Original Research

ASTHMA

2-Adrenergic Receptor Polymorphisms Affect Response to Treatment in Children With Severe Asthma Exacerbations*
Christopher L. Carroll, MD, FCCP; Petronella Stoltz, APRN; Craig M. Schramm, MD; and Aaron R. Zucker, MD

Background: 2-adrenergic receptor (AR) agonists are the mainstay of treatment for severe asthma exacerbations, one of the most common causes of critical illness in children. Genotypic differences in the 2-AR gene, particularly at amino acid positions 16 and 27, have been shown to affect the response to 2-AR agonist therapy. Our hypothesis is that genotypic differences contribute to patient response to 2-AR agonist treatment during severe asthma exacerbations in children. Methods: Children admitted to the hospital ICU for a severe asthma exacerbation between 2002 and 2005 were located, and genetic samples were obtained from saliva. Children hospitalized during this period were treated with a protocol that titrated 2-AR therapy (first nebulized, then IV) according to a validated clinical asthma score. Results: Thirty-seven children hospitalized during the study period were enrolled into the study. At amino acid position 16 in the 2-AR gene, 13 children were homozygous for the glycine (Gly) allele (Gly/Gly), 8 were homozygous for the arginine (Arg) allele (Arg/Arg), and 16 were heterozygous (Arg/Gly). Despite similar clinical asthma scores on hospital admission, the children with the Gly/Gly genotype had significantly shorter hospital ICU length of stay and duration of continuously nebulized albuterol therapy and were significantly less likely to require IV 2-AR therapy than those with Arg/Arg or Arg/Gly genotypes. No association existed among polymorphisms at amino acid position 27 and response to 2-AR therapy. Conclusions: In this cohort of children with severe asthma exacerbations, children whose genotypes were homozygous for Gly at amino acid position 16 of the 2-AR gene had a more rapid response to 2-AR agonist treatment. The 2-AR genotype appears to influence the response to therapy in this population. (CHEST 2009; 135:1186 1192)
Abbreviations: AR adrenergic receptor; Arg arginine; Gln glutamine; Glu glutamic acid; Gly glycine; MPIS modified pulmonary index score; SNP single-nucleotide polymorphism

evere asthma exacerbations are one of the most S common causes of critical illness in children, accounting for approximately 10,000 hospital ICU admissions per year in the United States.15 Inhaled
*From the Department of Pediatrics, Connecticut Childrens Medical Center, Hartford, CT. This research was supported by the University of Connecticut Health Center General Clinical Research Center (grant M01 RR006192). The authors have reported to the ACCP that no significant conflicts of interest exist with any companies/organizations whose products or services may be discussed in this article. Manuscript received August 21, 2008; revision accepted November 8, 2008.
1186

2-adrenergic receptor (AR) agonist medications are the foundation of therapy for acute asthma exacerbation.6 8 They may be delivered intermittently or continuously during more severe episodes.6 8 If the child progresses to having a severe asthma exacerbation that requires a hospital ICU admission, several
Reproduction of this article is prohibited without written permission from the American College of Chest Physicians (www.chestjournal. org/site/misc/reprints.xhtml). Correspondence to: Christopher L. Carroll, MD, FCCP, Division of Pediatric Critical Care, Connecticut Childrens Medical Center, 282 Washington St, Hartford, CT 06106; e-mail: ccarrol@ccmckids.org DOI: 10.1378/chest.08-2041
Original Research

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

different second-line therapies are used, including systemic 2-AR agonists, methylxanthines, and magnesium.6 8 Often, these therapies are used in combination or a trial-and-error fashion and chosen without an evidence-based rationale.6 8 Determining the likelihood of response to a specific therapy would be a major advance in the treatment of severe asthma exacerbations in children. Genetic variations of the 2-AR may have important effects on modulating responses to therapy for asthma.9 23 Single-nucleotide polymorphisms (SNPs) at amino acid positions 16 and 27 of the 2-AR gene are the most common and have been shown to be the most functionally relevant.9 23 A change at base 46 from adenine to guanine causes glycine (Gly), rather than arginine (Arg), to appear at amino acid position 16 in the 2-AR gene.9 A change at base 79 from guanine to cytosine results in the substitution of glutamic acid (Glu) for glutamine (Gln) at position 27.9 However, conflicting data exist regarding the effects of these variations in different populations, and the clinical importance of these polymorphisms is poorly understood.9 23 Our hypothesis is that genotypic differences of the 2-AR are associated with response to short-term 2-AR agonist treatment during severe asthma exacerbations in children. Materials and Methods
This study was approved by the Institutional Review Board at Connecticut Childrens Medical Center. Written informed consent was obtained before patient enrollment. All children between 2 and 18 years of age with physiciandiagnosed asthma and who were admitted with a severe asthma exacerbation between January 1, 2002, and December 31, 2005, were included in the study. Severe asthma exacerbations were defined as those requiring hospital ICU admission. Children with chronic medical conditions other than asthma, such as bronchopulmonary dysplasia, tracheobronchial malacia, and congenital heart disease, were excluded. The modified pulmonary index score (MPIS) was used to assess illness severity. Asthma scoring systems often are used in pediatric patients because of the difficulty in obtaining reliable and reproducible measures of airflow obstruction in children who are critically ill. This validated scoring system is highly reproducible among groups of medical professionals (respiratory therapists, nurses, and physicians) as well as among individuals within each group.24 In the MPIS, the following six categories are evaluated: oxygen saturation in room air, accessory muscle use, inspiratory-to-expiratory ratio, degree of wheezing, heart rate, and respiratory rate. For each of these measurements or observations, a score of zero to three is assigned.24 Admission and discharge criteria from both the ICU and the hospital remained constant during the study period. At the study institution, pediatric patients may be treated with continuously nebulized albuterol on the inpatient ward. Children were admitted to the hospital ICU for an asthma exacerbation if after 2 h of at least 20 mg/h of continuous nebulized albuterol therapy the child was given an MPIS score of 12, required supplemental oxygen of 40% to maintain oxygen saturation 94%, or was intubated and mechanically ventilated. A child was transferred
www.chestjournal.org

from the hospital ICU to the ward when he or she required bronchodilator therapy of 20 mg/h of continuous albuterol aerosol, needed supplemental oxygen 40% to maintain oxygen saturation 94%, and was given an MPIS score of 10. Pediatric patients were discharged home if their MPIS score was 7 while receiving intermittent albuterol nebulizer treatments every 4 h or more and required no supplemental oxygen therapy to maintain oxygen saturation at 94%. During the study period, all children were treated prospectively according to a clinical protocol that adjusted 2-AR agonist therapy based on hourly MPIS assessments of each childs illness severity.25,26 The children were treated initially with high-dose continuous nebulized albuterol therapy ( 20 mg/h), and those who showed no improvement on sequential MPIS assessments were treated with IV terbutaline, which also was adjusted hourly based on MPIS scores. This previously published protocol25 has been shown to reduce variability and reduce duration of therapies for asthma exacerbations. All the children also received 4 mg/kg/d of IV methylprednisolone during the acute phase of illness. All families of children meeting the study criteria were contacted. The childrens genomic DNA was obtained from a saliva sample (ORAgene DNA Self-Collection Kit; DNA Genotek Inc; Ottawa, ON, Canada), and analysis was performed at the University of Connecticut Health Centers General Clinical Research Center. Genotyping of the adjacent Arg16Gly and Gln27Glu was determined by restriction fragment length polymorphism analysis of a 100-base pair (bp) polymerase chain reaction product encompassing both SNPs, using primers AGCGCCTTCTTGCTGGCACCCCAT and ACATGACGATGCCCATGC. Digestion of the polymerase chain reaction product with NcoI was used to determine frequency of the Arg16 and Gly16 variant alleles (100 bp vs 20 80 bp) as well as with NcoI and Fnu4HI to generate size-specific products (italicized) for each of the following four possible haplotypes: Gly16/Glu27 (20 bp, 35 bp, 45 bp), Gly16/ Gln27 (20 bp, 35 bp, 45 bp), Arg16/Gln27 (55 bp, 45 bp), and Arg16/Glu27 (100 bp). These four haplotypes define 90% of the known haplotypes across a 1,500-bp region encompassing 13 SNP variants, including eight 5-upstream SNPs with potential regulatory effects as well as the common Arg16Gly and Gln27Glu amino acid variants.12 A trained research assistant extracted clinical data retrospectively from the medical record, using a uniform data extraction tool. Investigators were blinded to 2-AR genotype at the time of data collection. Actual lengths of stay and duration of therapy were calculated from the medical record. Although data regarding National Heart Lung and Blood Institute classifications27 were collected retrospectively, they were determined prospectively at the time of admission to the hospital ICU by an attending pulmonologist or intensivist, using the guidelines in effect at the time of hospitalization. Because of missing height data, the children were classified as overweight if their age-for-weight percentile was 95% based on gender-specific reference data collected by the National Center for Health Statistics.28 Statistical Analysis The relationships between 2-AR genotypes and outcomes were assessed with appropriate parametric tests and statistics, including 2 and t tests. Nonparametric tests, such as Wilcoxon rank sum test and Kruskal-Wallis test, were used when indicated by the distribution of the data. The Shapiro Wilk test was used to assess normality. Multiple regression was used to determine the influence of genotype, controlling for other potential risk factors found to be significantly associated with length of stay in the hospital ICU and duration of continuous albuterol therapy. All p values represent two-sided hypothesis testing, and a p value of 0.05 was considered statistically significant. Data were anaCHEST / 135 / 5 / MAY, 2009

1187

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

Table 1Demographics and Measures of Baseline Illness Severity According to 2-AR Genotype at Amino Acid Position 16*
Variables Age, yr Male gender Obese ( 95% weight for age) Race/ethnicity Hispanic African American White Public insurance Previous hospitalization Previous hospital ICU admission Previous intubation NHLBI asthma classification Intermittent Mild persistent Moderate persistent Severe persistent Baseline inhaled corticosteriod use Gly/Gly (n 13) 6.3 3.9 46 8 8 23 61 69 46 15 0 54 23 15 7 54 Arg/Gly or Arg/Arg (n 24) 7.7 3.9 54 33 21 21 50 58 58 33 8 17 38 21 25 54 p Value 0.23 0.74 0.12 0.22 1.00 0.73 0.72 0.52 0.44 0.53 0.03 0.48 1.00 0.38 1.00 Arg/Arg (n 8) 7.3 4.1 38 38 25 25 50 63 63 25 0 25 25 38 13 50 p Value 0.54 1.00 0.25 0.53 1.00 0.67 1.00 0.66 0.62 1.00 0.37 1.00 0.33 1.00 1.00 Arg/Gly (n 16) 7.9 4.0 63 31 31 19 50 56 56 38 13 13 44 13 31 56 p Value 0.45 0.46 0.21 0.30 0.93 0.80 0.77 0.75 0.41 0.25 0.05 0.44 0.31 0.24 0.96

*Values are given as the mean SD or %. NHLBI National Heart, Lung and Blood Institute. Comparison of Gly/Gly genotype to grouped sample of Arg/Arg and Arg/Gly genotype populations. Comparison of Gly/Gly genotype to Arg/Arg genotype populations. Comparison of all three genotype populations.

lyzed using a statistical software package (JMP, version 6.0.2; SAS Institute; Cary, NC) in collaboration with consultants from the University of Connecticut Health Centers General Clinical Research Center. Results are reported as mean SD or as frequency (%).

Results Patient Characteristics During the study period, 149 children were admitted to the hospital ICU for a severe asthma exacerbation. The parents of 90 of these children could be contacted by mail and telephone, and 37 of them consented to enroll their child in this study. At amino acid position 16 of the 2-AR gene, 13 (35%) children were homozygous for Gly (Gly/Gly), 8 (22%) were homozygous for arginine (Arg/Arg), and 16 (43%) were heterozygous (Arg/Gly). At amino acid position 27 of the 2-AR gene, 16 children (43%) were homozygous for Gln (Gln/Gln), 5 children (14%) were homozygous for Glu (Glu/Glu), and 16 children (43%) were heterozygous (Glu/Gln). Six haplotypes were present in this cohort. The most common haplotype was Arg/Gly-Glu/Gln (n 10, 27%), followed by Arg/Arg-Gln/Gln (n 9, 24%), Gly/Gly-Glu/Gln (n 6, 16%), Gly/Gly-Glu/ Glu (n 5, 14%), Arg/Gly-Gln/Gln (n 5, 14%), and Gly/Gly-Gln/Gln (n 2, 5%). Outcomes Children with the Gly/Gly genotype at amino acid position 16 of the 2-AR were more likely to have
1188

intermittent asthma exacerbations than those with either the Arg/Arg or Arg/Gly genotypes. Otherwise, no statistically significant differences were found in the demographics, baseline characteristics, or medical history between these two patient groups (Table 1). No differences were found in admission MPIS among the study groups; however, despite similar illness severity on hospital admission, children with the Gly/Gly genotype had significantly shorter hospital ICU length of stay, duration of continuously nebulized albuterol therapy, and duration of supplemental oxygen therapy and were significantly less likely to require IV 2-AR therapy than those with Arg/Arg or Arg/Gly genotypes (Table 2 and Fig 1). In addition to these grouped comparisons, we also compared the clinical characteristics and outcome variables by individual genotypes at amino acid position 16 (Tables 1 and 2). When comparing the clinical outcomes of the children with the Gly/Gly genotype to those with the Arg/Arg genotype, the Gly/Gly group had significantly shorter duration of continuous albuterol therapy (Table 2). When comparing clinical outcomes of the children with the Gly/Gly, Arg/Arg, and Arg/Gly genotypes, significant differences were found in the duration of continuous albuterol therapy and hospital ICU length of stays among these groups (Table 2). No other statistically significant differences were found in clinical characteristics or outcomes among the groups (Tables 1 and 2). Genetic polymorphisms at amino acid position 27 were not associated with response to 2-AR agonist therapy or with the other clinical outcomes measured.
Original Research

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

Table 2Hospital and Outcome Data According to 2-AR Genotype at Amino Acid Position 16*
Variables Admission MPIS ICU length of stay, h Types of therapy received, % IV 2-AR Intubation Duration of therapies Continuous albuterol, d Oxygen, d IV corticosteroids, d IV 2-AR, h Gly/Gly (n 13) 14 2 43 25 31 0 3.0 0.9 3.5 1.6 3.2 1.4 38 22 Arg/Gly or Arg/Arg (n 24) 14 2 74 34 71 8 4.8 1.9 4.8 1.8 4.5 1.7 64 34 p Value 0.58 0.009 0.036 0.53 0.002 0.04 0.02 0.22 Arg/Arg (n 8) 15 2 70 31 75 13 5.1 2.5 4.8 2.3 4.5 1.9 63 22 p Value 0.06 0.08 0.08 0.38 0.03 0.13 0.06 0.22 Arg/Gly (n 16) 14 1 75 36 69 6 4.7 1.7 4.8 1.7 4.5 1.7 64 39 p Value 0.11 0.03 0.06 0.46 0.009 0.11 0.07 0.44

*Values are given as the mean SD, unless otherwise indicated. Comparison of Gly/Gly genotype to grouped sample of Arg/Arg and Arg/Gly genotype populations. Comparison of Gly/Gly genotype to Arg/Arg genotype populations. Comparison of all three genotype populations.

Haplotypes of the 2-AR also were not associated with clinical characteristics or outcomes measured. To identify significant predictors of duration of continuous albuterol therapy and hospital ICU length of stay, stepwise multiple regressions were performed using key variables, including 2-AR genotype, age, gender, obesity, intermittent asthma classification, and admission MPIS. In these models, Gly/Gly genotype and female gender were associated with decreased duration of continuous albuterol therapy and hospital ICU length of stay; however, the Gly/ Gly genotype had a stronger relationship to these outcomes than did gender (Table 3). Discussion In this cohort of children with severe asthma exacerbations, the children whose genotypes were homozygous for the 2-AR genotype were associated with a response to short-term high-dose 2-AR agonist therapy. Specifically, children homozygous

Figure 1. Kaplan-Meier curve of time to discharge from the hospital ICU for children with Arg/Gly or Arg/Arg genotypes and children with Gly/Gly genotypes (p 0.006 by log-rank test).
www.chestjournal.org

for the Gly allele at amino acid position 16 had significantly shorter durations of continuously nebulized 2-AR agonist therapy and shorter hospital ICU length of stays when compared to the rest of the cohort and treated according to a goal-directed protocol. Knowledge of this genotype could significantly affect treatment selection for severe asthma exacerbations in children. The relationship between 2-AR genotypes and response to 2-AR agonist therapy is controversial. Some studies10 17 have found that the Arg/Arg genotype is associated with reduced response to 2-AR agonists, whereas others1720 have found that the Gly/Gly genotype is associated with reduced response. This difference may be partly due to the use of different types of 2-AR agonist therapy. The influence of 2-AR genotype appears to vary, depending on whether the child receives short-term, singledose therapy or long-term, recurrent therapy. Children with severe asthma exacerbations, however, routinely receive very high doses of 2-AR agonist therapy for relatively long durations. Examining the pharmacogenetics in this population may provide potentially different results than found in the populations previously studied. When examining the influence of 2-AR genotype on response to short-term, single-dose 2-AR agonist therapy, the Gly/Gly genotype has been more strongly associated with reduced response.1720 Martinez18 examined the bronchodilating effect of single-dose albuterol administration in children. Children with the Gly/Gly genotype had significantly diminished bronchodilator response than children with the Arg/ Arg genotype at amino acid position 16 of the 2-AR gene. Kotani19 and Lima20 reported similar results. However, when examining the influence of 2-AR genotype on the response to long-term and repeated
CHEST / 135 / 5 / MAY, 2009

1189

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

Table 3Multiple Regression Analysis of Univariate Factors Influencing ICU Length of Stay
Factor Gly/Gly genotype Age Obesity Gender Intermittent asthma MPIS Unstandardized Regression Coefficient 30.6 0.1 6.2 26.6 2.9 0.7 95% Confidence Interval for Regression Coefficient 54.2 to 6.9 2.5 to 2.7 18.2 to 30.5 47.0 to 6.3 20.9 to 26.7 5.8 to 7.3 Standardized Regression Coefficient 0.438 0.013 0.079 0.398 0.039 0.035 p Value 0.015 0.933 0.616 0.014 0.810 0.826

dosages of 2-AR agonist therapy, the Arg/Arg genotype has been more closely associated with reduced response.10 17 In a study by Israel et al,13 190 adult patients with mild asthma were given regular inhaled 2-AR agonist treatments. The patients with the Arg/Arg genotype experienced a decline in morning peak flow rates relative to those with the Gly/Gly genotype. In a follow-up study by Taylor et al,14 patients with the Arg/Arg genotype were found to have an increased number of asthma exacerbations while receiving regular, short-acting inhaled 2-AR agonist therapy. Israel et al15 then conducted a prospective, randomized, double-blinded, placebocontrolled, genotype-stratified trial of a short-acting inhaled 2-agonist vs placebo for the regular treatment of adult patients with asthma. The patients with the Gly/Gly genotype had improved morning peak flow rates with regularly scheduled albuterol, whereas the patients with the Arg/Arg genotype had worsened morning peak flow rates. Palmer et al16 duplicated these findings in a cohort of 546 children. Our findings are similar to those of other studies10 17 of long-term, repeated 2-AR agonist therapy. In both populations (patients receiving longterm 2-AR agonist therapy and children receiving short-term high-dose therapy), the Gly/Gly genotype was associated with improved response to 2-AR agonist therapy. It is possible that tachyphylaxis to 2-AR agonist therapy may have contributed to decreased response to therapy in children and adults with other genotypic subtypes. In studies by Telleria et al21 and Lee et al,22 adults with the Arg allele of the 2-AR gene had increased tachyphylaxis to 2-AR agonist therapy. If children with the Gly/Gly genotype had less tachyphylaxis to high-dose 2-AR agonist therapy while in the hospital ICU, this may have led to the improved response seen in our study. Martin et al23 conducted the only previous study to have examined the effect of genotype during acute asthma exacerbations in children. They evaluated 2-AR genotypes of 148 children who presented to the emergency department with acute asthma. They found that the Glu/Glu genotype at amino acid position 27 was associated with rapidity of clinical
1190

improvement; however, genotype at amino acid position 16 was not in their study. Several possible explanations exist for the differing results between our studies. First, Martin et al included all children presenting with acute asthma exacerbations, whereas our population included only children who were severely ill, had been admitted to the hospital ICU, and were treated with continuous and high doses of 2-AR agonist therapy. In addition, the children in the Martin et al study were treated based on subjective physician preferences; thus, treatment variations may have influenced rates of clinical improvement. Racial and ethnic differences also may have played a role in the relationship of 2-AR polymorphisms and asthma; however, studies29 32 have found conflicting results in different populations. Additionally, the use of a variety of outcome measures makes comparisons between studies difficult. In AfricanAmerican children with asthma, Elbahlawan et al29 found that polymorphisms at amino acid position 27 were linked more closely to clinical outcomes than polymorphisms at amino acid position 16. Additionally, in the larger adult and pediatric Study of African Americans, Asthma, Genes Environments, Tsai et al30 reported that polymorphisms at amino acid position 19 and not at position 16 were associated with baseline pulmonary function. Within Hispanic patient populations, the Tucson Childrens Respiratory Study31 found that the frequency of 2-AR genotypes differed significantly by ethnicity, with the Glu allele at amino acid position 27 being significantly less common in Hispanic children than white children with asthma. Finally, within a cohort of Hispanic children and adults with asthma, Choudhry et al32 reported that in Puerto Rican patients, the Arg allele at amino acid position 16 was associated with greater bronchodilator response compared to Mexican patients. These findings support the importance of examining genetic factors in different racial and ethnic populations. Several limitations exist in our retrospective study. The sample size was small, and enrollment of eligible patients was relatively low; both factors potentially limit the generalizability of our findings. In addition,
Original Research

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

lack of statistical significance for some outcomes may have been due to insufficient power. However, a strength of our study was the treatment protocol used for all patients. The 2-AR agonist therapy and responses were assessed hourly, and treatment was adjusted based on a validated measure of illness severity. Previously,25 we have shown that this protocol significantly decreases variation in therapy. Use of treatment guidelines at our institution may have reduced the noise of the treatment variation, allowing the treatment effects of 2-AR polymorphisms to be observed. This study builds on our previous work26 to establish phenotypes of severe asthma exacerbations in children. Establishing appropriate phenotypes is a crucial first step before attempting to link genotypes to phenotypes in a particular population of patients. In this previous population of children,26 we identified a group of children who were slow responders to IV 2-AR agonist therapy. In this population of children admitted to the hospital ICU with a severe asthma exacerbation, we noted that a significant proportion had a slow response to 2-AR agonist therapy. The etiology of this slow response likely was multifactorial; however, we suspected the importance of genetic influences in this population. The current study links genetic polymorphisms to that previously identified phenotype. Conclusions We found that the Gly/Gly genotype of 2-AR was associated with improved response to highdose 2-AR agonist therapy in children with severe asthma exacerbations. This finding suggests that pharmacogenetics may allow for evidence-based therapy in this population. References
1 McFadden ER Jr. Acute severe asthma. Am J Respir Crit Care Med 2003; 168:740 759 2 Romagnoli M, Caramori G, Braccioni F, et al. Near-fatal asthma phenotype in the ENFUMOSA cohort. Clin Exp Allergy 2007; 37:552557 3 Pendergraft TB, Stanford RH, Beasley R, et al. Rates and characteristics of intensive care unit admissions and intubations among asthma-related hospitalizations. Ann Allergy Asthma Immunol 2004; 93:29 35 4 McCormick MC, Kass B, Elixhauser A, et al. Annual report on access to and utilization of health care for children and youth in the United States: 1999. Pediatrics 2000; 105:219 230 5 DeFrances CJ, Podgornik MN. 2004 National Hospital Discharge Survey. Adv Data 2006; 371:119 6 Werner HA. Status asthmaticus in children. Chest 2001; 119:19131929 7 Baren JM, Zorc JJ. Contemporary approach to the emergency department management of pediatric asthma. Emerg Med Clin North Am 2002; 20:115138
www.chestjournal.org

8 Smith SR, Strunk RC. Acute asthma in the pediatric emergency department. Emerg Med 1999; 46:11451165 9 Reihsaus E, Innis M, MacIntyre N, et al. Mutations in the gene encoding for the 2-adrenergic receptor in normal and asthmatic subjects. Am J Respir Cell Mol Biol 1993; 8:334 339 10 Taylor DR, Epton MJ, Kennedy MA, et al. Bronchodilator response in relation to 2-adrenoceptor haplotype in patients with asthma. Am J Respir Crit Care Med 2005; 172:700 703 11 Lipworth BJ, Hall IP, Tan S, et al. Effects of genetic polymorphism on ex vivo and in vivo function of the 2-adrenoceptors in asthmatic patients. Chest 1999; 115:324 328 12 Drysdale CM, McGraw DW, Stack CB, et al. Complex promoter and coding region 2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness. Proc Natl Acad Sci U S A 2000; 97:10483 10488 13 Israel E, Drazen JM, Liggett SB, et al. The effect of polymorphisms of the 2-adrenergic receptor on the response to regular use of albuterol in asthma. Am J Respir Crit Care Med 2000; 162:75 80 14 Taylor DR, Drazen JM, Herbison GP, et al. Asthma exacerbations during long term -agonist use: influence of 2-adrenoceptor polymorphism. Thorax 2000; 55:762767 15 Israel E, Chinchilli VM, Ford JG, et al. Use of regularly scheduled albuterol treatment in asthma: genotype-stratified, randomised, placebo-controlled cross-over trial. Lancet 2004; 364:15051512 16 Palmer CAN, Lipworth BJ, Lee S, et al. Arginine-16 2 adrenoceptor genotype predisposes to exacerbations in young asthmatics taking regular salmeterol. Thorax 2006; 61:940 944 17 Contopoulos-Ioannidis DG, Manoli EN, Ioannidis JP. Metaanalysis of the association of 2-adrenergic receptor polymorphisms with asthma phenotypes. J Allergy Clin Immunol 2005; 115:963972 18 Martinez FD, Graves PE, Baldini M, et al. Association between genetic polymorphisms of the 2-adrenoceptor and response to albuterol in children with and without a history of wheezing. J Clin Invest 1997; 100:3184 3188 19 Kotani Y, Nishimura Y, Maeda H, et al. 2-adrenergic receptor polymorphisms affect airway responsiveness to salbutamol in asthmatics. J Asthma 1999; 36:583590 20 Lima JJ, Thomason DB, Mohamed MH, et al. Impact of genetic polymorphisms of the 2-adrenergic receptor on albuterol bronchodilator pharmacodynamics. Clin Pharmacol Ther 1999; 65:519 525 21 Telleria JJ, Blanco-Quiros A, Muntion S, et al. Tachyphylaxis to 2-agonists in Spanish asthmatic patients could be modulated by 2-adrenoceptor gene polymorphisms. Respir Med 2006; 100:10721078 22 Lee DK, Currie GP, Hall IP, et al. The arginine-16 2-adrenoceptor polymorphism predisposes to bronchoprotective subsensitivity in patients treated with formoterol and salmeterol. Br J Clin Pharmacol 2004; 57:68 75 23 Martin AC, Zhang G, Rueter K, et al. 2-adrenoceptor polymorphisms predict response to 2-agonists in children with acute asthma. J Asthma 2008; 45:383388 24 Carroll CL, Sekaran AK, Lerer TJ, et al. A modified pulmonary index score with predictive value for pediatric asthma exacerbations. Ann Allergy Asthma Immunol 2005; 94:355359 25 Carroll CL, Schramm CM. Protocol-based titration of intravenous terbutaline decreases length of stay in pediatric status asthmaticus. Pediatr Pulmonol 2006; 41:350 356 26 Carroll CL, Schramm CM, Zucker AR. Slow-responders to IV
CHEST / 135 / 5 / MAY, 2009

1191

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014

2-adrenergic receptor agonist therapy: defining a novel phenotype in pediatric status asthmaticus. Pediatr Pulmonol 2008; 43:627 633 27 National Asthma Education and Prevention Program. Expert panel report 3: guidelines for the diagnosis and management of asthma. Bethesda, MD: National Heart, Lung and Blood Institute, 2007; NIH publication No. 07 4051 28 Kuczmarski RJ, Ogden CL, Grummer-Strawn LM, et al. CDC growth charts: United States. Adv Data 2000; 127 29 Elbahlawan L, Binaei S, Christensen ML, et al. 2-adrenergic receptor polymorphisms in African-American children with status asthmaticus. Pediatr Crit Care 2006; 7:1518

30 Tsai HJ, Shaikh N, Kho JY, et al. 2-adrenergic receptor polymorphisms: pharmacogenetic response to bronchodilator among African American asthmatics. Hum Genet 2006; 119: 547557 31 Guerra S, Graves PE, Morgan WJ, et al. Relation of 2-adrenoceptor polymorphisms at codon 16 and 27 to persistence of asthma symptoms after the onset of puberty. Chest 2005; 128:609 617 32 Choudhry S, Ung N, Avilia PC, et al. Pharmacogenetic differences in response to albuterol between Puerto Ricans and Mexicans with asthma. Am J Respir Crit Care Med 2005; 171:563570

1192

Original Research

Downloaded From: http://journal.publications.chestnet.org/ on 03/17/2014