35), have been demonstrated to be elevated in both untreated celiac disease and dermatitis herpetiformis (35,36). In accordance with our original finding in celiac disease reported in the present study, the gene expression of IL-8 in small intestinal biopsies in dermatitis herpetiformis normalized after implementation of a gluten-free diet, suggesting gluten-induced IL-8 production in small intestinal mucosa as a principal source of serum IL-8 (36). Until now, it was not known whether IL-8 production both in small intestinal mucosa and in peripheral blood mononuclear cells was regulated in a similar manner in patients with celiac disease. Our findings about altered gene expression profiles of TLRs and an inhibitor of their signaling in celiac disease suggest that microbiota-associated factors are important in the pathogenesis of the disease. A more detailed assessment of mucosal microbiota would be needed. To explore the issue more closely and the role and mechanisms of IL-8 production in small intestinal mucosa in celiac disease warrants further study. Acknowledgment: Ms Riikka Lankinen is acknowledged for excellent laboratory assistance.

REFERENCES
1. Schuppan D, Junker Y, Barisani D. Celiac disease: from pathogenesis to novel therapies. Gastroenterology 2009;137:19122133. 2. Wolters VM, Wijmenga C. Genetic background of celiac disease and its genetic implications. Am J Gastroenterol 2008;103:1905. 3. Decker E, Engelmann G, Findeisen A, et al. Cesarean delivery is associated with celiac disease but not inammatory bowel disease in childhood. Pediatrics 2010;125:e143340. ki M, Rautava S, et al. Mode of deliveryeffects on 4. Huurre A, Kallioma gut microbiota and humoral immunity. Neonatology 2008;93:23640. nchez E, Marzotto M, et al. Differences in faecal bacterial 5. Sanz Y, Sa communities in coeliac and healthy children as detected by PCR and denaturing gradient gel electrophoresis. FEMS Immunol Med Microbiol 2007;51:5628. 6. Nadal I, Donat E, Ribes-Koninckx C, et al. Imbalance in the composition of the duodenal microbiota of children with coeliac disease. J Med Microbiol 2007;56 (Pt 12):166974.

www.jpgn.org

731

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.

Kallioma ki et al
28. Westerholm-Ormio M, Vaarala O, Tiittanen M, et al. Inltration of Foxp3- and Toll-like receptor-4-positive cells in the intestines of children with food allergy. J Pediatr Gastroenterol Nutr 2010;50: 36776. 29. Sapone A, Lammers KM, Casolaro V, et al. Divergence of gut permeability and mucosal immune gene expression in two glutenassociated conditions: celiac disease and gluten sensitivity. BMC Med 2011;9:23. 30. Otte JM, Cario E, Podolsky DK. Mechanisms of cross hyporesponsiveness to Toll-like receptor bacterial ligands in intestinal epithelial cells. Gastroenterology 2004;126:105470. 31. Steenholdt C, Andresen L, Pedersen G, et al. Expression and function of Toll-like receptor 8 and Tollip in colonic epithelial cells from patients with inammatory bowel disease. Scand J Gastroenterol 2009;44: 195204.

JPGN

Volume 54, Number 6, June 2012

32. Gribar SC, Sodhi CP, Ward M, et al. Reciprocal expression and signaling of TLR4 and TLR9 in the pathogenesis and treatment of necrotizing enterocolitis. J Immunol 2009;182:63646. 33. Fasano A. Zonulin and its regulation of intestinal barrier function: the biological door to inammation, autoimmunity and cancer. Physiol Rev 2011;91:15175. 34. Lammers KM, Lu R, Brownley J, et al. Gliadin induces an increase in intestinal permeability and zonulin release by binding to the chemokine receptor CXCR3. Gastroenterology 2008;135:194204. 35. Manavalan JS, Hernandez L, Shah JG, et al. Serum cytokine elevations in celiac disease: association with disease presentation. Hum Immunol 2010;71:507. 36. Hall RP 3rd, Benbenisty KM, Mickle C, et al. Serum IL-8 in patients with dermatitis herpetiformis is produced in response to dietary gluten. J Invest Dermatol 2007;127:215865.

732

www.jpgn.org

Copyright 2012 by ESPGHAN and NASPGHAN. Unauthorized reproduction of this article is prohibited.