Expressionofa laccase cDNAfromTrametes sp.

AH28-2in
Pichia pastoris andmutagenesis oftransformants bynitrogen
ion implantation
Yuzhi Hong
1
, Yazhong Xiao
1
, Hongmin Zhou
1
, Wei Fang
1
, Min Zhang
1
, Jun Wang
2
, Lijun Wu
2
&
Zengliang Yu
2
1
School of Life Sciences & Modern Experiment Technology Center, Anhui University, Hefei, China and
2
Key Laboratory of Ion Bioengineering,
Chinese Academy of Sciences, Hefei, China
Correspondence: Yazhong Xiao, School
of Life Sciences & Modern Experiment
Technology Center, Anhui University,
Hefei, 230039, China. Tel.: 186 0551
5108509; fax: 186 0551 5107408;
e-mail: yzxiao@ahu.edu.cn
Received 28 November 2005; revised 16
February 2006; accepted 19 February 2006.
First published online March 2006.
doi:10.1111/j.1574-6968.2006.00209.x
Editor: Diethard Mattanovich
Keywords
Trametes; laccase; Pichia pastoris; recombinant
expression; low-energy nitrogen ion
implantation.
Abstract
A laccase cDNA from Trametes sp. AH28-2 was expressed in Pichia pastoris, with
the highest expression level of 4.0 mg L
1
(1360 Umg
1
). The apparent K
m
(24.6
mM) for ABTS (2,2
0
-azinobis [3-ethylbenzothia-zoline-6-sulfonic acid]) and the
carbohydrate content of the recombinant laccase A (rLacA) are approximately
identical to those of the native LacA (nLacA). However, the two enzymes differed
in the pH optimum when both ABTS and guaiacol served as substrates. The
optimum pH for enzyme stability is 5.5 for rLacA. Thermal stability was also
investigated. The mutagenesis of rLacA utilizing low-energy nitrogen ion implan-
tation resulted in the isolation of a yeast clone that produced 7.7 mg L
1
(1085 Umg
1
) of laccase, 92.5% more than the nonirradiated control (4.0 mg L
1
).
Compared with rLacA, the mutant LacA (mLacA) with ve amino-acid residue
changes in the coding sequence showed a slight change in its catalytic ability but
superior thermal stability.
Introduction
Laccases (benzenediol : oxygen oxidoreductase, EC1.10.3.2),
a family of blue multicopper oxidases, are capable of
oxidizing a wide range of aromatic compounds with con-
comitant reduction of molecular oxygen to water (Ullah
et al., 2000; OCallaghan et al., 2002). Laccases are found in
highly evolved fungi and plants (Thurston, 1994), whereas
laccase-like activities have been found in some insects
(Thomas et al., 1989) and bacteria (Alexandre & Zhulin,
2000). The enormous potential of laccases as biological
catalysts for several industrial applications has been recog-
nized, including paper pulping/bleaching, bioremediation,
enzymatic removal of phenolic compounds in beverages,
enzymatic modication of bers, dye-bleaching and biosen-
sors (Smith et al., 1997; Gianfreda et al., 1999; Abadulla
et al., 2000; Kulys & Vidziunaite, 2003).
The industrial application requires a large amount of
enzyme at lowcost. However, the yield of laccase production
by most fungi is currently low. To increase laccase produc-
tion, researchers have used heterologous expression systems.
Pichia pastoris is a methylotrophic yeast that can be used to
express recombinant proteins under the control of the
strong alcohol oxidase promoter Aox1, which is tightly
regulated and induced by methanol (Cereghino & Cregg,
2000). Many strategies have been used to improve the
production of heterologous laccases and much progress has
been made in recent years (Hong et al., 2002).
Low-energy ion implantation has been successfully used
in biological systems (Huang et al., 1996; Vilaithong et al.,
2000; Yuan & Yu, 2003). The mutagenic effects exerted
by low-energy ion implantation on the plant and micro-
organism breeding were stronger and more effective than
those caused by other forms of mutagenesis, such as ultra-
violet rays, g-rays, lasers, neutrons and chemicals (Shao
et al., 1997; Chen et al., 1998; Xie et al., 2003). It has been
demonstrated that the ion beam could simultaneously
induce several effects such as energy deposition, momentum
transfer, mass deposition and electric charge exchange in the
implantation process (Huang et al., 1996; Zhao et al., 2001),
leading to highly efcient mutagenesis.
The white-rot fungus Trametes sp. AH28-2 has proven to
be an effective laccase producer, secreting multiple laccase
isozymes (Xiao et al., 2003, 2004). In this study, P. pastoris
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
was used to express the lacA gene from Trametes sp. AH28-2.
The recombinant laccase (rLacA) was characterized in
comparison with the native laccase (nLacA). Furthermore,
a Pichia transformant was mutagenized by low-energy
nitrogen ion beam implantation and the mutant laccase
(mLacA) was analyzed.
Materials and methods
Organisms and media
Trametes sp. AH28-2 is kept in the culture collection of
School of Life Sciences, Anhui University, China. The
Escherichia coli strain JM109 was obtained from Stratagene
(La Jolla, CA). The Pichia pastoris strain GS115 was obtained
from Invitrogen (Carlsbad, CA). All enzymes used to
manipulate RNA or DNA were obtained from Sino-Amer-
ican Biotechnology Co. (Beijing, China) or TAKARA Co
(Dalian, China).
All chemicals were of analytical grade. XH fermentation
medium contained per liter: 15 g glucose, 1.5 g L-asparagine,
1.0 g KH
2
PO
4
, 0.5 g MgSO
4
7H
2
O, 0.1 g Na
2
HPO
4
5H
2
O,
0.01 g CaCl
2
, 0.001 g FeSO
4
7H
2
O, 0.028 g adenine, 0.002 g
CuSO
4
5H
2
O and 50 mg vitamin B1. Buffered minimal
methanol (BMM), buffered minimal glycerol (BMG), mini-
mal dextrose (MD) and yeast extract-peptone-dextrose
(YPD) media were prepared according to the manual of the
Pichia Expression Kit (Invitrogen).
Cloning of the lacA cDNA in a yeast
expression vector
Trametes sp. AH28-2 was cultivated according to the meth-
od of Xiao et al. (2003, 2004) and induced by o-toluidine.
The myceliumwas harvested at the peak of laccase activity in
cultures, frozen in liquid nitrogen and then ground to a ne
powder with a mortar and pestle. Total RNA was extracted
using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany).
The reverse transcription products of total RNA by M-
MLV reverse transcriptase (Promega, Madison, WI) were
used as templates for PCR. The specic sense primer (Ps:
AAAGAATTCGCCATTGGGCCCACCGCTGAC) and the
antisense primer (Pa: TTTGCGGCCGCCTGGTCGTTGA
CATCGAGCG) were designed based on the structural gene
of lacA (GenBank accession no. AF388910) and used to
amplify the lacA cDNA using Taq polymerase. The PCR
products were separated by electrophoresis in a 1.0%
agarose gel. A 1.5 kb product was puried using the DNA
Gel Extraction Kit (V-gene, Hangzhou, China), digested by
EcoRI and NotI, inserted into the pPIC9K vector (Invitro-
gen) and then transformed into E. coli JM109 competent
cells. Sequence analyses of the target expression vectors
(pPlacA) were performed to ensure the correct open reading
frames of the constructs.
Screening of laccase-producing clones
The pPlacA plasmid and the control vector pPIC9K were
linearized by SacI and transformed into P. pastoris GS115
competent cells by electroporation with a Genepulser II
apparatus (Bio-Rad, Hercules, CA). Positive clones were
selected by growth on histidine-decient MD agar plates.
His
1
transformants were washed with sterilized water and
transferred onto YPD plates containing 1.0 and 2.0 mg mL
1
G418 for screening multicopy clones. Several multicopy
clones obtained were spotted onto BMM (pH 6.0) agar
plates containing 0.1 mM CuSO
4
and 0.2 mM ABTS (2,2
0
-
azinobis [3-ethylbenzothia-zoline-6-sulfonic acid]). Lac-
case-producing clones were identied by the presence of a
dark green color around Pichia colonies.
Laccase activity assay
Laccase activity was determined in two ways. One was to
monitor the oxidation of ABTS by laccase spectroscopically
at 420 nm within 30 min at 30 1C. The reaction mixture in a
total volume of 3 mL contained 0.1 mL cell-free super-
natants at various dilutions and 0.5 mM ABTS in 100 mM
sodium tartarate buffer (pH 4.0). The other was to measure
the oxidation of guaiacol at 465 nm within 30 min at 25 1C.
The reaction mixture contained 1 mL laccase dilution, 1 mM
substrate and 50 mM succinic acid-NaOH buffer (pH 4.5).
One unit was dened as the amount of laccase that oxidizes
1 mmol substrate min
1
. Assays were carried out in triplicate
for each sample and the mean values were obtained from
data with a standard deviation of less than 5%.
Production of rLacA
Ten multicopy transformants from the 1.0 and 2.0 mg mL
1
G418-YPD plates were inoculated into 10 mL BMG medium
in 100 mL Erlenmeyer asks, and incubated at 30 1C on a
rotary shaker at 150 r.p.m. for 24 h until the OD
600 nm
in one
milliliter reached 510. After centrifugation at 3000 g for
5 min at room temperature, the cell pellets were resuspended
in 30 mL BMM media (pH 6.0, 0.1 mM CuSO
4
) to an
OD
600 nm
of about 1.0 in 150 mL asks, cultivated at 20 1C
in the presence of 0.5% (volume in volume) methanol with
shaking at 150 r.p.m. Each sample was analyzed daily for
laccase activity and cell growth. All experiments were
performed in triplicate. One of the 20 transformants was
chosen at random to optimize the cultivation conditions,
such as the type of media, temperature, pH and concentra-
tions of CuSO
4
. Unless otherwise stated, 0.5% methanol was
added daily.
Characterization of enzymes
Both native and heterologous laccases were separated and
puried as described previously (Xiao et al., 2003). Protein
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
97 Mutagenesis of heterologous laccase
concentration was tested using a BCA assay kit (Hyclone,
Pierce Rockford, IL). The molecular mass of the denatured
laccase was estimated by sodium dodecyl sulfate (SDS)
polyacrylamide gel electrophoresis (PAGE) using a 10%
polyacrylamide gel (Laemmli, 1970). The pH stability of
laccase was determined in 100 mM citrate-Na
2
HPO
4
buffer
(pH 2.58.5, buffer A) and 100 mM glycine-NaOH buffer
(pH 8.010.5, buffer B) and thermal stability was assessed
between 20 and 70 1C using buffer A (pH 5.5). The pH
optimum for laccases was identied in buffer A using ABTS
and guaiacol as substrates and the temperature optimum
was investigated in the buffers used for laccase activity assay.
In addition, kinetic studies were performed at 30 1C by
measuring the initial velocity in 3 mL cuvettes with 1 cm
path length following the addition of the laccase to the
reaction. The initial rates were obtained from the linear
portion of the progress curve.
Mutagenesis by low- energy nitrogen ion
implantation
Low-energy nitrogen ion implantation was carried out at the
Key Laboratory of Ion Beam Bioengineering, Chinese Acad-
emy of Sciences. Cell cultures (200 mL), grown in BMG
media at OD
600 nm
5, were evenly spread onto three
sterilized glass plates and air-dried for 30 min. These three
samples with a thin layer of cells were bombarded by pulse
nitrogen cations at the energy of 10 keV with doses of 10 ,
40 and 100 (2.6 10
15
) ions/cm
2
, respectively. The
pulse time was 5 s with pulse interval being 25 s and the
operating pressure in the target chamber was kept at c.
10
3
Pa.
The treated cells were washed off with 0.9% physiological
salt solution and grown on BMG plates at 30 1C for 2 days
after appropriate dilution. These clones were washed and
transferred on BMG plates for several rounds. The nal cell
mixtures were grown at 20 1C for 5 days on BMM (pH 5.0)
plates containing 1 mM guaiacol and 0.2 mM CuSO
4
, with
200 mL methanol being replenished daily. Clones with ru-
fous haloes were selected at random for submerged fermen-
tation at 20 1C in BMM (pH 6.0) media containing 0.3 mM
Cu
21
and 0.2% (weight in volume, w/v) alanine. The
mutated LacA (mLacA) clones were sequenced and further
characterized.
Results
Cloning and heterologous expression of lacA
Sequence analysis showed that the cDNA sequence of lacA
was 1497 bp encoding a 499-amino acid mature protein and
identical to AF388910. The cDNA fragment was inserted
into the Pichia expression vector pPIC9K between EcoRI and
NotI sites, resulting in a 10.8 kb plasmid (pPlacA). The
expression cassette contained the leader sequence of a-factor
from Saccharomyces cerevisiae, lacA and the terminator.
His
1
transformants were obtained from MD plates at a
frequency of less than 100 clones per mg DNA. YPD plates
containing 1.0 and 2.0 mg mL
1
G418 were further used to
select transformants with multicopy lacA. These transfor-
mants produced dark green haloes when spotted onto BMM
plates containing ABTS, suggesting that functional laccases
were expressed. In contrast, the green zones were not
observed from the control clones.
Optimization of growth conditions
Twenty transformants, 10 each from the 1.0 and
2.0 mg mL
1
G418-YPD plates, were cultured at 20 1C for
8 days in BMM media (pH 6.0) containing 0.1 mM CuSO
4
.
The laccase activities were nearly equal for these cultures
(data not shown), indicating that the gene copy number did
not appear to have an obvious impact on laccase synthesis.
One of the transformants, GS-lacAI, was randomly chosen
for further characterization.
The extracellular laccase yield was in direct proportion to
the amount of copper in the cultures. The laccase yield of
GS-lacAI was relatively low in the absence of copper and the
highest yield of laccase was obtained in the presence of
0.3 mM copper. However, the biomass of cultures decreased
slightly as the copper concentration increased.
The positive effect of alanine on the pH of cultures was
also observed in this study. The pH values of GS-lacAI
cultures were successfully maintained at 5.87.0 for more
than 14 days in the presence of 0.20.8% (w/v) alanine. In
the BMM medium (pH 6.0) supplemented with 0.2%
alanine and 0.3 mM CuSO
4
, the laccase output reached
5470 UL
1
after 13 days of cell culture. However, laccase
yields decreased with increasing concentration of alanine,
which could be due to the instability of heterologous laccase
protein at pH 6.5 or higher.
Molecular weight and K
m
The calculated molecular mass of the mature protein,
deduced from the lacA cDNA, was 53 562, whereas the
molecular weight of nLacA determined by matrix-assisted
laser desorption ionization mass spectrum was 58 522 Da
(Xiao et al., 2003). The difference was due to the carbohy-
drate content of the enzyme. The rLacA expressed in Pichia
pastoris and the corresponding native enzyme (nLacA)
secreted by Trametes sp. AH28-2 were separately puried to
homogeneity by ion exchange and gel ltration chromato-
graphy. The apparent molecular weight of rLacA estimated
by SDS-PAGE (63 kDa) was nearly identical to that of nLacA
(62 kDa), indicating that the carbohydrate content of the
two laccases could be very similar. The apparent K
m
values
of nLacA and rLacA for ABTS, determined from the
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
98 Y. Hong et al.
Lineweaverburk plot, were estimated to be 25.0 and 24.6
mM, respectively.
The pH and thermo- stability of laccases
An interesting result was that the optimum pH of rLacA for
substrates had a tendency of shift to acidity compared with
nLacA (Fig. 1). The optimum pH of nLacA for ABTS and
guaiacol were 3.0 and 4.5, respectively. However, the opti-
mum pH of rLacA for ABTS and guaiacol declined to 2.5
and 3.5, respectively. The effect of pH on enzyme stability
was investigated by keeping enzymes in buffers at 25 1C.
nLacA was stable at pH 3.010.0 (Table 1) and maintained
over 90% activity after incubation for a month at pH
7.09.0. In contrast, rLacA exhibited a pH optimum at 5.5
with a half-life of 117 h.
The optimal temperature for rLacA using ABTS as the
substrate was estimated to be 50 1C, which is identical to
that of nLacA (Xiao et al., 2003). The relative activity of
rLacA at 50 1C was 48.7%, 22.7%, 13.3%, 18.5% and 68.9%
more than that at 20, 30, 40, 60 and 70 1C, respectively. The
thermal stability of the two laccases was also investigated at
pH 5.5 at temperatures ranging from 20 to 70 1C. As shown
in Table 2, the half-life of enzyme activities of nLacA were
substantially longer than those of rLacA.
Isolation and characterization of mutant laccase
In order to improve the production or the physicochemical
characteristics of rLacA, low-energy N ion was used as a
mutagen to mutate the cells of GS-lacAI. The treated cells
were periodically cultivated on BMG plates more than six
times to ensure genetic stability. After being screened on
BMM (pH 5.0) plates containing 1 mM guaiacol, 13 clones
with dark rufous haloes, from each treatment with 10 ,
40 and 100 (2.6 10
15
) ions/cm
2
, respectively, were
randomly selected for submerged fermentation. Laccase
production of N ion-treated clones was nearly identical
between two batches of fermentation, indicating that these
clones were hereditably stable after prolonged passages in
culture. Although the growth rate of the treated transfor-
mants was similar to the nonirradiated control, the laccase
production of a majority of the treated clones was lower
than the control. Screening of the laccase production yielded
target clones that expressed more laccase than the control
clone. The high expression clones, one from each treated
group, showed laccase yields of 8324, 6037 and 5911 UL
1
,
respectively, with a 52.2%, 10.4% and 8.1% increase over the
control (5470 UL
1
). Among these, mutant 1 (laccase yield
of 8324 UL
1
) was further characterized as described below.
The laccase (mLacA) from mutant 1 was puried and its
apparent molecular mass, as estimated by SDS-PAGE, was
63 kDa, identical to that of rLacA. The optimum pH and
temperature of mLacA for ABTS were pH 2.5 and 50 1C, the
same as rLacA. However, the apparent K
m
of mLacA (28.8
mM) was slightly more than that of rLacA (24.6 mM) and the
relative specic activity of mLacA (1085 Umg
1
) was less
than that of rLacA (1360 Umg
1
). The half-life of mLacA
activity increased at all temperatures tested compared with
rLacA (Table 2).
To understand the difference in enzyme activity between
mLacA (mutant 1) and rLacA (GS-lacAI), DNA sequence
analysis was performed. Seven nucleotide changes were
identied in the coding sequence of mutant 1: 247 nucleo-
tides (nt) (AT !GC), 394 nt (AT !CG), 439 nt
(AT !GC), 481 nt (AT !GC), 486 nt (TA !CG),
1244 nt (AT !GC) and 1428 nt (AT !CG). These
changes resulted in changes of amino acids at ve sites: 83
(N ! D), 132 (T ! P), 147 (T !A), 161 (T !A) and
415 (Y !C). It is not clear at present which change(s)
might have impacted enzyme activities observed in this
study.
100
R
e
l
a
t
i
v
e

a
c
t
i
v
i
t
y

(
%
)
80
60
40
20
0
2 3 4 5
pH
6 7
Fig. 1. Effects of pH on enzyme activities of both nLacA and rLacA
using 2,2
0
-azinobis [3-ethylbenzothia-zoline-6-sulfonic acid] (ABTS) and
guaiacol as substrates. D, rLacA/ABTS; &, nLacA/ABTS; m, rLacA/
guaiacol; , nLacA/guaiacol.
Table 1. The half-life times of nLacA and rLacA at various pHs

pH 2.5 3.0 4.0 5.0 5.5 6.0 7.0 8.0 8.0

B
9.0
B
10.0
B
nLacA (days) 1.8 2.9 9.9 14.6 21 25 460 460 460 460 55
rLacA (h) 1.7 3.3 16.8 77.6 117 103 24.0 1.1 / / /

nLacA and rLacA were incubated at 25 1C in buffer A (pH 2.58.0) and buffer B (pH 8.010.0). The superscript B indicates that enzyme was kept in
buffer B.
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
99 Mutagenesis of heterologous laccase
Discussion
It is of great benet to develop an efcient system for the
heterologous expression of laccases, which have potential for
various environmental and industrial applications. The
Pichia pastoris system has often been used to express
proteins that require posttranslational modications. We
used this system to express the lacA gene from Trametes sp.
AH28-2. The yield was c. 4.0 mg L
1
, similar to the levels
previously reported in yeasts (35 mg L
1
) and the relative
activity reached 1360 Umg
1
, similar to the level
(1380 Umg
1
) reported by Hong et al. (2002).
Previous work has suggested that the laccase gene lccT,
obtained from Panus rudis, was modied by adding ve
amino-acid residues at the C-terminus in the coding se-
quence and the relative activity of the heterologous LCCT in
P. pastoris increased twofold in comparison with the corre-
sponding laccase without modication (Yang et al., 2003).
In this work, use of the a-factor signal peptide and the
termination sequence in pPIC9Kvector added 12 additional
amino-acid residues (EAEAYVEF at the N-terminus and
AAAN at the C-terminus) to rLacA protein, resulting in a
1283.3 Da increase of the calculated molecular weight in
comparison with nLacA. The apparent K
m
(24.6 mM) and
the optimal temperature (50 1C) of rLacA for substrate
ABTS are almost the same as those of nLacA. The optimal
pH of rLacA for substrates ABTS and guaiacol has a
tendency of shift to acidity compared with nLacA (Fig. 1),
and the heterologous laccase rLacA is stable at pH 2.56.0
(Table 1). It is not clear what caused the pH shift for optimal
enzyme activity. A difference in posttranslational modica-
tions, such as glycosylation, between the lamentous fungi
and P. pastoris may be one of the explanations (Han & Lei,
1999). Nevertheless, these attributes indicate rLacA could be
utilized as an industrial enzyme.
The mutagenesis of the Pichia transformant GS-lacAI by
low-energy nitrogen ion beam implantation was designed to
generate mutant strains for higher laccase production. Out
of 39 clones selected, mutant 1 expressed laccase (mLacA) at
8324 UL
1
, a 52.2% increase over the control (rLacA). In
comparison with the nonmutant rLacA, the apparent K
m
of
mLacA increased 17.2% to 28.8 mM and its relative activity
decreased 20.2% to 1085 Umg
1
. The yield of mLacA
reached 7.7 mg L
1
, a 92.5% increase over the GS-lacAI
control (4.0 mg L
1
). The thermal stability of mLacA was
also enhanced (Table 2). Sequence analysis of mLacA
identied seven nucleotide changes including ve sense
mutations. An attempt is being made to pinpoint the
mutations responsible for the altered biochemical behaviors
of laccases.
In conclusion, several physicochemical characters of a
rLacA expressed in P. pastoris changed in acidic conditions
in comparison with the nLacA. The success of generating
high-laccase-production strains by low-energy N ion im-
plantation underscores the importance of molecular evolu-
tion. Our study provided a viable strategy to improve
heterologous expression and enzyme activity of laccase.
Acknowledgements
We are grateful of Dr Changyou Chen for reviewing this
manuscript. This work was supported by grants from the
National Natural Sciences Foundation of China (30370045,
30470056), the Science & Technology Foundation of Distin-
guished Young Scholars of Anhui Province (04043048,
05023057) and the Innovative Research Team of 211 Project
in Anhui University (02203109).
References
Abadulla E, Tzanov T, Costa S, Robra KH, Cavaco-Paulo A &
G ubitz GM (2000) Decolorization and detoxication of textile
dyes with a laccase from Trametes hirsute. Appl Environ
Microbiol 66: 33573362.
Alexandre G & Zhulin IB (2000) Laccases are widespread in
bacteria. Trends Biotechnol 18: 4142.
Cereghino JL & Cregg JM (2000) Heterologous protein
expression in the methylotrophic yeast Pichia pastoris. FEMS
Microbiol Rev 24: 4566.
Chen Y, Lin ZX, Zou ZY, Zhang F, Liu D, Liu XH, Tang JZ, Zhu
WM & Huang B (1998) High yield antibiotic producing
mutants of Streptomyces erythreus induced by low energy ion
implantation. Nucl Instrum Methods Phys Sec B 140: 341348.
Gianfreda L, Xu F & Bollag JM (1999) Laccases: a useful group of
oxidoreductive enzymes. Bioremediation J 3: 125.
Han Y & Lei XG (1999) Role of glycosylation in the functional
expression of an Aspergillus niger phytase gene (phyA) in Pichia
pastoris. Arch Biochem Biophys 364: 8390.
Hong F, Meinander NQ & J onsson L (2002) Fermentation
strategies for improved heterologous expression of laccase in
Pichia pastoris. Biotechnol Bioeng 79: 438449.
Table 2. The half-life times of laccases at different temperatures

Laccase 201C (days) 30 1C 401C 50 1C 60 1C 70 1C (min)

rLacA 7.0 25.0 h 6.6h 32.3 min 6.4 min 0.9
mLacA / / 8.0h 42.5 min 7.9 min 1.4
nLacA 36 days 13 days 3.3 days 18.9 h 2.2 h 5.1

Enzymes were incubated at different temperatures in buffer A at pH 5.5. Samples were taken to examine their residual activity at certain interval time.
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
100 Y. Hong et al.
Huang WD, Yu ZL, Jiang ZY & Yang XH (1996) Study of mass
and energy deposit effects of ion implantation of NAA. Radiat
Phys Chem 48: 319323.
Kulys J & Vidziunaite R (2003) Amperometric biosensors based
on recombinant laccases for phenols determination. Biosensors
Bioelectron 18: 319325.
Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T
4
. Nature 227:
680685.
OCallaghan J, OBrien MM, McClean K & Dobson ADW (2002)
Optimisation of the expression of a Trametes versicolor laccase
gene in Pichia pastoris. J Ind Microbiol Biotechnol 29: 5559.
Shao CL, Wang XQ & Yu ZL (1997) Phosphate release from N
1
ions irradiated 5
0
-CMP nucleotide and its kinetics. Radiat Phys
Chem 6: 561565.
Smith M, Thurston CF & Wood DA (1997) Fungal laccases: role
in delignication and possible industrial applications. Multi-
Copper Oxidases (Messerschmidt A, ed), pp. 201224. World
Scientic, New Jersey, USA.
Thomas BR, Yonekura M, Morgan TD, Czapla TH, Hopkins TL &
Kramer KL (1989) A trypsin solubilised laccase from phrate
pupal integument of the tobacco hornworm, Manduca sexta.
Insect Biochem 19: 611622.
Thurston CF (1994) The structure and function of fungal
laccases. Microbiology 140: 1926.
Ullah MA, Bedford CT & Evans CS (2000) Reactions of
pentachlorophenol with laccase from Coriolus versicolor. Appl
Microbiol Biotechnol 53: 230234.
Vilaithong T, Yu LD, Alisi C, Phanchaisri B, Apavatjrut P &
Anuntalabhochai S (2000) A study of low-energy ion beam
effects on outer plant cell structure for exogenous
macromolecule transferring. Surf Coatings Technol 128:
133138.
Xiao YZ, Tu XM, Wang J, Zhang M, Cheng Q, Zeng WY & Shi YY
(2003) Purication, molecular characterization and reactivity
with aromatic compounds of a laccase from basidiomycete
Trametes sp. strain AH28-2. Appl Microbiol Biotechnol 60:
700707.
Xiao YZ, Chen Q, Wu J, Hang J, Hong YZ, Shi YY & Wang YP
(2004) Selective induction, purication and characterization
of a laccase isozyme from the basidiomycete Trametes sp.
AH28-2. Mycologia 96: 2635.
Xie CX, Yao JM, Pan RR, Wu LJ & Yu ZL (2003) Mutagenesis of
ion beam implantation and identication of two new
rifampicin resistance determining sites in rpoB gene in
Escherichia coli. Acta Microbiol Sin 43: 732739.
Yang JQ, Tang GY, Dai HM, Liu G & Zhu HC (2003)
Expression and purication of the modied gene of
laccase from Panus rudis in Pichia pastoris. Lett
Biotechnol 16: 255258.
Yuan CL &Yu ZL (2003) The grand process of low
energy ion beam in life sciences. China J Biotechnol 23:
5761.
Zhao H, Li Y, Pei H & Zhang T (2001) Study on effect of
gentemicin producers mutagenized and breeded by N
1
implanting. J Tianjin Inst Technol 17: 1417.
FEMS Microbiol Lett 258 (2006) 96101 c 2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
101 Mutagenesis of heterologous laccase