Genes Genom (2013) 35:623630 DOI 10.

1007/s13258-013-0112-6

RESEARCH ARTICLE

Analysis of transgenic silkworms producing insulin-like growth factor-I in Bombyx mori

Jiyeon Seong Min-Jung Kim Soo Won Lee Hee Jin Yang Hong Sik Kong Keun-Chong Kim Dong Sang Suh

Received: 4 September 2012 / Accepted: 26 April 2013 / Published online: 28 May 2013 The Genetics Society of Korea 2013

Abstract Silkworms contain a powerful and effective broin promoter, which controls the expression of broin, a silk protein. The broin promoter and well-known characteristics of silkworm, the application of transgenic technique to silkworm will provide an excellent opportunity to mass-produce biomolecules. In this study, the production of recombinant human insulin like growth factor-I (rhIGF-I) in the silkworm system was designed. The method makes use of the microinjection technique and P element vector to transfer foreign genes into the chromosomes. We constructed the expression vector using the broin gene promoter and P element vector containing IGF-I gene (pFpIGF-I). We then microinjected this vector into eggs, and through PCR screening, transgenic silkworms were selected. We isolated and puried rhIGF-I from silkworm cocoons, returning a concentration of rhIGF-I of about 1,300 ng/g from transgenic silkworm cocoons. In a comparison of transgenic silkworm rhIGF-I and colostral IGF-I on cell proliferation, colostral IGF-I was better able to increase the proliferation rate of the cell line relative to the transgenic silkworm rhIGF-I, and

showed a similar cell proliferation pattern. The anti-cancer effects of transgenic silkworm rhIGF-I were higher than that of colostral IGF-I on HeLa and SNU-C1 cancer cells. These results conrmed the construction of new transgenic silkworm strains producing rhIGF-I. Keywords Silkworm Bombyx mori Insulin like growth factor-I Transgenic

Introduction Escherichia coli has been frequently used to produce useful biological substances in large quantities. However, since E. Coli does not have all of the qualities higher organisms possess they are not universally suitable for bioproduction processes. Silk worms possess a number of additional qualities and can conduct post translational modication to produce useful substances in large quantities. The silkworm synthesizes vast amounts of silk proteins in the silk gland, and spins them out as a cocoon (Seong et al. 2011; Ogawa et al. 2007). In addition, silkworms produce what are known to be the most powerful and effective promoters for the control of the expression of broin, a type of silk protein (Seong et al. 2011; Kim et al. 2003). Fibroin is composed of broin H-chain, broin L-chain, and brohexamerin (fhx) at a molar rate of 6:6:1 (Hino et al. 2006; Inoue et al. 2000). This prominent capability is assumed to have developed for the mass production of recombinant proteins (Seong et al. 2011; Ogawa et al. 2007). The silkworm is of considerable importance as a producer of recombinant silk proteins, which are used in genetic transformation technologies, such as the baculovirus system and transposon-based vector system (Choi et al. 2007; Ogawa et al. 2007; Imamura et al. 2003; Kim et al. 2003).

J. Seong M.-J. Kim D. S. Suh (&) Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea e-mail: dssuh@skku.edu J. Seong H. S. Kong Genomic Informatics Center, Hankyong National University, Anseong 425-839, Republic of Korea S. W. Lee H. J. Yang Sungkyun Biotech, Co., Ltd., Ansan 425-839, Republic of Korea K.-C. Kim Hong-Ik University, Jochiwon 339-700, Republic of Korea

123

624

Genes Genom (2013) 35:623630 Table 1 PCR primer sequences of IGF-I gene Sequence IG-up(128mer) 50 GAATTCGGCGCCGGTCCTGAGACGCTCTGCGGTGCAGAGC TGGTGGATGCACTTCAGTTCGTGTGTGGTGACAGGGGTTT TTATTTCAACAAGCCTACAGGTTATGGTTCATCATCACGG AGGGCACC30 IG-down(129mer) 50 CTGCAGTCTAGATTATGCTGACTTTGCAGGCTTGAGGGGT GCGCAATACATCTCCAGCCTCCTTAGATCACAGCTCCGGA AGCAGCACTCATCCACGATACCTGTCTGAGGTGCCCTCCG TGATGATGA30 Underlined bases represent overlapped sequence

The insulin-like growth factor-I (IGF-I) is associated with neonatal growth, further cell development, and regeneration of damaged cells by the formation of bone, muscle, and nerve tissues. IGF-I is secreted by mature osteoblasts, and can be stored locally in the bone matrix until its release during bone resorption (Ochiai et al. 2012). Also, in bovine colostrums, the rst milk following parturition includes IGF-I (Lee and Ho 2002). IGF-I is a 70 amino acid polypeptide hormone (7.5 kDa), which is similar in structure to insulin (Elliott et al. 1990a; Cong et al. 2011), and is an pleiotropic factor that plays a key role in maintaining glucose homeostasis and protein metabolism in type 1 diabetes (Simpson et al. 2004). IGF-I has been successfully isolated from yeast (Elliott et al. 1990b) and silkworms (Cong et al. 2011; Li et al. 2011). In the silkworm, IGF-I is produced using recombinant baculovirus (Zhang and He 2002), and the PiggyBac vector, fhx/P25 promoter, in silk glands has recently been studied in this regard (Cong et al. 2011; Li et al. 2011). In this study, the production of puried recombinant human IGF-I (rhIGF-I) in cocoons of transgenic silkworms was investigated. We developed transgenic silkworms with P element vectors carrying the broin-L promoter and IGFI gene. The P element vectors containing foreign genes were microinjected into eggs, and mediated a stable germline transformation of the silkworm. To accomplish this, a transgenic silkworm containing a vector system, and allowing the next generation to be controlled was developed. The rhIGF-I was then puried from the transgenic silkworm cocoon and the effect of rhIGF-I on in vitro cell proliferation and anti-cancer of several cells was studied.

Microinjection Eggs of the Baekokjam strain were used for microinjection. The eggs were collected between 1 and 2 h after having been laid, when they were in the syncytial preblastoderm stage. About 1-10 nl of DNA in microinjection buffer (0.5 mM phosphate buffer, pH 7.0, 5 mM KCl) was injected into each egg, as has been previously described (Nikolaev et al. 1993). The opposite end of the eggs were then microinjected using microcapillary tubes. The injection opening was sealed with parafn, and the embryos were allowed to develop at 25 C. Genomic DNA preparation and PCR analysis of transgenic silkworms Genomic DNA extracted from the larva of moths was used as a template for PCR analysis. PCR was conducted using the following primers: s-for primer 50 GTA CAG TTG TTT GAT A 30 , IGF-I for primer 50 -GAATTCGGCGC CGGTCCT-30 , SVPS-R primer 50 CCC CCT GAA CCT GAA ACA TA 30 . The PCR conditions were as follows: 95 C for 30 s, 55 C for 30 s, and 72 C for 30 s for 45 cycles. rhIGF-I extraction from cocoons and IGF-I rich fraction colostral whey Total proteins were isolated from fresh cocoons (50 mg) by extraction, using 40 % lithium thiocyanate (2 ml) and 29 PBS buffer. They were then centrifuged at 5,000 rpm for 30 min at 4 C to remove pellets. The supernatant was gradually passed through 1 kDa ultraltration cartridges (Prep/Scale-TFF; Millipore, Billerica, MA, USA). Fresh cocoons (5 g) were mixed with 29 PBS buffer (500 ml) and were stirred for 24 h. The supernatant was

Materials and methods Silkworm strains A Korean strain of silkworm, Baekokjam of Bombyx mori (Animalia-Arthropoda- Insectda-Lepidoptera-BombyxidaeBombyx-mori), was used in this study. The silkworms were bred from original strains in our laboratory (Sungkyunkwan University). Silkworms were reared at 25 C on a 12 h light dark cycle, and were fed either fresh mulberry leaves or an articial diet. Construction of expression vector The expression vector, pFPIGF-I, was made using the FibL promoter, the IGF-I gene and the pUChsneo vector. The IGF-I gene, which included the mat peptide, was amplied to overlap by PCR (Table 1).

123

Genes Genom (2013) 35:623630

625

then gradually passed through 100 and 1 kDa ultraltration cartridges. Holstein colostrum was used for the isolation of the IGF-I RF, and was collected within 24 h after parturition. The colostrum samples were centrifuged at 5,000 rpm for 30 min at 4 C to remove milk fat. The separated skimmed milk was subsequently acidied with 1 N HCl and was centrifuged at 5,000 rpm for 30 min at 4 C. In accordance with the procedure described by Hossner and Yemm (2000), the separated whey was gradually passed through 30 and 1 kDa ultraltration cartridges (Prep/Scale-TFF; Millipore, Billerica, MA, USA) to separate IGF-I RF, the free form of IGF-I. IGF-I in the ultraltered fractions was veried using SDS-PAGE and Western blotting, and the IGF-I content was measured using sandwich ELISA. Western blot The puried rhIGF-I samples were transferred to a 15 % SDS-polyacrylamide gel which was then transferred to a polyvinyldiuoride membrane (PVDF, Gilman, USA), after which they were reacted with anti-hIGF-I and visualized with the ECL Western Blot Detection System (Santa Cruz). Cell lines, cell culture The cell proliferative activity of IGF-I was isolated from the cocoons of transgenic silkworms, and was assessed in a cell culture system using IEC-6, Detroit 551, EL-4 and L6, and cell cytotoxicity was then assessed using cancer cell lines, A427, SK-HEP-1, A498, HeLa, WiDr and SNU-C1 cells (Korean cell line bank). Cell viability assay Cell proliferation was assessed by a 3-(4,5-dimethyl thiazol-2-yl)-2, 5- diphenyltetrazolium bromide (MTT) assay. Each sample at various concentrations was then added to 20 ll rhIGF-I and IGF-I RF. After being incubated with 5 % CO2 at 37 C for 48 h, a 10 ll MTT solution was added to each well, and the absorbance of the extract was measured at 540 nm.

Fig. 1 Physical map of expression vector pFPIGF-I. The pFPIGF-I expression vector was designed to contain the broin light gene promoter in B. mori, IGF-I gene and pUChsneo. The broin light promoter consists of the upstream region -1,000 to the signal peptide (111 amino acid) of the broin light chain gene, and the IGF-I gene includes the mat peptide

gene was constructed using the pb/pUChsneo vector and IGF-I gene. The pb/pUChsneo vector consists of the broin light chain promoter and pUChsneo vector. The broin light promoter consists of the upstream region 1,000 to the signal peptide (1-11 amino acid) of the broin light chain gene. The IGF-I gene, has a length of 213 bp that includes the mat peptide. The expression vector, pFIGF-I, which consists of a signal peptide linker, broin light chain promoter, IGF-I gene, SV40 polyA signal and pUChsneo, was constructed successfully for the generation of a transgenic silkworm (Fig. 1). Generation of transgenic silkworms in B. mori The expression vector, pFPIGF-I, was injected into preblastoderm stage silkworm eggs, with a helper vector, pp25.7wcD2-3.

Table 2 Survival of embryos and yield of positive larvae

Results Construction of expression vector (pFPIGF-I) containing broin gene promoter and IGF-I An expression vector (pFPIGF-I) designed to contain the broin gene promoter, P element and IGF-I as a foreign

Injected eggs No. Rate (%) 4,605

Pigmented eggs 109 2.37

Hatched eggs 70 1.52

Transgenic silkworm 5 0.11

The expression vectors were injected into 4,605 eggs and 5 of 4,605 microinjection eggs were transformed

123

626 Fig. 2 Screening and identication of transgenic silkworms. a PCR products were amplied 420 bp of IGF-I gene and SV40 poly(A) signal from G7 genomic DNA (M, DNA maker; lane 1, B. mori; lane 27, transgenic silkworm; lane 8, expression vector pFPIGF-I); b Results of PCR products sequence in transgenic silkworms G2 (upper case, IGFI gene; lower case, SV40 poly(A) signal); c, d Size comparison of normal silkworm and transgenic silkworm; e SDS-PAGE (left) and Western blotting (right) analysis patterns of IGF-I rich fraction separated from membrane ltration (lane M, Low molecular weight marker (Bio-Rad, USA), lane 1, Standard IGF-I(R&D system, USA), lane 2, rhIGF-I from cocoon of the silkworm, lane 3, colostral IGF-I rich fraction

Genes Genom (2013) 35:623630

123

Genes Genom (2013) 35:623630 Table 3 Comparison of normal and transgenic pupae weight Normal pupae Female Advantage (g) SD 1.286 0.093 Male 0.907 0.076 Transgenic pupae Female 1.499 0.078 Male 1.108 0.085

627

The weight of the self-mated transgenic pupae of each generation was greater than that of the normal strain

The weight of the self-mated transgenic pupae and cocoons of each generation was greater than that of the normal strain. Additionally, PCR analysis revealed that the G7 of the transgenic silkworms contained the 213 bp IGF-I gene and SV40 polyA signal, as well as the pFPIGF-I vector (Fig. 2a). It was through this process that the generation of transgenic silkworm for production of rhIGF-I was achieved. Purication of rhIGF-I from transgenic silkworms We isolated and puried rhIGF-I from cocoons by grinding the cocoons in lithium thiocyanate and 29 PBS buffer. The supernatant was gradually passed through 100 and 1 kDa ultraltration cartridges. The concentration of IGF-I in the transgenic silkworm cocoons was about 1,300 ng/g. The proteins were then separated by SDS-PAGE, and were immunoblotted with antibodies against IGF-I antibody (Santa Cruz, USA). The puried rhIGF-I produced a band with a molecular weight of approximately 7.5 kDa and the immunoblotted rhEPO also had an immunoreactive band (Fig. 2e).

The expression vector was injected into 4,605 eggs and hatched G0 larvae were reared at 25 C to moths. A total of 70 microinjected eggs survived (Table 2). The growth rate of the transgenic G0 silkworms was faster than that of the control silkworms. In addition, the pupae and cocoons of transgenic G0 silkworms were larger and heavier than those of the control silkworms (Fig. 2c, d; Table 3). G0 adults that survived from injected eggs were mated with the parental strain, after which the moths were screened by PCR (Fig. 2a). PCR screening of the G0 adults revealed transgenic silkworms, which were subsequently shown to contain the rhIGF-I gene. A total of 5 rhIGF-I producing strains were obtained (Table 2).

(a)
Cell proliferation(%)

70 60 50 40 30 20 10 0

(b)
Cell proliferation(%)

60 50 40 30 20 10 0

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

(c)
Cell proliferation(%)

60 50 40 30 20 10 0

(d)
Cell proliferation(%)

50 45 40 35 30 25 20 15 10 5 0

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

Fig. 3 The cell proliferation of IGF-I rich fractions separated from colostral whey and transgenic silkworm by ultraltration. Supplementation levels of rhIGF-I were from 1 mg/ml to 1 lg/ml on the

basis of protein content. Cell proliferation increases were expressed as the relative percentage of cell number in groups supplemented rhIGFI, to that of control group. a IEC-6, b Detroit 551, c EL-4, d L6

123

628

Genes Genom (2013) 35:623630

(a)
% of cytotoxicity

35 30 25 20 15 10 5 0

(b)
% of cytotoxicity Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

20 18 16 14 12 10 8 6 4 2 0

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

(c)
Cell proliferation(%)

25 20 15 10 5 0

(d)
35

Cell proliferation(%) Protein concentration

Colostral IGF-I rf Silkworm IGF-rf

30 25 20 15 10 5 0

Protein concentration
Colostral IGF-I rf Silkworm IGF-rf

(f) (e)
Cell proliferation(%)
30

30 25 20 15 10
5 0

Cell proliferation(%)

25 20 15 10 5 0

-5 -10 -15 -20

Protein concentration Protein concentration

Colostral IGF-I rf Silkworm IGF-rf Colostral IGF-I rf Silkworm IGF-rf

Fig. 4 The anti cancer effects of IGF-I rich fractions separated from colostral whey and transgenic silkworm by ultraltration. Supplementation levels of rhIGF-I were from 1 mg/ml to 1 lg/ml on the basis of protein content. a A427; b SK-HEP-1; c A498; d HeLa; e WiDr; f SNU-C1 cells

The biological activity of rhIGF-I The effect of rhIGF-I on cell proliferation of IEC-6, Detroit 551, EL-4 and L6 cells are indicated in Fig. 3. Supplementation levels of rhIGF-I were from 1 mg/ml to 1 lg/ml on the basis of protein content. Each well of a 96-welltissue culture plate was then treated with either medium containing 1 mg/ml, 0.1 mg/ml, 0.01 mg/ml, 0.001 mg/ml IGF-I included colostral and silkworm protein. The treated groups were harvested at day 2 and cell proliferation was

determined. Cell proliferation was expressed as the relative percentage of cell number in groups supplemented rhIGF-I to that of the control group. The IEC-6 cell proliferation of rhIGF-I in media containing 1, 0.1, 0.01 and 0.001 mg/ml were increased by 21.27, 13.72, 5.1 and 2.1 %, respectively. The Detroit 551 cell line was increased by 23.78, 10.56, 4.1 and 2.54 % under the respective treatments, whereas the EL4 cell line was increased by 33.1, 13.9, 3.1 and 2.1 %, and the L6 cell line was increased by 21.56, 12.54, 5.75 and 3.34 %. Cell proliferation of rhIGF-I,

123

Genes Genom (2013) 35:623630

629

which included silkworm protein was lower than the IGF-I, which included colostral. This is thought to be caused by the implementation of other substances that were in the fraction of the colostrium that has not been thoroughly puried causing grater effects on cell growth. However, it showed a similar cell proliferation pattern. These ndings show that growth rate was dependent on rhIGF-I concentrations, indicating its biologically activity. The effect of rhIGF-I on cell cytotoxicity of cancer cell lines, A427, SK-HEP-1, A498, HeLa, WiDr and SNU-C1 cells are indicated in Fig. 4. The A427 cell cytotoxicities of rhIGF-I in media containing 1, 0.1, 0.01 and 0.001 mg/ml were 25, 16.44, 11.22 and 4.98 %, respectively. Those of the SK-HEP-1 cell were 13.32, 9.53, 7.57 and 3.21 %. Those of the A498 cell were 17.6, 8.65, 3.21 and 1.5. Those of the HeLa cell were 32.5, 28.76, 12.21 and 7.53 %. Those of the WiDr cell were 25.54, 10.86, 6.87 and 4.53 %, while those of the SNU-C1 cell were 24.3, 16.74, 6.47 and 3.75 %, respectively. The anti cancer effect of the rhIGF-I which included silkworm protein was lower than that of IGF-I which included colostral in A427, A498 and WiDr cells, but was able to effect a similar cell proliferation pattern. The anticancer effects of transgenic silkworm IGF-I were higher than those of colostral IGF-I on HeLa and SNU-C1 cancer cells.

Discussion Transgenesis has great value in the research of domestic silkworm, B. mori, because of the organisms great scientic and economic importance as a lepidopteran insect (Kim et al. 2003; Nagaraju et al. 1996). In a previous study, PiggyBac-mediated germ-line transformation has been used successfully in silkworm (Li et al. 2011; Imamura et al. 2003; Tomita et al. 2003; Tamura et al. 2000). However, since the species transformed with PiggyBac is wider in range than other transposons, the possibility of horizontal transmission to other insects must be considered in application (Kim et al. 2003; Handler 2002). Therefore, we have constructed a vector consisting of the P element and the broin promoter of B. mori and IGF-I gene. The P element of D. melanogaster is a crucial candidate because it has a steep range of transformed species (Kim et al. 2003; OBrocha and Atkinson 1996). In this study, a successful transgenic silkworm system producing rhIGF-I in its cocoon was developed. In addition, a line of transgenic silkworm producing rhIGF-I was developed. Currently, rhIGF-I is produced from E. coli and Yeast, but the associated system of purication is relatively complicated when compared to that described in this study, as the silkworm have fewer type proteins.

To successfully construct a transgenic silkworm, it was conrmed that foreign genes and P elements were integrated into the genome, and stably inherited to the next generation in transgenic silkworm. Transgenic silkworms were selected and were found to be maintained, with the modication being transmitted to their progeny. The rhIGF-I was puried from transgenic silkworm cocoons. The electrophoretic pattern of the puried rhIGF-I revealed a protein band with a molecular weight of approximately 7.5 kDa. The immunoblotted rhIGF-I also showed an immunoreactive band. We isolated and puried rhIGF-I from cocoons by grinding the cocoons, and the concentration of rhIGF-I was determined to be about 1,300 ng/g. In the comparison of transgenic silkworm rhIGF-I with colostral IGF-I in relation to cell proliferation, colostral IGF-I was able to increase the proliferation rate of the cell line relative to that of the transgenic silkworm rhIGF-I, and both showed similar cell proliferation patterns. The anti-cancer effects of transgenic silkworm rhIGF-I were higher than that of colostral IGF-I on HeLa and SNU-C1 cancer cells. Although the similarities have been conrmed between the structures of colostral IGF-I and transgenic silkworm rhIGF- I, the effects on growth of normal cells and cancer cells were slightly different, since the ingredients were not puried by functional analysis, and thus, other substances coexist. These results conrm the construction of new transgenic silkworm strains producing rhIGF-I. Furthermore, the results conrmed that rhIGF-I possesses biological activity in vitro. The transgenic silkworm, P element and broin gene promoter may facilitate the production of a variety of useful biological materials, and may be useful in the mass production of proteins for diagnostic and therapeutic purposes.
Acknowledgments This work was supported by the Technology Development Program for Agriculture and Forestry, Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea (109170-3) and grant from the Next-Generation BioGreen 21 Program (No. PJ008196).

References
Choi KH, Goo TW, Yun EY, Hwang JS, Kang SW (2007) Gene expression prole of the posterior silk glands of the silkworm, Bombyx mori L. Kor J Genet 29(2):193201 Cong L, Cao G, Renyu X, Zhonghua P, Xiaojian Z, Zhou W, Gong C (2011) Reducing blood glucose level in TIDM mice by orally administering the silk glands of transgenic hIGF-I silkworm. Biochem Biophys Res Commun 410:721725 Elliott S, Fagin KD, Narhi LO, Miller JA, Jones M, Koski R, Peters M, Hsieh P, Sachdev R, Rosenfeld RD, Rohde MF, Arakawa T (1990) Yeast-derived recombinant human insulin-like growth factor I. Production, purication, and structural characterization. J Protein Chem 95104 Elliott S, Fagin KD, Narhi LO, Miller JA, Jones M, Koski R, Peters M, Hsieh P, Sachdev R, Rosenfeld RD et al (1990b) Yeast-

123

630 derived recombinant human insulin-like growth factor I: production, purication, and structural characterization. J Protein Chem 9:95104 Handler AM (2002) Use of the piggyBac transposon for germ-line transformation of insects. Insect Biochem Mol Biol 32(10): 12111220 Hino R, Tomita M, Yoshizato K (2006) The generation of germline transgenic silkworms for the production of biologically active recombinant fusion proteins of broin and human basic broblast growth factor. Biomaterials 27:57155724 Hossner KL, Yemm RS (2000) Improved recovery of insulin-like growth factors (IGFs) from bovine colostrums using alkaline dialtration. Biotechnol Appl Biochem 32(3):161166 Imamura M, Nakai J, Inoue S, Guo XQ, Kanda T, Tamura T (2003) Targeted gene expression using the GAL4/UAS system in the silkworm Bombyx mori. Genetics 165:13291340 Inoue S, Tanaka K, Arisaka F, Kimura S, Ohtomo K, Mizuno S (2000) Silk broin of Bombyx mori is secreted, assembling a high molecular mass elementary unit consisting of H-chain, L-chain, and P25, with a 6:6:1 molar ratio. J Biol Chem 275:4051740528 Kim SJ, Sung SH, Seung JY, Nam HY, Kim KC, Suh DS (2003) Production of transgenic silkworm (Bombyx mori L.) by P element-mediated integration of recombinant luciferase with silkworm broin promoter. Kor J Genet 25(1):5762 Lee SH, Ho KL (2002) Effects of bovine colostral ultra ltrates on growth and differentiation of 3T3-LI preadipocytes. Biotechnol Appl Biiochem 36:205212 Li Y, Cao G, Wang Y, Xue R, Zhou W, Gong C (2011) Expression of the hIGF-I gene driven by the Fhx/P25 promoter in the silk glands of germline silkworm and transformed BmNcells. Biotechnol Lett 33:489494 Nagaraju J, Kanda T, Yukihiro K, Chavancy G, Tamura T, Couble P (1996) Attempt at transgenesis of the silkworm (Bombyx mori L.) by egg-injection of foreign DNA. Appl Entomol Zool 31:587596

Genes Genom (2013) 35:623630 Nikolaev AI, Tchkonia TT, Kaani CA, Tarantul VZ (1993) Prefernetial extrachromosomal localization of exogenous DNA in transgenic silkworm Bombyx mori L. Mol Gen Genet 236:326330 OBrocha DA, Atkinson PW (1996) Transposable elements and gene transformation in non-drosophilid insects. Insect Biochem Mol Biol 26:739753 Ochiai H, Okada S, Saito A, Hoshi K, Yamashita H, Takato T, Azuma T (2012) Inhibition of IGF-I expression by prolonged TGF-b1 administration suppresses osteoblast differentiation. JBC. doi: 10.1074/jbc.M111.279091. http://www.jbc.org/cgi/ Ogawa S, Tomita M, Shimizu K, Yoshizato K (2007) Generation of a transgenic silkworm recombinant proteins in the sericin layer of cocoon: production of recombinant human serum albumin. J Biotechnol 128:531544 Seong J, Kim MJ, Kim HS, Kim SA, Jeon HW, Sung SH, Kim KC, Suh DS (2011) Generation of transgenic silkworms for production of erythropoietin in Bombyx mori. Genes Genomics 33:237243 Simpson HL, Jackson NC, Shojaee-Moradie F, Jones RH, RussellJones DL, Sonksen PH, Dunger DB, Umpleby AM (2004) Insulin-like growth factor I has a direct effect on glucose and protein metabolism, but no effect on lipid metabolism in type I diabetes. J Clin Endocrinol Metab 89:425432 Tamura T, Thibert C, Royer C, Kando T, Abraham E, Kamba M, Komoto N, Thomas JL, Mauchamp B, Chavancy G, Shirk P, Fraser M, Prudhomme JC, Couble P (2000) Germline transformation of the silkworm Bombyx mori L. using a piggyback transposon derived vector. Nat Biotech 18:8184 Tomita M, Munetsuna H, Sato T, Adachi T, Hino R, Hayashi M, Shimizu K, Nakamura N, Tamura T, Yoshizato K (2003) Transgenic silkworms produce recombinant human type I procollagen in cocoons. Nat Biotech 21:5256 Zhang ZF, He JL (2002) Blood sugar reducing method of orally taking human insulin-like growth factor-I produced in silkworm bioreactor. Chinese patent 02112766, 15 March

123