JOURNAL OF CLINICAL MICROBIOLOGY, May 2005, p. 20472052 0095-1137/05/$08.000 doi:10.1128/JCM.43.5.20472052.2005 Copyright 2005, American Society for Microbiology.

. All Rights Reserved.

Vol. 43, No. 5

Consensus Sequence-Based Scheme for Epidemiological Typing of Clinical and Environmental Isolates of Legionella pneumophila
Valeria Gaia,1 Norman K. Fry,2* Baharak Afshar,2 P. Christian Lu ck,3 He le `ne Meugnier,4 4 1 Jerome Etienne, Raffaele Peduzzi, and Timothy G. Harrison2
Istituto Cantonale di Microbiologia, Bellinzona, Switzerland1; Health Protection Agency, Respiratory and Systemic Infection Laboratory, Centre for Infections, London, United Kingdom2; Institute of Clinical Microbiology and Hygiene, Dresden, Germany3; and Centre National de Re fe rence des Le gionelles, INSERM E0230, Faculte de Me decine Laennec, IFR62, Lyon, France4
Received 8 October 2004/Returned for modication 26 November 2004/Accepted 30 December 2004

A previously described sequence-based epidemiological typing method for clinical and environmental isolates of Legionella pneumophila serogroup 1 was extended by the investigation of three additional gene targets and modication of one of the previous targets. Excellent typeability, reproducibility, and epidemiological concordance were determined for isolates belonging to both serogroup 1 and the other serogroups investigated. Gene fragments were amplied from genomic DNA, and PCR amplicons were sequenced by using forward and reverse primers. Consensus sequences are entered into an online database, which allows the assignment of individual allele numbers. The resulting sequence-based type or allelic prole comprises a string of the individual allele numbers separated by commas, e.g., 1,4,3,1,1,1, in a predetermined order, i.e., aA, pilE, asd, mip, mompS, and proA. The index of discrimination (D) obtained with these six loci was calculated following analysis of a panel of 79 unrelated clinical isolates. A D value of >0.94 was obtained, and this value appears to be sufcient for use in the epidemiological investigation of outbreaks caused by L. pneumophila. The D value rose to 0.98 when the results of the analysis were combined with those of monoclonal antibody subgrouping. Sequence-based typing of L. pneumophila is epidemiologically concordant and discriminatory, and the data are easily transportable. This consensus method will assist in the epidemiological investigation of L. pneumophila infections, especially travel-associated cases, by which it will allow a rapid comparison of isolates obtained in more than one country. Many phenotypic and genotypic methods have been applied to the epidemiological typing of Legionella pneumophila (4, 12, 15, 21, 23, 28, 29, 3436), the principal cause of the majority of cases of legionellosis (22). Members of The European Working Group for Legionella Infections (EWGLI) have previously evaluated a number of genotypic methods for the epidemiological typing of L. pneumophila, which is particularly applicable to cases of travel-associated legionellosis. The aim of such studies has been to achieve a standardized protocol that allows the exchange of typing data rather than strains across countries and borders, the latter of which is increasingly difcult, costly, and time-consuming (810). One of these methods, a singleendonuclease, amplied fragment length polymorphism analysis method by which the patterns are resolved by standard agarose electrophoresis (8, 34), was adopted as an international standard (9) and is widely used by the members of EWGLI. However, while this method allows relatively rapid screening of isolates within a single laboratory, interlaboratory results from comparison of the proles contained in a webenabled identication library database revealed that a signicant proportion of laboratories could not achieve correct identication 100% of the time (8; B. Afshar, N. K. Fry, and T. G. Harrison, Abstr. 19th Annu. Meet. Eur. Working Group Legionella Infections, Chamonix, France, 2004). Therefore, we sought to develop a simple, rapid, and discriminatory typing method which would be truly portable to aid with the investigation of legionellosis and characterization of L. pneumophila isolates. The advantages of using a multilocus sequence typing approach with nonselective housekeeping genes have been well documented (http://www.mlst.net) (6, 7, 32, 33). A previous study (11) with L. pneumophila used a similar approach, termed sequence-based typing, to investigate four gene targets likely to be selectively neutral, acn (26), groES and groEL (18, 27), and recA (37), and three likely to be under selective pressure, aA (17), proA (2), and mompS (11) (E. Cristoph and W. Ehret, unpublished data). The authors found that a combination of just three of the selective targets, aA, proA, and mompS, produced sufcient discrimination to allow epidemiological typing of L. pneumophila serogroup (sg) 1. In the present study, the asd, mip, and pilE genes, which encode the L. pneumophila aspartate--semialdehyde dehydrogenase (14), macrophage infectivity potentiator protein (5), and type IV pilin (31), respectively, were investigated,. The aims of this study were to (i) seek to improve the level of discrimination by investigation of the additional genes, asd, mip, and pilE, and to modify the protocol for one of the previous gene targets (mompS) and (ii) formally describe a consensus sequence-based epidemiological typing scheme and establish an online database which would allow the ready characterization of clinical and environmental isolates of L. pneumophila.
2047

* Corresponding author. Mailing address: Health Protection Agency, Respiratory and Systemic Infection Laboratory, Centre for Infections, 61 Colindale Avenue, London NW9 5HT, United Kingdom. Phone: 44 (0)20 8327 6776. Fax: 44 (0)20 8205 6528. E-mail: Norman.Fry@HPA.org.uk.

2048

GAIA ET AL. TABLE 1. Oligonucleotide primers used in this study

J. CLIN. MICROBIOL.

Primer name

Sequence (53)

Gene

GenBank-accession no. of reference sequence

Positionsa

Reference

asd-487F asd-1039R aA-619F aA-846R mip-58F mip-595R mompS-492F mompS-1015R mompS-1116R pilE-12F pilE-453R proA-1090F proA-1553R
a

CCCTAATTGCTCTACCATTCAGATG CGAATGTTATCTGCGACTATCCAC TTTCTCTGGCGCAAGCTTCC GCTGCTTTGGCATAGGCAG GCTGCAACCGATGCCAC CATATGCAAGACCTGAGGGAAC GACATCAATGTGAACTGG CAGAAGCTGCGAAATCAG TGGATAAATTATCCAGCCGGACTTC CACAATCGGATGGAACACAAACTA GCTGGCGCACTCGGTATCT GATCGCCAATGCAATTAG ACCATAACATCAAAAGCC

asd asd aA aA mip mip mompS mompS mompS pilE pilE proA proA

AF034213 AF034213 X83232 X83232 AJ496265 AJ496265 AF078136 AF078136 AF078136 AF048690 AF048690 M31884 M31884

487511 10391062 619638 846864 5874 595616 492509 10321015 11161140 1235 453471 10901107 15531570

This This 11 11 This This 11 11 This This This 11 11

study study study study study study study

The positions of all primers are according to the numbering of the reference sequence.

MATERIALS AND METHODS Participants. Four institutes took part in the study. Each of the institutes acts as a national reference laboratory for legionella infections: (i) Istituto Cantonale di Microbiologia, Bellinzona, Switzerland; (ii) Institute of Clinical Microbiology and Hygiene, Dresden, Germany; (iii) Centre National de Re fe rence des Le gionelles, INSERM E0230, Faculte de Me decine Laennec, IFR62, Lyon, France; and (iv) Health Protection Agency, Respiratory and Systemic Infection Laboratory, Centre for Infections, London, United Kingdom. The study was coordinated by the Health Protection Agency, Respiratory and Systemic Infection Laboratory, Centre for Infections. Bacterial strains. A total of 105 clinical and environmental isolates of L. pneumophila were analyzed, including 96 L. pneumophila sg 1 isolates and 9 L. pneumophila isolates from other serogroups. Ninety-ve of the L. pneumophila sg 1 isolates from nine European countries were selected to produce one epidemiologically unrelated panel of 79 clinical isolates (panel 1), one epidemiologically related panel of 16 isolates (panel 2), and one stability panel of ve isolates (panel 3). Each of these isolates was obtained from the EWGLI Legionella culture collection and has a unique number (European Union Legionella culture collection number; see http://www.ewgli.org). This collection of isolates was established by members of the EWGLI to facilitate epidemiological typing studies. Each isolate has previously been extensively characterized, and details for these isolates have been described previously (811). The epidemiologically related panel (panel 2) comprised ve sets of epidemiologically related isolates and two replicates of the same isolate. The stability panel (panel 3) comprised ve variants of the same strain. A number of clinical and environmental non-sg 1 isolates of L. pneumophila recovered during the course of outbreak investigations were also investigated, including some belonging to sg 6 (n 2), sg 8 (n 2), and sg 10 (n 2), together with a number of reference strains for sg 1 (3), sg 6 (16, 24), sg 8 (1), and sg 10 (25) obtained from the National Collection of Type Cultures, London, United Kingdom. Strategy. Six gene targets were investigated, asd, aA, mip, mompS, pilE, and proA. Preliminary data have previously been described for aA, proA, and mompS (11). For this study, evaluation was undertaken as outlined in the Consensus Guidelines of the European Study Group on Epidemiological Markers (32) and previous studies (811). Typeability (T) was calculated as the proportion of isolates assigned to a type by sequencing of each target gene. Reproducibility (R) was calculated by analysis of two to six loci from the 16 panel 2 isolates in at least two centers by using a number of different conditions (including the use of reagents from different manufacturers) for DNA extraction, PCR, and DNA sequencing. Epidemiological concordance (E) was expressed as the number of epidemiologically related sets of strains found to be indistinguishable by the typing system divided by the total number of such sets in the panel. Estimates of the indices of discriminatory power (D) were determined by using Hunter and Gastons (20) modication of Simpsons index of diversity (30, 32). If the sample consists of completely unique subtypes, then the value of the indices is 1 (maximum value), while a value of 0 (minimum value) occurs when all isolates have an identical subtype. Due to the sampling process, the calculated diversity indices are estimates of the unknown true value for the population from which the sample was taken. Therefore, condence intervals were calculated to convey the

precision about these point estimates by using the formula below, originally described by Simpson (30): 4 N

n 3 i1

xi N

i1

xi N

where is the standard deviation, N is the total number of isolates, and xi is the number of isolates in the ith category. Approximate 95% condence intervals (CIs) were then calculated by using the usual formula: 95% CI D 1.96 2, D 1.96 2 Individual, combined D values and 95% condence intervals were calculated by using the allelic proles of the isolates analyzed in this study (as described below), together with data from aA, proA, and monoclonal antibody (MAb) subgrouping results from previous studies (8, 10, 11). The stability of each gene was assessed by analysis of the ve variants of the same strain (panel 3). Sequence-based typing was performed essentially as described previously (11), with the following modications and additions. Since the previous study, optimization of the amplication and sequencing conditions for the mompS gene target have resulted in improved sequence quality. Therefore, these new conditions were used in this study. Three new gene targets, asd, mip, and pilE, were also investigated. DNA extraction, PCR amplication, and DNA sequencing. Genomic DNA was extracted as described previously (11) or by emulsifying two colonies of L. pneumophila in 0.5 ml sterile water and heating for 8 min at 100C. Oligonucleotide primers targeting regions of each of the genes were used to amplify 245- to 648-bp products encompassing regions of variation (Table 1). The same primers were used for amplication and sequencing of all targets except mompS (amplication primers, mompS-492F and mompS-1116R; sequencing primers, mompS492F and mompS-1015R). Amplication by PCR was performed as described previously (11) or with 5 to 10 l lysate. Amplication was performed by using the following conditions: 35 cycles of denaturation for 30 s at 94C; annealing for 30 s at 50C (for aA, mompS, and proA), 55C (for pilE), 60C (for mip), or 62C (for asd); and elongation for 30 s at 72C. In order to establish whether the same program (annealing temperature) could be used for the primary amplication of all loci, a range of annealing temperatures, 50 to 65C (for all loci), was evaluated by visualization of the primary amplicons, together with analysis of the sequence data generated from these amplicons. Purication of amplicons was performed as described previously (11) or with Montage PCR96 lter plates (Millipore). The sequencing products were analyzed as described above or on a model 3730XL ABI DNA sequencer (Applied Biosystems), following the instructions supplied by the manufacturer. Sequence analysis. Sequence analyses were performed locally by using the programs described previously and Chromas (Technelysium Pty Ltd., Australia; http://www.technelysium.com.au), Readseq, SeaView (13), Sequencher (Gene Codes Corporation), Autoassembler, or Sequence navigator (Applied Biosystems). For all analyses the data obtained with the forward and reverse sequencing primers were combined and aligned manually to produce a consensus se-

VOL. 43, 2005

SEQUENCE-BASED TYPING OF LEGIONELLA PNEUMOPHILA TABLE 2. Sequence variation in genes in L. pneumophila

2049

Gene

Fragment size (bp) of amplied product

Size (nucleotides) of region used to determine allele type

Region used for allele assignmenta

No. of allele types

No. of variable sites

% Sequence variation

asd aA mip mompS pilE proA

a

575 245 558 648 459 480

473 182 402 352 333 405

5381010 653749 117518 5231010 103435 11341230

13 11 13 16 10 15

35 23 12 43 46 32

7.4 12.6 3.0 12.2 13.8 7.9

With respect to the reference sequence (see Table 3).

quence. Consensus sequences trimmed to the correct length were then identied by comparison with the sequences of preexisting alleles by using online tools. Chromatogram traces from putative novel allele types were submitted to the coordinating center for verication. The genes, the reference sequences, the fragment sizes of the primary PCR products and regions used in the analysis, and the number of alleles found in this study are shown in Table 2. Final analysis of the complete data set was performed by the coordinating center with BioNumerics software (Applied Maths). Nomenclature and description of allelic proles. The major outer membrane gene of L. pneumophila was originally described by Hoffman and colleagues (19) and was designated ompS. The previous study (11) and the present study were based on a distinct major outer membrane protein precursor gene designated mompS (GenBank accession no. AF078136; Cristoph and Ehret, unpublished). For this study, the notation mompS is used. As in the previous study (11), for each gene of L. pneumophila analyzed, identical sequences were assigned to the same allele number, e.g., aA(1), and different sequences were assigned distinct allele numbers, e.g., aA(1), aA(2), aA(3), etc. For each isolate, the combination of alleles at each of the loci was dened as the allelic prole or sequencebased type (SBT) by using a predetermined order, i.e., aA, pilE, asd, mip, mompS, and proA. For example, for strain EUL 120, the allelic prole (or SBT) is 4,7,11,3,11,12. If an individual allele number has not been determined, a 0 is entered into the allelic prole, thus maintaining its integrity. For example, if the proA allele number was not determined for the example above, the prole would be 4,7,11,3,11,0; and if the mompS allele was not determined, the prole would be 4,7,11,3,0,12. This format allows the sequential addition of future gene targets, subject to appropriate evaluation and consensus agreement. The authors also took the decision not to designate single number sequence types representing the complete allelic prole at this time. Thus, a novel allele, x, would be a seventh allele, and thus, all proles would then include seven numbers. Assignment of new allele numbers is made by the coordinating center, which also curates the online SBT database. In order to designate alleles, the consensus text sequence and the forward and reverse chromatogram les from putative new alleles are examined, and the new allele number added to the database, subject to verication by at least two people. In this study the sequences of all allele numbers for all loci were conrmed in at least two of the participating centers. Nucleotide sequences. The sequences from the isolates of L. pneumophila described in this study are available from the authors or at http://www.ewgli.org.

Reproducibility. Data from consensus sequences from six loci (aA, pilE, asd, mip, mompS, and proA) from all 16 isolates tested by the laboratories by using different methods of DNA extraction, PCR cycling conditions, and DNA sequencing platforms were in complete agreement (R 1.00). By using the cycling conditions described with an annealing temperature of 55C, primary amplicons suitable for DNA sequence analysis and good-quality sequence data were obtained from all loci. Epidemiological concordance. All six of the sets of isolates included in the epidemiologically related panels of isolates had compelling evidence of epidemiological relatedness (8); and previous analyses revealed concordant MAb subgrouping, restriction fragment length polymorphism analysis, restriction enzyme analysis, amplied fragment length polymorphism analysis, and sequence-based typing results (8, 10). Six genes were sequenced for the 16 isolates representing the six sets of epidemiologically related strains and two replicates of the same strain. The epidemiologic concordance (E) was calculated for each of the genes analyzed by using this set of 16 isolates, and for each locus E was equal to 1.00. The mip gene and the proA gene could differentiate only ve of the six sets of strains, whereas all of the other targets could distinguish

TABLE 3. Allelic proles of L. pneumophila sg 1 isolates from epidemiologically related sets

Allele no. EUL no. aA pilE asd mip mompS proA

EUL 120 EUL 121 EUL 73 EUL 78 EUL 79 EUL 71 EUL 76 EUL 77 EUL 48 EUL 56 EUL 40 EUL 47 EUL EUL EUL EUL 140 141 142 143

4 4 3 3 3 8 8 8 5 5 11 11 12 12 12 12

7 7 4 4 4 10 10 10 2 2 14 14 8 8 8 8

11 11 1 1 1 3 3 3 22 22 16 16 11 11 11 11

3 3 1 1 1 15 15 15 27 27 1 1 5 5 5 5

11 11 14 14 14 18 18 18 6 6 15 15 20 20 20 20

12 12 9 9 9 1 1 1 10 10 13 13 12 12 12 12

RESULTS Typeability. All isolates included in the study yielded PCR products of the expected size and DNA sequences with primers specic for all genes when they were tested by all four centers. For each isolate, the alleles either could be assigned to a preexisting allele number or could be identied as novel alleles in the course of this study; thus, T was equal to 1.0. Sequence variation. The number of nucleotides from each of the gene targets included in the analysis ranged from 182 to 473 bp (Table 2). The numbers of allele types and polymorphic nucleotide sites and the percentage of nucleotide substitutions within each gene locus from the analysis of the panel of 79 strains are shown in Table 2. The highest percentage of polymorphic sites was found in the mompS gene (13.8%), and the least was found in the mip gene (3.0%).

2050

GAIA ET AL.

J. CLIN. MICROBIOL.

TABLE 4. Allelic proles of L. pneumophila isolates belonging to serogroups other than sg 1 from three epidemiologically related sets and four unrelated reference strains
Strain type and EUL no. Allele no. Serogroup aA pilE asd mip mompS proA

Epidemiologically related sets LC 202 LC 206 LC 569 LC 606 LC 384 LC 395 Reference strains NCTC 11192 NCTC 11406 NCTC 11985 NCTC 12000

sg 6 sg 6 sg 8 sg 8 sg 10 sg 10 sg sg sg sg 1 6 8 10

3 3 3 3 2 2 3 3 8 2

13 13 10 10 10 10 4 10 1 10

1 1 1 1 3 3 1 1 22 3

28 28 28 28 28 28 1 3 30 28

14 14 14 14 9 9 14 14 6 9

9 9 9 9 4 4 9 9 10 4

of these indices were all above 0.95, indicating that the true index of diversity could be above 0.95 and that the lower 95% condence limits are slightly above 0.9. When SBT data for all six loci were combined with MAb subgrouping data, the estimated index of diversity was 0.981 and the lower 95% condence limit was 0.967, indicating that the true index of diversity was unlikely to be below 0.95. If just the combination of aA, pilE, asd, and MAb types was used, the estimated index of diversity was 0.978 and the lower 95% condence limit was 0.966, again indicating that the true index of diversity was unlikely to be below 0.95 for this combination. Stability. Analysis of all ve variants (EUL 135 to EUL 139) in the stability panel (panel 3) resulted in identical SBTs, i.e., 6,10,15,28,9,14. mip allele 28 was a novel allele and was also found in the reference strain of sg 10 (Table 4). DISCUSSION Sequence-based typing of L. pneumophila, rst applied to strains belonging to sg 1 by Gaia and colleagues (11), demonstrated the potential application of this technique to the investigation of outbreaks of legionellosis. In this study we present data validating the method for three additional genes and demonstrating the application of this approach to other serogroups of L. pneumophila. The primary aim of this study was to seek to improve the level of discrimination offered by investigation of the additional genes, asd, mip, and pilE, and the robustness of the data from one of the previous targets, mompS. Indices of discrimination for single and multiple gene loci (with and without MAb data) were calculated by using a well-dened panel of isolates, allowing ready comparison. Various publications report that D values of 0.90 and above are desirable, if the typing results are to be interpreted with condence (20), or report that D values of 0.95 and above are ideal for use in a typing system (32). However, these values assume that the sample used is representative of the total number of subtypes in the population of interest. Although data from environmental isolates of L. pneumophila are limited, it appears from previous studies that clinical isolates of L. pneumophila show less genotypic variation than that found in environmental isolates, which have not been associated with human infections (8, 11). As the

among all six sets of isolates (Table 3). The results for the three additional epidemiologically related sets (LC 202 and LC 206, LC 569 and LC 606, and LC 384 and LC 395), which comprised clinical and environmental isolates belonging to serogroups other than sg 1, were also epidemiologically concordant (E 1.00), suggesting epidemiological linkage, and gave unique proles for each set (Table 4). The allelic proles of the unrelated reference strains from sg 1, sg 6, sg 8, and sg 10 are also shown in Table 4 and were distinct from those of the epidemiologically related sets belonging to the same serogroup. Indices of discrimination. Estimates of individual indices of discrimination (D) obtained with the six genes, aA, pilE, asd, mip, mompS, and proA, and various combinations of two or more alleles were determined by using the panel of 79 unrelated clinical isolates (Table 5). Individual-locus D values ranged from 0.767 (proA) to 0.848 (mompS), and maximum discrimination (i.e., D 0.943) was achieved by using all six loci. By using the combination of the three loci aA, pilE, and asd and further combinations obtained by sequential addition of the remaining three loci, the resulting indices were almost identical, i.e., D 0.94. The upper 95% condence intervals

TABLE 5. Indices of discrimination (D) calculated from the 79 unrelated isolates of L. pneumophila sg 1 using combinations of gene loci with and without MAb subgrouping results
Presence of gene locus Target aA pilE asd mip mompS proA Phenon MAb D Standard error 95% Condence interval

Single locus X X X X X Locus combination X X X X X X X X X X X X X X X X X X X X X

X X X

X X

0.767 0.791 0.794 0.825 0.827 0.848 0.910 0.937 0.939 0.940 0.943 0.981

0.0412 0.0270 0.0290 0.0243 0.0323 0.0236 0.0205 0.0191 0.0194 0.0195 0.0196 0.0064

0.686 0.738 0.737 0.777 0.763 0.802 0.870 0.900 0.901 0.902 0.904 0.967

to to to to to to to to to to to to

0.848 0.844 0.851 0.873 0.890 0.894 0.950 0.975 0.977 0.979 0.980 0.992

VOL. 43, 2005

SEQUENCE-BASED TYPING OF LEGIONELLA PNEUMOPHILA

2051

panel of 79 isolates used to calculate the indices of discrimination was composed entirely of clinical isolates belonging to sg 1, albeit from 10 different European countries, the D values generated probably represent an underestimate of the true discrimination that would be obtained by sampling a larger range of clinical and environmental isolates from different geographical regions and of other serogroups. However, use of the same panel of strains in multicenter studies has facilitated the calculation and comparison of the relative discriminatory powers of different typing systems for the discrimination of L. pneumophila sg 1 isolates. The use of only three loci, aA, pilE, and asd, gave an index of discrimination of 0.94; further combinations obtained by the inclusion of mip, mompS, and proA did not appear to offer signicantly higher values. However, as the lower 95% condence limits are above 0.9, this suggests that these combinations are acceptable as the basis of a typing method. Use of the combination of all six loci (aA, pilE, asd, mip, mompS, and proA) combined with MAb subgrouping yielded a value of 0.981, with a lower 95% condence limit of 0.967, indicating that the true D value was unlikely to be below 0.95. As such, the approach meets that specied for an ideal typing system (32). In order to demonstrate the validity of this sequencebased typing approach for strains of L. pneumophila other than sg 1, a number of additional isolates were also characterized and gave concordant results; i.e., clinical and environmental isolates that were epidemiologically linked gave identical proles for all six loci. The authors believe that this study demonstrates the validity of the sequence-based typing approach for the typing of L. pneumophila isolates. However, the inclusion of additional well-characterized isolates belonging to serogroups other than sg 1 in such panels would assist with the determination of condence limits for non-sg 1 strains. An expanded online SBT database (version 1.5) can now be queried (see www.ewgli.org). The website also proves detailed instructions regarding the submission of putative novel alleles, i.e., submission of consensus sequences together with sequencing results (chromatogram les) from both forward and reverse reactions, to the database curators. As indicated above, a level of discrimination of about 0.94 was achieved by using only three targets, aA, pilE, and asd; a level of discrimination of 0.943 was achieved by using all six loci; and a level of discrimination of 0.981 was achieved by using all six loci and MAb subgrouping data. An ideal system for the typing of L. pneumophila should facilitate the ability to determine the relatedness or otherwise of clinical and environmental isolates. In an outbreak situation, depending on the numbers of isolates involved, it is still advisable to rst conrm the serogroup and perform MAb subgrouping with sg 1 isolates (subject to the availability of MAb panels). When isolates are not yet available, e.g., in the rst 1 to 2 days of an outbreak investigation, it has been shown that the direct amplication of SBT primary amplicons from clinical and environmental samples is possible, for example, with aA and pilE (i.e., the targets with the smallest primary amplicon size [authors unpublished data]), thus enabling the rapid generation of sequence data and, thus, valuable typing data. The authors propose that epidemiological typing of L. pneumophila isolates be carried out by using sequence-based typing, as described here, with all six loci, at least until a larger data set

is established and reviewed. The resulting sequence-based type (or allelic prole) is thus dened by the cumulative allele number description of each locus, in the order aA, pilE, asd, mip, mompS, and proA. The absence of sequence information for any locus is entered into the prole as a 0. In conclusion, we have described and evaluated an improved method for the sequence-based epidemiological typing of L. pneumophila. Modications to the previous online SBT database now allow users to query the database and identify preexisting allelic proles for the six target genes described here, and the website provides instructions concerning the submission of novel allele types and proles.
ACKNOWLEDGMENTS We thank Nita Doshi and John Duncan for expert technical assistance; Jon Green, Anthony Underwood, and William Bellamy for work on the web-enabled database; Andre Charlett for statistical analysis and advice; and Robert George for constructive comments on the manuscript. Baharak Afshar and William Bellamy were funded by the European Commission.

ADDENDUM IN PROOF Analysis of the complete genome sequences of three L. pneumophila strains, Philadelphia-1T, Paris, and Lens, reveals that both the Paris and Lens strains contain two copies of the mompS gene, whereas the type strain (Philadelphia-1T) contains only one. The mompS amplication primers described in our study amplify only a single copy of mompS due to sequence variation in the noncoding anking regions.
REFERENCES 1. Bissett, M. L., J. O. Lee, and D. S. Lindquist. 1983. New serogroup of Legionella pneumophila, serogroup 8. J. Clin. Microbiol. 17:887891. 2. Black, W. J., F. D. Quinn, and L. S. Tompkins. 1990. Legionella pneumophila zinc metalloprotease is structurally and functionally homologous to Pseudomonas aeruginosa elastase. J. Bacteriol. 172:26082613. 3. Brenner, D. J., A. G. Steigerwalt, and J. E. McDade. 1979. Classication of the Legionnaires disease bacterium: Legionella pneumophila, genus novum, species nova, of the family Legionellaceae, familia nova. Ann. Intern. Med. 90:656658. 4. Edelstein, P. H., C. Nakahama, J. O. Tobin, K. Calarco, K. B. Beer, J. R. Joly, and R. K. Selander. 1986. Paleoepidemiologic investigation of Legionnaires disease at Wadsworth Veterans Administration Hospital by using three typing methods for comparison of legionellae from clinical and environmental sources. J. Clin. Microbiol. 23:11211126. 5. Engleberg, N. C., C. Carter, D. R. Weber, N. P. Cianciotto, and B. I. Eisenstein. 1989. DNA sequence of mip, a Legionella pneumophila gene associated with macrophage infectivity. Infect. Immun. 57:12631270. 6. Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identication of clones associated with serious invasive disease. Microbiology 144:30493060. 7. Enright, M. C., and B. G. Spratt. 1999. Multilocus sequence typing. Trends Microbiol. 7:482487. 8. Fry, N. K., S. Alexiou-Daniel, J. M. Bangsborg, S. Bernander, M. Castellani Pastoris, J. Etienne, B. Forsblom, V. Gaia, J. H. Helbig, D. Lindsay, P. C. Lu ck, C. Pelaz, S. A. Uldum, and T. G. Harrison. 1999. A multicenter evaluation of genotypic methods for the epidemiologic typing of Legionella pneumophila serogroup 1: results of a pan-European study. Clin. Microbiol. Infect. 5:462477. 9. Fry, N. K., J. M. Bangsborg, A. Bergmans, S. Bernander, J. Etienne, L. Franzin, V. Gaia, P. Hasenberger, B. Baladro n Jime nez, D. Jonas, D. Lindsay, S. Mentula, A. Papoutsi, M. Struelens, S. A. Uldum, P. Visca, W. Wannet, and T. G. Harrison. 2002. Designation of the European Working Group on Legionella Infection (EWGLI) amplied fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre prociency testing using a standard protocol. Eur. J. Clin. Microbiol. Infect. Dis. 21:722728. 10. Fry, N. K., J. M. Bangsborg, S. Bernander, J. Etienne, B. Forsblom, V. Gaia, P. Hasenberger, D. Lindsay, A. Papoutsi, C. Pelaz, M. Struelens, S. A.

2052

GAIA ET AL.

J. CLIN. MICROBIOL.
24. McKinney, R. M., H. W. Wilkinson, H. M. Sommers, B. J. Fikes, K. R. Sasseville, M. M. Yungbluth, and J. S. Wolf. 1980. Legionella pneumophila serogroup six: isolation from cases of legionellosis, identication by immunouorescence staining, and immunological response to infection. J. Clin. Microbiol. 12:395401. 25. Meenhorst, P. L., A. L. Reingold, D. G. Groothuis, G. W. Gorman, H. W. Wilkinson, R. M. McKinney, J. C. Feeley, D. J. Brenner, and R. van Furth. 1985. Water-related nosocomial pneumonia caused by Legionella pneumophila serogroups 1 and 10. J. Infect. Dis. 152:356364. 26. Mengaud, J. M., and M. A. Horwitz. 1993. The major iron-containing protein of Legionella pneumophila is an aconitase homologous with the human ironresponsive element-binding protein. J. Bacteriol. 175:56665676. 27. Sampson, J. S., S. P. OConnor, B. P. Holloway, B. B. Plikaytis, G. M. Carlone, and L. W. Mayer,. 1990. Nucleotide sequence of htpB, the Legionella pneumophila gene encoding the 58-kilodalton (kDa) common antigen, formerly designated the 60-kDa common antigen. Infect. Immun. 58:3154 3157. 28. Saunders, N. A., T. G. Harrison, A. Haththotuwa, N. Kachwalla, and A. G. Taylor. 1990. A method for typing strains of Legionella pneumophila serogroup 1 by analysis of restriction fragment length polymorphisms. J. Med. Microbiol. 31:4555. 29. Schoonmaker, D., T. Heimberger, and G. Birkhead. 1992. Comparison of ribotyping and restriction enzyme analysis using pulsed-eld gel electrophoresis for distinguishing Legionella pneumophila isolates obtained during a nosocomial outbreak. J. Clin. Microbiol. 30:14911498. 30. Simpson, E. H. 1949. Measurement of diversity. Nature 163:688. 31. Stone, B. J., and Y. A. Kwaik. 1998. Expression of multiple pili by Legionella pneumophila: identication and characterization of a type IV pilin gene and its role in adherence to mammalian and protozoan cells. Infect. Immun. 66:17681775. 32. Struelens, M. J., and members of the European Study Group on Epidemiological Markers (ESGEM). 1996. Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin. Microbiol. Infect. 2:211. 33. Urwin, R., and M. C. Maiden. 2003. Multi-locus sequence typing: a tool for global epidemiology. Trends Microbiol. 11:479487. 34. Valsangiacomo, C., F. Baggi, V. Gaia, T. Balmelli, R. Peduzzi, and J.-C. Piffaretti. 1995. Use of amplied fragment length polymorphism in molecular typing of Legionella pneumophila and application to epidemiological studies. J. Clin. Microbiol. 33:17161719. 35. van Belkum, A., M. Struelens, and W. Quint. 1993. Typing of Legionella pneumophila strains by polymerase chain reaction-mediated DNA ngerprinting. J. Clin. Microbiol. 31:21982200. 36. van Ketel, R. J., and B. de Wever. 1989. Genetic typing in a cluster of Legionella pneumophila infections. J. Clin. Microbiol. 27:11051107. 37. Zhao, X., and L. A. Dreyfus. 1990. Expression and nucleotide sequence analysis of the Legionella pneumophila recA gene. FEMS Microbiol. Lett. 58:227231.

11.

12. 13. 14. 15.

16. 17.

18.

19. 20. 21.

22.

23.

Uldum, P. Visca, and T. G. Harrison. 2000. Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplied fragment length polymorphism analysis. Eur. J. Clin. Microbiol. Infect. Dis. 19:773780. Gaia, V., N. K. Fry, T. G. Harrison, and R. Peduzzi. 2003. Sequence-based typing of Legionella pneumophila serogroup 1 offers the potential for true portability in legionellosis outbreak investigation. J. Clin. Microbiol. 41: 29322939. Gaia, V., C. Poloni, and R. Peduzzi. 1994. Epidemiological typing of Legionella pneumophila with ribotyping: report of two clinical cases. Eur. J. Epidemiol. 10:303306. Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12:543548. Harb, O. S., and Y. A. Kwaik. 1998. Identication of the aspartate-betasemialdehyde dehydrogenase gene of Legionella pneumophila and characterization of a null mutant. Infect. Immun. 66:18981903. Harrison, T. G., N. A. Saunders, A. Haththotuwa, N. Doshi, and A. G. Taylor. 1990. Typing of Legionella pneumophila serogroups 214 strains by analysis of restriction fragment length polymorphisms. Lett. Appl. Microbiol. 11:189192. Harrison, T. G., and A. G. Taylor (ed.). 1988. Appendix 1. In A laboratory manual for Legionella. John Wiley & Sons, Chichester, United Kingdom. Heuner, K., L. Bender-Beck, B. C. Brand, P. C. Lu ck, K. H. Mann, R. Marre, M. Ott, and J. Hacker. 1995. Cloning and genetic characterization of the agellum subunit gene (aA) of Legionella pneumophila serogroup 1. Infect. Immun. 63:24992507. Hoffman, P. S., L. Houston, and C. A. Butler. 1990. Legionella pneumophila htpAB heat shock operon: nucleotide sequence and expression of the 60kilodalton antigen in L. pneumophila-infected HeLa cells. Infect. Immun. 58:33803387. Hoffman, P. S., M. Ripley, and R. Weeratna. 1992. Cloning and nucleotide sequence of a gene (ompS) encoding the major outer membrane protein of Legionella pneumophila. J. Bacteriol. 174:914920. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpsons index of diversity. J. Clin. Microbiol. 26:24652466. Joly, J. R., R. M. McKinney, J. O. Tobin, W. F. Bibb, I. D. Watkins, and D. Ramsay. 1986. Development of a standardized subgrouping scheme for Legionella pneumophila serogroup 1 using monoclonal antibodies. J. Clin. Microbiol. 23:768771. Joseph, C. A., on behalf of the European Working Group for Legionella Infections. 2002. Surveillance of Legionnaires disease in Europe, p. 311 317. In R. Marre, Y. A. Kwaik, C. Bartlett, N. P. Cianciotto, B. S. Fields, M. Frosch, J. Hacker, and P. C. Lu ck (ed.), Legionella. ASM Press, Washington, D.C. Marques, M. T., N. Bornstein, and J. Fleurette. 1995. Combined monoclonal antibody typing, multilocus enzyme electrophoresis, soluble protein proles and plasmid analysis of clinical and environmental Legionella pneumophila serogroup 1 isolated in a Portuguese hospital. J. Hosp. Infect. 30:103110.