American Journal of Research Communication www.usa-journals.

com
Suleiman, et al., 2014: ajrc.journal@gmail.com

Comparison of Widal test and polymerase chain reaction for early and
rapid diagnosis of typhoid fever
Suleiman Ali and Mohammed Nafi

AL-Neelain University, Faculty of Medical Laboratory Science Khartoum - Sudan
Correspondence: Suleiman Ali Suleiman
AL-Neelain University, Faculty of Medical Laboratory Science, Microbiology
Department - Khartoum-Sudan
Phone: +249912906129, E-mail: suliman.al80@gmail.com



Abstract
Background: Typhoid is a common problem in developing countries. Cultivation of bacteria
and serology (especially Widal test) gives unacceptable levels of false-negative and false-
positive results, respectively.
Aim: The aim of this study is to compare Widal test and Polymerase chain reaction for the
detection of the early typhoid fever.
Method: A total of 80 suspected cases of typhoid fever were included in this study. Blood
samples (serum and EDTA) were collected from all cases during the first week of illness.
Widal test and polymerase chain reaction were carried for all samples.
The results: A total of 80 individuals of both gender suspected to have typhoid fever were
included in this study, of them 19 (23.8%) were positive and 61 (76.2%) were negative for
Salmonella typhi O, whereas for Salmonella paratyphi BO 20 (25%) were positive and 60
(75%) were negative. For PCR 10 (12.5%) were positive and 70 (87.5%) were negative.
There was significant differences by using Widal test and PCR in diagnosis of typhoid fever
p. value 0.000
Conclusion: PCR technique is not only absolutely specific, but also very sensitive and,
therefore, much superior to Widal test for the early diagnosis of typhoid.
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

Key words: PCR, Salmonella, Typhoid fever, Widal
{Citation: Suleiman Ali, Mohammed Nafi. Comparison of Widal test and polymerase chain
reaction for early and rapid diagnosis of typhoid fever. American J ournal of Research
Communication, 2014:} www.usa-journals.com, ISSN: 2325-4076.



Introduction
There are an estimated 21 million new cases and 216,000 deaths attributed to typhoid fever
every year
(1)
. The disease, caused by Salmonella enterica serovar typhi, remains a common
problem in many parts of the world where access to clean water is limited. In the regions
where enteric fever is common, clinical diagnosis of typhoid fever is inadequate, as the
symptoms it causes are non-specific and overlap with those of many other febrile illness
including malaria, dengue fever, rickettsioses, leptospirosis and melioidosis
(2)
. Widal test is
agglutination assay in which Salmonella typhi cells are used to detect antibodies in blood.
Many of the surface antigens of the enterobacteriaceae demonstrate significant conservation
and induce antibodies that are cross-reactive. Consequently, the Widal test has very low
sensitivity and specificity, and little or no practical value in endemic areas despite its
continued use
(2)
. Several other serologically based assays are available for use in typhoid
diagnosis including, Typhidot and Tubex, but have the same problems associated with the use
of the Widal test
(3)
. Isolation of the salmonella remains the most reliable diagnostic method
in suspected typhoid fever and blood has been the main sample used for culture of the
organism
(4,5)
. However, blood culture can only identify 45 to 70% of patients with typhoid
fever, and is highly dependent on the amount of blood sampled. In addition the bacteraemic
level of Salmonella typhi, the presence of bactericidal activity in the blood, recent
administration of antibiotics may all affect the sensitivity. The intracellular nature
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

of Salmonella serovar Typhi also slows its growth in blood culture media. In addition, blood
culture takes at least 2 to 5 days before the identification of the organism, which is often too
late to initiate appropriate antibiotic therapy
(6,7)
. Given the problems associated with
serological methods and blood culture, PCR based methods have been exploited recently
because they can theoretically amplify DNA only from Salmonella typhi (specificity) and
should detect even low numbers of live or dead bacterial cells (sensitivity)
(8,9)
. The aim of
this study is to compare between Widal test and Polymerase chain reaction for the detection
of the early typhoid fever.
Methods
A descriptive cross-sectional study was done between J une and October 2013 at Khartoum
Teaching hospital, Khartoum state. A total of 80 suspected cases of typhoid fever both male
and female were included in this study, individual with past history of typhoid fever, and
individual complaining from fever with any obvious focus for other infections were excluded
from this study. Two venous blood samples were collected (2.5 ml in EDTA, and other 2.5
ml in plain container), serum was prepared from the plain container for Widal test, and
EDTA was stored at 20
o
C for DNA extraction and PCR.
Widal test procedure
The Vidal agglutination test was done by a tube titration method, using Murex reagents
(Murex Biotech Limited, UK) containing O (somatic) and H (flagellar) antigens of
Salmonella typhi and O and H. antigen of Salmonella paratyphi A and B , with serial dilutions
of sera beginning at 1:10. Patient serum is doubly diluted by mixing and transferring from
1:10 to 1:640 in three-four rows. First row usually comprises of Felix tubes, where somatic S.
typhi O antigen was added. For all the remaining rows, Dreyers tubes were taken; where
different flagellar H antigens are added. Each tube contains 0.5 ml of diluted serum. A test
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

tube with only saline was kept in each row as a control. All the tubes (including control) in a
row were mixed with 0.5 ml of antigen suspension. The first row is treated with S. typhi O
antigen, the second row with S. typhi H antigen, the third row with S. paratyphi A H antigen
and the fourth row with S. paratyphi B H antigen. Since infections by S. paratyphi B are rare,
this antigen is usually omitted in the test. After all the tubes have been treated with specific
antigen suspensions, the widal rack is placed in a thermostatically controlled water bath
maintained at 37
o
C for overnight incubation.Titer 80 and more was regarded as positive for
typhoid fever.
Detection of Salmonella using PCR
DNA extraction: One mL of blood containing 20 mM potassium EDTA as anticoagulant
was centrifuged at 10,000 rpm for 5 minutes. One mL of lysis buffer (0.2% Triton X100 in
Tris HCl pH 8.0) was added to the pellet. The mixture was gently aspirated several times to
effect hemolysis. The tube was centrifuged at 12,000 rpm for 6 minutes, the supernatant was
discarded, and the procedure was repeated once. The pellet was washed once with distilled
water. After the removal of the supernatant, the pellet was resuspended in 20-30 L of
distilled water. The tubes were sealed, kept in boiling water for 20 minutes, and brought back
to room temperature before being used as a template for PCR.
PCR Procedure: The flic-d gene sequence of salmonella serovar typhi was detected by
PCR,. The primer sequences were as follows: forward primer
ACTCAGGCTTCCCGTAACGC; reverse primer GGCTAGTATTGTCCTTATCGG. The
reaction was performed in a 50 L volume using Jena Bioscience, Germany master mix of
thermostable DNA polymerase for PCR. Thermo-cycling conditions in a Techne
thermocycler (Bibby Scientific Limited, Beacon Road, Stone, Staffordshire, ST15 0SA, UK)
were as follows: 95C for 5 min, followed by 35 cycles of 93C for 30 Sec, 55C for 30 Sec
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

and 72C for 40 Sec, with a final extension at 72C for 5 min. The amplified products (5 l)
were separated by electrophoresis on 1% agarose gel and visualized by staining with
ethidium bromide using UV gel documentation system. A163-bp PCR product was amplified
with the above flic-d gene specific primers.
Ethical Clearance: Approval was taken by the ethical review board of the Faculty of
Medical Laboratory Sciences Al-Neelain University. Verbal consent was taken from each
study unit


Results
A total of 80 individuals of both sexes suspected to have typhoid fever were included in this
study, of them 19 (23.8%) were positive, 61 (76.3%) were negative for S. typhi O, whereas
for S. paratyphi BO 20 (25%) were positive and 60 (75%) were negative, for PCR 10
(12.5%) were positive and 70 (87.5%) were negative. In comparison, between Widal test and
PCR results, 7 cases were positive by both S. typhi O Ag and PCR, 3 cases were positive by
PCR and negative by S. typhi O Ag and 12 cases positive by S. Type O Ag and negative by
PCR; On the other hand 10 cases were positive by both S. paratyphi BO Ag and PCR while
10 cases were positive only by S. paratyphi BO Ag. There was a significant difference by
using Widal test (tube) and PCR in diagnosis of typhoid fever p. value 0.000.
Table 1: Comparison between PCR and Widal test
S. typhi O Ag S. paratyphi B O Ag
Positive Negative Positive Negative
PCR Positive 7 3 10 0
Negative 12 58 10 60
Total 19 61 20 60


American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

Discussion
Typhoid fever is one of the most common infectious diseases in developing countries. Early
and definitive diagnosis of the disease is not only important in relieving patients suffering,
but also critical in avoiding fatal complications such as perforation of the intestines. It also
makes possible specific treatment at an early stage, which leads to the rapid elimination of the
pathogen. Otherwise, the patients excreta, especially stool, becomes a constant source of
spread of the disease. Although various diagnostic techniques have been used, Widal test is
the most favored method. Widal test is not a candidate for early detection of the disease
because specific antibodies take at least one week to reach detectable levels. Beside these
shortcomings, its value is further diminished by its non-specificity. It is particularly
unreliable with single titers
(10)
. The recent introduction of PCR techniques offers highly
specific, sensitive and reasonably quick diagnostic modality. Even 1-5 bacteria/mL can be
detected with absolute specificity within 1-2 days. We decided to check this theoretical
promise of PCR on the actual situation and compare it to Widal test. For polymerase chain
reaction, we preferred to target the flagellin gene because its hypervariable, region VI is
unique for Salmonella typhi, and its amplification provides 100% specificity The alternative
method in which the Vi gene is targeted can give false-positive results because of the
presence of Salmonella paratyphi C.
(11)
. The sensitivity of the latter has been reported to be
more (5 bacteria/mL) than the former (10 bacteria/mL). The sensitivity of our regular PCR
was tenfold more than that reported by Song et. al.
(12)
. There were significant differences by
using Widal test and PCR We conclude that PCR is much superior to Widal test. It has great
discriminating value due to its very high sensitivity and specificity. Therefore, it can be of
singular importance for the detection of early cases of typhoid, which is not only important
for the treatment of patients but is also necessary for control of the disease. Due to the need
for extensive infrastructure and specialized skills, the PCR facility cannot be made available
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

everywhere, especially in developing countries. Nevertheless, due to its high sensitivity and
specificity, as demonstrated in this study, it needs to be made available to everyone by
establishing collection centers, which can send samples to a few specialized reference
laboratories built in larger cities. Another factor to be considered is the relatively high cost,
which is almost twice that of blood culture. In fact, due to the rapid and definitive diagnosis,
the patient is saved from hospital admission, loss of working days, unnecessary expenditure
on unrelated and misdirected treatment which may be many times more than the cost of PCR.
It is believed that in the long run, it will turn out to be less expensive for both the patient and
the community. Furthermore, due to rapid diagnosis and definitive treatment, the patients
physical suffering is reduced to a minimum.



References
1. Crump J A, Mintz ED: Global trends in typhoid and paratyphoid fever. Clinical Infectious
Diseases 2010, 50:241-6
2. Levine MM, Grados O, Gilman RH, Woodward WE, Solis-Plaza R, Waldman W:
Diagnostic value of the Widal test in areas endemic for typhoid fever. Am J Trop Med
Hyg 1978, 27:795-800.
3. Prakash P, Sen MR, Mishra OP, Gulati AK, Shukla BN, Nath G: Dot enzyme
immunoassay (Typhidot) in diagnosis of typhoid fever in children. J Trop
Pediatr 2007, 53:216-217.
4. Parry CM, Hien TT, Dougan G, White NJ , Farrar J J : Typhoid fever. N Engl J
Med 2002, 347:1770-1782.
5. Wain J , Hosoglu S: The laboratory diagnosis of enteric fever. J Infect Dev
Ctries 2008, 2:421-425.
6. Wain J , Pham VB, Ha V, Nguyen NM, To SD, Walsh AL, Parry CM, Hasserjian RP,
HoHo VA, Tran TH, Farrar J , White NJ , Day NP: Quantitation of bacteria in bone
marrow from patients with typhoid fever: relationship between counts and clinical
features. J Clin Microbiol 2001, 39:1571-1576.
7. Wain J , Diep TS, Bay PV, Walsh AL, Vinh H, Duong NM, Ho VA, Hien TT, Farrar J ,
White NJ , Parry CM, Day NP: Specimens and culture media for the laboratory diagnosis
of typhoid fever. J Infect Dev Ctries 2008, 2:469-474.
American Journal of Research Communication www.usa-journals.com
Suleiman, et al., 2014: ajrc.journal@gmail.com

8. Ali A, Haque A, Sarwar Y, Mohsin M, Bashir S, Tariq A: Multiplex PCR for differential
diagnosis of emerging typhoidal pathogens directly from blood samples. Epidemiol
Infect 2009, 137:102-107.
9. Levy H, Diallo S, Tennant SM, Livio S, Sow SO, Tapia M, Fields PI, Mikoleit M,
Tamboura B, Kotloff KL, Lagos R, Nataro J P, Galen J E, Levine MM: PCR method to
identify Salmonella enteric servers typhi, paratyphi A, and paratyphi B among salmonella
Isolates from the blood of patients with clinical enteric fever. J Clin
Microbiol 2008, 46:1861-1866.
10. Abdul Haque, PhD; J anbaz Ahmed, MBBS, M Phil; J aved A. Qureshi, PhD EARLY
Detection of Typhoid by Polymerase Chain Reaction. Annals of Saudi Medicine. 1999,19:
337-340
11. Ambati SR, Nath G, Das BK: Diagnosis of typhoid fever by polymerase chain reaction.
Indian J Pediatr 2007, 74:909-913.
12. Song J H, Cho H, Park MY, Na DS, Moon HB, Pai CH: Detection of Salmonella typhi in
the blood of patients with typhoid fever by polymerase chain reaction. J Clin
Microbiol 1993, 31:14391443.