Bioresource Technology 134 (2013) 151157

Contents lists available at SciVerse ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Temperature regulates fatty acid desaturases at a transcriptional level and modulates the fatty acid prole in the Antarctic microalga Chlamydomonas sp. ICE-L
Meiling An a, Shanli Mou b, Xiaowen Zhang b, Naihao Ye b,, Zhou Zheng a, Shaona Cao b, Dong Xu b, Xiao Fan b, Yitao Wang b, Jinlai Miao a,
a b

Key Laboratory of Marine Bioactive Substance, The First Institute of Oceanography, State Oceanic Administration, Qingdao, China Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, China

h i g h l i g h t s
" Potential FA desaturation metabolic pathway of the microalga was displayed. " For the rst time the ve FADs have been analyzed together. "

x3CiFADs are of vital consequence to acclimation low temperatures.

" PUFAs were signicantly increased at 0 and 5 C, while decreased at 15 C.

a r t i c l e

i n f o

a b s t r a c t
Chlamydomonas sp. ICE-L which can thrive in extreme environments of the Antarctic is a major biomass producer. The FAD genes in Chlamydomonas sp. ICE-L were obtained and sequence alignment showed that these genes are homologous to known FADs with conserved histidine motifs. In this study, we analyzed the transcription of ve FADs and FA compositions at different temperatures. The results showed that the expressions of D9CiFAD, x3CiFAD1 and x3CiFAD2 were apparently up-regulated at 0 C, however, the upregulation of D6CiFAD intensied with rising temperature. Meanwhile, analysis of the FA compositions showed that PUFAs were dominant compositions, accounting for more than 75% TFA in Chlamydomonas sp. ICE-L. Furthermore, PUFAs were signicantly increased at 0 and 5 C, which may be attributed to higher proportions of C18:3 and C20:3. Moreover, PUFAs were signicantly decreased at 15 C whereas SFAs were signicantly increased. 2013 Elsevier Ltd. All rights reserved.

Article history: Received 9 November 2012 Received in revised form 23 January 2013 Accepted 24 January 2013 Available online 8 February 2013 Keywords: Chlamydomonas sp. ICE-L FADs PUFAs Temperature stress

1. Introduction High-level fatty acid unsaturation of the membrane is a common feature of plant cells that allows them to falling and rising temperature as such FAs maintain the uidity of the membrane lipids (Morgan-Kiss et al., 2006; Frederic et al., 2005). Two types of fatty acid desaturases (FADs), which function at the endoplasmic reticulum (ER) and the chloroplast respectively, are responsible for FA desaturation. The limiting enzyme in the conversion of saturated fatty acids (SFAs) to unsaturated fatty acids (UFAs), D7/ D9FAD, inserts the rst double bond into SFAs (Leonard et al., 2004; Singh et al., 2005). D12 FAD, called x6 desaturase, converts hexadecenoic acid (C16:1) or oleic acid (C18:1) to hexadecadienoic acid (C16:2) or linoleic acid (C18:2) by inserting a double bond at
Corresponding authors. Tel./fax: +86 532 85830360.
E-mail addresses: yenh@ysfri.ac.cn (N. Ye), miaojinlai@163.com (J. Miao). 0960-8524/$ - see front matter 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biortech.2013.01.142

the x6 position, whereas x3 desaturases insert a double bond at the x3 position and D4, D5, D6 and D8FAD are considered to be responsible for the production of eicosapentaenoic acid (EPA) (Zhang et al., 2005; Li et al., 2011a). Adjustments of the lipid contents and FA proles are responses associated with variations of temperature in many plants, and there is a positive relationship between a higher degree of FA desaturation and both cold and freezing tolerance (Zhang et al., 2012). In Arabidopsis thaliana, a microarray analysis suggested induction of D9FAD under cold stress (Kreps et al., 2002). A similar trend was also observed in x3 desaturase under low temperatures (Matsuda et al., 2005). In tomato leaves, the expression of x3 desaturase was induced at 4 C, but inhibited at high temperature (45 C) (Liu et al., 2006). However, in Pavlova salina, RT-PCR results suggested that a higher growth temperature (20 and 30 C) increased the expressions of D4, D5 and D8FAD. In comparison, the expressions of all three genes were reduced at 15 C (Zhou

152

M. An et al. / Bioresource Technology 134 (2013) 151157

et al., 2007). In fungus (Conidioblus obscurus), the transcript level of D6 FAD increased with a shift from 20 to 10 C, whereas, when the fungal culture was shifted in temperature from 20 to 30 C, the transcript level decreased dramatically. Accordingly, PUFAs were the highest at 10 C, followed by 20 C and lowest when the fungus was grown at 30 C (Li et al., 2011a). Furthermore, a similar tendency of EPA and PUFAs to increase was observed at lower temperature in Phaeodactylum tricornutum (Jiang and Gao, 2004). Lower temperature promoted lipid accumulation in Scenedesmus (Li et al., 2011b), whereas increases in the lipid content of Nannochloropsis oculata at high temperature have been reported by Converti et al. (2009). Interestingly, the Antarctic Navicula grown at 4 and 20 C produced the highest amount of lipids compared with those grown at other temperatures (Teoh et al., 2012). The role of lipids and UFAs has also been demonstrated in other algae such as Thalassiosira, Chaetoceros and Antarctic Chlorella (Reuss and Poulsen, 2002; Hu et al., 2008). Alteration of the FA composition by means of enrichment of UFAs is a universal temperature adaptation mechanism in algae. The Antarctic microalga Chlamydomonas sp. ICE-L was isolated from an algal mat residing on the surface of a rock adjoining the Zhongshan Station (China) of Antarctica where is subject to low temperature, high pressure, and poor nutrient, with less air exchanges(Mou et al., 2012a). Although we reported the high lipid content in Chlamydomonas sp. ICE-L (Mou et al., 2012b), regulation of the FA content as well as the related desaturation genes as a function of temperature still remained to be investigated. Here, we analyzed the FAD expressions and FA compositions when cells were exposed to a gradient of six temperatures: 20, 10, 0, 5, 10 and 15 C; in particular, the expressions proles of the ve FADs were investigated. To the best of our knowledge, this is the rst time the ve FADs have been analyzed together in Chlamydomonas sp. ICE-L. Efforts were made to determine the FA desaturation metabolic pathway of the microalga. A concomitant linkage between changes in the transcription and the metabolism in response to temperature was expected, and the results enable a more comprehensive understanding the functions of FADs and FA compositions in response to temperature stress. 2. Methods 2.1. Algal culture and temperature treatment The Antarctic ice algae, Chlamydomonas sp. ICE-L, were isolated from the oating ice near the Zhongshan Research Station of Antarctica (69S, 77E). Cultures were routinely grown in autoclaved Provasoli seawater medium (Provasoli, 1968) at a light density of 40 lmol photons m2 s1 under a 12:12 light/dark cycle at 5 C. In the temperature stress treatment, cells in the logarithmic phase were exposed to a gradient of temperatures: 20, 10, 0, 5, 10 and 15 C, in three replicates. To investigate the expression levels of FADs, cells (50 mL) were harvested by centrifugation (4 C, 5 min, 5000g) at 2, 4, 6, 12, 24 and 48 h. Every 800 mL samples of cells were harvested at 8, 32 and 56 h and washed with deionized water and lyophilized prior to FA analysis. 2.2. RNA extraction Total RNA was extracted from liquid nitrogen ground algae powder using Trizol reagent (Invitrogen) as described by Sambrook et al., (2001). After thawing and centrifugation (4 C, 5 min, 12,000g), 200 lL of chloroform were added and mixed thoroughly by inverting the tubes several times. Samples were centrifuged for 15 min at 12,000g and 450 lL from the uppermost aqueous layer was transferred into a fresh Eppendorf tube. RNA

was precipitated for 10 min by adding 450 lL of isopropanol to the aqueous solution and centrifuged at 12,000g for 10 min, and washed with 1 mL ethanol (75%), and nally stored in 50 lL diethyl pyrocarbonate (DEPC) treated distilled water at 80 C. 2.3. Cloning and sequencing of FADs cDNA Prior to PCR amplication, the cDNA was synthesized using oligo d (T) 18 (TaKaRa Biotech Co., Dalian, China) and M-MLV reverse transcriptase (Promega Biotech Co., Madison, WI, USA). Specic primers were designed based on the potential full-length cDNAs, which obtained from the transcriptome of Chlamydomonas sp. ICE-L. The primers used in the experiment are shown in Table 1. The PCR products were then resolved by electrophoresis on 1% agarose gel, after which the fragment of interest were excised, puried using an agarose gel DNA fragment recovery kit (Tiangen Biotech Co. China). PCR fragments were then cloned into PMD-18 T vector and sequenced. 2.4. Quantitative real-time PCR Real-time PCR was conducted using the cDNA template prepared as described above. Five pairs of FADs gene-specic primers (Table 1) were designed with Primer Premier 5.0 and OMIGA software. A house-keeping gene, rbcl, (Table 1) was used as an internal control (Zhang et al., 2011). Real-time PCR was performed on ABI StepOne Plus Real-Time PCR System (Applied Biosysytems, USA) with SYBR Premix Ex TaqTMII (TaKaRa Biotech Co., Dalian, China) for 40 cycles (95 C for 5 s; 58 C for 10 s; 72 C for 40 s). The data were further analyzed using the comparative Ct (2DDCT) method (Livak and Schmittgen, 2001). To maintain consistency, the baseline was set automatically by the software. The mean SD was calculated for each experiment and analyzed using the SPSS 17.0 data processing system software. 2.5. Bioinformatics analysis The sequence was examined for homology at the NCBI (http:// www.ncbi.nlm.nih.gov/blast) using BLASX. The nucleotide sequences of the FADs were translated to protein sequences (http:// searchlauncher.bcm.tmc.edu/seq-util/Options/sixframe.html) and matched with the protein database in NCBI. Multiple sequence alignments were performed with the Clustal X program and

Table 1 Primers used in experiment. Primers Primers for cDNA D9CiFAD-F D9CiFAD-R x3CiFAD1-F x3CiFAD1-R D6CiFAD-F D6CiFAD-R Primers for qRT-PCR rbcl-F rbcl-R D9CiFAD-F0 D9CiFAD-R0 D12CiFAD-F0 D12CiFAD-R0 x3CiFAD1-F0 x3CiFAD1-R0 x3CiFAD2-F0 x3CiFAD2-R0 D6CiFAD-F0 D6CiFAD-R0 Sequence (50 30 ) ACTCTATAATCATGCACGGTAT CCACTTAAACAGTGTTCAACA GTGATGAATGAGGACGG CATCCCTTATGCCGTG ATTCCAATATGCAAGCTCTTA CCAAGCTGTTTAAAACCTG ACATTCTCTGGTCCTCCTCACG AAGGAAACGGTCTCTCCAACGC CGGAGAAGGATGGCACAACA ACACTGTCAGCCAGACCAAAGAA ATCAAGCACAACCACCACCAT CAGGAAGAAGCGGAACAAGC CCATGTCATTCATCACCTCTT AACCATCCCTTGCTCTTCTCA TGAGACCCATGTCGTCCACC GGAACCATCCCTTGCTCTTTT TGGAGGATGAGTGCAACAAGC ACCTAACAAATCGGCCAACAAT

M. An et al. / Bioresource Technology 134 (2013) 151157

153

analyzed with the BioEdit program (Chenna et al., 2003). The phylogenetic tree was constructed using the neighbor-joining algorithm of Mega 4.0 program with a total of 1000 boots trap replicates. 2.6. Fatty acid analysis For FA analysis, 20 mg of each lyophilized sample were added to a conical ask with 30 mL petroleum ether. The solution was placed in an ultrasound bath (40.0 kHz, 600 W) for 30 min at 50 C, and this operation was repeated two more times. Then, the solvent was removed with a rotary vacuum evaporator at 50 C. Glycerophospholipid FAs were transmethylated to fatty acid methyl esters (FAMEs) with 0.4 M KOHmethanol (v/v) at room temperature (15 C). Analysis of the resulting FAMEs analysis was carried out using a Finnigan Trace GCMS. FAMEs were identied by comparison with authentic standards (Sigma Chemicals Co., USA) and peaks were integrated with DPS software Version 7.05 (Zhejiang University, China). 3. Results and discussion 3.1. Cloning and sequencing of CiFAD genes Five FAD genes were obtained from the transcriptome of Chlamydomonas sp. ICE-L, and for convenience, they were designated as D9ACPCiFAD, D6CiFAD, x3CiFAD1, D12CiFAD and x3CiFAD2. The sequences of D12CiFAD and x3CiFAD2 were identical to the ones (D12FAD, JN127366; x3FAD2, ACX42440) in Chlamydomonas sp. ICE-L which had been deposited in Genbank (Zhang et al., 2011). Putative D9CiFAD, D6CiFAD and x3CiFAD1 cDNA fragments were generated by PCR and then sequenced, which showed the highest similarities to the FADs of the fresh water green alga Chlamydomonas reinhardtii. The stearoyl-ACP desaturase, D9ACPCiFAD, was the only soluble desaturase identied, located in the chloroplast. It encoded a 397-amino acid polypeptide of 44.3 kDa with a theoretical pI of 6.13. D12-FAD was the key enzyme for producing LA and was also the speed-limiting enzyme for routes of x-6 and x-3 FAs. In Chlamydomonas sp. ICE-L, D12CiFAD had a potential chloroplast transit peptide in its N-terminal region and ve TM helices predicted by TMHMM. The x3 desaturases were essential for the desaturation of x-6 FAs into x-3 FAs. The x3CiFAD1 protein had a deduced Mw of 42.1 kDa with a pI of 6.24, and the x3CiFAD2 protein had a deduced Mw of 49.3 kDa and a pI of 7.12. Both x3CiFAD proteins were typical transmembrane proteins with a distribution of hydrophobic amino acids. Analysis by ChloroP implied that x3CiFAD1 was microsomal location, whereas x3CiFAD2 had already been identied as a chloroplast enzyme. The D6FAD consists of 511 amino acids with a pI of 8.93, and had an estimated Mw of 56.9 kDa. The deduced protein contained three TM helices with a transit peptide in the N-terminal region, which is a feature of plastidial desaturases. The sequences of D6CiFAD, D9ACPCiFAD and x3CiFAD1 were submitted to GenBank (D6CiFAD, JX049587; D9ACPCiFAD, KC012988; x3CiFAD1, KC012989). 3.2. Structural and phylogenetic analysis The amino acid sequences of D6CiFAD, D9ACPCiFAD and x3CiFAD1 showed 65%, 74% and 69% similarities to those of C. reinhardtii, respectively. Multiple sequence alignments of FADs against similar desaturases highlighted typical conserved motifs. The amino acid sequences of the FAD genes contained histidinerich boxes (Table 2), which agreed with the standard of different types of desaturases. The histidine-rich motifs, which were highly conserved among membrane-bound acyl-lipid desaturases, were

proposed as forming a potential di-iron active site. Whats more, there were altered conserved residues in the same histidine boxes of different kinds of FADs, suggesting that these proteins might have acquired different functions from a common ancestor during evolution. For instance, D9ACPCiFAD was consistent with those of plastidial stearoyl-ACP desaturases that are represented as EENRHG, DEARHE; D12CiFAD matched the standard for plastidial D12 desaturase (GHDAGH, HNHHH, and HVIHH). In addition, the three histidine boxes of the x3CiFAD1 and x3CiFAD2 from Chlamydomonas sp. ICE-L (HDCGH, HGWRISHRTHH and HHX3THVIHH) were in accord with the standard for x3 desaturases. The typical histidine-rich boxes were also found in D6CiFAD (HCGNH, HX3H and QX2HH). From the phylogenetic tree, it can be seen that all of the desaturases fell into four distinct subfamilies (Fig. 1): the x3 desaturases subfamily, D12 desaturases subfamily, D9ACP desaturase subfamily and D6 desaturases subfamily. As shown in Fig. 1, prospective stearoyl-ACP desaturases clustered into a single monophyletic group. D9ACPCiFAD was grouped with those from green algae, apart from the subgroup comprised of genes from higher plants, which was assumed that stearoyl-ACP desaturases in algae and higher plants arose by independent gene duplication events. In the cluster of the x3 desaturase subfamily, two x3-homologous genes from Chlamydomonas sp. ICE-L as well as three genes from green algae fell into a group, whereas the FADs of Chlamydomonas sp. ICE-L remained relatively close to those of the higher plant FADs but were comparatively distant from those of cyanobacteria. In the clade of D12FAD, D12CiFAD was also clustered with those from green algae and set apart from enzymes from higher plants and cyanobacteria. In the cluster of D6FAD, D6CiFAD was grouped with C. reinhardtii and distant from diatoms and cyanobacteria. In general, the relationships displayed in the phylogenic tree were in accordance with traditional taxonomy. 3.3. Effects of temperature stress on the expression of FAD genes To determine the effects of temperatures on the expression levels of the genes, the samples were exposed to different temperatures (20, 10, 0, 5, 10, 15 C) for different periods (2, 4, 6, 12, 24, 48 h). The expression level of the gene at 0 h was set to 1 as the control. Expression levels of D9ACPCiFAD showed no obvious change except an increase at 0 C (Fig. 2a). The expression of D9ACPCiFAD was continuously up-regulated its expression during 48 h at 0 C and ultimately peaked at levels 12-fold higher than the control. This was different from D12CiFAD, which showed no sharp change at different temperatures with the exception of 15 C (Fig. 2b). It seemed that D12CiFAD was less affected by temperature with only minute uctuations observed and a similar phenomenon took place in cotton when grown between 32 and 20 C (Kargiotidou et al., 2008). We might suggest the hypothesis that the prudence of D12CiFAD probably revealed the key role it plays in balancing the proportion between MUFAs and PUFAs. However, Tang has reported that D12FADs are applied solely to post-transcriptional/post-translational modications rather than to an increase in their mRNA levels under cold stress (Tang et al., 2005). The expression of D6CiFAD was mostly up-regulated at elevated temperatures of 10 and 15 C. It accumulated rapidly and increased almost linearly during the rst 24 h at 15 C and peaked at 24 h by approximately 12-fold but dropped to 7-fold at 48 h (Fig. 2c). The transcript level of D6CiFAD was enhanced at elevated temperature, which might indicate that D6CiFAD was liable to induction at elevated temperatures. Special interest went to x3CiFADs, whose expression levels increased dramatically at 0 C and were repressed at elevated temperatures, indicating they facilitate cold adaption and restrict existence at elevated temperatures (Fig. 2d and e). At 0 C, expression

154

M. An et al. / Bioresource Technology 134 (2013) 151157

Table 2 Conserved histidine-rich boxes of FADs in Chlamydomonas sp. ICE-L. Name H-box1 WTRAWTAEENRHGDL FVVGHDAGHRSFH TMFWALFVLGHDCGHQSFS TMFWSLFVLGHDCGHASFS HCGNHGAMS H-box2 ASDEARHE EPWRIKHNHHHAKTN YHGWRISHRTHHANHGH YHGWRISHRTHHSNHGH WRYHHQVSHHIHCND H-box3 / HDINVHVPHHVSS HHNIETHVIHHLFSQMPHYNL HHDIGTHVIHHLFSQMPHYNL GGLNLQIEHHLFPAISFMH

D9CiFAD D12CiFAD x3CiFAD1 x3CiFAD2 D6CiFAD

Fig. 1. Phylogenetic analysis of FAD-like proteins. A neighbor-joining (NJ) tree constructed based on analysis of the FAD-like protein in Chlamydomonas sp. ICE-L and sequences downloaded from GenBank.

of x3CiFAD1 peaked with a 35-fold at 24 h and decreased thereafter to a level of about 15-fold higher than that of the control; expression of x3CiFAD2 followed a similar pattern, reaching its highest expression level at 12 h by 18-fold, but then decreased slightly at 24 h (16-fold) and markedly at 48 h (5-fold). Preempting temperature changes by overexpression or knock-down of individual x3FADs appears to increase tolerance to temperature extremes (Peneld, 2008). Kodama has reported transgenic tobacco plants overexpressing the Arabidopsis plastidial x3FAD displayed increased tolerance to chilling when transferred from 25 C to 4 C (Kodama et al., 1995). In contrast, due to silencing of a plastidial x3FAD, tobacco plants showed increased tolerance to temperatures above 33 C (Murakami et al., 2000). Research has suggested that temperature regulates FAD expression at both the transcriptional and post-transcriptional levels. Despite the fact that FADs have been widely studied in higher plants, to our knowledge, few FADs have been studied from polar microalgae. The FA desaturation metabolic pathway, especially the EPA metabolic pathway, was expected. The cloning of the genes of chloroplast FADs (D6CiFAD, D9ACPCiFAD, D12CiFAD and x3CiFAD2) in Chlamydomonas sp. ICE-L made the FA desaturation metabolic in chloroplast discernable. However, little is known about the FADs in the endoplasmic reticulum. Taken together, these results indicated that the mRNAs of FADs in Chlamydomonas sp. ICE-L were regulated differentially in

response to temperature stress. Moreover, D9ACPCiFAD, x3CiFAD1 and x3CiFAD2 were found to be more sensitive to low temperature, indicating that they might play primary roles in protecting of the algal cells from potential damage at low temperature around 0 C. The up-regulation of D6CiFAD intensied following elevation of the temperature showed that it might survive the algae from high temperature. 3.4. Effects of temperature stress on the fatty acid prole The FA proles of cells cultivated under various temperature conditions are displayed in Table 3, which shows the overall FA prole in Chlamydomonas sp. ICE-L was similar. SFAs were accounted for about 20% TFA and mainly displayed in the form of C16:0, which constituted about 85% SFAs. Beyond any doubt, the microalgae Chlamydomonas sp. ICE-L was dominated by high amount of PUFA (7379% TFA) and contained perceptible amount of C12:0 in a range of 0.40.6% TFA. This is in accordance with the study of the psychrophile C. raudensis, where psychrophily was linked to the presence of the short-chain FAs, as well as high levels of PUFAs in its membrane lipids (Morgan-Kiss et al., 2002). Previous work has suggested that modications of the content of C18:3 and C20:5 are important in plant adaptation to extreme temperatures (Peneld, 2008; Morgan-Kiss et al., 2005). In Chlamydomonas sp. ICE-L, C18:3, C20:3 and C20:5 were the major

M. An et al. / Bioresource Technology 134 (2013) 151157

155

Fig. 2. Expression of the FAD genes in Chlamydomonas sp. ICE-L exposed to different condition for different times. (a) D9ACPCiFAD, (b) D12CiFAD, (c) D6CiFAD, (d) x3CiFAD1, and (e) x3CiFAD2.

Table 3 Fatty acid prole (% of total) in different temperature condition (52 h). Fatty acids (C) 20 10 0 5 10 15 C12:0 0.46 0.54 0.47 0.48 0.45 0.40 C16:0 14.05 15.44 13.90 13.66 14.74 16.55 C16:1 4.53 3.69 3.21 3.74 2.90 3.31 C16:2 0.52 0.65 0.81 0.79 0.82 0.69 C18:0 1.72 1.67 0.98 0.99 1.19 1.61 C18:2 8.28 10.29 9.57 10.24 9.95 10.19 C18:3 28.85 27.10 28.32 28.08 27.69 29.01 C20:3 13.26 18.05 20.80 19.79 19.89 14.63 C20:5 25.08 19.92 19.00 19.33 18.36 19.16 P SFA P PUFA 75.99 75.74 78.49 78.24 76.71 73.67

16.22 17.47 15.35 15.12 16.37 18.57

components, among which C18:3 was the highest in content. In an Antarctic diatom, high C20:5 content appeared to be crucial for adaptation to low temperature as the percentage of the PUFA decreased with increasing temperature (Teoh et al., 2012). Similar trends in C18:3 and C20:5 were observed when Chlamydomonas sp. ICE-L was subjected to 15 C. In contrast, C18:3 and C20:5 were

considerably higher at 0 and 5 C. This is in accordance with the strategies adopted for survival at low temperatures, which include increasing the degree of FA unsaturation or branching and decreasing the FA chain length. To maintain proper membrane uidity at low temperatures, Chlamydomonas sp. ICE-L appeared to be chiey dependent upon increasing the degree of FA unsaturation.

156

M. An et al. / Bioresource Technology 134 (2013) 151157

Fig. 3. Percentage of unsaturated and saturated fatty acids in total FAs from Chlamydomonas sp. ICE-L exposed to different temperature condition for different times. (A) 8 h, (B) 32 h, and (C) 56 h.

Moreover, no signicant differences were found in C12:0 and C16:2 under these conditions. Variations in the FA proles at different temperatures are summarized in Fig. 3, which demonstrates diverse trends in FAs metabolism in Chlamydomonas sp. ICE-L. At 0 C, the SFAs and PUFAs showed no overall changes in spite of signicant alterations (increase or reduction) that took place in individual FAs. C18:3 and C20:5 displayed considerable increases at the expense of C18:2 and C20:3 at 0 C. In contrast, the situation was different at 15 C, with the increase of C18:2 and C20:3 at the expense of C18:3 and C20:5. Moreover, PUFAs were signicantly decreased at 15 C with SFAs showing signicant increase. Similarly, decreases in PUFAs as well as C20:3 were observed at 10 C. However, PUFAs were signicantly increased when Chlamydomonas sp. ICE-L grew at 5 C. Under the experimental conditions, the algae could grow in a cold and freezing environment but could not survive above 15 C. This is in accordance with Antarctic psychrophiles, whereas many Antarctic phytoplanktons master the ability to grow at temperatures above 20 C. Generally, an increase in PUFAs is one of the ways employed by marine microalgae to acclimatize to lowtemperature conditions. Chlamydomonas sp. ICE-L walks the chalks in the long time evolution with high PUFA, exactly as psychrophilic bacteria (Metz et al., 2001) isolated from sea ice as well as the sea ice diatoms isolated from the Antarctic (Mock and Kroon, 2002a,b). 4. Conclusions The x3CiFADs are of vital consequence to acclimate low temperatures and D6CiFAD may be involved in survival of high temperature. In addition, PUFAs as well as C18:3 and C20:5 were

considerably higher at 0 and 5 C. Chlamydomonas sp. ICE-L is conceivably a promising alternative for PUFA production (especially for EPA) because of the high concentration of these components as well as the high growth rate and biomass of the species (data not shown). Information about how FAs change and how these alterations are generated will help us to understand the modulation of FAs in response to temperature stresses. Acknowledgements This work was supported by National Natural Science Foundation of China (31200187, 41176153, 40876107, 31200097, 31200272), Hi-Tech Research and Development Program (863) of China (2012AA052103), Shandong Science and Technology plan project (2011GHY11528), the Specialized Fund for the Basic Research Operating expenses Program (20603022012004), Natural Science Foundation of Shandong Province (2009ZRA02075), Qingdao Municipal Science and Technology plan project (10-3-411-1-jch, 11-3-1-5-hy), National Marine Public Welfare Research Project (200805069). References
Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., Thompson, J.D., 2003. Multiple sequences alignment with the clustal series of programs. Nucleic Acids Res. 31, 34973500. Converti, A., Casazza, A.A., Ortiz, E.Y., 2009. Effect of temperature and nitrogen concentration on the growth and lipid content of Nannochloropsis oculata and Chlorella vulgaris for biodiesel production. Chem. Eng. Process. 48, 11461151. Frederic, D., Amine, A., Ulrich, Z., Herve, M., Ernst, H., 2005. In vivo characterization of the rst acyl-CoA D6-desaturase from a member of the plant kingdom, the microalga Ostreococcus tauri. Biochem. J. 389, 483490.

M. An et al. / Bioresource Technology 134 (2013) 151157 Hu, H.H., Li, H.Y., Xu, X.D., 2008. Alternative cold response modes in Chlorella (Chlorophyta, Trebouxiophyceae) from Antarctica. Phycologia 47, 2834. Jiang, H., Gao, K., 2004. Effects of lowering temperature during culture on the production of polyunsaturated fatty acids in the marine diatom Phaeodactylum tricornutum (Bacillariophyceae). J. Phycol. 40, 651654. Kargiotidou, A., Deli, D., Galanopoulou, D., Tsaftaris, A., Farmaki, T., 2008. Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum). J. Exp. Bot. 59, 20432056. Kodama, H., Horiguchi, G., Nishiuchi, T., Nishimura, M., Iba, K., 1995. Fatty acid desaturation during chilling acclimatization is one of the factors involved in conferring low-temperature tolerance to young tobacco leaves. Plant Physiol. 107, 11771185. Kreps, J.A., Wu, Y., Chang, H.S., Zhu, T., Wang, X., Harper, J.F., 2002. Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol. 130, 21292141. Leonard, A.E., Pereira, S.L., Sprecher, H., Huang, Y.S., 2004. Elongation of long-chain fatty acids. Prog. Lipid Res. 43, 3654. Li, T., Dauenpen, M.Y., Xiao, Q., 2011a. Molecular analysis of D6 desaturase and D6 elongase from Conidioblus obscurus in the biosynthesis of eicosatetraenoic acid, a x3 fatty acid with nutraceutical potentials. Appl. Microbiol. Biotechnol. 90, 591601. Li, X., Hu, H.Y., Zhang, Y.P., 2011b. Growth and lipid accumulation properties of a freshwater microalga Scenedesmus sp. under different cultivation temperature. Bioresour. Technol. 102, 30983102. Liu, X.Y., Yang, J.H., Li, B., Yang, X.M., Meng, Q.W., 2006. Antisense-mediated depletion of tomato chloroplast omega-3 fatty acid desaturase enhances thermal tolerance. J. Integr. Plant Biol. 48, 10961107. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402408. Matsuda, O., Sakamoto, H., Hashimoto, T., Iba, K., 2005. A temperature-sensitive mechanism that regulates post-translational stability of a plastidial omega-3 fatty acid desaturase (FAD8) in Arabidopsis leaf tissues. J. Biol. Chem. 280, 3597 3604. Metz, J.G., Roessler, P., Facciotti, D., Levering, C., Dittrich, F., Lassner, M., Valentine, R., Lardizabal, K., Domergue, F., Yamada, A., Yazawa, K., Knauf, V., Browse, J., 2001. Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293, 290293. Mock, T., Kroon, B.M., 2002a. Photosynthetic energy conversion under extreme conditions. I: Important role of lipids as structural modulators and energy sink under N-limited growth in Antarctic sea ice diatoms. Phytochemistry 61, 4151. Mock, T., Kroon, B.M., 2002b. Photosynthetic energy conversion under extreme conditions. II: The signicance of lipids under light limited growth in Antarctic sea ice diatoms. Phytochemistry 61, 5360. Morgan-Kiss, R., Ivanov, A.G., Williams, J., Mobashsher, K., Huner, N.P., 2002. Differential thermal effects on the energy distribution between photosystem II and photosystem I in thylakoid membranes of a psychrophilic and a mesophilic alga. Biochim. Biophys. Acta 1561, 251265.

157

Morgan-Kiss, R.M., Priscu, J.P., Pocock, T., Gudynaite-Savitch, L., Huner, N.P.A., 2006. Adaptation and acclimation of photosynthetic micro-organisms to permanently cold environments. Microbiol. Mol. Biol. Rev. 70, 222252. Mou, S.L., Xu, D., Ye, N.H., Zhang, X.W., Liang, C.W., Liang, Q., Zheng, Z., Zhuang, Z.M., Miao, J.L., 2012a. Rapid estimation of lipid content in an Antarctic ice alga (Chlamydomonas sp.) using the lipophilic uorescent dye BODIPY 505/515. J. Appl. Phycol. 24, 11691176. Mou, S.L., Zhang, X.W., Ye, N.H., Dong, M.T., Liang, C.W., Liang, Q., Miao, J.L., Xu, D., Zheng, Z., 2012b. Cloning and expression analysis of two different LhcSR genes involved in stress adaptation in an Antarctic microalga, Chlamydomonas sp. ICEL. Extremophiles 16, 193203. Murakami, Y., Tsuyama, M., Kobayashi, Y., Kodama, H., Iba, K., 2000. Trienoic fatty acids and plant tolerance of high temperature. Science 287, 476479. Peneld, S., 2008. Temperature perception and signal transduction in plants. New Phytol. 179, 615628. Provasoli, L., 1968. Media and prospects for the cultivation of marine algae. In: Watanabe. A., Hattori R. (Eds.), Culture and Collections of Algae. Proceedings of USJapan Conference, Hakone, pp. 6395. Reuss, N., Poulsen, L.K., 2002. Evaluation of fatty acids as biomarkers for a natural plankton community. A eld study of a spring bloom and a post-bloom period off West Greenland. Mar. Biol. 141, 423434. Sambrook, J., Fritsch, E.F., Maniatis, T., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory Press, New York. Singh, S.P., Zhou, X.R., Liu, Q., Stymne, S., Green, A.G., 2005. Metabolic engineering of new fatty acids in plants. Curr. Opin. Plant Biol. 8, 197203. Tang, G.Q., Novitzky, W.P., Carol-Grifn, H., Huber, S.C., Dewey, R.E., 2005. Oleate desaturase enzymes of soybean: evidence of regulation through differential stability and phosphorylation. Plant J. 44, 433446. Teoh, M.L., Pang, S.M., Chu, W.L., 2012. Response of Antarctic, temperate, and tropical microalgae to temperature stress. J. Appl. Phycol.. http://dx.doi.org/ 10.1007/s1081101298638. Zhang, P.Y., Liu, S.H., Cong, B.L., Wu, G.T., Liu, C.L., Lin, X.Z., Shen, J.H., Huang, X.H., 2011. A novel omega-3 fatty acid desaturase involved in acclimation processes of polar condition from Antarctic ice algae Chlamydomonas sp. ICE-L. Mar. Biotechnol. 13, 393401. Zhang, M., Barg, R., Yin, M., Gueta-Dahan, Y., Leikin-Frenkel, A., Salts, Y., Shabtai, S., Ben-Hayyim, G., 2005. Modulated fatty acid desaturation via overexpression of two distinct omega-3 desaturases differentially alters tolerance to various abiotic stresses in transgenic tobacco cells and plants. J. Plant. 44, 361371. Zhang, J., Liu, H., Sun, J., Li, B., Zhu, Q., 2012. Arabidopsis Fatty acid desaturase FAD2 is required for salt tolerance during seed germination and early seedling growth. PLoS One 7 (1), e30355. http://dx.doi.org/10.1371/ journal.pone.0030355. Zhou, X.R., Robert, S.S., Petrie, J.R., Frampton, D.M., Mansour, M.P., Blackburn, S.I., Nichols, P.D., Green, A.G., Singh, S.P., 2007. Isolation and characterization of genes from the marine microalga Pavlova salina encoding three front-end desaturases involved in docosahexaenoic acid biosynthesis. Phytochemistry 68, 785796.