Sie sind auf Seite 1von 24

REPLICACIN DE ADN

La primera pregunta:
semiconservativa o conservativa?
Experimento de Meselson y Stahl
Replicacin semiconservativa
La copia de DNA original fue marcada con N15 (istopo pesado).
Este DNA entr a una ronda de replicacin con N14 y despus la mezcla fue centrifugada de tal
manera que el DNA pesado (2 hebras N15) formara una banda ms baja en el tubo, el DNA
intermedio(una hebra N15 y una hebra N14) una banda ms ligera y ms arriba en el tubo y el DNA
ligero (N14) formara una banda ms arriba de las dos anteriores).
Los resultados esperados para cada modelo:
Conservativa: Despus de una generacin una banda pesada y una banda ligera, el resultado no
cambia despus de varias generaciones.
Semiconservativa: Despus de una generacin una sola banda intermedia, despus de varais
generaciones, una banda ligera y una banda intermedia.
La replicacin del ADN produce una copia de s
mismo por medio de enzimas. El mecanismo
de replicacin es esencialmente el mismo en
todas las clulas.
Es un proceso semiconservativo porque cada uno
de los dos ADN hijos tiene una cadena del
ADN anterior.
Cada una de las dos molculas hijas contiene la
mitad de la molcula madre. Este tipo de
duplicacin semiconservativa se puede realizar
porque la secuencia de las bases que la
constituyen ha sido conservada, de forma que la
secuencia de cada molcula madre sirve de
molde para formar la secuencia de las dos
molculas hijas.
El proceso tiene 3 fases bien diferenciadas:
Iniciacin, Elongacin y Terminacin.
EL DNA se replica desenrollando la hlice y
rompiendo los puentes de hidrgeno entre las
hebras complementarias.
La replicacin comienza en sitios especficos
u orgen de replicacin
Procariontes: Un origen de replicacin
Eucariontes: Mltiples orgenes de
replicacin.
La replicacin es bidireccional a partir del
origen de replicacin
Bidirectional Circular DNA Replication in Bacteria
Sitios de origen de la replicacin
Genoma circular
1 sitio origen
de la replicacin
Genoma lineal
varios sitios origen
de la replicacin
La iniciacin de la replicacin del ADN comienza siempre en una
secuencia especfica de nucletidos conocida como origen de
replicacin, en el que hay un gran contenido de adenina y
timina.
Requiere una serie de protenas iniciadoras especiales (protenas
desestabilizadoras de la hlice) y enzimas conocidas como
helicasas, que rompen los puentes de hidrgeno abriendo la
hlice, formndose las horquillas de replicacin, una a cada
lado de la burbuja a que da lugar la separacin de las ramas del
ADN.
Iniciacin
Para iniciar la replicacin se requieren enzimas
desenrrolladoras llamadas helicasas y as se
forman las horquillas de replicacin (replication
forks)
Una vez abierta la cadena de ADN se unen otras protenas y
enzimas adicionales:
Protenas SSB (protenas de unin a cadena)
No permiten que el ADN se vuelva a naturalizar o
forme estructuras secundarias.
Las enzimas topoisomerasa evitan que se retuerzan y formen
superenrrollamientos cortando una o ambas hebras del ADN
alivindolos
Replicacin de ADN. Durante la
Iniciacin de la replicacin, la
doble hlice de ADN se abre por
accin de una helicasa. A
continuacin, una molcula de
ADN polimerasa se une a una de
las hebras de ADN. Se mueve
recorriendo la hebra usndola
como molde para ir sintetizando
la cadena lder (en rojo),
aadiendo nucletidos y
recomponiendo la doble hlice
Elongacin
En el siguiente paso, las enzimas llamadas ADN
polimerasas catalizan la sntesis real de las nuevas
cadenas aadiendo nucletidos sobre el molde.
La ADN polimerasa sintetiza las nuevas cadenas,
complementarias a cada una de las cadenas primitivas,
pero slo es capaz de sintetizar nuevo ADN en sentido 5
3 partiendo de un ARN corto especfico llamado
ARN cebador -molcula formada por nucletidos de
ARN catalizados por ARN primasas.
Durante la sntesis, en cada horquilla de replicacin, se van
formando dos copias nuevas, sobre cada una de las dos
hebras de ADN que se separaron en la fase de iniciacin.
Cuando una ADN polimerasa hace contacto con el
extremo de otro fragmento de Okazaki contiguo el
ARN cebador de este es eliminado y otra enzima, la
ADN ligasa, conecta los dos fragmentos de Okazaki
de ADN recin sintetizado, catalizando las reacciones
de condensacin que unen los grupos fosfato y azcar
de los nucletidos contiguos y as, una vez unidos
todos los fragmentos de Okazaki se completa la doble
hlice de ADN.
Terminacin
Replicacin
AGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCT
TCGAATCGGATTCGAATCGGATTCGAATCGGATTCGAATCGGA
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
5
5
3
3
TCGAATCGGATTCGAATCGGATTCGAATCGGATTCGAATCGGA
5 3
AGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCT
5
3
TCGAATCGGATTCGAATCGGATTCGAATCGGATTCGAATCGGA
5 3
AGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCT
5
3
5
3 AGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCTAAGCTTAGCCU
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
UCGAATCGGATTCGAATCGGATTCGAATCGGATTCGAATCGGA
5 3
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I
DNA
Separacin de
las cadenas
Replicacin
DNA RNAm Polip
Templado 1
Templado 2
DNA polimerasa III no puede empezar de cero, necesita un
Extremo OH libre en donde unir el primer nucletido, por
Eso se requiere un primer de RNA (Primasa).
Lectura 3-5
Sntesis 5-3
Adelaida Camitjana
Entonces, hay una hebra lder y una hebra retrasada
Una vez terminada la copia del DNA, se
deben remover los pedazos de RNA (DNA
pol I) y unir toda la cadena (Ligasa).
En la copia puede haber errores
(mutaciones) que en general son corregidas
simultneamente por la DNA pol III.
A T C G A A C C G T T G C A C C G T T G C A C
U A G C T T G G C A A C G T G
Sntesis continua de la cadena 5 -3
Sntesis continua de la cadena en direccin 5'3'. La sntesis de esta cadena no plantea ningn
problema. As, una vez separadas ambas cadenas, se sintetiza el primer y la ADN pol. III (una de las
enzimas que unen los nucletidos) va a elongar la cadena en direccin 5'3'.
A T C G A A C C G T T G C A C C G T T G C
T A G C T U G G C A A C G T G
Sntesis discontinua de la cadena 3 -5
A A C C C G G T
Sntesis discontinua. La cadena complementaria no se va a replicar en sentido 3'5' sino que se
replica discontinuamente en direccin 5'3'. Primero se sintetiza el primer (ARN) y posteriormente
este se elonga con ADN. El ARN es posteriormente eliminado y los diferentes fragmentos sintetizados,
llamados fragmentos de Okazaki, son unidos entre s.
Enzima Accin Funcin en la
clula
DNA polimerasa I
Aade nucletidos a la
molcula de DNA en
formacin. Remueve
primers de RNA
Llena huecos en el DNA,
fundamentalmente para
reparacin. Remueve
primers de RNA.
DNA polimerasa III
Aade nucletidos a la
molcula de DNA en
formacin. Revisa la
seecuencia y corrige
Replica DNA
DNA girasa
(topoisomerasa II)
Promueve
superenrrolamiento
Mantiene la
compactacin del DNA
DNA helicasa
Se une al DNA cerca de
la horquilla de
replicacin
Promueve la separacin
de las hebras de DNA
Topoisomerasa I
Relaja el DNA super
enrollado
Mantiene el nivel
adecuado de
enrollamiento
Primasa
Hace cadenas pequeas
de RNA unsando DNA
como molde
Se necesita para que la
DNA polimerasa replique
la hebra retrasada