Sie sind auf Seite 1von 114

Material de Estudo de Biologia 10 Classe

Ficha Tcnica:

Elaborao
Armando Machaieie
Alfredo Cossa
Manuel Jos Simbine
Roberto Timteo

Coordenao
Departamento pedaggico

Digitao e formatao
Repartio das TICs

Direco
Messias Bila Uile Matusse





INDICE


INTRODUO ............................................................................................................................... 2
Seco I ............................................................................................................................................ 5
Unidade 1- Base Citolgica da Hereditariedade ......................................................................... 5
Clulas procariotas e eucariotas ............................................................................................... 5
Estrutura da clula procariota ............................................................................................... 5
Funes vitais ....................................................................................................................... 9
Estrutura do ADN ............................................................................................................... 12
O modelo da dupla hlice do ADN .................................................................................... 14
A descoberta de Watson e Crick ........................................................................................ 14
Replicao semiconservativa ............................................................................................. 15
O ADN e seus auxiliares .................................................................................................... 16
Ciclo Celular .......................................................................................................................... 20
Tipos de Diviso Celular .................................................................................................... 21
Fases da Mitose .................................................................................................................. 21
Meiose ................................................................................................................................ 23
Caractersticas da meiose ........................................................................................................... 23
2 Diviso da Meiose diviso equacional ........................................................................ 26
PROFASE II ............................................................................................................................... 26
Prfase II .................................................................................................................................... 26
META ......................................................................................................................................... 26
FASE II ...................................................................................................................................... 26
Metfase II .................................................................................................................................. 26
ANAFASE II .............................................................................................................................. 26
Anfase II ................................................................................................................................... 26
TELFASE II ............................................................................................................................ 26
Telfase II .................................................................................................................................. 26
Gametognese .................................................................................................................... 27
Espermatognese ................................................................................................................ 27
Reproduo Sexuada ou Gmica ........................................................................................ 32
Seco II ......................................................................................................................................... 38
Unidade 2- Gentica ................................................................................................................... 38
Terminologia Gentica ........................................................................................................... 38
Vida e experincia de Mendel ............................................................................................ 39
Leis de Mendel ................................................................................................................... 40
Cruzamento-teste ................................................................................................................ 42
Segunda Lei de Mendel ...................................................................................................... 43
Resoluo das tarefas de determinao de sexo e herana ................................................. 46
TRANSFUSO .................................................................................................................. 53
HEREDITARIEDADE ................................................................................................................ 57
23 pares de cromossomas 22 pares autossmicos 1 par sexual .................................................... 58
Mutaes ............................................................................................................................ 61
Doenas infecciosas ............................................................................................................... 66
Doenas hereditrias .............................................................................................................. 67

Instituto de Educao Aberta e Distncia 1
POLIDACTILIA ............................................................................................................................ 68
Doenas cromossmicas ........................................................................................................ 70
SECO III ................................................................................................................................... 71
Teoria Cientfica Sobre a Origem da Vida ............................................................................. 71
Evoluo das Primeiras Clulas Primitivas a Partir das Protoclulas .................................... 72
Hiptese heterotrfica ........................................................................................................ 72
Teorias Antigas Sobre a Origem dos Seres Vivos ................................................................. 73
A Experincia de Pasteur ................................................................................................... 73
Teorias Evolucionistas ........................................................................................................... 75
Factores de Evoluo ............................................................................................................. 76
Provas de Evoluo ................................................................................................................ 76
Origem do Homem ................................................................................................................. 77
Evoluo dos Homindeos ...................................................................................................... 77
Lugar do Homem na Natureza ............................................................................................... 78
Raas Humanas ...................................................................................................................... 79
As Caractersticas Raciais e o seu Estado .......................................................................... 79
Unidade 5 - Ecologia .................................................................................................................. 86
Pirmide Ecolgico ............................................................................................................ 93
Ciclos biogeoqumicos ........................................................................................................... 93
Ciclo de carbono ................................................................................................................. 93
Ciclo de Nitrognio ............................................................................................................ 94
Ciclo de gua ...................................................................................................................... 95
Grupos Sanguneos ........................................................................................................... 108
REFERNCIAS BIBLIOGRFICAS ......................................................................................... 111






Instituto de Educao Aberta e Distncia 2
INTRODUO

Amigo (a) estudante. A biologia , como deve saber, uma cincia fascinante, relativamente, fcil
de estudar. Mas para que ela se apresente assim to fcil para si, preciso observar os seguintes
aspectos:

1. Ler os textos de biologia quando estiver psicologicamente seguro de que est
preparado para nova aprendizagem. Pea esclarecimentos, sempre que for necessrio;
2. Fazer os exerccios, solicitando ajuda do professor, ou melhor, docente de disciplina
no CAA, sempre que precisar;
3. Fazer os exerccios recomendados neste material disponvel, do livro e/ou outros
adicionais que o docente de disciplina ou tutor disponibilizar no CAA ou ainda por
outra fonte, e que estejam todos acertados no seu caderno at a hora de rev-los para a
prova;
4. Saber identificar no texto e rever os fundamentos tericos para a resoluo dos
exerccios;
5. Usar rascunho para fazer as operaes observando os dados e os passos para a
resoluo dos exerccios;
6. No preocupar-se em memorizar os contedos, mas sim, compreend-los, pois s
desta maneira se aprende a raciocinar;

Quanto a resoluo de exerccios de biologia, deve:

1. L-los, com ateno, at entend-los perfeitamente;
2. Encontrar ligao entre o que dado e o que pedido;
3. Buscar, se possvel, diferentes caminhos para resolv-los, equacionando a sua
resoluo atravs de esquemas, perguntas, frmulas, etc.;
4. No se dar por vencido at encontrar um caminho que lhe leve a uma soluo
satisfatria;
5. Antes de efectuar os clculos, conferir atentamente, se os dados foram copiados
correctamente;
6. Fazer a reviso dos passos e dos clculos, pois a maioria dos erros nos exerccios,
est nas operaes;
7. Reler a pergunta, para respond-la adequadamente.

Caro estudante, podemos dizer muita coisa neste contexto, com a finalidade de lhe proporcionar
maior apoio possvel, no estudo da disciplina de biologia. Vamos entretanto, acrescentar apenas
mais um procedimento que poder parecer moroso, mas pensamos que vai certamente ser muito
til para si.






Instituto de Educao Aberta e Distncia 3
Guia de leitura


1 MOMENTO
Ler com muita ateno e concentrao algumas pginas (o estudo da disciplina de biologia
consiste essencialmente no conhecimento de conceitos, das leis e seus significados e
importncia, como so os casos das bases citologicas da hereditariedade e as leis de Mendel).
Agora faa anotaes no seu caderno sobre cada um dos conceitos, leis, frmulas ou outros
aspectos que julgares importantes.
2 MOMENTO
Sem consultar o material de estudo recomendado ou caderno, escrever num papel simples as
palavras ou conceitos chaves, as definies das leis, raciocnios, frmulas, desenhos
esquemticos, sem se esforar muito, nem perder muito tempo. Nesta etapa no obrigatrio
lembrar-se rigorosamente de tudo de importante que acabou de ler.
3 MOMENTO
Agora aprecie criticamente o que escreveu no papel: Tem sentido? Falta alguma coisa no ?
Qual a ordem lgica na formulao dessas definies, e frmulas? Como explicaria a uma
pessoa o que acabou de ler? etc. ... natural que agora se lembre de coisas que no se recordou
no momento anterior.
4 MOMENTO
Voltar a ler o mesmo texto e fazer um resumo. Os conceitos cientficos, as leis, as definies,
etc., ganham maior clareza quando se repetem ou se resolvem exerccios especficos. Por isso,
caro aluno, procura recapitular o questionrio resolvido e resolva os exerccios sem chave de
correco, devendo para isso contar com a interaco de colegas, principalmente do docente. Esta
a fase mais decisiva de preparao para a avaliao do fim da seco no CAA.
5 MOMENTO
S depois de resolver correctamente os exerccios recomendados, sobretudo depois de vencer o
captulo anterior que poder continuar a leitura do captulo seguinte, procedendo tal e qual
vimos anteriormente.
Amigo estudante! Embora parea um desperdcio de tempo, este procedimento apesar de lento
rende mais. Pois o conhecimento dos conceitos fundamentais possibilita um melhor domnio dos
assuntos estudados e dos que ir estudar a seguir. Por isso, ficaramos gratos em saber que vai
seguir o nosso conselho, com algumas inovaes, positivas claro, sob orientao do seu docente
de disciplina, tutor e apoio dos seus colegas

Caro (a) estudante. Nesta classe ir estudar temas importantssimos que iro com certeza,
contribuir na resoluo de vrios problemas do seu dia a dia, como sejam:

1. Base Citolgica da hereditariedade
2. Gentica
3. Evoluo
4. Ecologia

Amigo (a) estudante. Dos temas acima apresentados vamos reagrup-los de modo a
encontrar contedos que vo ser avaliados no mesmo teste como se tratasse de um mdulo
como j deve estar habituado das classes anteriores, mas que neste caso chamaremos seces.


Instituto de Educao Aberta e Distncia 4
Existem ao todo 3 seces, sendo que a primeira corresponde unidade Base Citolgica da
Hereditariedade. A 2 seco corresponde a unidade sobre Gentica e a ltima seco com a
terceira e a quarta unidades sobre Evoluo e Ecologia respectivamente.
Por isso temos neste material de estudo uma avaliao no final de cada seco de estudo, que
precedida de tarefas, umas com resoluo e outras sem as respectivas respostas

Na 10 Classe temos os seguintes objectivos especficos a alcanar:

1 Interpretar as leis de Mendel;
2 Demonstrar a importncia da Gentica na preveno de doenas congnitas e outras de
carcter hereditrias;
3 Aplicar os conhecimentos da Gentica na medicina, criao e melhoramento de plantas e
animais;
4 Descrever as teorias da evoluo;
5 Identificar os ecossistemas em Moambique;
6 Desenvolver o esprito de investigao aplicando os mtodos cientficos;
7 Divulgar os conhecimentos da evoluo para melhor percepo da sua origem.














Instituto de Educao Aberta e Distncia 5
Seco I
Unidade 1- Base Citolgica da Hereditariedade
Introduo
Como introduo ao estudo da Biologia da 10 classe, apresentamos a unidade 1, Base citolgica
da hereditariedade, que inicia com o estudo da Biologia a nvel celular e onde so abordadas a
estrutura e a funo dos componentes da clula. Aqui, concentramos a nossa ateno ao ncleo,
para melhor compreendermos como que esta regio especializada controla todas as actividades
celulares e a transmisso de informao gentica da clula-me para as clulas-filhas.

A seguir ser discutido como que as clulas vivas surgem a partir de outras pr-existentes,
atravs do processo de diviso celular. Vamos estudar o mecanismo de diviso de clulas
somticas (do corpo) e das clulas reprodutoras (gmetas) atravs dos processos denominados
mitose e meiose.

Para finalizar a seco ser apresentado o tema reproduo, processo fundamental para a
manuteno do nmero de indivduos de uma espcie, uma vez que, os seres vivos s surgem a
partir de outros seres vivos iguais a eles por meio da reproduo.

Esperamos que no fim do estudo desta seco voc seja capaz de:
Mencionar as principais funes da clula;
Descrever o mecanismo de replicao do ADN;
Explicar os diferentes tipos de diviso celular;
Distinguir a ovognese da espermatognese;
Diferenciar a reproduo assexuada da sexuada.
Clulas procariotas e eucariotas
Os seres vivos so constitudos por clulas e por substncias por elas produzidas. As clulas so
as unidades estruturais e funcionais dos organismos.
As clulas mais primitivas, no possuem um ncleo organizado e por isso so designadas por
procariotas. As mais evoludas, possuem um ncleo organizado; so as eucariotas.
Os organismos podem ser formados por uma clula (organismos unicelulares) ou por vrias
clulas (organismos pluricelulares), coordenadas entre si. Os organismos formados por clulas
procaritas (procariontes) so sempre unicelulares. Os organismos constitudos por clulas
eucaritas (eucariontes) podem ser unicelulares ou pluricelulares.

Estrutura da clula procariota
No nosso objectivo determo-nos na biologia dos organismos procariontes. Recorreremos a
uma sntese, traduzida no esquema de uma hipottica bactria que reunisse em si todos os
atributos de todas as bactrias (Fig. 1).


Instituto de Educao Aberta e Distncia 6

Fig. 1 - Esquema de uma bactria hipottica

A principal caracterstica comum a todas as clulas procariotas no terem ncleo
individualizado do citoplasma por falta de membrana nuclear: o seu cromossoma no est
encerrado num espao delimitado, como acontece em muitas outras clulas.


Tabela 1.
Funes das principais estruturas e organelos da clula procariota

Estrutura ou organelo Funo
Cpsula Protege contra agentes anti microbianos presentes nos animais
e contra antibiticos artificiais.
Parede D forma bactria e confere-lhe rigidez, desempenhando
papel de proteco.
Membrana plasmtica Regula todas as trocas de substncias entre a clula e o meio
externo, mantendo assim a constituio caracterstica do
citoplasma.
Membranas respiratrias (mesossomas) Produzem energia.
Flagelos Conferem mobilidade.
Tilacides/cianossomas/ clorossomas Responsveis pela fotossntese.
Ribossomas Sintetizam protenas.
Nucleide/regio nuclear Coordena e comanda todas as funes vitais da clula e
responsvel pela hereditariedade.



Instituto de Educao Aberta e Distncia 7
Nucleide
Todas as bactrias possuem uma zona geralmente central, o nucleide, onde se localiza um nico
cromossoma, constitudo por uma molcula circular de cido desoxirribonucleico (ADN),
relativamente longa, mas enovelada. A anlise qumica do nucleide revela a presena, para alm
de ADN, de cido ribonuclico (ARN) e de protenas

Clulas eucariotas
Estrutura geral
Na tabela 2 resumem-se as funes dos principais organelos e estruturas membranares de uma
clula eucariota:

Tabela 2.
Funes das principais estruturas e organelos da clula eucariota

Estrutura ou
organelo
Funo
Membrana plasmtica Regula todas as trocas de substncias entre a clula e o meio externo, mantendo
assim a constituio caracterstica do citoplasma.
Retculo endoplasmtico
rugoso e liso
O retculo endoplasmtico rugoso responsvel pela sntese e transporte de
protenas. O retculo endoplasmtico liso intervm na sntese de lpidos.
Aparelho de Golgi Local de acumulao e transformao de protenas.
Produz secrees e forma lisossomas.
Lisossomas Vesculas cheias de enzimas digestivas (protenas) que realizam a digesto
intracelular
Ribossomas Responsveis pela sntese de protenas.
Mitocndrias Produzem energia.
Cloroplastos Responsveis pela fotossntese.
Parede celular Reforo de celulose das clulas vegetais.
Vacolos pulsteis Eliminam produtos inteis.
Vacolo de suco celular Armazena gua e outras substncias na clula vegetal.
Centrolos Presentes apenas nas clulas animais, organizam o fuso acromtico durante o
processo de diviso celular.
Originam os clios e os flagelos.
Clios e flagelos Associados ao movimento.
Nuclolo Regio do ncleo onde se formam os ribossomas.
Ncleo Contm toda a informao gentica, o que lhe permite controlar a actividade celular.
O invlucro nuclear delimita e protege este organelo. Os poros nucleares regulam
todas as suas trocas com o citoplasma.


Instituto de Educao Aberta e Distncia 8
As clulas eucarioticas so caracterizadas por possurem um ncleo limitado por uma formao
membranar designada por invlucro nuclear. esta regio da clula que encerra a maior parte
do material gentico, os cromossomas, em nmero varivel consoante as espcies.
As clulas eucariotas podem ser animais e vegetais (Fig 2 e 3).




Fig. 2. Clula animal



Instituto de Educao Aberta e Distncia 9


Fig. 3. Clula vegetal
Funes vitais

Todos os seres vivos podem se reproduzir e crescer, possuem metabolismo, respondem a
estmulos do meio e evoluem. Estas caractersticas essenciais a vida ocorrem a nvel das clulas e
constituem as funes vitais.

Funes vitais da clula
a) Metabolismo celular
o conjunto de todos os fenmenos qumicos que ocorrem nas clulas e que so responsveis
pela transformao e utilizao de matria e da energia.

b) Homeostase
a capacidade que a clula tem de manter constante a sua composio interna,
independentemente do que possa ocorrer no meio externo.

c) Contractilidade
a capacidade da clula se encurtar devido ao encurtamento activo de determinadas molculas
proteicas do seu citoplasma, mantendo o mesmo volume.

d) Irritabilidade
a capacidade que a clula tem de responder aos estmulos do meio.

Instituto de Educao Aberta e Distncia 10
e) Diviso celular
a capacidade que a clula tem de produzir outra clula.

f) Hereditariedade
a capacidade que a clula tem de transmitir informaes s clulas filhas. Estas informaes
destinam-se a serem usadas pela prpria clula e esto contidas nos cromossomas.

Definio da clula
A clula a mais pequena unidade que pode ser isolada e que ainda apresenta todas as
caractersticas vitais. Cresce e multiplica-se, dando origem a cpias de si prpria. capaz de
homeostase e apresenta mecanismos prprios de hereditariedade.

Generalidades Sobre o Ncleo
O perodo em que a clula no se encontra em diviso denominado interfase e fala-se do
ncleo interfsico.
O ncleo interfsico dos eucariontes constitudo pelo invlucro nuclear (membrana nuclear),
nucleoplasma, cromatina (cromossomas) e nuclolo.


Fig. 4. Estrutura do ncleo.

Membrana Nuclear ou Carioteca
A membrana nuclear ou carioteca separa o material nuclear do citoplasma.
A membrana nuclear no contnua, apresenta poros, que estabelecem comunicao do
citoplasma com o interior do ncleo.

Nucleoplasma ou Cariolinfa
Apresenta-se como uma soluo aquosa de protenas e es que preenche o espao entre a
cromatina e os nuclolos.

Cromatina e Cromossomas

Instituto de Educao Aberta e Distncia 11
Quando a clula no esta em diviso, os cromossomas apresentam-se como fios muito finos,
dispersos no nucleoplasma recebendo o nome de cromatina.
Os cromossomas s se tornam bem visveis individualizados ao microscpio ptico durante a
diviso celular quando sofrem um processo chamado condensao. Neste processo, tornam-se
mais curtos e mais espessos, que facilita a visualizao. Cada cromossoma formado por uma
nica e longa molcula de ADN, associada a vrias molculas de protenas.

Quando uma clula vai entrar em diviso, os cromossomas duplicam-se ainda na interfase. Cada
cromossoma produz um outro idntico a ele e esses dois filamentos cromossmicos, agora
denominados cromatdeos ficam unidos por uma regio denominada centrmero.

Figura 5. Cromossoma duplo: Cada cromossoma formado por 2 cromatdeos idnticos unidos
por um centrmero.

Os cromossomas pertencentes s clulas de indivduos da mesma espcie apresentam forma,
tamanho e nmero constantes, porm variam de espcie para espcie. Enquanto uma clula
humana possui 46 cromossomas, o boi possui 60, e o milho 20. Para cada cromossoma h um
outro semelhante na forma e no tamanho. No homem contamos 23 pares de cromossomas
semelhantes, no boi 30 pares e no milho 10 pares. Dois cromossomas de um par, so homlogos.
Uma clula que apresenta cromossomas aos pares diplide (2n) e uma clula que apresenta um
cromossoma de cada tipo haplide (n). O n indica o nmero de cromossomas diferentes
existentes numa clula.
O ncleo, atravs dos cromossomas, coordena e comanda todas as funes vitais da clula e
responsvel pela transmisso dos caracteres hereditrios aos descendentes

Nuclolo
uma estrutura, no delimitada por membrana, mergulhada no nucleoplasma. Durante a diviso
celular, o nuclolo desaparece. Esta estrutura produz cido ribonuclico (ARN).

Base molecular da hereditariedade: ADN e ARN
Hoje sabemos que as propriedades vitais so controladas pelas molculas de cido nuclico.


Instituto de Educao Aberta e Distncia 12
O cido nuclico tem esse nome porque foi descoberto no ncleo das clulas. encontrado em
todos os seres vivos.
A molcula do cido nuclico contm todas as informaes necessrias para a formao e
funcionamento do organismo. Essa molcula determina as caractersticas, a composio e as
possibilidades de reaces qumicas. Sabemos que o que hoje chamamos de gene corresponde a
um pedao da molcula de cido nuclico. Os genes so responsveis pelas caractersticas; no
caso do homem, eles determinam, por exemplo, a cor dos olhos, dos cabelos ou a forma do nariz.
Desse modo, o cido nuclico representa uma espcie de receita de bolo. O bolo, no caso o
organismo, seria fabricado de acordo com as instrues da receita e suas propriedades seriam
determinadas por ela.
Estrutura do ADN
O cido desoxirribonucleico (ADN ou DNA) uma molcula orgnica complexa, formada por
milhes de nucleotdeos ligados uns aos outros formando cadeias polinucletidas.

Cada nucleotdeo , por sua vez, formado por trs tipos de substncias qumicas:
1. Um composto contendo nitrognio (base azotada)
2. Desoxirribose (um acar de 5 carbonos)
3. Um grupo fosfato
A imagem abaixo mostra uma representao simplificada de um nucletdeo ou nucleotdeo: P
representa a molcula de fosfato, S representa o acar (desoxirribose), e B representa uma das
quatro bases azotadas.

Fig. 6. Representao simplificada de um nucleotdeo: P-grupo fosfato, S-desoxirribose e B-base
azotada.

Bases Azotadas (nitogenadas)
As quatro bases azotadas so:
Adenina
Guanina
Citosina
Timina

A denominao dos nucleotdeos depende da base azotada (nitrogenada) que os compem. O
nome dos quatro nucleotdeos do ADN so adenina, guanina, citosina e timina. Eles sero
referidos como A, G, C, e T respectivamente.
Adenina e timina ligam-se uma outra para formar um par de bases A-T. Igualmente, guanina e
citosina ligam-se uma outra para formar um par de bases G-C. As bases permanecem unidas
por fracas ligaes chamadas pontes de hidrognio, e so estas pontes de hidrognio as
responsveis pela manuteno da estrutura do ADN. A imagem seguinte ilustra como os pares de
bases se unem por pontes de hidrognio (As linhas entre as bases representam as pontes de
hidrognio).

Instituto de Educao Aberta e Distncia 13

Fig 7. Ligao entre dois nucleotdeos atravs de pontes de hidrognio.

Isto permite que uma longa fita seja construda (cadeia polinucletida). Um exemplo de uma fita
nica de ADN mostrada abaixo.

Fig. 8. Representao simplificada de uma fita nica de ADN.

Ao invs de sempre ver um diagrama molecular enorme de uma fita de ADN, o que vemos
frequentemente uma sequncia de letras, tais como " ATCTTAG ". Esta sequncia representa
bases que esto em um determinado lado de uma fita de ADN. A sequncia acima (ATCTTAG)
representa a fita: adenina-timina-citosina-timina-timina-adenina-guanina."
O ADN tem duas fitas. Os nucleotdeos que esto em uma fita, correspondem sequncia dos
nucletidos da outra fita devido maneira como ocorre o emparelhamento das bases (A com T, G
com C).
A figura abaixo mostra como as fitas so complementares.

Instituto de Educao Aberta e Distncia 14

Fig. 9. Representao simplificada de uma cadeia (fita) dupla de ADN: adenina emparelha-se
com timina e guanina com citosina.
.
O modelo da dupla hlice do ADN
A descoberta de Watson e Crick
Segundo o modelo proposto por Watson e Crick, a molcula de ADN constituda por duas
cadeias (fitas) polinucleotdicas (muitos nucleotdeos unidos uns aos outros) dispostas em hlice
ao redor de um eixo imaginrio, girando para a direita (uma hlice dupla).



A Os degraus da escada mostram o
emparelhamento C-G e A-T.
B Os degraus da escada esto representados
por traos horizontais.

Fig.10. Modelo de ADN de Watson e Crick: consiste numa cadeia dupla de nucleotdeos
formando uma escada enrolada em hlice. Os degraus da escada so formados por bases azotadas
(C-G e A-T).

Instituto de Educao Aberta e Distncia 15

As duas cadeias polinucleotdicas mantm-se unidas por pontes de hidrognio, que se
estabelecem entre pares de bases especficos: adenina com timina e citosina com guanina. Assim,
as duas cadeias que constituem um segmento de ADN, so complementares entre si: onde em
uma cadeia existir uma timina, na outra existir uma adenina, e onde existir uma guanina, na
outra existir uma citosina. A nica diferena entre um nucleotdeo e outro est no tipo de base.
Desse modo, duas molculas de ADN diferem entre si pela sequncia de bases ao longo do seu
filamento.

Nucleosdeos
Alguns derivados dos nucleotdeos so encontrados livres no citoplasma, como o caso do ATP,
cuja funo armazenar energia. A unio da base nitrogenada (azotada) com o acar forma um
composto chamado nucleosdeo. No ATP, por exemplo, h uma base nitrogenada, a adenina,
unida ao acar ribose, formando o nucleosdeo adenosina. Vem da o nome de adenosina
trifosfato, dado a essa molcula.

Replicao do ADN
O ADN necessita de se auto-reproduzir, fazendo cpias da informao gentica de modo a
transmiti-la de gerao em gerao.
Essas cpias so feitas atravs da duplicao do material hereditrio, ou seja, do ADN. Esse
processo de duplicao do ADN, chama-se replicao.
Em 1953, Watson e Crick propuseram um modelo para o ADN, e tambm sugeriram um
mecanismo para sua replicao.
O processo de replicao do ADN envolve a participao de diversas enzimas, entre elas, as
polimerases. Elas actuam no processo da sntese da nova molcula de ADN. Mas, como ocorre a
sntese?
O mecanismo da replicao envolve:
1. Desenrolamento da fita dupla do ADN;
2. Rompimento de ligaes (pontes de hidrognio) entre bases complementares;
3. Incorporao de nucleotdeos do meio, por complementaridade, com formao de duas
novas cadeias.
Replicao semiconservativa
Da molcula de ADN forma-se uma copia integral de cada uma das cadeias constituintes da
molcula original, atravs da adio ordenada de nucleotdeos, segundo a regra da
complementaridade de bases.
A sntese semi-conservativa do ADN precisa que nucleotdeos livres sejam posicionados sobre
uma cadeia polinucleotdica molde, e estejam unidos entre si, formando uma nova cadeia
complementar cadeia me que serve como molde. A enzima que actua nesse processo a
polimerase.

De que modo a polimerase catalisa a sntese do ADN?
As polimerases do ADN actuam adicionando um nucleotdeo de cada vez na extremidade livre de
uma cadeia polinucleotdica em formao, que se encontre emparelhada com a cadeia molde.
O primeiro passo na adio de um novo nucleotdeo nova cadeia que est a ser sintetizada, o
emparelhamento deste ao nucleotdeo correspondente na cadeia molde.
Como se d esse emparelhamento?

Instituto de Educao Aberta e Distncia 16

T emparelha-se com A
G emparelha-se com C

Quando o nucleotdeo estiver emparelhado correctamente, a polimerase do DNA catalisa a
formao de uma ligao entre o novo nucleotdeo e a cadeia em formao. Aps a formao da
ligao, a polimerase do DNA avana um resduo de nucleotdeo na cadeia molde posicionando-
se para promover a ligao de um novo nucleotdeo cadeia em crescimento (Fig. 11).
Cada uma das molculas de ADN formadas idntica a molcula original, tendo uma cadeia da
molcula original e uma cadeia da nova. A replicao semi-conservativa porque o ADN
formado conserva uma cadeia da molcula original e a outra cadeia nova..



Fig. 11. Replicao semi-conservativa do ADN: as fitas complementares permanecem abertas.

Cada fita serve de molde, dirigindo a sntese de uma nova fita complementar. Sendo assim a partir
de um ADN teremos duas molculas filhas de ADN.
O modelo de replicao semiconservativa permite explicar a transmisso do material gentico e a
relativa constncia da composio do ADN no decurso das divises celulares.

O ADN e seus auxiliares
Nos organismos actuais existe um cido principal, o ADN (o cido desoxirribonucleico), que
corresponde coleco de genes. Cada gene corresponde um pedao do ADN, formado por
dezenas ou centenas de nucleotdeos. Uma nica molcula de ADN pode conter muitos genes,
que sero diferentes uns dos outros no nmero e principalmente na sequncia em que as bases
azotadas esto arrumadas. Podemos dizer, resumidamente, que cada gene responsvel por um
tipo de protena e esta responsvel por uma caracterstica.




Instituto de Educao Aberta e Distncia 17
O que uma protena?
As protenas so os principais componentes dos seres vivos. Toda a molcula de protena possui
tomos de carbono, hidrognio, oxignio e nitrognio.
Esses tomos so organizados em unidades chamadas aminocidos. A molcula de protena pode
conter at milhares dessas unidades, adquirindo grandes dimenses (macromolculas) e alta
complexidade estrutural.
Encontramos 20 tipos de aminocidos fazendo parte na formao de protenas.

O arranjo dos aminocidos caracteriza o tipo de protena. Uma protena diferente de outra no
nmero, nos tipos de aminocidos e, principalmente, na sequncia em que eles esto arrumados.
Para compreender melhor essa ideia, podemos comparar a protena a uma palavra. O significado
da palavra depende das letras e da sequncia em que essas letras so usadas. Por exemplo, com as
letras c, a, s e o, possvel formar vrias palavras, como; caso, soca, ocas, caos, saco, coas, asco.
Observe que se o nmero de letras disponvel for maior, e, se as palavras puderem conter um
nmero varivel de letras, com ou sem repetio, o nmero possvel de palavras praticamente
infinito. Facto idntico ocorre com as protenas. Existem pouco mais de 20 tipos de aminocidos
e com eles podemos fazer um nmero praticamente infinito de protenas. Para mostrar como
importante a sequncia de aminocidos nas propriedades da protena, podemos citar o caso da
anemia falciforme. Os indivduos com essa doena possuem uma hemoglobina errada, que
difere da normal pela troca de um aminocido na cadeia. Em determinado trecho da cadeia h o
aminocido valina, em vez do aminocido glutmico. Essa troca altera a estrutura da protena,
provocando a doena.

O ARN
Os cidos ribonuclicos (ARN) recebem este nome devido presena, em seus nucleotdeos, do
acar ribose em vez de desoxirribose. Alm dessa diferena em relao ao ADN, as quatro bases
encontradas no ARN so adenina, guanina, citosina e uracilo, em vez de timina, presente no
ADN.. H trs tipos de ARN: o mensageiro, o transportador e o ribossomal. O ARN mensageiro
ou moldador (ARN-m), ao contrrio do ADN, formado por um nico filamento de
nucleotdeos. Cada molcula desse ARN fabricada no ncleo, tendo como molde um
determinado sector do ADN, que corresponde ao gene. Essa molcula migra ento para o
citoplasma, onde vai comandar a sntese de protenas, segundo as instrues fornecidas pelo
ADN.
Apenas um dos filamentos do ADN usado para a sntese do ARN-m. Durante a sntese, um
filamento de ADN se afasta do seu complemento, expondo suas bases, onde se encaixam os
nucleotdeos de ARN-m. Esse encaixe obedece obrigatoriedade de ligao entre as bases.
Porm, onde houver uma adenina no ADN, vai se encaixar a base uracilo. Por exemplo: para uma
sequncia TACGGACTA do ADN, haver a sequncia AUGCCUGAU no ARN-m. Assim, a
mensagem gentica que estava no cdigo de letras do ADN foi transcrita para o cdigo do
ARN-m. Por esse motivo, a sntese de ARN-m chamada de transcrio.








Instituto de Educao Aberta e Distncia 18
Comparao entre ADN e ARN:

ADN ARN
Grupo fosfato cido fosfrico cido fosfrico
Acar Desoxirribose Ribose
Bases azotadas Adenina, guanina, citosina, timina. Adenina, uracilo, citosina,
guanina.
Tipo de cadeia Dupla Simples.

Do ARN protena
A sntese de protenas o resultado final do cdigo gentico. Esse processo consiste em
traduzir a sequncia de bases do ARN-m numa cadeia de aminocidos. Assim estar sendo
cumprida, finalmente, a ordem vinda do ADN, ou seja, a mensagem gentica ser traduzida
em termos de protenas. Para que isso acontea, deve haver uma correspondncia entre a
sequncia de bases do ARN-m e a sequncia de aminocidos da protena. Cada grupo de trs
bases consecutivas (tripleto) do ARN-m corresponde a um aminocido. Descobriu-se os
tripletos de bases responsveis por cada aminocido (Tabela 3). Cada um desses tripletos foi
chamado codoo.
A partir das quatro bases do RNA-m (Adenina, Guanina, Uracilo e Citosina) agrupadas trs a trs
teremos 64 combinaes possveis e somente 20 aminocidos. Portanto podemos dizer que o
cdigo gentico degenerado, pois vrios codos determinam o mesmo aminocido como pode
ser visualizado abaixo na tabela do Cdigo Gentico.

Tabela 3. O cdigo gentico universal: os tripletos de bases do ARN-mensageiro responsveis
pelos aminocidos. Ex. O tripleto UUU codifica o aminocido fenilalanina.

Primeira
base
Segunda base Terceira
base
U C A G

U
FENILALANINA
FENILALANINA
LEUCINA
LEUCINA
SERINA
SERINA
SERINA
SERINA
TIROSINA
TIROSINA
Fim da sntese
Fim da sntese
CISTENA
CISTENA
Fim da sntese
TRIPTOFANO
U
C
A
G

C
LEUCINA
LEUCINA
LEUCINA
LEUCINA
PROLINA
PROLINA
PROLINA
PROLINA
HISTIDINA
HISTIDINA
GLUTAMINA
GLUTAMINA
ARGININA
ARGININA
ARGININA
ARGININA
U
C
A
G

A
ISOLEUCINA
ISOLEUCINA
ISOLEUCINA
METIONINA (INCIO.)
TREONINA
TREONINA
TREONINA
TREONINA
ASPARAGINA
ASPARAGINA
LISINA
LISINA
SERINA
SERINA
ARGININA
ARGININA
U
C
A
G

G
VALINA
VALINA
VALINA
VALINA
ALANINA
ALANINA
ALANINA
ALANINA
AC. ASPRTICO
AC. ASPRTICO
AC. GLUTMICO
AC. GLUTMICO
GLICINA
GLICINA
GLICINA
GLICINA
U
C
A
G

Instituto de Educao Aberta e Distncia 19
Entretanto, o codoo s realiza o trabalho de identificao dos aminocidos com o auxlio do
ARN-transportador. O ARN-transportador (ARN-t) capaz de se ligar aos aminocidos que esto
dissolvidos no citoplasma e transportar essas unidades at ARN-mensageiro.
O filamento de ARN-t possui um tripleto de bases que varia de um transportador para outro. Esse
tripleto chamado anticodo, uma vez que atravs dele que o ARN-t vai se encaixar nos
codos do ARN-m. Para cada uma das 20 espcies de aminocidos existe um transportador
diferente. Essa diferena, que torna o transportador especfico para cada aminocido, est no
anticodo. Por exemplo: se o ARN-t tem o anticodo CCG, ele vai se ligar exclusivamente ao
aminocido alanina.
Traduo sntese de protena
A traduo (passagem de ARN-m para protena) da sequncia de bases do ARN-m para
protenas feita nos ribossomas. O ARN-t, com os respectivos aminocidos, vo se encaixando
nos codo correspondentes do ARN-m. Se, por exemplo, o transportador tem o anticodo CGA,
se encaixa no codoo GCU. Assim, a sequncia de codo determina, por intermdio do
transportador, qual ser a sequncia de aminocidos. Como a sequncia de codo do ARN-m foi
modelada pelo ADN, conclumos que o ADN, indirectamente, est a determinar a sequncia de
aminocidos da protena. A sequncia de aminocidos, por sua vez, define o tipo de protena
estrutural ou enzimtica, que vai determinar as caractersticas do organismo.
Ex. A transcrio de um sector do ADN com os nucleotdeos TAC CCG AGG TAG CCG
CGT CGT TCG forma um ARNm com os tripletos AUG GGC UCC AUC GGC GCA GCA
AGC que produzem uma protena (cadeia polipeptdica) constituda pelos aminocidos
Metionina Glicina Serina Isoleucina Glicina Alanina (Tabela 4 e Fig. 12):

Tabela 4. Transcrio de um sector do ADN em ARN-m e a sntese de uma cadeia polipeptdica
(protena).

ADN



Transcrio
ARN-m



Traduo
Aminocidos que constituem a Protena
TAC AUG Metionina
CCG GGC Glicina
AGG UCC Serina
TAG AUC Isoleucina
CCG GGC Glicina
CGT GCA Alanina
CGT GCA
TCG AGC


Fig.12 Nos codos do ARN-m encaixam-se os anticodos dos ARNt que transportam os
aminocidos (metionina, glicina, serina, isoleucina, glicina, alanina...) que participam na sntese
da protena.

Instituto de Educao Aberta e Distncia 20
As Protenas so macromolculas que possuem variao enorme no peso molecular (at vrios
milhes). Apesar da grande variedade de protenas encontradas nos seres vivos, so compostos
dos mesmos vinte tipos de aminocidos. Esses aminocidos so unidos por ligaes peptdicas
formando cadeias polipeptdicas.
Portanto, as protenas variam tanto na sequncia quanto na quantidade dos vinte aminocidos,
determinando todos os tipos de protenas, que podem ser agrupadas em protenas que fazem parte
da estrutura de um ser vivo (estruturais) ou relacionada com o funcionamento deste ser (enzimas).
As Enzimas catalisam as reaces de transformao de substncias nos seres vivos.

Ciclo Celular
O ciclo celular o perodo que vai desde que se forma uma clula por diviso de uma clula Me
at que ela prpria se divide, dando lugar a duas ou quatro clula filhas dependendo do tipo de
diviso celular em causa.
Importncia das Divises Celulares
Garantir o crescimento nos organismos multicelulares;
Garantir a regenerao de tecidos e substituio de clulas mortas;
Permitir a formao de clulas sexuais (gmetas);
Garantir a ocorrncia de reproduo assexuada em certos seres unicelulares.

O ciclo celular divide se em duas fases principais:
Interfase
Fase Reprodutiva ou de diviso celular
Existem basicamente dois tipos de diviso celular: a mitose e a meiose.

Interfase . Durante a interfase, as clulas crescem, o material gentico (DNA) se duplica,
formam-se novos organelos citoplasmticos e a clula acumula energia para continuar o
processo.

A Interfase pode ser subdividida em 3 perodos: G1, S e G2
G1 o intervalo que ocorre antes da duplicao do ADN, no qual a clula apresenta
cromossomas simples isto , em forma de filamentos de cromatina. Neste perodo a clula
cresce e produz todas as protenas necessrias para a sntese de ADN.
S a inicial da palavra sntese e durante S que se d a duplicao do ADN. Durante o
perodo S produz-se uma cpia exacta de cada cromossoma, de maneira que no fim do
perodo S cada cromossoma constitudo por duas cadeias de ADN, iguais entre si, a que
chamamos cromatdeos.
G2 o intervalo que ocorre depois da sntese, por tanto, depois da duplicao dos
cromossomas. A clula novamente cresce e sintetiza protenas e inicia a diviso celular
propriamente dita.


Instituto de Educao Aberta e Distncia 21


Fig. 13a). Diagrama do ciclo celular. interfase (com as
fases G1, S e G2) e mitose.

Fig.13.b) Variao do teor do ADN no
ncleo ao longo do ciclo celular. No perodo
S h duplicao de ADN..
Tipos de Diviso Celular
Mitose
Meiose

Mitose

Uma clula, dividindo-se por mitose, d origem a duas novas clulas com o mesmo nmero de
cromossomas da clula inicial.

Importncia da Mitose
Permitir crescimento em organismos multicelulares;
Garantir a regenerao de tecidos e a substituio de clulas mortas;
Garantir a reproduo assexuada em certos organismos unicelulares.

Fases da Mitose
O esquema abaixo representa uma clula que iniciou a diviso, observa com ateno a sua
estrutura para melhor compreender s transformaes que ocorrem durante a mitose:

Instituto de Educao Aberta e Distncia 22

Fig. 14. Esquema da estrutura de uma clula no incio da diviso celular.




Tabela 5. Fases da mitose

Fase Caractersticas Esquema




Profase
Os filamentos de cromatina encurtam e
engrossam, formando os cromossomas.
Cada cromossoma constitudo de dois
cromatdeos unidos pelo centrmero
Desaparecimento do Nuclolo e da membrana
nuclear;
Duplicao dos centriolos. Sntese e organizao
das protenas do fuso acromtico.





Metfase
O fuso acromtico ocupa todo espao do
citoplasma celular;
Os cromossomas unem-se as fibras do fuso
acromtico, pelos centrmeros, e dispem-se
no equador da clula formado a placa equatorial;
Os cromossomas esto bem individualizados e
fortemente condensados.

Instituto de Educao Aberta e Distncia 23





Anfase

Separao dos centrmeros e dos cromatdeos
de cada par;
Cromatdeos idnticos migram para plos
opostos.
Cada cromatdeo (cromossoma) assim formado
vai subir para um dos plos da clula atravs das
fibras do fuso acromtico.





Telfase

Desaparecimento do fuso acromtico;
Reaparecimento do nuclolo e da membrana
nuclear;
Transformao dos cromossomas em forma de
filamentos de cromatina;
Diviso do citoplasma em duas clulas filhas.



Resultado Final da Mitose
Formao de duas clulas filhas idnticas clula Me.

Meiose

Na meiose, uma clula d origem a quatro novas clulas com a metade do nmero de
cromossomas da clula inicial. A meiose um tipo de diviso que ocorre no processo de
formao dos gmetas nos indivduos que apresentam reproduo sexuada:

Caractersticas da meiose
Ocorre em clulas reprodutivas;
O nmero de cromossomas nas clulas filhas metade do da clula me;
H emparelhamento dos cromossomas homlogos;
As clulas filhas no podem sofrer mais divises meiticas;
consiste em duas divises celulares seguidas, acompanhadas por uma s duplicao
cromossmica.

Instituto de Educao Aberta e Distncia 24


Fig. 15. Meiose: durante a primeira diviso a partir de uma diplide formam-se duas haplides de
cromossomas duplicados. Durante a segunda diviso cada clula forma duas de cromossomas simples.



Fases da Meiose

1 Diviso da Meiose diviso reducional
Forma duas clulas filhas semelhantes, tendo cada uma metade do nmero de cromossomas da
clula me, quer dizer, uma constituio cromossmica diplide separa-se em duas constituies
cromossmicas haplides, nas quais cada um dos cromossomas formado por dois cromatodeos,
unidos pelo centrmero.














Instituto de Educao Aberta e Distncia 25
Tabela 6. Fases da meiose I.

Fase Caractersticas Esquema





Prfase I

Encurtamento e individualizao dos
cromossomas em cromatdeos;
Emparelhamento de cromossomas homlogos,
ocorrendo permuta (crossing-over) de material
gentico entre eles ou seja, a troca de
segmentos homlogos de ADN entre
cromtideos (Fig. 15).
Desaparecimento do nuclolo e da membrana
nuclear;
Sntese e organizao das protenas do fuso
acromtico;



Metfase I
Cromossomas homlogos continuam
emparelhados;
Forma-se o fuso acromtico e os cromosomas
emparelhados se alinham no plano equatorial
da clula com seus centrmeros orientados
para plos diferentes.



Anfase I
No h diviso do centrmero;
Separao dos cromossomas homlogos;
Cromossomas homlogos migram para plos
opostos;




Telfase I
Desaparecimento do fuso acromtico;
Reaparecimento do nuclolo e da membrana
nuclear;
Diviso do citoplasma em duas clulas filhas;
Transformao dos cromossomas em forma de
filamentos.



Fig.15. Permuta (crossing-over) de material gentico entre cromossomas homlogos ou
seja, troca de segmentos homlogos de ADN entre cromtideos.

Instituto de Educao Aberta e Distncia 26
2 Diviso da Meiose diviso equacional
Sem haver duplicao do ADN, comea a segunda diviso da meiose que origina, a partir de cada
uma das clulas de constituio cromossmica aplide, duas clulas filhas idnticas, tambm
aplides, por diviso dos centrmeros e separao dos cromatdeos de cada cromossoma.

Tabela 7. Fases da meiose II.


Fase Caractersticas Esquema
PROFASE
II

Prfase II
Encurtamento e individualizao dos
cromossomas em cromatideos;
Desaparecimento do nuclolo e da
membrana nuclear;
Organizao das protenas do fuso
acromtico.

META

FASE II
Metfase II
O fuso acromtico ocupa todo o
espao do citoplasma celular;
Os cromossomas unem-se as fibras do
fuso acromticos pelos centrmeros e
localizam na placa equatorial da
clula.

ANAFASE
II

Anfase II

Diviso dos centrmeros e separao
dos cromatideos de cada cromossoma;
Cromatdeos irmos migram para
plos opostos

TELFAS
E II

Telfase II
Desaparecimento do fuso acromtico;
Reaparecimento do nuclolo e da
membrana nuclear;
Diviso do citoplasma de cada clula
em duas clulas filhas;
Transformao dos cromossomas em
forma de filamentos (cromatina)
Formao de quatro clulas filhas.


Resultado Final da Meiose

Formao de 4 clulas filhas aploides a partir de uma clula Me diploide.






Instituto de Educao Aberta e Distncia 27
Tabela 8. Comparao entre mitose e meiose

Mitose Meiose
Origina duas clulas
geneticamente iguais
- Origina quatro clulas
geneticamente diferentes
- No h reduo do nmero de
cromossomas
- H reduo do nmero de cromossomas
- No h permuta de material gentico entre
cromossomas homlogos
- Normalmente ocorre permuta de material
gentico entre os cromossomas homlogos
- Ocorre em clulas somticas - Ocorre em clulas germinativas
- A duplicao do DNA antecede
apenas uma diviso celular
- A duplicao do DNA antecede duas
divises celulares
- Uma clula produzida por mitose,
em geral, pode sofrer nova mitose
- Uma clula produzida por meiose no
pode sofrer meiose
- importante na reproduo
assexuada de organismos
unicelulares, na regenerao das
clulas somticas e no crescimento dos
multicelulares
- importante na produo de gmetas.

Gametognese

Introduo
Gametognese o processo pelo qual os gmetas so produzidos nos organismos dotados de
reproduo sexuada. O evento fundamental da gametognese a meiose, que reduz metade a
quantidade de cromossomas das clulas, originando clulas haplides , chamadas gmetas, o
vulo e o espermatozide. O vulo o gmeta feminino e o espermatozide o gmeta
masculino.
Tanto o vulo como o espermatozide formado por meiose de clulas denominadas
germinativas, que so diplides. So formadas em rgos especializados, as gnadas que so de
dois tipos: as femininas e as masculinas.
As gnadas femininas so os ovrios, que produzem vulos; as gnadas masculinas so os
testculos, que produzem espermatozides.
O processo de formao dos gmetas denomina-se gametognese. Sendo dois os tipos de
gametognese:
espermatognese: formao dos espermatozides;
ovognese: formao dos vulos.

Espermatognese
A Espermatognese comea na fase embrionria, em que as clulas diplides germinativas dos
testculos do embrio multiplicam-se activamente por mitose (perodo germinativo). As clulas
assim formadas so as espermatognias ou espermatcitos jovens.
A espermatognese processa-se segundo quatro perodos:
Perodo germinativo

Instituto de Educao Aberta e Distncia 28
Perodo de crescimento
Perodo de maturao
Perodo de diferenciao

Entre o nascimento e a puberdade h um perodo de pausa nas mitoses formadoras de
espermatcitos jovens. Na puberdade, o processo mittico retomado. Formam-se
constantemente mais espermatcitos jovens, que passam por um certo perodo de crescimento e
se transformam em espermatcitos primrios. Ento, comea a meiose. Cada espermatcito
primrio efectua a primeira diviso meitica, originando dois espermatcitos secundrios, que
faro, em seguida, a segunda diviso meitica originando quatro clulas haplides, as
espermatides, que por um processo de diferenciao celular, conhecido como espermiognese,
transforma-se em espermatozides.


Tabela 9. Clulas formadas em cada perodo da espermatognese.

Espermatognese
Perodo Tipo de diviso
celular
Nome de clulas
formadas
N de clulas
Germinativo Mitose Espermatognias ou
espermatcitos
jovens
1 clula pequena,
diplide.
Crescimento Espermatcitos
primrios
1 clula maior
diplide
Maturao Meiose I Espermatcitos
secundrios
2 clulas mais
pequenas, haplides.
Meiose II Espermatides 4 clulas pequenas,
haplides
Diferenciao Espermatozides 4 clulas ainda mais
pequenas, haplides

O espermatozide humano pode ser dividido em trs regies: cabea, pea intermediria e cauda.
Na cabea situam-se o ncleo e acrossoma. O acrossoma uma transformao do complexo de
golgi e nele que esto as enzimas que iro digerir a membrana do vulo, na fecundao. A pea
intermediria apresenta muitas mitocndrias, responsveis pela liberao da energia necessria
movimentao do espermatozide, que efectuada pela cauda, um flagelo modificado.
Em cada ejaculao do homem so libertados cerca de quinhentos milhes de espermatozides.
A espermatognese se processa desde a puberdade at o fim da vida.


Instituto de Educao Aberta e Distncia 29


Fig. 17. a) Espermatognese: o
espermatcito primrio diplide sofre
meiose e d origem a quatro
espermatozides haplides.
Fig. 17. b) Esquema de espermatozide

A Ovognese
Nos ovrios, encontram-se agrupamentos celulares chamados folculos ovarinos de Graff, onde
esto as clulas germinativas, que originam os gmetas.
Nas mulheres, apenas um folculo ovarino entra em maturao a cada ciclo menstrual, perodo
compreendido entre duas menstruaes consecutivas e que dura, em mdia, 28 dias. Isso significa
que, a cada ciclo, apenas um gmeta torna-se maduro e liberto no sistema reprodutor da mulher.
Os ovrios alternam-se na maturao dos seus folculos, ou seja, a cada ciclo menstrual, a
libertao de um vulo, ou ovulao, acontece em um dos dois ovrios.
A ovognese dividida em trs etapas:

Perodo germinativo ou de multiplicao ou ainda de proliferao: uma fase de mitoses
consecutivas, em que as clulas germinativas aumentam em quantidade e originam ovognias.

Nos fetos femininos humanos, a fase proliferativa termina por volta do final do primeiro trimestre
de gravidez. Portanto, quando uma menina nasce, j possui em seus ovrios cerca de 400 000
ovognias. uma quantidade limitada, ao contrrio dos homens, que produzem espermatognias
durante quase toda a vida.

Fase de crescimento: As ovognias. Passam por um notvel crescimento, com aumento do
citoplasma e grande acumulao de substncias nutritivas. Esse depsito citoplasmtico de
nutrientes chama-se vitelo, e responsvel pela nutrio do embrio durante seu
desenvolvimento.
Terminada a fase de crescimento, as ovognias transformam-se em ovcitos primrios (ovcitos
de primeira ordem ou ovcitos I). Nas mulheres, essa fase perdura at a puberdade, quando a
menina inicia a sua maturidade sexual.


Instituto de Educao Aberta e Distncia 30
Fase de maturao: Dos 400 000 ovcitos primrios, apenas 350 ou 400 completaro sua
transformao em gmetas maduros, um a cada ciclo menstrual. A fase de maturao inicia-se
quando a menina alcana a maturidade sexual, por volta de 11 a 15 anos de idade.
Quando o ovcito primrio completa a primeira diviso da meiose, origina duas clulas. Uma
delas no recebe citoplasma e desintegra-se a seguir, na maioria das vezes sem iniciar a segunda
diviso da meiose. o primeiro corpsculo (ou glbulo) polar.
A outra clula, grande e rica em vitelo o ovcito secundrio (ovcito de segunda ordem ou
ovcito II). Ao sofrer, a segunda diviso da meiose, origina o segundo corpsculo polar, que
tambm morre em pouco tempo, e o vulo, gmeta feminino, clula volumosa e cheia de vitelo.


Fig. 18. Ovognese: A meiose origina um vulo e dois glbulos polares. Na gametognese
feminina , a diviso meitica desigual porque no reparte igualmente o citoplasma entre as
clulas-filhas. Isso permite que o vulo formado seja bastante rico em substncias nutritivas.



Tabela 10. Clulas formadas em cada perodo da ovognese.

Ovognese
Perodo Tipo de diviso
celular
Nome de clulas formadas N de
clulas
Germinativo Mitose Oognias (ovognias) 1
Crescimento Ovcito Primrio 1
Maturao Meiose I Ovcito secundrio e o 1 glbulo polar. 2
Meiose II vulo e o 2glbulo polar. 2




Instituto de Educao Aberta e Distncia 31
O vulo:
O vulo e uma clula normalmente imvel e maior que o espermatozide.
no citoplasma do vulo que se encontra o vitelo ou deutoplasma, substncia que serve de
alimento ao embrio.
Comparao entre espermatognese e ovognese:
Tanto no espermatognese como no ovognese h perodo germinativo, de crescimento e de
maturao. O que diferencia os dois o perodo de diferenciao, ausente na ovognese.
Na ovognese, cada oognia d origem a um vulo e glbulos polares (clulas no funcionais) e,
na espermatognese, cada espermatognia d origem a quatro espermatozides.

A Fecundao
Para que surja um novo indivduo, os gmetas fundem-se aos pares, um masculino e outro
feminino, que possuem papis diferentes na formao do descendente. Essa fuso a fecundao
ou fertilizao.

Ambos trazem a mesma quantidade haplide de cromossomas, mas apenas os gmetas femininos
possuem nutrientes, que alimentam o embrio durante o seu desenvolvimento. Por sua vez,
apenas os gmetas masculinos so mveis, responsveis pelo encontro que pode acontecer no
meio externo (fecundao externa) ou dentro do corpo da fmea (fecundao interna).
Quando a fecundao externa, tanto os machos quanto as fmeas produzem gmetas em grande
quantidade, para compensar a perda que esse ambiente ocasiona. Muitos gmetas so levados
pelas guas ou servem de alimentos para outros animais. Nos animais dotados de fecundao
interna, as fmeas produzem apenas um ou alguns gmetas por vez, e eles encontram-se
protegidos dentro do sistema reprodutor.

Concluso
O corpo constitudo por dois tipos de clulas: as somticas que formam o corpo e as
reprodutoras que se destinam a perpetuao da espcie ou seja os gmetas. As clulas somticas
formam-se por mitoses sucessivas. A formao dos gmetas denomina-se gametognese que o
processo de formao dos espermatozides e do vulo. Partindo da unio dessas clulas
(fecundao), originam-se as clulas diplides conhecida como ovo ou zigoto que ao se
desenvolver dar origem a um novo ser,

Reproduo
Podemos definir reproduo de vrias maneiras distintas. Entre as definies temos:
a capacidade que tm os seres vivos de, ao atingirem certo estgio de desenvolvimento
originar outros semelhantes.
Processo pelo qual os seres vivos perpetuam suas espcies atravs do tempo e do espao,
produzindo outros seres semelhantes a si mesmo.
Os seres vivos apresentam vrios tipos de reproduo, mas todos esses tipos podem ser
agrupados em duas grandes categorias: a reproduo assexuada e reproduo sexuada.

Reproduo Assexuada ou Agmica
um processo biolgico pelo qual um organismo produz uma cpia geneticamente igual a si
prprio, sem haver combinao de material gentico. Esta reproduo individual e sem a
participao de gmetas.


Instituto de Educao Aberta e Distncia 32
A reproduo assexuada compreende basicamente a diviso binria e a diviso mltipla.

a) Diviso binria ou bipartio ou cissiparidade
Neste processo, a clula que constitui o corpo do indivduo se divide por mitose em outras duas
idnticas. Este mecanismo ocorre tanto com os seres procariontes como os eucariontes.
Exemplos: protozorios e bactrias:


b) Diviso mltipla
Consiste na segmentao do corpo do indivduo, originando diversos segmentos com capacidade
de formar novos indivduos completos
O caso mais simples o acto de plantar uma estaca duma planta - estamos a "reproduzi-la"
artificialmente. De facto, muitas plantas, e outros organismos, como os fungos e as algas, tm
esta capacidade, sem necessidade da interveno do homem: produzem rebentos que criam
razes e depois se tornam independentes da "planta-me".
Entre os animais, um dos exemplos mais conhecidos o da estrela-do-mar que, ao perder um dos
braos, pode regenerar os restantes, formando-se uma nova estrela-do-mar do brao seccionado.
O novo ser geneticamente idntico ao "progenitor". o que se chama um "clone
Muitos animais, como a hidra, tambm produzem gomos na sua superfcie externa que se
podem desenvolver como novos indivduos.
Reproduo Sexuada ou Gmica
O que caracteriza a reproduo sexuada sua ocorrncia custa de clulas especialmente
formadas para a finalidade reprodutiva, chamadas gmetas. Essas clulas so produzidas por
rgos especiais denominados gnadas. Esta reproduo permite uma variabilidade das espcies,
pois h recombinao gentica (troca de material gentico).
Basicamente, podemos distinguir dois mecanismos: a conjugao e a fecundao.

a) Conjugao
Nesta reproduo no h propriamente a formao de gmetas, nem existem gnadas, mas h
uma troca de material gentico entre as clulas, promovendo em cada uma delas uma
recombinao gentica. Aps esta troca, as clulas separam-se, e cada qual dar origem a novos
seres. Exemplos. Algumas bactrias e protozorios (paramecium).

b) Fecundao
a forma mais tpica e evoluda de reproduo sexuada. Consiste na unio de dois gmetas
sexualmente opostos, masculino e feminino, resultando o aparecimento da clula-ovo ou zigoto.
A fecundao constitui a nica fonte adequada para a variao do organismo, pois em uma s
clula, o zigoto, rene o material hereditrio de duas outras que determinam as caractersticas do
novo ser.


Instituto de Educao Aberta e Distncia 33
Tarefas:
I. L com ateno as seguintes perguntas e assinale opo mais correcta com X:

1. Uma clula que no apresenta um ncleo individualizado, diz-se esta ser:
a) Clula animal
b) Clula vegetal
c) Clula procariota
d) Clula eucariota

2. Os tipos de clulas so:
a) Vegetal e animal
b) Vegetal e procariota
c) Procariota e eucariota
d) Animal e eucariota

3. Uma clula muscular foi introduzida num meio muito concentrado e com elevada temperatura.
Nesta, no houve alterao do pH nem da actividade enzimtica. A esta propriedade celular
chama-se:
a) Contractilidade
b) Homeostase
c) Irritabilidade
d) Metabolismo celular

4. Se na experincia acima referida, houvesse alterao da actividade celular, ao fenmeno
chamaramos de:
a) Contractilidade
b) Homeostase
c) Irritabilidade
d) Metabolismo celular

5. A unidade estrutural dos cidos nuclicos chama-se:
a) Nucleosdeo
b) Nucleotdeo
c) Nucleina
d) cidos nuclicos

6. O tipo de ARN que carrega a informao gentica para a sntese de protenas :
a) ARNt
b) ARN-m
c) ARNr
d) ARN das protenas

7. Se a molcula de ADN tiver ATC AAA CCG a molcula de ARN-m ser:
a) UAG UUU GGC
b) UCG UUU GGT
c) TAC TTT CCG
d) CGA CCC GGT

Instituto de Educao Aberta e Distncia 34
8. Se a molcula de ARN tiver UAG UUU GGC a molcula de protena ter os seguintes
aminocidos:
a) Glicina, Fenilalanina e, valina
b) Valina, Fenilalanina e Glicina.
c) Fenilalanina, Parada e Glicina.
d) Fenilalanina, Glicina e valina.

9. Se uma molcula de ADN tiver 15 bases azotadas ser formada uma protena com:
a) 3 aminocidos
b) 4 aminocidos
c) 5 aminocidos
d) 6 aminocidos

10. . Indique as fases da mitose em que ocorrem os fenmenos abaixo citados:

a) Aumento do volume nuclear
b) Condensao mxima dos cromossomas
c) Diviso dos centrmeros
d) Diviso do citoplasma
e) Migrao dos cromossomas aos plos

11. O grfico abaixo representa a distncia entre pares de cromossomas homlogos durante a
meiose. A anfase inicia-se aos:



a) 15 minutos
b) 18 minutos
c) 20 minutos
d) 25 minutos
e) 30 minutos

12. A quantidade de ADN de uma clula somtica em metfase mittica X. Clulas do mesmo
tecido, mas nas fases G1 e G2, devem apresentar uma quantidade de DNA, respectivamente,
igual a:

a)
2
X
e X b) X e
2
X
c) 2X e X d) X e 2X



Instituto de Educao Aberta e Distncia 35
II. Responda com clareza as seguintes perguntas:

13. Usando os termos diplide e haplide, classifique as seguintes clulas:
a) espermatozide;
b) ovo;
c) clula da pele;
d) vulo.

14. Em que fase da vida celular os cromossomas so mais facilmente visveis? Porqu?

15. A interfase um perodo em que as clulas esto em repouso. Concorda com esta afirmao?
Justifique sua resposta.

16.A interfase dividida em trs perodos: G1, S e G2. O que acontece em cada um deles?

17. Justifique as seguintes afirmaes:
a) A meiose e a fecundao so fenmenos complementares.
b) Com a fecundao inicia-se a diplofase ou fase diplide no Homem.
18. Em que perodo da vida tm incio os fenmenos da ovognese?

19. A ltima fase da espermatognese a fase de diferenciao. Que fenmenos ocorrem durante
esta fase?

20. Qual a funo atribuda ao acrossoma?

21. O processo de ovognese interrompido durante a fase de maturao. Em que altura da vida
ocorre esta interrupo e quando que os fenmenos da ovognese voltam a ocorrer?

III. Assinale com V as afirmaes verdadeiras e com F as falsas.
22. Ao comparar os processos de espermatognese e de ovognese, os estudantes fizeram as
seguintes afirmaes.
a) Ambos os processos ocorrem continuamente e ao longo de toda a vida.
b) Nos testculos produzem-se milhes de espermatozides por dia, enquanto que nos ovrios
geralmente produzido um s vulo por ms.
c) A fase de diferenciao ocorre em ambos os processos.











Instituto de Educao Aberta e Distncia 36
Resoluo das tarefas:

I. Respostas s perguntas de escolha mltipla.
Resposta 1.
c)
Resposta 2.
c)
Resposta 3.
b)
Resposta 4.
c)
Resposta 5.
b)
Resposta 6.
b)
Resposta 7.
a)
Resposta 8.
b)
Resposta 9
c)
Resposta 10.
a) prfase
b) metfase
c) anfase
d) telfase
e) anfase
Resposta 11
a)
Resposta 12.
a)

II. Respostas s perguntas abertas:
Resposta 13.
a) haplide
b) diplide
c) diplide
d) haplide
Resposta 14.
Metfase, devido ao grau mximo de condensao dos cromossomas.
Resposta 15.
No, a actividade metablica intensa, com sntese de DNA, RNA e protenas.
Resposta 16.
G1: sntese intensa de RNA e protenas.
S: sntese de DNA.
G2: reduzida sntese de RNA e protenas.
Resposta 17.

Instituto de Educao Aberta e Distncia 37
a) Meiose diminuio do nmero de cromossomas para metade, diplide haplide.
Fecundao diplide haplide; a juno dos dois gmetas faz com que o vulo que
originar um novo indivduo seja novamente diplide, ou seja, que tenha o mesmo
nmero de cromossomas dos seus progenitores.
b) Diplofase ou fase diplide corresponde fase do ciclo de vida do Homem em que este
diplide.
Resposta 18.
Na fase embrionria.
Resposta 19.
Espermatdeos adquirem forma caracterstica de espermatozides; diferenciao da cauda;
eliminao de grande parte do citoplasma; reorganizao dos organelos fuso de
vesculas do aparelho de Golgi para formar o acrossoma, alongamento do ncleo, nova
disposio dos centrolos, formao dos tbulos da cauda.
Resposta 20.
Produo de enzimas cuja aco permite romper o invlucro do vulo.
Resposta 21.
interrompida na Infncia e retomada na puberdade.

III. Respostas s questes de Verdadeiro ou Falso.
Resposta 22.
a) F; b) V; c) F.








Instituto de Educao Aberta e Distncia 38
Seco II
Unidade 2- Gentica
Caro (a) amigo (a) estudante! Nesta seco ir recapitular e/ou aprender matrias da
Hereditariedade e variao at aos exerccios de monohibridismo. Chamamos ateno para
alguns dos objectivos especficos que dever perseguir ao longo do estudo desta seco, tendo em
conta que no fim do estudo e depois de resolvidos vrios exerccios, ir realizar avaliaes de
treinamento.
Esta seco corresponde a unidade temtica Gentica. Boa sorte.

So os seguintes os objectivos desta seco.

Objectivos:
Identificar e interpretar as leis de Mendel;
Descrever os caracteres hereditrios e no hereditrios;
a importncia da Gentica para o homem na preveno de doenas congnitas e outras de
carcter hereditrio;

Terminologia Gentica

GENE: um trecho de uma molcula de DNA com informao para a expresso de uma
caracterstica.

CROMOSSOMAS: peas formadas pelo enrolamento das molculas de ADN em protenas
chamadas de histonas.

LOCO (locus): posio ocupada por um gene em um cromossoma.

CROMOSSOMAS HOMLOGOS: Aqueles que possuem mesma sequncia de genes e
pareiam na ocasio da diviso por meiose.

ALELOS: variantes do gene para um carcter que resultam em diferentes formas de expresso e
ocupam o mesmo loco em cromossomas homlogos. Por exemplo, em algum loco de um dos
cromossomas da planta de ervilha est o gene para a cor da semente. Este gene pode ocorrer sob a
forma do alelo dominante (para a cor amarela) ou do alelo recessivo (para a cor verde). Em um
cromossoma homlogo ao citado, na mesma posio, tambm deve haver um alelo do gene para a
cor da semente de ervilha. Assim, tambm se pode dizer que genes ocupantes do mesmo loco em
cromossomas homlogos so alelos entre si.

GENTIPO: conjunto de genes que condicionam caractersticas em um individuo. Por exemplo,
A A homozigotico dominante (ambos os alelos que determinam o carcter so dominantes)
A a heterozigotico (os alelos que determinam o carcter so um dominante e outro recessivo)
a a homozigotico recessivo (ambos os alelos que determinam o carcter so recessivo)


Instituto de Educao Aberta e Distncia 39
FENTIPO: um carcter expresso como resultado da interaco entre um gentipo e factores
ambientais. Por exemplo, mesmo que um indivduo tiver herdado de seus parentais um gentipo
que condicione grande estatura, se no tiver uma boa alimentao (factor ambiental) no perodo
de crescimento ser baixo. Portanto:

Fentipo = Gentipo + Meio ambiente

FENOCPIA: imitao de um fentipo pela aco de agentes puramente ambientais. Por
exemplo, um diabtico que mantm uma taxa equilibrada de acar no sangue por fazer aplicao
de insulina uma fenocpia de um indivduo que no possui essa doena. Uma pessoa que pinta
os cabelos de uma cor que no natural destes tambm uma fenocpia obtida pela aplicao de
tintura.

Vida e experincia de Mendel

Gregor Johann Mendel (Heizendorf, 20 de Julho de 1822 Brno 6 de Janeiro de 1884) foi um
monge agostiniano, botnico e meteorologista austraco.

Nasceu na regio de Troppau, na Silsia, que pertencia ustria. Na sua infncia revelou-se
muito inteligente; em casa costumava observar e estudar as plantas. Sendo um brilhante estudante
a sua famlia encorajou-o a seguir estudos superiores, e mais tarde aos 21 anos a entrar num
mosteiro da Ordem de Santo Agostinho em 1843, pois no tinham dinheiro para suportar o custo
dos estudos. A Mendel tinha a seu cargo a superviso dos jardins do mosteiro.



Desde 1843 a 1854 tornou-se professor de cincias naturais na Escola Superior de Brno,
dedicando-se ao estudo do cruzamento de muitas espcies: feijes, chicria, bocas-de-drago,
plantas frutferas, abelhas, camundongos e principalmente ervilhas cultivadas na horta do
mosteiro onde vivia analisando os resultados matematicamente, durante cerca de sete anos.
Gregor Mendel, "o pai da gentica", como conhecido, foi inspirado tanto pelos professores
como pelos colegas do mosteiro que o pressionaram a estudar a variao do aspecto das plantas.

Props que a existncia de caractersticas (tais como a cor) das flores devido existncia de um
par de unidades elementares de hereditariedade, agora conhecidas como genes.

Instituto de Educao Aberta e Distncia 40

Em 1865, formula e apresenta em dois encontros da Sociedade de Histria Natural de Brno as leis
da hereditariedade, hoje chamadas Leis de Mendel, que regem a transmisso dos caracteres
hereditrios. Aps 1868, as tarefas administrativas mantiveram-no to ocupado que ele no pode
dar continuidade s suas pesquisas, vivendo o resto da sua vida em relativa obscuridade.
Morreu a 6 de Janeiro de 1884, em Brno, no antigo Imprio Austro-Hngaro hoje Repblica
Checa de uma doena renal crnica; um homem frente do seu tempo, mas ignorado durante
toda a sua vida.

Leis de Mendel
Primeira Lei de Mendel
A primeira lei de Mendel, chamada de lei da segregao ou lei da pureza dos gmetas, pode ser
enunciada da seguinte forma: na formao dos gmetas, os pares de factores se segregam.

O trabalho genial de Gregor Johann Mendel, colocou-o no nvel dos maiores cientistas da
humanidade. Sua obra Experincias com hibridizao de plantas, que no abrange mais de 30
pginas impressas, um modelo de mtodo cientfico. O primeiro cuidado que teve foi
seleccionar devidamente o material de estudo; para isso, estabeleceu alguns critrios e procurou
material que se lhes adequassem. Tais critrios consistiam principalmente em encontrar plantas
de caracteres nitidamente distintos e facilmente diferenciveis; que essas plantas cruzassem bem
entre si, e que os hbridos delas resultantes fossem igualmente frteis e se reproduzissem bem; e,
por fim, que fosse fcil proteg-las contra polinizao estranha.

Baseado nesses critrios, depois de vrias anlises, Mendel escolheu algumas variedades e
espcies de ervilhas (Pisum sativum), conseguindo um total de sete pares de caracteres distintos.
O estudo. Vamos chamar de linhagem os descendentes de um ancestral comum. Mendel observou
que as diferentes linhagens, para os diferentes caracteres escolhidos, eram sempre puras, isto ,
no apresentavam variaes ao longo das geraes. Por exemplo, a linhagem que apresentava
sementes da cor amarela produziam descendentes que apresentavam exclusivamente a semente
amarela. O mesmo caso ocorre com as ervilhas com sementes verdes. Essas duas linhagens eram,
assim, linhagens puras. Mendel resolveu ento estudar esse caso em especifico.

A flor de ervilha uma flor tpica da famlia das Leguminosae. Apresenta cinco ptalas, duas das
quais esto opostas formando a carena, em cujo interior ficam os rgos reprodutores masculinos
e femininos. Por isso, nessa famlia, a norma haver autofecundao; ou seja, o gro de plen da
antera de uma flor cair no pistilo da prpria flor, no ocorrendo fecundao cruzada. Logo para
cruzar uma linhagem com a outra era necessrio evitar a autofecundao.

Mendel escolheu alguns ps de ervilha de semente amarela e outros de semente verde, emasculou
as flores ainda jovens, ainda no maduras. Para isso, retirou das flores as anteras imaturas,
tornando-as, desse modo, completamente femininas. Depois de algum tempo, quando as flores se
desenvolveram e estavam maduras, polinizou as flores de ervilha amarela com o plen das flores
de ervilha verde, e vice-versa. Essas plantas constituem portanto as linhagens parentais. Os
descendentes desses cruzamentos constituem a primeira gerao em estudo designada por
gerao F, assim como as seguintes so designadas por F, F, etc.


Instituto de Educao Aberta e Distncia 41
Resultados em F
Todas as sementes obtidas em F foram amarelas, portanto iguais a um dos pais.
Uma vez que todas as sementes eram iguais, Mendel plantou-as e deixou que as plantas quando
florescessem, autofecundassem-se, produzindo assim a gerao F.

Resultados em F
As sementes obtidas na gerao F foram amarelas e verdes, na proporo de 3 para 1, sempre 3
amarelas para 1 verde. Inclusive na anlise de dois caracteres simultaneamente, Mendel sempre
caa na proporo final de 3:1.

Interpretao dos resultados

Para explicar a ocorrncia de somente sementes amarelas em F os dois tipos em F, Mendel
comeou admitindo a existncia de factores que passassem dos pais para os filhos por meio
dos gmetas. Cada factor seria responsvel pelo aparecimento de um carcter.

Assim, existiria um factor que condiciona o carcter amarelo e que podemos representar por V
(maisculo), e um factor que condiciona o carcter verde e que podemos representar por v
(minsculo). Quando a ervilha amarela pura cruzada com uma ervilha verde pura, o hbrido F
recebe o factor V e o factor v, sendo portanto, portador de ambos os factores. As ervilhas obtidas
em F eram todas amarelas, isso quer dizer que, embora tendo o factor v (minsculo), esse no se
manifestou. Mendel chamou de "dominante" o factor que se manifesta em F, e de "recessivo" o
que no aparece. Utiliza-se sempre a letra do carcter recessivo para representar ambos os
caracteres, sendo maiscula a letra do dominante e minscula a do recessivo.

Continuando a anlise, Mendel contou em F, o nmero de indivduos com carcter recessivo, e
verificou que eles ocorrem sempre na proporo de 3 dominantes para 1 recessivo.

Mendel chegou a concluso que o factor para verde s se manifesta em indivduos puros, ou seja
com ambos os factores iguais a v (minsculo). Em F as plantas possuam tanto os factores V
quanto o factor v sendo, assim, necessariamente amarelas. Podemos representar os indivduos da
gerao F como Vv (heterozigtico, e, naturalmente, dominante). Logo para poder formar
indivduos vv (homozigticos recessivos) na gerao F os gmetas formados na fecundao s
poderiam ser vv.

Esse facto no seria possvel se a gerao desse origem a gmetas com factores iguais aos deles
(Vv). Isso s seria possvel se ao ocorrer a fecundao houvesse uma segregao dos factores V e
v presentes na gerao F, esse factores seriam misturados entre os factores V e v provenientes do
pai e os factores V e v provenientes da me. Os possveis resultados sendo: VV, Vv, vV e vv.
Esse fato foi posteriormente explicado pela meiose, que ocorre durante a formao dos gmetas.
Mendel havia criado ento sua teoria sobre a hereditariedade e da segregao dos factores





Instituto de Educao Aberta e Distncia 42
1 Lei de Mendel
Cruzamentos bsicos
Agora, vamos relembrar o caso da cor das sementes de ervilhas estudado por Mendel utilizando
termos da gentica.

ALELOS GENTIPOS GMETAS FENTIPOS
V (dominante) V V Somente V amarela
v (recessivo) V v V e v amarela
v v Somente v verde

Vamos usar como modelo para observar os cruzamentos bsicos com monohibridismo (anlise de
um nico par de alelos) o albinismo. O albinismo uma doena recessiva na qual o indivduo
tem deficincia na produo de melanina, um pigmento da pele. O gene dominante A condiciona
pigmentao normal da pele e seu alelo a condiciona a ausncia de pigmento. Portanto,
indivduos albinos so sempre homozigoticos recessivos para este carcter e indivduos
homozigoticos dominantes ou heterozigotos tm fentipo normal quanto pigmentao da pele
Assim,
Gentipos Parentais Proporo genotpica em F
1
Proporo fenotpica em F
1

A A x A A 100% A A 100% normal
A A x A a 50% A A, 50% A a 100% normal
A A x a a 100% A a 100% normal
A a x a a 50% A a, 50% a a 50% normal, 50% albino
A a x A a 25% A A, 50% A a, 25% a a 75% normal, 25% albino
a a x a a 100% a a 100% albino

Cruzamento-teste
Um fentipo dominante pode resultar tanto de um gentipo homozigotico dominante quanto de
um gentipo heterozigotico. Portanto, s vezes voc sabe que um indivduo tem fentipo
dominante, mas no tem certeza de seu gentipo. Essa dvida pode ser resolvida pelo
cruzamento-teste, que consiste em cruzar tal indivduo com um homozigotico recessivo e
observar a proporo fenotpica da prole. Vamos exemplificar novamente atravs do albinismo.

Normal (A _) x Albino (a a) : Se o indivduo de pigmentao normal for homozigotico
dominante (A A), a F
1
ter 100% de indivduos normais (100% A a). Porm, se o indivduo
normal for heterozigotico (A a), a F
1
ter 50% de indivduos normais (50% A a) e 50% de
albinos (50% a a).



Instituto de Educao Aberta e Distncia 43
Co-dominncia (herana sem dominncia)
H casos em que os genes alelos no exercem relao de dominncia ou recessividade entre si,
sendo denominados co-dominantes. Neste caso, haver dois fentipos diferentes para os dois
tipos de homozigoticos e o heterozigotico apresentar um fentipo intermedirio.

Um exemplo bastante comum a expresso da cor das flores da planta Mirabilis jalapa, chamada
popularmente de maravilha. Nesta o gentipo V V condiciona flores vermelhas, o gentipo B B
condiciona flores brancas, e o gentipo V B condiciona flores rseas (fentipo
intermedirio).Observe:


Assim, conclumos que a proporo fenotpica resultante do cruzamento entre plantas rseas com
co-dominncia de 1 : 2 : 1.
Segunda Lei de Mendel
Segunda Lei de Mendel Tambm conhecida como Lei da segregao independente dos genes.
Mendel em suas experincias tambm cruzou plantas que diferiam em relao a dois pares de
alelos. Neste cruzamento, que objectivava esclarecer a relao de diferentes pares de alelos, ele
cruzou plantas que possuam sementes amarelas e lisas com plantas que possuam sementes
verdes e rugosas. A descendncia F1 resultante entre o cruzamento dos progenitores
homozigticos formada por hbridos (heterozigticos) para dois pares de genes. A descendncia
F1 (GgWw) formada por dibridos e, por extenso, o cruzamento GGWW x ggww um
cruzamento dibrido. Sabia-se, graas experincias anteriores, que os alelos que determinavam
sementes amarelas e lisas eram dominantes sobre seus respectivos alelos, que produziam
sementes verdes e rugosas. Assim, considerando dois deles tinham-se as informaes: Carcter
cor das sementes

Instituto de Educao Aberta e Distncia 44
J tinha sido observado que o padro amarelo (V_) apresentava dominncia sobre o padro verde
(vv)
Carcter aspecto da casca da semente
Neste caso, j se observa que o padro de casca lisa (R_) era dominante sobre o tipo casca rugosa
( rr)
estudo
Os cruzamentos foram realizados no mesmo esquema da elaborao da primeira lei. A gerao
parental (P) utilizava duas plantas homozigticas para as caractersticas estudadas, assim uma
duplo-dominante (AA) era cruzada com uma duplo-recessiva (aa). Desse cruzamento surgiu um
hbrido heterozigtico (Aa). Mendel seleccionou dois caracteres das sete estudadas na primeira
lei para comparao, ervilhas amarelas (AA) e lisas (BB) (duplo-dominante) e ervilhas verdes
(aa) e rugosas (bb) (duplo-recessiva).No primeiro cruzamento (F1) todas as ervilhas obtidas eram
amarelas (Aa) e lisas (Bb). Na segunda gerao (F2) foram obtidas ervilhas amarelas (A_) e lisas
(B_), amarelas (A_) e rugosas (bb),verdes (aa) e lisas (B_) e verdes(aa) e rugosas (bb), na
proporo, respectivamente, 9:3:3:1 (P)AA/aa + BB/bb (F1)AAxaa=Aa BBxbb=Bb
(F2)AaxAa=AA/Aa/Aa/aa BbxBb=BB/Bb/Bb/bb

Cruzamentos possveis de todos os gmetas obtidos

Gmetas AB Ab aB ab
AB AABB AABb AaBB AaBb
Ab AABb AAbb AaBb Aabb
aB AaBB AaBb aaBB aaBb
ab AaBb Aabb aaBb aabb

A_: Dominante (cor Amarela). B_: Dominante (forma Lisa). aa: Recessivo (cor Verde). bb:
Recessivo (forma Rugosa).

Obs.: Foram obtidos dezasseis resultados entre os cruzamentos dos possveis tipos de
cromossomas. Obs.2: A proporo obtida na experincia decorre da soma do nmero de
ocorrncias. Exemplo: Amarela e Lisa(A_B_): 1/16x9= 9/16.
Assim na gerao F2 constata-se a existncia de quatro fentipos distintos, sendo dois idnticos
da gerao parental (A_B_) e dois novos(A_bb e aaB_). Todos os resultados confirmaram que os
genes de cada carcter passavam de forma independente dos demais, ou seja, o fentipo
dominante - amarelo - no era transmitido obrigatoriamente com o fentipo dominante - liso, o
mesmo ocorreu com a transmisso dos fentipos recessivos - verde e rugoso - para os
descendentes.
Concluso
A segunda Lei de Mendel tambm denominada de lei da segregao independente foi criada por
Gregor Mendel diz que, as diferenas de uma caracterstica so herdadas independentemente das
diferenas em outras caractersticas


Instituto de Educao Aberta e Distncia 45
Tarefas de determinao de sexo e herana
1. O que so genes?

02. Explique a relao existente entre gentipo e fentipo.

03. O termo gentipo refere-se ao:

a) conjunto de todos os caracteres de um organismo;
b) conjunto de caracteres externos de um organismo;
c) conjunto de caracteres internos de um organismo;
d) conjunto de cromossomas de um organismo;
e) conjunto de genes de um organismo.

04. O fentipo de um indivduo :
a) herdado dos pais;
b) independente do gentipo;
c) independente do ambiente;
d) o resultado da interaco do gentipo com o ambiente;
e) o conjunto de cromossomas.

05. No milho, um gene produz gros vermelhos se a espiga for exposta luz, mas, se as espigas
ficarem cobertas, os gros permanecem brancos.
O fenmeno descrito ilustra:

a) a actuao do meio das mutaes;
b) o processo da seleco natural;
c) a influncia do ambiente na alterao do gentipo;
d) a interaco do gentipo com o meio ambiente;
e) a transmisso dos caracteres adquiridos.

06. Nas ervilhas, a cor vermelha da flor condicionada por um gene dominante B e a cor branca,
pelo seu alelo recessivo b. Que tipos de gmetas produzem as plantas BB, bb e Bb?

Resposta 6 : Gentipos - Gmetas
BB ; B
bb ; b
Bb ; B e b

07. Nas cobaias, o gene B para pelagem preta dominante sobre b, que condiciona pelagem
branca. Duas cobaias pretas heterozigticas so cruzadas. Calcule:

a) a proporo genotpica;
b) a proporo fenotpica.

08. Que percentagem dos espermatozides de um macho Aa conter o gene recessivo?

a) 25% ; b) 30% ; c) 50%; d) 75%; e) 100%

Instituto de Educao Aberta e Distncia 46
09. A pelagem das cobaias pode ser arrepiada ou lisa, dependendo da presena do gene
dominante L e do gene recessivo l. O resultado do cruzamento entre um macho liso com uma
fmea arrepiada heterozigtica :

a) 50% lisos e 50% arrepiados heterozigticos;
b) 50% arrepiados e 50% lisos heterozigticos;
c) 100% arrepiados;
d) 100% lisos;
e) 25% arrepiados, 25% lisos e 50% arrepiados heterozigticos.

10. Em uma raa bovina, animais mochos (M) so dominantes a animais com cornos (m). Um
touro mocho foi cruzado com duas vacas. Com a vaca I, que tem cornos, produziu um bezerro
mocho. Com a vaca II, que mocha, produziu um bezerro com cornos. Assinale a alternativa que
apresenta correctamente os gentipos dos animais citados:

TOURO VACA I VACA II

a) Mm mm Mm
b) Mm Mm Mm
c) MM mm Mm
d) MM Mm MM
e) Mm mm MM
Resoluo das tarefas de determinao de sexo e herana
RESPOSTA 1: Genes so segmentos da molcula de ADN, localizados nos cromossomas,
estruturas intranucleares.

RESPOSTA 2: Gentipo a constituio gentica do indivduo.
Fentipo qualquer aspecto de um organismo resultante da interaco do gentipo com o
meio ambiente.

RESPOSTA 3: e)
RESPOSTA 4: d)
RESPOSTA 5: d)

Resposta 6 : Gentipos - Gmetas
BB ; B
bb ; b
Bb ; B e b









Instituto de Educao Aberta e Distncia 47
Resposta 7:


B b
B BB Bb
b Bb bb


a) 1/4 BB; 1/2 Bb; 1/4 bb
b) 3/4 pretas; 1/4 brancas

RESPOSTA 8: c)
RESPOSTA 9: a)
RESPOSTA 10: a)


Introduo Anlise de Genealogias

Atravs do estudo das genealogias possvel identificar vrias formas de herana e, para isto,
usamos o heredograma (carta genealgica ou pedigree), que a representao grfica dos
indivduos relacionados por parentesco. As convenes mais utilizadas na elaborao dos
heredogramas so:


Abaixo, citamos alguns critrios que no so rgidos, mas que facilitam a identificao de
determinado padro de herana, quando analisamos um heredograma.
1. Herana autossmica dominante:
1.1 A caracterstica ocorre igualmente em homens e mulheres.

Instituto de Educao Aberta e Distncia 48
1.2 Indivduos afectados so frequentemente filhos de casais onde pelo menos um dos
cnjuges afectado, dessa forma, um casal normal no tem filhos afectados (a no ser
que haja mutao ou cruzamento incompleto).
1.3 A caracterstica ocorre em todas as geraes.

2. Herana autossmica recessiva:
2.1 Os dois sexos so igualmente afectados.
2.2 - Os indivduos afectados resultam de cruzamentos consanguneos em geral
2.3 - O carcter aparece tipicamente apenas entre irmos, mas no em seus pais,
descendentes ou parentes.
2.4 - Em mdia, dos irmos da resoluo so afectados.

3. Herana recessiva ligada ao sexo (ao X):
3.1 A incidncia mais alta nos homens (sexo heterogamtico) do que nas mulheres
(sexo homogamtico).
3.2 O carcter passado de um homem afectado, atravs de todas as suas filhas para
metade dos filhos delas.
3.3 - O carcter nunca transmitido directamente de pai para filho.

4. Herana dominante ligada ao sexo (ao X):
4.1 Os homens afectados transmitem o carcter para todas as suas filhas e nenhum de
seus filhos.
4.2 - As mulheres afectadas que so heterozigticas transmitem o carcter para a metade
de seus filhos de ambos os sexos.
4.3 - As mulheres afectadas que so homozigticas transmitem o carcter para toda a sua
prole.

A herana dominante ligada ao X no pode ser distinguida da herana autossmica
dominante pela prole das mulheres afectadas, mas apenas pela prole dos homens
afectados.















Instituto de Educao Aberta e Distncia 49
Exerccios de Genealogias

1. Numere no heredograma abaixo as geraes I, II, III e IV e os respectivos indivduos:


a) Quantos homens esto representados nessa genealogia?
b) Quantas mulheres esto representadas?
c) Quantos indivduos esto a representados?
d) Quantos afectados?
e) Indique (pelos respectivos nmeros) que casais possuem maior nmero de descendentes.


2. O plo dos porquinhos da ndia determinado por um gene dominante B e o plo branco pelo
seu alelo recessivo b. Suponha que II.1 e II.4 no sejam portadores de alelos recessivos. Calcule a
probabilidade de um descendente de III.1x III.2 apresentar plos brancos.





3. Desenhe um heredograma representando os seguintes dados genticos:
Um casal normal para viso em cores teve quatro filhos: trs mulheres e um homem, todos
normais, nessa ordem de nascimento. A primeira filha casa-se com um homem normal e tem
quatro crianas, todas normais, sendo duas mulheres um homem e uma mulher, nessa ordem. A
segunda filha casa-se com um homem normal e tambm tem quatro crianas: uma menina
normal, um menino daltnico, um menino normal e o ltimo daltnico. Os demais filhos do casal
ainda no tm descendentes.






I
II
III

Instituto de Educao Aberta e Distncia 50
4. O heredograma abaixo apresenta uma famlia com indivduos portadores de fibromatose
gengival (aumento da gengiva devido a um tumor).



a) Qual o tipo de herana envolvida?
b) Quais os indivduos seguramente homozigticos do heredograma?
c) Quais os indivduos seguramente heterozigticos do heredograma?


Sistema ABO

Introduo:
Foi no sculo XX que a transfuso de sangue, adquiriu bases mais cientficas. Em 1900 foram
descritos os grupos sanguneos A, B e O por Landsteiner e em 1902 o grupo AB por De Costello
e Starli. A descrio do sistema Rh foi posterior (1940), por Landsteiner e Wiener.

Os grupos sanguneos so constitudos por antgenos que so a expresso de genes herdados da
gerao anterior. Quando um antgeno est presente, isto significa que o indivduo herdou o gene
de um ou de ambos os pais, e que este gene poder ser transmitido para a prxima gerao. O
gene uma unidade fundamental da hereditariedade, tanto fsica quanto funcionalmente.

Sistema ABO
H vrios grupos sanguneos herdados independentemente entre si. So conhecidos diversos
sistemas de grupo sanguneos. Entre eles podemos citar os sistemas ABO, Rh, MNS, Kell, Lewis,
etc. O sistema ABO o de maior importncia na prtica transfusional por ser o mais antignico,
ou seja, por ter maior capacidade de provocar a produo de anticorpos, seguido pelo sistema Rh.
Os antgenos deste sistema esto presentes na maioria dos tecidos do organismo . Fazem parte
deste sistema trs genes A, B e O podendo qualquer um dos trs ocupar o loco ABO em cada
elemento do par de cromossomas responsveis por este sistema.

Os genes ABO no codificam directamente seus antgenos especficos, mas enzimas que tem a
funo de transportar acares especficos, para uma substncia precursora produzindo os
antgenos ABO. O indivduo do grupo AB possuidor de um gene A e de um gene B, tendo sido
um herdado da me e o outro do pai. Ele possui nos seus glbulos vermelhos os antgenos A e B,
seu gentipo AB.

No caso do grupo O, foi herdado do pai e da me o mesmo gene O. O gene O amorfo, isto ,
no produz antgeno perceptvel. As clulas de grupo O so reconhecidas pela ausncia de

Instituto de Educao Aberta e Distncia 51
antgeno A ou B. Quando o gene O herdado ao lado de A, apenas o gene A se manifesta; e se
herdado ao lado do gene B apenas o gene B se manifesta.

Ao realizarmos os testes rotineiros em laboratrio, no podemos diferenciar os indivduos BO e
BB, e nem AO e AA. Os smbolos A e B, quando nos referimos a grupos, indicam fentipos,
enquanto que AA, BO etc. so gentipos (ver quadro abaixo).

FENTIPO GENTIPO
A AO
A AA
O OO
B BO
B BB
AB AB

dito homozigtico quando o indivduo possuidor de genes iguais (AA, BB, OO), e
heterozigtico quando os genes so diferentes (AO, BO, AB)

A CLASSIFICAO SANGNEA

A determinao do grupo sanguneo deste sistema, feito usando dois tipos de teste.
1 Atravs da identificao da presena de antgenos nos eritrcitos, usando reactivos compostos
de anticorpos conhecidos (anti-A, anti-B, anti-AB). Esta a chamada classificao ou tipagem
directa .
2 Atravs da identificao da presena de anticorpos no soro/plasma usando reactivos
compostos de antgenos conhecidos (hemcias A e hemcias B). Esta a classificao ou tipagem
reversa (ver quadro abaixo).

GRUPO
SANGUNEO
SORO DE
TIPAGEM
Anti-A Anti-B
HEMCIAS
DE TIPAGEM
A B
ANTGENO ANTICORPO
A + - - + A Anti-B
B - + + - B Anti-A
AB + + - - AB Ausente
O - - + + - Anti-A e Anti-B

Regularmente as pessoas expostas a um antgeno que no possuem, podem responder com a
produo de um anticorpo especfico para este antgeno. Entretanto, h alguns antgenos que
possuem uma estrutura que se parece muito com antgenos de bactrias e planta, aos quais

Instituto de Educao Aberta e Distncia 52
estamos constantemente expostos. Nestes casos, ocorre a produo de anticorpos a partir do
constato com as bactrias e plantas, e no ao antgeno eritrocitrio.

Neste grupo encontramos os antgenos do sistema ABO. Por este processo, os indivduos com
idade superior a seis meses, possuem o anticorpo contra o antgeno que no tem, pois j foram
expostos a essas bactrias e plantas, atravs da alimentao. Estes anticorpos so chamados de
isoaglutininas ou aglutininas naturais. Observando o quadro acima podemos perceber a presena
dos antgenos e anticorpos em cada grupo sanguneo. nesta presena ou ausncia de antgenos e
anticorpos que se baseia a tipagem sangunea e a escolha do sangue a ser transfundido.

As transfuses podem ser:
* Isogrupo quando doador e receptor so do mesmo grupo ABO* Heterogrupo doador e
receptor so de grupo sanguneo diferente

A escolha do sangue se baseia em que o indivduo no pode ser transfundido com um sangue que
possua um antgeno que ele no tem, pois o anticorpo presente no seu plasma, contra esse
antgeno, iria reagir com essas hemcias transfundidas. Em vista disso e observando o quadro
acima, fica claro que um indivduo do grupo A no pode tomar sangue B e assim por diante.
Sempre que possvel deve se transfundir sangue isogrupo, pois se por exemplo, transfundimos
um sangue do grupo O a um paciente do grupo A, junto com as hemcias transfundidas temos
uma quantidade de plasma onde h anticorpo anti-A, que poder reagir com as hemcias deste
paciente causando um grau de hemlise maior ou menor, mas que poder ter um significado a
depender do quadro clnico do paciente. Cada caso deve ser analisado pelo hemoterapeuta .
Este sistema ABO, tambm pode ocasionar incompatibilidade materno-fetal, com
desenvolvimento da doena hemoltica peri-natal. Apresenta tambm importncia em
transplantes renais ou cardaco, com menor papel nos hepticos ou de medula ssea. Em alguns
processos pode ocorrer a perda parcial do antgeno A ou B, como em algumas leucemias.
No soro , parte do plasma onde se concentram anticorpos ( protenas de defesa), so usados
contra o antgeno.

B : no grupo A
A : no grupo B
nenhum : no grupo AB
A, B, AB : no grupo O
- AB : Receptor universal
- O : Doador universal

Sistema Rh:
Quando referimos que o indivduo Rh Positivo, quer dizer que o antgeno D est presente. O
antgeno D foi o primeiro a ser descoberto nesse sistema, e inicialmente foi considerado como
nico. Alm deste, foram identificados quatro outros antgenos C, E, c, e, pertencentes a este
sistema. Aps os antgenos A e B (do sistema ABO), o antgeno D o mais importante na prtica
transfusional.
Em algumas situaes podemos ter uma expresso fraca do antgeno D . Isso pode ocorrer por:

* Variaes quantitativas que so transmitidas geneticamente

Instituto de Educao Aberta e Distncia 53
* Efeito de posio, sendo o mais conhecido o enfraquecimento do antgeno D quando o gene C
est na posio trans em relao ao D
* Expresso parcial por ausncia de um dos mltiplos componentes do antgeno D

Estes casos so chamados na prtica de Rh fraco, e se refere ao que era conhecido anteriormente
como D.
Ao contrrio do que ocorre com os antgenos A e B, as pessoas cujos eritrcitos carecem do
antgeno D, no tem regularmente o anticorpo correspondente. A produo de anti-D quase
sempre posterior a exposio por transfuso ou gravidez a eritrcitos que possuem o antgeno
D. Uma alta proporo de pessoas D-negativas que recebem sangue D-positivo produzem anti-D.
Se encontramos um anticorpo deste sistema podemos concluir que ocorreu uma imunizao
atravs de uma transfuso ou de uma gravidez. Qualquer antgeno deste sistema capaz de
provocar a produo de anticorpos, e assim a gerar situaes de incompatibilidade.
Aloimunizaes contra antgenos E, c, e, C so tambm observadas em pacientes
politransfundidos, mas com uma frequncia inferior.
A maioria dos casos de Doena Hemoltica do Recm-Nascido (DHRN) devida ao anti-D. A
profilaxia por imunoglobulinas anti-D diminuiu o nmero de aloimunizaes maternas contra o
antgeno D, mas no contra E, c, e, C

anti-D.
nmero de aloimunizaes maternas contra o antgeno D, mas no contra E, c, e, C
anti-D.
nmero de aloimunizaes maternas contra o antgeno D, mas no contra E, c, e,
Na rotina, realizada a tipagem, apenas, para o antgeno D nesse sistema. Os outros antgenos (E,
C, c, e), so determinados em situaes onde ocorre incompatibilidade, e necessrio obter
sangue que no possuam algum desses antgenos.
A produo de anticorpos contra estes antgenos ocorre de forma semelhante a produo de anti-
D. A capacidade de provocar a produo de anticorpos destes antgenos varia. Partindo do mais
imunognico, temos D > c > E > C > e.

TRANSFUSO
Para efeito de transfuso, considerado que pacientes Rh positivos podem tomar sangue Rh
positivo ou negativo, e que pacientes Rh negativos devem tomar sangue Rh negativo.
Para os pacientes D fraco, existem alguns critrios a serem observados. Se o antgeno D est
enfraquecido por interaco gnica, estando o mesmo presente integralmente, o paciente poder
tomar Rh positivo ou negativo. Porm nos casos em que o antigeno D est enfraquecido por
ausncia de um dos componentes, pode ocorrer produo de anticorpos contra o antigeno D na
sua forma completa. Como rotineiramente, no identificamos a causa que leva a expresso
enfraquecida do antgeno, acostuma-se a dar preferncia a usar sangue Rh negativo para os
pacientes Rh fraco. (1)
Existem situaes clnicas onde necessrio avaliar o risco X benefcio, e fazer outras opes.
Neste momento necessrio o acompanhamento do hemoteraputa.




Instituto de Educao Aberta e Distncia 54
Resumo:
Gentipo Dd , DD dd
Fentipo Rh + Rh -

Rh - : no tem nas paredes da hemcia o factor Rh ;
Se um Rh - doar sangue para um Rh+ , ele estar entregando hemcias lisas e nada acontece;
Se um Rh + doar sangue para um Rh -, ele estar entregando uma protena estranha (factor Rh ),
no soro do receptor pode haver anticorpos, assim pode ocorrer a aglutinao do sangue .
Eritroblastose Fetal: (Doena hemoltica do recm - nascido)
A me e o feto possuem Rh diferentes. ( me - , filho + ).
Nos ltimos meses de gravidez , a criana comprime o abdmen da me . E comum haver
contacto de sangue materno e sangue fetal .Quando isso ocorre o sistema imunolgico activado
, iniciando a produo de anticorpos . No acontece nada dessa primeira vez. Mas , no caso de
uma segunda gravidez , o sistema imunolgico produz anticorpos com mais rapidez e quantidade
.O soro da me passa para o feto , ocorrendo uma reaco nas hemcias : o bebe recebe sangue
Rh - , podendo assim ocorrer um aborto . Em caso de nascimento o bebe apresenta problemas
hepticos .
A me fica muito sensibilizada.
evitada atravs de vacinas.

Tarefas resolvidas
Grupos Sanguneos
01. Na presena de aglutinina correspondente, as hemcias que contm o aglutinognio se
aglutinam. Pode-se dessa forma, determinar o grupo sanguneo do sistema ABO a que pertencem
os indivduos. Foi testado o sangue de dois indivduos (I e II) com os soros-padro anti-A e anti-
B, obtendo-se os seguintes resultados:



A que grupos sanguneos pertencem, respectivamente, os indivduos I e II?

02. Por que o indivduo do grupo O pode doar seu sangue a qualquer pessoa? Por que uma pessoa do
grupo AB pode receber sangue de qualquer tipo?



Instituto de Educao Aberta e Distncia 55
03. Um homem do grupo sanguneo AB casado com uma mulher cujos avs paternos e maternos
pertencem ao grupo sanguneo O. Esse casal poder ter apenas descendentes:

a) do grupo O;
b) do grupo AB;
c) dos grupos AB e O;
d) dos grupos A e B;
e) dos grupos A, B e AB.


04. Um banco de sangue possui 5 litros de sangue tipo AB, 3 litros tipo A, 8 litros tipo B e 2 litros
tipo O. Para transfuses em indivduos dos tipos O, A, B e AB esto disponveis, respectivamente:


a) 2, 5, 10 e 18 litros;
b) 2, 3, 5 e 8 litros;
c) 2, 3, 8 e 16 litros;
d) 18, 8, 13 e 5 litros;
e) 7, 5, 10 e 11 litros.


05. Dois caracteres com segregao independente foram analisados em uma famlia: grupos
sanguneos do sistema ABO e miopia. A partir dessa anlise, obtiveram os seguintes dados:

I 1, 2 e 3 pertencem ao grupo O.
II 4 pertence ao grupo AB.
III 4 e 5 so mopes.



Qual a probabilidade de o casal 5 e 6 ter uma criana do grupo sanguneo O e mope?

a) 1 / 16
b) 1 / 8
c) 1 / 4
d) 1 / 2
e) 3 / 4




Instituto de Educao Aberta e Distncia 56
06. Como se forma o anti-Rh no corpo humano?

07. Uma mulher que nunca recebeu transfuso sangunea teve trs filhos. O primeiro e o terceiro
nasceram normais e o segundo, com eritroblastose fetal. Quais so os fentipos e os gentipos
para o factor Rh dos indivduos acima citados?


08. (FEI) Para que haja possibilidade de ocorrncia de eritroblastose fetal (doena hemoltica do
recm-nascido), preciso que o pai, a me e o filho tenham, respectivamente, os tipos
sanguneos:

a) Rh
+
, Rh
-
, Rh
+

b) Rh
+
, Rh
-
, Rh
-

c) Rh
+
, Rh
+
, Rh
+

d) Rh
+
, Rh
+
, Rh
-

e) Rh
-
, Rh
+
, Rh
+



09. Um indivduo de tipo sanguneo O, Rh
-
, filho de pais tipo sanguneo A, Rh
+
, pretende se casar
com uma jovem de tipo sanguneo A, Rh
-
, filha de pai de tipo sanguneo O, Rh
-
e me AB, Rh
+
.
A probabilidade de o casal ter filhos com o mesmo fentipo do pai ser:

a) 1/4
b) 1/2
c) 1/3
d) 1/8
e) 1/16


10. Um casal cujo filho do grupo sanguneo A, com factor Rh positivo, pode ter os seguintes
gentipos:

a) |
A
|
B
Rhrh e |
B
|
B
rhrh
b) |
A
|
A
rhrh e |
B
|
B
RhRh
c) |
B
| Rh
rh
e ii rhrh
d) |
B
|
B
rhrh e |
A
|
B
RhRh
e) |
A
|
B
rhrh e ii Rhrh











Instituto de Educao Aberta e Distncia 57
Resoluo das tarefas

RESOLUO 1: I do grupo B; II pertence ao grupo O.

RESOLUO 2: O doador universal por no apresentar aglutinognios nas
hemcias.
AB receptor universal por no possuir aglutininas no plasma.

RESPOSTA 3: D

RESPOSTA 4: A

RESPOSTA 5: C

RESOLUO 6: O anti-Rh produzido nos organismos Rh negativos que
recebem, injectado, sangue Rh
+
.

RESOLUO 7: Mulher Rh
-
(rr); marido Rh
+
(Rr); 1 filho Rh
+
(Rr); 2 filho Rh
+

(Rr); 3 filho Rh
-
(rr).

RESPOSTA 8: A

RESPOSTA 9: B

RESPOSTA 10: E



HEREDITARIEDADE

EM RELAO AO SEXO

Genes ligados ao sexo
Genes parcialmente ligados ao sexo
Genes influenciados pelo sexo
Genes limitados ao sexo


GENES LIGADOS AO SEXO

CONCEITO
Refere-se herana de genes localizados na poro no homloga do cromossoma X (mamferos,
Drosophila, etc.) ou no cromossoma anlogo Z.



Instituto de Educao Aberta e Distncia 58
CARACTERSTICAS
Os seguintes factos so evidncias de uma herana ligada ao sexo:
Herana cruzada em cruzamentos onde a fmea recessiva;
Cruzamentos recprocos com resultados diferentes;
Herana do tipo av-neto. Neste caso o fentipo do av desaparece na F1 e volta aparecer na F2.

EXEMPLOS

Cor de olhos em Drosophila


Fentipo Macho Fmea
Vermelho XB Y XBXB XBXb
Branco Xb Y XbXb

Daltonismo
O daltonismo um defeito na viso em que o indivduo confunde cores. Comumente a
confuso se faz entre o verde e o vermelho e da o nome, dado em relao ao qumico
Dalton, que sofria desta anomalia. Este defeito provocado por um alelo recessivo ligado ao
sexo.

Fentipo Homem Mulher
Normal XDY XDXD ou XDXd
Daltnico XdY XdXd

Hemofilia
A hemofilia uma anomalia na capacidade de coagulao do sangue, regulada por um alelo
recessivo ligado ao sexo. uma doena que causou grande mal s famlias reais europeias,
depois de ser introduzida pelos descendentes da rainha Vitria. Os sintomas apresentados pelo
hemoflico so: hemorragia quer por ferimento ou no; sangramento de natureza de fluxo lento e
persistente; sangramento duradouro. Pode durar semanas e ento levar a uma anemia profunda.
Verificou-se que a coagulao em tubo de ensaio poderia levar 30 minutos ou horas se o sangue
fosse de um hemoflico. Com relao a este carcter so verificados os seguintes gentipos e
fentipos:
Fentipo Homem Mulher
Normal XHY XHXH ou XHXh
Hemoflico XhY XhXh
Cromossomas Sexuais:
2n = 46
23 pares de cromossomas
22 pares autossmicos
1 par sexual

Instituto de Educao Aberta e Distncia 59
1) Um homem destro, heterozigtico para este carcter, que no possui a capacidade de enrolar a
lngua, casa-se com uma mulher canhota, com a capacidade de enrolar a lngua, heterozigtica
para o ltimo carcter. Qual a probabilidade de o casal mencionado vir a ter uma filha
homozigtica para ambos os caracteres?

Pelo enunciado vemos que ser destro uma caracterstica dominante, em relao ao canhoto, e
que ter a capacidade de enrolar a lngua tambm uma caracterstica dominante, em relao a
no conseguir faz-lo, certo?
Considerando que:
A - alelo que condiciona o facto de se ser destro
a - alelo que condiciona o facto de se ser canhoto
B alelo que condiciona a capacidade de enrolar a lngua
b alelo que condiciona a incapacidade de enrolar a lngua
O Gentipo do homem destro, heterozigtico para este carcter, que no possui a capacidade de
enrolar a lngua Aabb
O Gentipo da mulher canhota, com a capacidade de enrolar a lngua, heterozigtica para o
ltimo carcter aaBb
Tm vrias formas de resolver o problema, todas envolvendo a conjuno de probabilidades
independentes:



Forma I:





Instituto de Educao Aberta e Distncia 60
Forma II:
13) A rvore genealgica refere-se a uma famlia com casos de alcaptonria (doena gentica
rara, que afecta o metabolismo da tirosina). Nesta genealogia os gentipos que no podem ser
determinados so os dos indivduos:



a) 1, 2 e 5
b) 1, 3 e 6
c) 3, 5 e 6
d) 3, 8 e 10
e) 7, 8 e 10

Como sempre deves comear por identificar o gene dominante e recessivo (caso se trate de um
caso de hereditariedade de Dominncia completa) e depois atribuir uma legenda, assim
Identificas a normalidade como fentipo dominante, uma vez que do cruzamento entre dois
indivduos normais (casal 1 e 2, ou 5 e 6) nasce uma criana com alcaptonria (indivduos 4 e 9
respectivamente), ou seja, estes pais so portadores da doena, mas no a manifestam por ser
recessiva, assim:

Considerando:
A alelo que condiciona a normalidade
a alelo que condiciona a alcaptonria

os gentipos dos indivduos desta rvore sero: 1 Aa, 2 Aa, 3 AA ou Aa, 4 aa, 5 Aa, 6
Aa, 7 Aa, 8 AA ou Aa, 9 aa, 10 AA ou Aa
assim a resposta correcta a opo d)











Instituto de Educao Aberta e Distncia 61
Dominncia incompleta ou codominncia?



Mutaes
Mutao( do L. Mutare=alterao). Variao brusca, hereditria, que ocorre num indivduo, em
consequncia de uma alterao num gene.

I- Mutaes genticas
Os genes esto dispostos linearmente ao longo dos cromossomas; como so demasiadamente
pequenos, no puderam, at hoje, ser observados, nem sequer com o microscpio electrnico.
Cada cromossoma , em regra, portador de centenas ou de milhares de genes.
So eles que determinam se o nosso sangue do tipo A, B, AB, O; se nascemos com uma viso
normal, ou se estamos afectados por alguns tipos de deficincia visual hereditria; se temos os
olhos azuis, verdes ou castanhos; se uma dieta nos faz aumentar de peso, ou se, ao segui-la, nos
mantemos magros; se uma educao musical nos converte em artistas, ou nos deixa na situao
de incapazes de distinguir um som de outro, etc.

Numerosas experincias apoiam a hiptese de que os genes so constitudos, para todos os seres
vivos, por cido nuclico.
Pensa-se que um gene seja uma molcula de DNA(ADN), que controla na clula uma
determinada reaco qumica.

Instituto de Educao Aberta e Distncia 62
O ADN(DNA), cido Desoxirribonucleico, uma molcula biolgica universal presente em
todas as clulas vivas. no ADN que est contida toda a nossa
informao gentica, sob a forma de genes. O ADN(DNA) constitudo
por quatro tipos de nucletideos , unidade bsica do ADN(DNA) (que por
sua vez constitudo por uma pentose, um grupo fosfato e uma base
azotada), que se associam de uma forma especfica, formando uma cadeia
dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os
nucletidos so designados deste modo devido s bases azotadas que
entram nas suas constituies. possvel ler a cadeia de ADN(DNA),
obtendo-se uma sequncia de letras, como por exemplo,
ATGATTCTGTAGCCTGATCCC, a uma sequncia completa de
ADN(DNA) d-se o nome de genoma.
O ADN(DNA) tem a forma de uma escada de corda enrolada
helicoidalmente, ou seja, de uma hlice dupla em que os degraus so
formados por pares de bases azotadas ligadas entre si, atravs de ligaes
de hidrognio, com fundamento na complementaridade de bases. A
estrutura, do ADN(DNA), foi proposta h 53 anos por James Watson e
Francis Crick. A descoberta da estrutura do ADN(DNA) abriu o caminho
para se compreender como que a informao gentica transmitida de
progenitores para descendentes, ou de uma clula para outra, isto , como
funciona a hereditariedade.



Antes de a clula se dividir cada cromossoma d origem a outro cromossoma inteiramente
semelhante, com os mesmos genes dispostos segundo a mesma origem, visto que cada molcula
de DNA(ADN) produz uma cpia exacta de si mesma.
Quando a clula se divide em duas clulas, os cromossomas separam-se dos seus duplicados
recm-formados e cada uma das clulas-filhas recebe o mesmo nmero e os mesmos tipos de
cromossomas e genes.

O processo mediante o qual se duplicam os cromossomas e os genes , em geral, rigorosamente
preciso.


Instituto de Educao Aberta e Distncia 63
Porm, uma vez por outra, ocorre um erro. Por razes que ainda no esto suficientemente
esclarecidas, um gene no exactamente igual ao anterior. Um nucleotdeo inserido em vez de
um outro, ou suprimido da molcula de DNA(ADN).
Qualquer destas alteraes modifica a molcula do cido nuclico, deixando de ser uma cpia do
original. Por conseguinte, a mensagem gentica escrita no alfabeto dos nucleotdeos modifica-se.
Este processo de mudana gentica, devido mudana de um gene, recebe o nome de mutao
gentica. No pode ser observada ao microscpio.
Quando, mais tarde, o cromossoma, no qual se produziu a mutao, forma um duplicado de si
mesmo, como preparao para a diviso celular, reproduz o gene mudado de maneira to fiel
como a que se verifica na duplicao dos genes inalterados.
Desta maneira, a mutao herdada. O mesmo gene pode mudar de vrios modos, determinando
o aparecimento de vrios alelos- alelos mltiplos -, que continuam localizados no mesmo lugar
do cromossoma.

II- Mutaes cromossmicas

So mutaes que afectam a estrutura dos cromossomas ou o conjunto da constituio
cromossmica. Podem ser observadas ao microscpio.

A- Alteraes na estrutura dos cromossomas
Pode acontecer que determinado cromossoma se fracture anormalmente, originando-se, a
partir dele, vrios fragmentos.
possvel que, aps a fractura, se verifique a ligao. Se essa ligao restabelece a
situao anterior, nenhuma alterao se produz. Caso contrrio, surgem vrios casos de
mutaes cromossmicas, como seja o caso das delees e translocaes.
Translocao
Dois cromossomas sofrem quebras e h a soldadura de um segmento cromossmico a uma regio
fracturada de outro.
Existem dois tipos principais:

Translocaes recprocas
Resultam de quebra de cromossomas no homlogos, com trocas recprocas de segmentos soltos.

Rearranjos equilibrados
Quando o conjunto cromossmico possui o complemento normal de informaes. Todas as
informaes genticas esto presentes, mas acondicionadas de modo diferente.

Inverso
Inverso a ocorrncia de duas quebras em um cromossoma unifilamentoso durante a intrfase e
a soldadura em posio invertida do fragmento ao restante do cromossoma.

Alteraes no nmero de cromossomas
(Aberraes cromossmicas)

Como exemplos, poderemos citar anomalias humanas
Trissomia 21
Esta anomalia conhecida, clinicamente por sndrome de Down ou mongolismo.

Instituto de Educao Aberta e Distncia 64
Os sintomas da trissomia 21, provocados por no disjuno do par 21, aquando da meiose, so os
mesmos da trissomia 21 provocada pela translocao (21-14).

Abriu-se uma nova era na gentica mdica, em 1959, quando dois cientistas, Lejeune e Turpin,
demonstraram que as crianas com sndrome de Down tem 47 cromossomas em cada clula do
corpo, ao invs de 46 normais. A partir de ento, observou-se que tais anomalias ,ou aberraes
cromossmicas, so muito mais frequentes e variadas do que se imaginava antes, e que tambm
eram causa significante de defeitos congnitos e abortos que ocorrem em aproximadamente 0,7%
dos que nascem com vida e em um tero dos abortos espontneos de primeiro trimestre. (Figura
abaixo):




Os indivduos atingidos apresentam debilidade mental, acompanhada de perturbaes de
crescimento e metabolismo. A idade da me intervm no aparecimento desta anomalia. Antes dos
30 anos, o risco, para a me, de originar crianas trissmicas, cerca de 1/2000; depois dos 35
anos, passa a 4/1000, e para l dos 45 anos atinge 2/100.

Trissomia XYY
Esta anomalia conhecida clinicamente por sndrome de supermasculinidade.
Os indivduos portadores de um cromossoma Y suplementar so geralmente altos,
medindo 1,80m a 2m. O seu comportamento apresenta anomalias, notavelmente certa
agressividade.

Trissomia XXY
Conhecida clinicamente por sndrome de Klinefelter, traduz-se por uma
intersexualidade, isto , uma mistura de caracteres masculinos e femininos. O aspecto
masculino; o tamanho normal e por vezes elevado; os seios so desenvolvidos; as
glndulas genitais so pequenas e estreis. O aspecto de homens normais e com

Instituto de Educao Aberta e Distncia 65
psiquismo viril. Os indivduos com esta sndrome tm grau de inteligncia abaixo do
normal

Monossomia X
Esta anomalia conhecida por sndrome de Turner.
As mulheres que a apresentam so pequenas(1,40m), possuem infantilismo genital, que as
torna estreis, e malformaes esquelticas, cutneas e viscerais.

A causa das mutaes
As causas da maioria das mutaes so desconhecidas. Os bilogos no sabem ainda por
que razo, em determinado momento, surge uma mutao.
Muller, um dos colaboradores de Morgan, na tentativa de conseguir grande nmero de
mutantes de Drosophila, para a realizao das suas experincias de gentica, resolveu
submeter algumas destas moscas aco de determinada dose de raios X.
Estudando depois os descendentes dessas moscas, acabou por verificar que a percentagem
de mutaes se elevava de acordo com a dose de radiaes a que os progenitores tinham
sido submetidos.
Estas experincias, retomadas, a partir da, por outros cientistas, mostraram a
possibilidade de aumentar a percentagem de mutaes em todos os seres vivos por aco
de agentes mutagneos, tais como:
Raios X, raios beta e gama, neutres, radiaes ultravioleta.
Temperatura- Quando a temperatura das clulas sexuais aumentada, dentro
dos estreitos limites tolerados pelo organismo, a taxa de mutaes aumenta.
Agentes qumicos - Quando as clulas so tratadas por certas drogas, a taxa de
mutaes tambm aumenta.


Tarefas

01. Porque que a mutao um dos mais importantes factores evolutivos?

02. Quais so os fenmenos biolgicos responsveis pela formao de
Organismos adultos haplides? D exemplos.

03. O daltonismo tem herana ligada ao X. Um indivduo anormal, com caritipo 47, XXY, era
daltnico. Seus progenitores tinham viso normal para cores.

a) Qual dos progenitores formou o gmeta com 24 cromossomas? Explique.

04. Qual das seguintes sndromes humanas devida a uma monossomia?

a) Sndrome de Down
b) Sndrome de Turner
c) Sndrome de Klinefelter
d) Sndrome de Kernicterus
e) Sndrome da imunodeficincia adquirida.

Instituto de Educao Aberta e Distncia 66
RESOLUO das tarefas:

RESPOSTA 1: Porque provoca variaes necessrias s modificaes das espcies.
RESPOSTA 2: Meiose inicial (algas e fungos) e partenognese (abelhas).
RESPOSTA 3: a) A me, portadora do gene para daltonismo (d) situado no cromossoma X.
RESPOSTA 04: B

Doenas infecciosas
O corpo humano cercado e habitado por bilies de microrganismos (organismos vivos to
minsculos que podem ser vistos somente pelo microscpio). A maioria dos microrganismos
inofensiva ou at benfica como, por exemplo, as bactrias que costumam viver no sistema
digestivo e nos ajudam na digesto de alimentos. De vez em quando, no entanto, um
microrganismo capaz de causar uma doena invade nosso corpo. As doenas causadas por esses
microrganismos so chamadas de doenas infecciosas.

Doenas infecciosas so contagiosas, ou seja, podem ser transmitidas de uma pessoa para outra.
Elas podem ser transmitidas por contacto com a pele, atravs de fluidos corporais, em alimentos
ou bebidas contaminados ou por partculas do ar que contenham microrganismos, embora valha
lembrar que os caminhos e facilidade de transmisso variem de uma doena para outra.

Alm disso, picadas de insectos ou mordidas de animais so outra forma de transmisso. Se um
insecto, por exemplo, picar uma pessoa infectada, ele pode transportar o microorganismo e passar
a doena para outra por meio de uma picada. Os dois tipos mais comuns de doenas infecciosas
so as infeces bacterianas e as virais.

As bactrias causadoras de doenas, ou patognicas, atacam os tecidos do corpo directamente
ou causam danos atravs da secreo de substncias venenosas chamadas toxinas. Felizmente, no
entanto, as infeces causadas por bactrias costumam ser curveis. Os antibiticos matam
alguns tipos de bactrias e as vacinas previnem algumas doenas causadas por bactrias.

Os vrus so os menores microrganismos conhecidos e so responsveis por doenas to
relativamente inofensivas quanto a constipao e por outras to graves quanto a meningite. Os
vrus vivem e se reproduzem somente dentro de clulas vivas, e apenas determinadas clulas so
susceptveis a um vrus especfico.
Voc pode ser o hospedeiro de diversos vrus sem sofrer qualquer tipo de doena, mas se um
nmero muito grande de clulas forem atacadas, a que ficamos doentes.

No h tratamento mdico eficaz para a maioria das infeces virais. Isso acontece porque,
como os vrus vivem dentro das clulas, qualquer tratamento criado para mat-lo provavelmente
tambm atingir a clula. Alm disso, h milhares de vrus diferentes, cada um com propriedades
diversas, e um agente que seja eficaz contra um vrus provavelmente no ser to eficaz contra os
outros. E embora haja vacinas para algumas doenas virais, o tratamento para a maior parte delas
se limita ao tratamento dos sintomas.
Neste artigo, vamos nos concentrar nos diferentes aspectos das doenas contagiosas,
comeando por como o corpo se defende delas.

Instituto de Educao Aberta e Distncia 67
Qual a diferena entre doenas infecciosas e doenas contagiosa?

Doenas infecciosas so as doenas causadas por agentes como bactrias, fungos e vrus.
Doenas contagiosas so aquelas que se transmitem por contacto com fontes de contaminao,
tais como: animais doentes, solo, gua, pastagem, etc.

Doenas hereditrias

ANEMIA FALCIFORME
A forma comum da Anemia Falciforme (HbSS) acontece quando uma criana herda um gene da
hemoglobina falciforme da me e outro do pai. necessrio que cada um dos pais tenha pelo
menos um gene falciforme, o que significa que cada um portador de um gene da hemoglobina
falciforme e um gene da hemoglobina normal.

Como a condio de portador do trao falciforme um estado benigno, muitas pessoas no esto
cientes de que o possuem. Quando duas pessoas portadoras do trao falciforme resolvem ter
filho(s), importante que saibam que para cada gestao h possibilidade de um para quatro de
que a criana tenha doena falciforme; h possibilidade de uma em duas de que a criana tenha
doena falciforme; h possibilidade de uma em quatro de que a criana tenha o trao da
falciforme, e a chance de um em quatro de que tenha a hemoglobina normal.

O que doena falciforme ?

A Doena Falciforme uma doena herdada em que, os glbulos vermelhos, diante de certas
condies, alteram sua forma e se tornam parecidos com uma foice, da o nome falciforme.
Os glbulos vermelhos em forma de foice se agregam e dificultam a circulao do sangue nos
pequenos vasos do corpo. Com a diminuio da circulao ocorrem leses nos rgos atingidos,
causando dor, destruio dos glbulos, ictercia (olhos amarelos) e anemia.








Instituto de Educao Aberta e Distncia 68
NEUROFIBROMATOSE DE VON RECKLINGHAUSEN (NF1)

um distrbio comum do sistema nervoso caracterizado por manchas caf-com-leite e tumores
cutneos fibromatosos.


O gene clinicamente observado em praticamente todas as pessoas (cruzamento completo). No
heredograma acima, o probando (indicado por uma seta) parece ser um gene mutante novo, pois
seus pais e avs no so afectado.

POLIDACTILIA

Polidactilia uma doena caracterizada pela presena de um dedo extra. H uma variao muito
grande na expresso dessa caracterstica, desde a presena de um dedo extra, completamente
desenvolvido, at a de uma simples protuso carnosa.

A remoo cirrgica o nico tratamento, de simples resoluo.
Na Polidactilia um fentipo expresso da mesma maneira em homozigoticos e heterozigotos.

Regras para identificar a Herana Autossmica Dominante:
Deve ocorrer em homens e mulheres em igual frequncia.
Pais normais s podem ter filhos normais.
Pais afectados podem ter filhos afectados e normais
No ocorrem saltos de geraes.

Doenas hereditrias
As doenas hereditrias so um conjunto de doenas genticas caracterizadas por transmitir-se
de gerao em gerao, isto de pais a filhos, na descendncia e que se pode ou no manifestar
em algum momento de suas vidas. As principais so diabetes, hemofilia, hipertenso, obesidade e
as alergias. No deve se confundir doena hereditria com:
Doena congnita: aquela doena que se adquire com o nascimento e se manifesta desde o
mesmo. Pode ser produzida por um transtorno durante o desenvolvimento embrionrio ou
durante o parto.
Doena gentica: aquela doena produzida por alteraes no DNA, mas que no tem por que se
ter adquirido dos progenitores; assim ocorre, por exemplo, com a maioria dos cancros(cncer).

Instituto de Educao Aberta e Distncia 69
Classificao das doenas hereditrias
Doenas monognicas
So doenas hereditrias produzidas pela mutao ou alterao na sequncia de DNA de um
gene. Tambm se chamam doenas hereditrias mendelianas, por se transmitir na descendncia
segundo as leis de Mendel. Conhecem-se mais de 6000 doenas hereditrias monognicas, com
uma prevalncia de um caso por cada 200 nascimentos. Exemplos de doenas monognicas so:
Anemia falciforme.
Fibrose cstica.
Doena de Batten.
Doena de Huntington (cromossoma 4).
Sndrome de Marfan.
Hemocromatose.
Deficincia de alfa-1 antitripsina.
Distrofia muscular de Duchenne.
Sndrome do X Frgil.
Hemofilia A.
Fenilcetonria.

As doenas monognicas transmitem-se segundo os padres hereditrios mendelianos como:
Doena autossmica recessiva. Para que a doena se manifeste, precisa-se de duas cpias do
gene mutado no genoma da pessoa afectada, cujos pais normalmente no manifestam a doena,
mas portam cada um uma cpia do gene mutado, pelo que podem o transmitir descendncia. A
probabilidade de ter um filho afectado por uma doena autossmica recessiva entre duas pessoas
portadoras de uma s cpia do gene mutado (que no manifestam a doena) de 25%.
Doena autossmica dominante. S se precisa uma cpia mutada do gene para que a pessoa
esteja afectada por uma doena autossmica dominante. Normalmente um dos dois progenitores
de uma pessoa afectada manifesta a doena e estes progenitores tm 50% de probabilidade de
transmitir o gene mutado a seu descendente, que manifestar a doena.
Doena ligada ao cromossoma X. O gene mutado localiza-se no cromossoma X. Estas doenas
podem transmitir-se a sua vez de forma dominante ou recessiva.

Doenas polignicas
So um conjunto de doenas hereditrias produzidas pela combinao de mltiplos factores
ambientais e mutaes em vrios genes, geralmente de diferentes cromossomas. Tambm se
chamam doenas multifactoriais.
Algumas das doenas crnicas mais frequentes so polignicas, como por exemplo:
Hipertenso arterial.
Diabetes mellitus.
Vrios tipos de cncer.
Inclusive a obesidade.

A herana polignica tambm se associa a rasgos hereditrios tais como os padres da impresso
digital, altura, cor dos olhos e cor da pele. Possivelmente a maioria das doenas so doenas
multifactoriais, produzidas pela combinao de transtornos genticos que predispem a uma
determinada susceptibilidade aos agentes ambientais.

Instituto de Educao Aberta e Distncia 70
Doenas cromossmicas
So devidas a alteraes na estrutura do cromossoma, como perda cromossmica, aumento do
nmero de cromossomas ou translocaes cromossmicas. Alguns tipos importantes de doenas
cromossmicas podem-se detectar no exame microscpico. A trissomia 21 ou sndrome de Down
um transtorno frequente que sucede quando uma pessoa tem trs cpias do cromossoma 21
(entre um 3 e um 4% dos casos so hereditrios; o resto so congnitos).

Exerccios
- Sabe-se que o HIV tem afinidade por uma determinada clula do organismo.
- Qual essa clula e qual sua funo no organismo? e o que ocorre com o organismo com a
destruio dessas clulas?

Respostas:
Respostas a doenas infecciosas
1-O HIV tem afinidade com as clulas do sistema imunolgico, especialmente linfcitos CD4.
Com a destruio dessas clulas, o organismo perde a imunidade, ficando vulnervel s
doenas.

2-elas tem a finalidade de protecao ao nosso sistema, e com a destruio dessas clulas nosso
sistema de defesa se enfraquece.

3- as clulas tem afinidade do sistema que imune, especialmente linfcitos CD4. Com a
destruio dessas clulas, o organismo perde a imunidade, ficando vulnervel s doenas.

4-o HIV atinge as clulas do sistema imunolgico, assim destruindo os anticorpos e facilitando o
contgio de vrias outras doenas como o

Instituto de Educao Aberta e Distncia 71
SECO III

Caro (a) amigo (a) estudante! Esta seco composta pelas unidades Evoluo e Ecologia. Nela
ir aprender matrias que compreendem a introduo sobre a Origem da vida e Evoluo,
introduo Ecologia at a relao entre os organismos no ecossistema.


Unidade 4 - Evoluo

Objectivos:
Interpretar os mecanismos da Evoluo;
Explicar os factos que apoiam a teoria da evoluo;
Explicar os factos que apoiam a seleco natural;
Interpretar sobre evoluo abiognica.
Teoria Cientfica Sobre a Origem da Vida
Estima-se que a terra existia h 5 bilies de anos. Quando a terra se formou, a temperatura nela
existente era elevadssima, aproximadamente 5000 C, o que no permitia a existncia de
nenhuma forma de vida, a terra era despida de atmosfera e oceanos.
A composio da atmosfera primitiva era muito diferente da atmosfera actual.

Reaces das substncias orgnicas e o surgimento dos primeiros compostos
Nos ltimos 120 anos, vrias ideias sobre a origem da terra, sua idade, as condies primitivas da
atmosfera foram surgindo. Em particular, verificou-se que os mesmos elementos que
predominam nos organismos vivos (carbono(C), hidrognio(H), oxignio (O) e nitrognio (N))
tambm existem fora dela; apenas nos organismos vivos esses elementos esto combinados de
maneira a formar molculas complexas, como protenas, polissacardeos (aucares), lpidos
(gorduras) e cidos nuclicos (material gentico).

A terra primitiva era formada pelos elementos: C, H, S, O, N e compostos de molculas simples e
com poucos tomos tais como: Metano (CH4), Amnia (NH3), cido Sulfdrico (H2S), gua
(H2O), Dixido de Carbono (CO2), Hidrognio (H2) e outros gases. Estas substncias foram
reagindo entre elas para posteriormente aparecerem as molculas complexas,
Ex: CO2 + 2NH3 CO (NH2)2 + H2O

Dixido de Carbono + Amnia Ureia + gua

1. Elementos,
2. Molculas Simples,
3. Molculas Complexas,
4. Protenas
5. Aglomerados de Protenas
6. Seres Vivos Simples
7. Seres Vivos Complexos (Pluricelulares)


Instituto de Educao Aberta e Distncia 72
Aristteles defende o surgimento da vida a partir de princpios activos contidos em certos
elementos, que quando ingeridos poderiam ser activos (Evoluo Abiognica)
No princpio, a evoluo foi abiognica, isto , no compreendeu organismos vivos. A energia
sob a forma de fascas elctricas e de calor produzido durante as exploses vulcnicas fez com
que as molculas simples presentes na atmosfera e na gua, so as que estariam presentes na terra
primitiva.

Francisco Redi A vida s se origina a partir de outra pr-existente, desde que encontre meio
favorvel no seu desenvolvimento (Biognese).

Biognese uma teoria biolgica na qual a matria viva precede sempre de matria viva.
Segundo as teorias formuladas pelos partidrios da biognese, entre os quais, Fritz Muller,
Serres e Haeckel, a evoluo do indivduo deve reproduzir a da espcie.

Segundo C. G. Jung, a histria do desenvolvimento das espcies se repete no desenvolvimento
embrionrio do indivduo.

Anton Leewenhock Aperfeioou o microscpio, relevando que os microrganismos tiveram
seus prprios meios de reproduo.

Em 1953, Stanley Miller - Foi o primeiro a desenvolver uma experincia deste tipo, utilizando
uma mistura de gua, metano, amnia e vapor de gua.

Em 1957, Sidney Fox Baseando-se no trabalho de Miller, tenta entender como poderiam ter
ocorrido protenas a partir de aminocidos, nas condies primitivas da terra.

As protoclulas, so estruturas parecidas com clulas tendo uma camada anterior que apresenta
algumas propriedades das membranas celulares, tais como permeabilidade de algumas molculas,
assim como, a impermeabilidade de outras.

Evoluo das Primeiras Clulas Primitivas a Partir das Protoclulas
Hiptese heterotrfica
A hiptese mais aceite, actualmente, diz que os primeiros seres vivos eram heterotrficos. Um ser
heterotrfico aquele que no tem capacidade de sintetizar o seu prprio alimento. Ele obtm a
matria prima e a energia, necessrias ao seu desenvolvimento, do meio em que vive. Ao
contrrio, um ser auttrofico aquele que tem capacidade de sintetizar seu prprio alimento. a
partir de substncias inorgnicas e de energia, os autotrficos conseguem produzir as molculas
necessrias ao seu desenvolvimento.

Os heterotrficos poderiam ter vivido, perfeitamente, nas condies dos mares primitivos, visto
que estes mares eram verdadeiras sopas nutritivas, ricas em matria orgnica. A hiptese que diz
que os primeiros seres vivos eram autotrficos foi abandonada, pois para se sintetizar molculas
orgnicas, estes seres teriam que ter um alto grau de organizao molecular. muito mais
razovel pensar-se que os primeiros seres vivos eram bem simples, como os hetertroficos, do
que altamente complexos, como os auttroficos.

Instituto de Educao Aberta e Distncia 73
Segundo a hiptese herotrfica, os primeiros seres vivos obtinham o seu alimento do meio
circundante. Os autotrficos surgiram depois.

Protoclulas ter-se-o desenvolvido de acordo com as diversas macromolculas que
continham. Eventualmente, surgiu um tipo de protoclulas que incorporava uma molcula de
AND formada abiognicamente. Este AND actuava como um modelo, ou padro, para a
produo de protenas e uma dessas protenas foi capaz de fazer cpias do prprio ADN.
Teorias Antigas Sobre a Origem dos Seres Vivos

(Fixismo e Transformismo)
Fixismo - Cada espcie vivente, vegetal ou animal, teria surgido de maneira independente, no
passado, por acto de criao divina, tendo exactamente as mesmas caractersticas que possui hoje.
Carlos Linneus o defensor desta Teoria Fixista (As especies biolgicas so fixas e imutveis).

Transformismo a transformao gradual das espcies no decorrer do tempo, originando
novas espcies. Assim, as espcies actuais teriam sido originadas de Ancestrais Comuns por
evoluo.

Gerao Espontnea
Acreditava-se que a vida teria surgido espontaneamente da matria no viva. Os cientistas
observavam que os lquidos contendo material orgnico ficavam infectados de microrganismos.
Pensava-se que esses organismos tivessem sido criados de novo, isto , que no derivavam de
outros semelhantes a si prprios.

Por volta de 1860, um cientista Francs, Louris Pasteur provou atravs de experincias que estas
ideias estavam erradas. Na sua experincia demonstrou que um meio estril em contacto com o ar
contaminado, permitia a proliferao de microrganismos.
A Experincia de Pasteur
As etapas da experincia de Pasteur so delineadas abaixo.
1. Primeiro, Pasteur preparou um nutriente semelhante uma sopa.
2. Em seguida, colocou pores iguais desse caldo em dois frascos de gargalo longo. Um
frasco tinha o gargalo recto; outro tinha um gargalo dobrado em forma de S.




Instituto de Educao Aberta e Distncia 74
3. Depois, ele ferveu o caldo em cada frasco a fim de matar qualquer matria viva que o
lquido contivesse. Os caldos esterilizados foram deixados descansando, em temperatura
ambiente e expostos ao ar, nos frascos sem tampa.



4. Depois de algumas semanas, Pasteur observou que o caldo no frasco de gargalo recto
estava nublado e descolorido, enquanto o do frasco de gargalo curvo no havia mudado.










5. Ele concluiu que germes conduzidos pelo ar conseguiam cair sem obstrues no frasco de
gargalo recto, contaminando o caldo. J o outro frasco aprisionava os germes em seu
gargalo curvo, impedindo-os de chegar ao caldo, que no mudou de cor ou se tornou
nublado.

6. Caso a gerao espontnea fosse um fenmeno real, argumentou Pasteur, o caldo no
frasco de gargalo curvo teria se infectado porque germes teriam sido gerados
espontaneamente. Mas o frasco de gargalo curvo no foi infectado, o que indica que s
outros germes podem gerar germes.



Instituto de Educao Aberta e Distncia 75
A experincia de Pasteur exibe todos os traos de uma investigao cientfica moderna. Ele
comeou por uma hiptese e testou a hiptese por meio de uma experincia cuidadosamente
controlada. O mesmo processo - baseado na mesma sequncia lgica de eventos - vem sendo
empregado por cientistas h cerca de 150 anos. Com o tempo, essas etapas se tornaram uma
metodologia idealizada que hoje conhecemos como mtodo cientfico.

Teoria de Catostrofismo de Cuvier (1769-1832)
Os cientistas diziam que calamidades de grande impacto, com inundaes, tinham feito com que
espcies inteiras desaparecessem. Posteriormente, elas eram substitudas por outras, por novas
espcies muitas vezes diferentes criadas espacialmente por Deus ou por espcies que tivessem
migrado de regies da terra no afectadas pela calamidade.

Teorias Evolucionistas
Lamarckismo
Lei de uso e desuso: O uso desenvolve um rgo e o desuso atrofia.
Crtica: verdadeira dentro dos limites da norma de reaco de gentipo

Lei de Herana dos Caracteres Adquiridos
As estruturas desenvolvidas pelo uso ou atrofiadas pelo desuso so hereditrias.
Crtica: Falsa, somente s pode ser hereditrias as modificaes no AND das clulas reprodutoras
que ocorrem independentemente do seu valor adaptativo.
Os principais pontos da teoria de Lamarck so:

A) LEI DO USO E DESUSO- o uso de um rgo desenvolve-o, enquanto o desuso atrofia-o.
B) LEI DA HERANA DOS CARACTERES ADQUIRIDOS- os caracteres adquiridos pelo
uso ou pelo desuso so transmissveis s novas geraes.


Darwinismo
Estabelece o conceito de seleco natural (sobrevivncia dos mais aptos, que deixam assim maior
prole e aumentam o nmero da populao), Estabelece que todas as espcies, incluindo o homem,
tm ancestrais comuns.
A teoria pode ser assim explicada:
Variabilidade : os seres vivos de uma determinada espcie tenderiam a produzir um
grande nmero de indivduos com pequenas diferenas individuais.
Seleco natural: o ambiente imporia uma srie de obstculos sobrevivncia e a
reproduo e, nesse ambiente, os indivduos mais adaptados s condies sobreviveriam e
transmitiriam geneticamente essas variaes aos seus descendentes.
Adaptao -: consequncia da seleco natural, agindo sobre a variao.
Crtica: O conceito de seleco natural vlido, mas a teoria no explica correctamente como
surgem as variedades, ficando contaminada pela lei de uso e desuso.

Teoria Actual
S passa a gerao seguinte o que est presente na linhagem germinativa (Experincia de
Weismann), as variaes surgem ao acaso, por mutaes (De Vries).

Instituto de Educao Aberta e Distncia 76
A reproduo sexuada potencializa o efeito das mutaes (Leis de Mendel e Crossing) e aumenta
a variedade gentica da populao.

Migrao, Isolamento Geogrfico e Isolamento Reprodutivo so factores importantes na
formao de novas espcies.

A seleco natural impe uma ordem ao processo evolutivo.

A evoluo pode ser definida matematicamente como uma alterao na frequncia de genes (Lei
de Hardy-Weinberg).

Em populaes pequenas podem ocorrer alteraes na frequncia de genes, sem nenhum valor
adaptativo (Oscilaes Genticas).
Factores de Evoluo
Mutao
Seleco Natural
Recombinao Gentica
Isolamento Geogrfico

Mutao uma modificao brusca do gentipo, possvel de ser transmitido descendncia.
Os organismos que sofrem mutaes podem apresentar uma ou duas caractersticas novas, que
podem ser teis ou no.

Seleco Natural So as caractersticas positivas que favorecem a sobrevivncia do ser vivo,
enquanto, as negativas o eliminam.

Recombinao Gentica Promove o aparecimento no de genes novos, mas sim de gentipos
novos.
A combinao gentica se processa por trs mecanismos bsicos:
a) Segregao dos cromossomas na meiose;
b) Ocorrncia da permutao (crossing-over)
c) Fecundao
Provas de Evoluo
Paleontologia Cincia que trata da descoberta e interpretao dos fsseis;
Fosseis So restos ou vestgios de organismos de pocas geolgicas remotas, que
ficaram preservadas nas rochas. O registo de fsseis e a prova directa que apoia a teoria
da evoluo;
Anatomia Comparada uma parte especial da Biologia que compara e contrasta as
semelhanas e diferenas das estruturas, tanto entre plantas como entre animais que so
estritamente relacionadas;
Embriologia Comparada Proporciona uma evidncia indirecta em apoio a teoria de
evoluo. A segmentao do ovo e as primeiras etapas do desenvolvimento embrionrio
so bastante comparveis nos diferentes grupos de animais.

Instituto de Educao Aberta e Distncia 77
Baseando-se em observaes embriolgicas, Haeckel, estabeleceu a Lei Biognica Bsica
O desenvolvimento de um ser vivo uma repetio curta do desenvolvimento da
espcie
Fisiologia Comparada Est relacionada com a comparao das diferentes funes que
revelam tambm certas semelhanas entre os seres vivos.

Origem do Homem
Cronologia Geral da Evoluo do Homem
Aspectos Gerais
1. O homem e o macaco tem antepassados comuns;
2. Ambos pertencem a ordem dos primatas e as caractersticas principais so:
a) Mamferos tipicamente arborcolas;
b) Mos e ps munidos de 5 dedos apreensores de objectos, com unhas e no garras e
com grande sensibilidade tactl na face palmar dos dedos;
c) Polegar oponvel aos restantes dedos;
d) Encfalo relativamente volumoso;
e) Glndulas mamrias em posio peitoral;
f) Actividade sexual continua.

Diferenas entre o Homem e outros Animais
a) Qualidade de inteligncia superior;
b) Elevado poder de comunicao;
c) Linguagem articulada;
d) Faculdades de fabricar e manejar instrumentos.

Modificaes que ocorrem no Homem ligadas `a posio bpede
Buraco occipital no centro da base do crnio
Coluna vertebral em forma de S vertical
Alongamento dos membros inferiores
Desenvolvimento dos Glteos e gmeos

Evoluo dos Homindeos
Factores da Antropognese
Do Ramapithecus ao Homo Sapiens Sapiens

1. Ramapithecus
a) Posio bpede ainda muito curvado
b) Pragmatismo facial
c) Arco dental com caninos e incisivos com insero parablica
d) Vida em hordas
e) Utilizao dos objectos naturais


Instituto de Educao Aberta e Distncia 78

2. Australopithecus 500 a.c
a) Posio bpede
b) Posio erecta
c) Bacia humana
d) Testa ausente
e) Caa e hordas
f) Utilizao de instrumentos primitivos

3. Homo Erectus (Homem de Java ou de Pequim) 800-1300 a.c
a) Superior capacidade craniana
b) Fortes salincias
c) Sem queixo definido
d) Caa e recolha de restos vegetais
e) Vida de cavernas
f) Fabrico de instrumentos de pedra
g) Utilizao ocasional do fogo

4. Homo Neanderthalensis (Neanderthal)
a) Corpo forte (membros e msculos)
b) Maior capacidade craniana
c) Fabrico de instrumentos especializados de pedra e Madeira
d) Produo do fogo
e) Vida em cavernas e rituais de caa
f) Cerimnias fnebre (enterravam os mortos)

5. Homo Sapiens Sapiens
a) Maior capacidade craniana, com maior nmero de circunvolues cerebrais
b) Testa lata
c) Reduo das arcadas superciliares
d) Salincias do queixo
e) Postura erecta e alta
f) Produo de instrumentos mais aperfeioados
g) Actividades ligadas a pastorcia e agricultura
h) Pinturas nas paredes das cavernas (arte rupestre)

Lugar do Homem na Natureza
1. Reino: Animlia Organismo usualmente mvel que ingerem alimentos.
2. Filo: Chordata Animal com simetria bilateral, corda dorsal e tubo neural em posio
dorsal.
3. Sub-Filo: Vertebrata Animal com esqueleto interno sseo ou cartilagneo e espiral
medula com crebro na extremidade anterior.
4. Classe: Mammalia Animal de sangue quente, coberto de plos, que amamentam as
suas crias.
5. Sub-Classe: Theria Mamfero vivparo, os seus embries desenvolvem-se ligados ao
corpo materno por uma estrutura chamada placenta.

Instituto de Educao Aberta e Distncia 79
6. Ordem: Primata Animal essencialmente arborcola, com capacidade de preenso
devido oponibilidade do polegar aos outros dedos. Tem unhas em vez de garras, num ou
em mais dos seus dedos.
7. Sub-Ordem: Anthropoidea Primatas mais evoludos, com grande controle dos dedos e
grande capacidade de aprendizagem e estrutura dental caracterstica.
8. Superfamlia: Homindea Primatas sem cauda e com grande liberdade de movimentos
dos membros superiores.
9. Famlia: Homindae Primatas terrestres, bpede e capaz de fabricar instrumentos
10. Gnero: Homo Homem modernos e seus ancestrais imediatos.
11. Espcie: Homo Sapiens Modernas populaes humanas do perodo ps-glacial e
algumas mais antigas.
12. Sub-Espcie: Homo Sapiens Sapiens Homem actual.

Raas Humanas
O termo raa indica, de modo geral, grupos de pessoas que tm caractersticas fsicas em
comum: cor de pele, estatura corporal, estatura craniana, etc..
s vezes, a essas particularidades objectivas so associadas supostas caractersticas morais e
psicolgicas. Essa falsa premissa utilizada para considerar algumas raas superiores e outras
inferiores, justificando o domnio de uma raa sobre outra. nisso que se apoia o racismo.
Todo homem carrega a forma inteira da condio humana, ou seja, raa no mais do que a
condio humana. Fora disso, como existem linhas morfolgicas, permitem antropologia fsica
classificar os grandes grupos humanos com europide (branca), mongolides (amarela) e
negride (negra).
O que existe a diversidade das linhas morfolgicas da raa humana em funo da adaptao
territorial e a diversidade dos modos pelos quais cada grupo humano relaciona-se com o seu real,
ou seja, a diversidade das culturas. A diferena dita tnica resulta de uma combinao de linhas
morfolgicas com singularidades lingusticas e culturais.
Em vrias partes do mundo existe ainda a segregao racial, isto , uma parte da populao vive
de alguma forma separada dos demais. A intolerncia para sinais de diversidade como cor da
pele, religio, hbitos de vida e lugar de origem contnua a causar problemas para milhes de
pessoas.

As Caractersticas Raciais e o seu Estado
Devido as caractersticas corporais externas, os povos dos diversos pases se diferenciam um dos
outros.
A soma dessas caractersticas que distingue um indivduo de outro: cor da pele, cabelos, olhos,
lbios, estatura, etc., so alguns desses caracteres.
Cor da pele, depende da melanina, pigmento negro que ocorre na pele, cabelo, etc..
Os cabelos distinguem-se em trs tipos; liso, ondulado e encarapinhado. A forma dos olhos,
depende da prega da plpebra. Os lbios possuem trs partes: cutnea, intermediria e mucosa,
mas existem quatro tipos de lbios: delgados, medianos, grossos e salientes. A estatura uma
caracterstica importante, porque se relaciona com os grupos antropolgicos territoriais em que se
dividem a humanidade. A mdia geral masculina de 165cm.

Instituto de Educao Aberta e Distncia 80
O estudo das caractersticas raciais feito com o auxlio de processos e de instrumentos
especiais: o antropmetro, instrumento para medir a estatura; o compasso de espessura,
instrumento usado principalmente para medies da cabea.
Os grupos humanos possuem uma classificao proposta por N. Tcheboquessarov como:
Afro-acenica ou negride;
Euro-Asiatic ou europide;
Asitico-americana ou mongolide.

A Raa Negride
Suas caractersticas so: pele escura, cabelos e olhos escuros, cabelo crespo, sistema piloso do
rosto e corpo pouco desenvolvido, largura da face pequena, nariz achatado e de abas largas,
lbios grossos. O ncleo principal dessa raa, situa-se no continente africano, por isso, chamado
de Continente Negro. O ramo ocidental da grande raa equatorial, constitudo pela negride
ou africano.
As caractersticas dos negrides africanos:
Cara pequena, um tanto quanto achatada;
Testa alta e recta;
Olhos grandes, cor castanha escura;
Nariz chato;
Lbios grossos;
Estatura variada;
Membros inferiores longos.

A Raa Europide
Essa raa muito numerosa, constitui 50% da humanidade. O ncleo principal da raa, branca
encontra-se no Velho Mundo: Europa, sia e no norte da frica.

Caractersticas da raa europide:
Pele entre clara e quase chocolate, com uma colorao rosada nas faces;
Cabelo mole, ondulado ou liso com vrias coloraes desde louro ao negro;
Testa recta;
Olhos horizontais, castanhos ou claros;
Nariz afilado;
Lbios delgados;
Queixo mediano;
Forma da cabea muito variada: braquicfalo, mesocfalo e dolicocfalo.

A Raa Mongolide
A raa mongolide compreende cerca de 40% da populao terrestre e a metade so chineses.
Habitam na sia, nas regies setentrionais, orientais, centrais e sul-orientais, e estende-se pela
Ocenia e Continente Americano.
Muitos de seu grupo formam parte da populao das regies asiticas da Rssia: iacutos,
buriatos, tunguses, tchuquetches, tuvinos, altaios, ilacos, aleutas, esquims asiticos.
A caracterstica dessa raa amarela so: pele clara ou bronzeada, cabelos duros, lisos e pretos,
sistema piloso corporal pouco desenvolvido.
Os mongolides setentrionais possuem as caractersticas: rosto grande, olhos castanhos, nariz de
largura mediana. Lbios delgados, queixos mediano, e na maioria dos casos cabea mesocfala.

Instituto de Educao Aberta e Distncia 81
Traos Comuns das Raas Humanas
As raas humanas assemelham-se muito uma das outras pelo aspecto fsico. Cada uma delas se
caracteriza por um conjunto de traos morfolgicos e fisiolgicos, que se modificam com a
hereditariedade. Cada ser humano possui caractersticas individuais, a soma dessas caractersticas
que distingue um indivduo do outro, ou raa da outra. Na evoluo da humanidade, o papel
fundamental se atribui aos factores sociais, alm disso, as raas se misturam com muita
facilidade, com isso se originou a evoluo do homem.


Tarefas resolvidas
Resolva os exerccios que se seguem com base no estudo que acaba de realizar

I - Assinale as respostas correctas, com X nos parnteses

1. Algumas pessoas, hoje em dia, acreditam que Bicho de fruta, fruta . Acreditar que os bicho
da fruta so parte da prpria fruta demonstra a prpria crena na teoria da:

a. ( ) Criao especial b. ( ) Gerao espontnea c. ( ) Biognese

2. Segundo algumas teorias, as condies que permitiram o surgimento da vida no planeta terra
foram:

a. ( ) Presena da gua, amnia, metano e hidrognio, ausncia de radiaes
b. ( ) Presena de carbono, hidrognio, oxignio, nitrognio, combinados ou no com outros
elementos.
c. ( ) Presena de gua, metano, amnia e hidrognio e grandes doses de radiaes.


3. A hiptese heterotrfica considera que os seres vivos primitivos eram capazes de:

a. ( ) Produzir seu prprio alimento
b. ( ) Realizar a fotossntese
c. ( ) Retirar seu alimento do meio circundante

II - Escreva, nos parnteses, V (verdadeira) ou F (falsa)

1. ( ) O Princpio Activo, segundo os apoiantes da gerao espontnea, era uma substncia
que toda matria no-viva possui.

2. ( ) A teoria da gerao espontnea era baseada na crena de que a vida podia ser criada a
partir da matria no-viva pela existncia de um princpio activo.
3. ( ) A teoria da Biognese foi comprovada definitivamente pelos trabalhos de Pasteur.

4. ( ) Segundo a teoria da Biognese, os seres vivos somente se originam de outros seres vivos
por meio da reproduo

5. ( ) As condies da terra primitiva eram muito semelhantes s actuais.

Instituto de Educao Aberta e Distncia 82
6. ( ) Segundo Oparin, a vida poderia ter surgido pela evoluo dos sistemas qumicos a
existentes na terra primitiva.

III Reflicta e responda as questes com suas prprias palavras.

1. A teoria da Biognese veio substituir a teoria da Gerao espontnea. As bases cientficas da
Biognese a tornam vlida at hoje.
Voc acha que a Biognese resolveu o problema da origem da vida? Por qu?


2. As pessoas que acreditam na gerao espontnea no podiam ser consideradas ignorantes.
Muitas delas eram pessoas que se destacavam socialmente e tambm pela cultura e saber, na
poca.
Por que voc acha que levaram aproximadamente dois mil anos acreditando na gerao
espontnea?

3. Por que a hiptese heterotrfica afirma que os seres autotrficos surgiram aps os
heterotrficos?







Resoluo das tarefas
Verifique as suas respostas

I. Respostas correctas

1. b. (X) gerao espontnea
2. c. (X) presena de gua, metano, amnia e hidrognio e grandes doses de radiaes.
3. c. (X) retirar seu alimento do meio circundante

II . Assinalou correctamente as suas respostas da seguinte forma

1. (F) O Princpio activo citado na teoria da gerao espontnea era um tipo de energia, de
capacidade para criar vida em determinadas condies.
2. (V)
3. (V)
4. (V)
5. (F) As condies da Terra primitiva eram muito diferentes das actuais.
Na Terra primitiva, a crosta, em formao, era ainda muito quente. A sua atmosfera era
constituda principalmente de metano, amnia, hidrognio e vapor de gua, e existiam fortes
descargas elctricas e de raios ultravioleta.
6. (V)


Instituto de Educao Aberta e Distncia 83
III . As suas respostas devem ser semelhantes a estas:

1. No, porque a teoria da biognese somente transferiu o problema para outra rea. Ela explica
apenas como os seres vivos surgem actualmente e no como os primeiros seres vivos apareceram.

2. O aluno pode ter respondido vrias coisas, mas a resposta essencialmente correcta a
natureza do conhecimento cientfico. O conhecimento considerado cientfico naquela poca
diferia profundamente do conhecimento cientfico da actualidade.

- As pessoas daquela poca no possuam um mtodo de trabalho cientfico, de acordo com o
trabalho cientfico moderno, o que lhes permitia chegar a concluses apressadas.


3. Porque as reaces autotrficas so complexas e provavelmente no poderiam ser realizadas
por organismos to simples.



Tarefas resolvidas
Resolva os exerccios tendo em conta as Teorias da Evoluo

I Assinale, com um X nos parnteses, a nica alternativa correcta em cada questo.
1. A Teoria da Seleco Natural leva em conta principalmente:

a. ( ) A sobrevivncia dos indivduos melhor dotados com relao a adaptao ao
ambiente em que vivem.
b. ( ) A herana das caractersticas adquiridas.
c. ( ) As mutaes
d. ( ) A lei de uso e desuso

2. Na luta pela vida, certamente, os mais fortes tero mais possibilidades de sobreviver.
Esta afirmao refere-se aos trabalhos de:

a. ( ) Lamarck b. ( ) Darwin c. ( ) Weisman

3. O uso desenvolve um rgo enquanto o desuso o atrofia. Este enunciado caracteriza a lei de
uso e desuso, estabelecida por:

a. ( ) Darwin b. ( ) Weisman c. ( ) Lamarck

4. A teoria Lamarckista da evoluo baseia-se na:

a. ( ) Ocorrncia de mutaes espontneas
b. ( ) Ocorrncia de mutaes dirigidas
c. ( ) Herana de uso e desuso
d. ( ) Herana de caracteres adquiridos


Instituto de Educao Aberta e Distncia 84
5. Os Fsseis constituem:

a. ( ) Um documento sem relao com as teorias da evoluo
b. ( ) Uma prova de que os seres vivos evoluram
c. ( ) Uma prova de que existem vrias categorias de seres vivos
d. ( ) Um documento para o estudo da anatomia comparada

6. Entre as provas da evoluo podemos destacar:
a. ( ) A anatomia comparada
b. ( ) A embriologia comparada
c. ( ) Os rgos vestigiais e os fsseis
d. ( ) Todas as alternativas esto correctas

7. Animais que precisam correr muito para escapar dos seus inimigos desenvolvem muito os
msculos das pernas e transmitem esta caracterstica aos seus descendentes. Esta afirmao
caracteriza:
a. ( ) As Teorias de Lamarck e Darwin
b. ( ) Apenas a Teoria de Lamarck
c. ( ) Apenas a Teoria de Darwin
d. ( ) A Teoria da Evoluo

II Reflicta e responda as questes.

1. Segundo Lamarck, as primeiras girafas que surgiram na terra tinham pescoo curto e se
alimentavam de vegetao mais baixa. medida que essa vegetao ia escasseando havia
necessidade de os animais esticarem o pescoo para apanharem folhas situadas em galhos mais
altos. Desta forma, o pescoo tornava-se mais comprido. Ao se cruzarem as girafas davam
descendentes com pescoo cada vez maior at ser atingido o comprimento do pescoo das girafas
actuais.

Que explicao teria dado Darwin para este facto?

2. A Teoria de Darwin aceite at hoje? O que faltou para que ela fosse completa.

3. Qual a principal diferena entre as leis de Lamarck e de Darwin, se ambos achavam que o
meio ambiente era um dos responsveis pelo processo evolutivo?











Instituto de Educao Aberta e Distncia 85
Resoluo das Tarefas

I. Alternativas correctas
1. a. (X) A sobrevivncia dos indivduos melhor dotados com relao adaptao ao
ambiente em que vivem.

2. c. (X) Darwin

3. d. (X) Lamarck

4. d. (X) Herana de caracteres adquiridos

5. b. (X) Uma prova de que os seres vivos evoluram

6. d. (X) todas as alternativas esto correctas

7. b. (X) Apenas a teoria de Lamarck

II. As suas respostas devem ser semelhantes a estas:
1. Para Darwin sempre houve girafas de pescoo curto e girafas de pescoo largo. medida
que a vegetao baixava, iam escasseando as girafas de pescoo curto que dela se
alimentavam; eram prejudicadas, morrendo em maior nmero e deixando menos
descendentes que as de pescoo largo. Estas, podendo se alimentar de folhas situadas em
galhos mais altos, tinham maior oportunidade de sobreviver.

2. A teoria de Darwin aceite at hoje. Ela s no completa, porque faltou uma explicao
cientfica para a origem da variabilidade dos organismos, pois o mecanismo de
transmisso hereditria dos caracteres era ainda desconhecido. A teoria da evoluo
actualmente aceita, a origem fundamental da variabilidade dos organismos e a mutao.

A principal diferena entre as ideias de Lamarck e de Darwin consiste no seguinte: enquanto para
Lamarck o princpio bsico do processo evoluo.
















Instituto de Educao Aberta e Distncia 86
Unidade 5 - Ecologia
Caro (a) amigo (a) estudante! Esta a ltima unidade temtica de estudo da disciplina de
biologia na 10 classe, a ecologia. Nesta unidade ir aprender matrias, desde a introduo
Ecologia at a relao entre os organismos no ecossistema. Vamos ento, enumerar os objectivos
especficos, que dever perseguir ao longo do estudo deste unidade. Lembre-se uma vez mais que
no trmino do estudo e depois de resolvidos, vrios exerccios de consolidao, previstos neste
captulo, tem a realizar avaliaes do fim da seco. Boa sorte.

Objectivos especficos

So objectivos especficos para esta unidade os seguintes:
Descrer os mecanismos de proteco dos ecossistemas;
Interpretar os factores biticos e abiticos;
Explicar o funcionamento dos ecossistemas;
Interpretar a relao entre organismos no ecossistemas.

Toda a matria, tanto viva como inanimada (sem vida) composta por certas unidades bsicas
chamadas tomos. A diferena entre os seres vivos e os no-vivos reside na organizao dos seus
tomos. A matria viva apresenta um grau mais elevado de organizao dos tomos em
molculas e outras estruturas, ao contrrio da matria inanimada.

Devido complexa disposio dos tomos na matria viva, realizam-se constantemente, sries
de complicadas reaces qumicas, a partir das quais os organismos crescem, respiram,
reproduzem-se, etc. Por isso, a vida um conjunto organizado e extraordinariamente complicado
de reaces qumicas que so o resultado da imensa complexidade da combinao dos tomos.

Mas a organizao no pra ao nvel da organizao interna dos organismos: ela continua at o
nvel das relaes entre os organismos e o seu ambiente. Cada ser vivo depende de outros
organismos vivos, quer da mesma espcie, quer de outras espcies e da sua interaco com os
factores do ambiente, como a luz do sol, a chuva, a gua, etc. A ecologia estuda como os seres
vivos esto organizados em comunidades, em que os indivduos dependem uns dos outros e do
ambiente no vivo em que se encontram.

Alguns conceitos bsicos de ecologia
Para a melhor compreenso dos nveis de organizao dos mais simples at os mais elevados que
constituem o campo de estudo da ecologia, vamos comear por rever os seguintes conceitos
bsicos.

Espcie Segundo Cant Von Linne, ou Linen ( sc. XVIII- 1707-1778),espcie: um conjunto
de seres vivos em que os indivduos tinham grandes semelhanas morfolgicas padronizadas,
comuns e tpicos de cada conjunto.

Hoje em dia: Espcies so grupos de populaes naturais potencialmente capazes de se cruzarem
e que esto repodutivamente isolados de outros grupos semelhantes.


Instituto de Educao Aberta e Distncia 87
2 Populao - Chama-se populao ao conjunto de indivduos da mesma espcie, vivendo numa
determinada rea e que interactuam e se cruzam livremente, por exemplo, a populao de
crocodilos do rio Zambeze.

Comunidade Uma comunidade o conjunto formado pelas populaes diferentes numa
determinada rea, por ex:

As diferentes espcies que representam diferentes populaes duma comunidade interagem em
conjunto de tal modo que essa comunidade permanece relativamente estvel.

Uma comunidade estvel aquela em que as flutuaes dos nmeros dos indivduos so
relativamente pequenas. Em geral, a estabilidade de uma comunidade depende do
nmero de espcies diferentes nela existentes, sendo maior, quanto maior for o nmero dessas
espcies

Ao conjunto das relaes entre seres vivos chamamos factores biticos que podem ser intra e
interespecficas.

Todas estas relaes podem ser classificadas da seguinte forma:
1. predatismo
2. parasitismo
3. mutualismo
4. facilitao
5. competio

1. Predatismo
Predatismo ou predao uma relao desarmnica em que um ser vivo, o predador captura e
mata um outro ser vivo, a presa, com o fim de se alimentar com a carne dele.
Geralmente uma relao interespecfica ou seja, uma relao que ocorre entre espcies
diferentes.
Os carnvoros so exemplos de animais predadores, o leo, o lobo, o tigre e a ona so
predadores que caam, matam e comem zebras, coelhos e outros animais. Nas guas so comuns
os peixes predadores que vivem caando e matando outros peixes a fim de se alimentarem; aves
predadoras, que matam e comem outros animais, como as corujas, guias e gavies que atacam
aves menores, ou seus ovos, ou outros animais mais pequenos, como ratos e lagartos; rpteis
predadores como crocodilos, jacars e as lagartixas domsticas, que devoram diversos tipos de
presas; a maioria dos aracndeos so predadores, como as aranhas, escorpies atacam e devoram
moscas, baratas e insectos em geral, ou at pequenas aves e mamferos.
At mesmo no mundo dos micrbios o predatismo evidente, existindo muitos protozorios
maiores que so predadores de protozorios menores.
Raros so os casos em que o predador uma planta. As plantas carnvoras, no entanto, so
exemplos excelentes, pois aprisionam, matam e digerem principalmente insectos afins de
absorver os minerais contidos na carne deles.


Instituto de Educao Aberta e Distncia 88


O predatismo pode-se representar da seguinte forma:



A+ - B

Explicao: um organismo A tem sempre uma influncia negativa sobre o outro B. Ex: o leo ao
alimentar-se, diminui a quantidade de zebras e organismo B tem uma influncia positiva sobre o
organismo A porque quanto mais zebras a quantidade de lees aumenta.

2. Parasitismo.
Parasitismo uma relao desarmnica entre seres de espcies diferentes, em que um deles o
parasita que vive dentro ou sobre o corpo do outro que designado hospedeiro, do qual retira
alimentos.
Os parasitas geralmente no tm intenes de causar a morte dos hospedeiros embora estejam
causando prejuzos, por vezes a populao do parasita cresce exageradamente em determinados
hospedeiros de forma que a superpopulao desses parasitas acaba provocando a morte desses
hospedeiros devido ao excesso de prejuzos devido a quantidade anormal de parasitas,
parasitando um s organismo hospedeiro, facto este designado hiperinfestao de parasitas.
Quanto localizao no corpo do hospedeiro, os parasitas podem ser classificados em:
Ectoparasitas "ecto" significa (sobre)
Endoparasitas "endo" significa (interno)
Parasitas intracelulares ("intra" significa dentro), dentro das clulas: exemplo vrus.
Ectoparasitas so parasitas que vivem no exterior do corpo dos hospedeiros como os carrapatos,
piolhos, pulgas, mosquitos e outros.

3. Mutualismo

Alguns exemplos do mutualismo ou simbiose:
- um fungo e uma alga tm uma cooperao mtua num lquene
- as azoto-bactrias tm cooperao com as leguminosas, como na planta
do amendoim e do feijoeiro


O Mutualismo pode-se representar na seguinte forma :



A+ +B
Explicao: os dois organismos tm uma influncia positiva e mtua, a sobrevivncia de um
depende do outro.

4. Facilitao

Alguns exemplos da facilitao:
os lees apanham e devoram uma girafa e os chacais aproveitam os restos (
comensalismo);
o boi cavalo come capim grande e rijo, aps o qual as ervas podem crescer melhor e as
impalas podem ento aproveitar as tenras.

Instituto de Educao Aberta e Distncia 89


A facilitao pode-se representar da seguinte forma:




A0 + B


Explicao: S um dos organismos B tem vantagens nesta relao, o organismo A no sofre nem
aproveita. As garas-do-gado, por exemplo, so estimuladas pele presena do gado, mas este no
tem (ou tem pouca) vantagem das garas

5. Competio
Existem duas modalidades de competio:
o Competio interespecfica
o Competio intra-especfica
A competio interespecfica uma relao de competio entre indivduos de espcies
diferentes, que concorrem pelos mesmos factores do ambiente, existentes em quantidades
limitadas.
Alguns exemplos:
- Corujas, cobras e gavies so predadores que competem entre si pelas mesmas espcies de
presas, principalmente por pequenos roedores (ratos, coelhos etc.) que so as presas preferidas
destes diferentes predadores, portanto uma competio por alimento.
- rvores de diferentes espcies crescendo umas muito prximas das outras competem entre si
pelo espao para as copas das rvores se desenvolverem e assim obterem mais luz solar para
realizarem a fotossntese, portanto uma competio por luz solar.
- Durante os perodos de estiagem ou seca prolongada fica sem chover durante meses fazendo
com que a oferta de gua potvel se reduza drasticamente no ambiente e fazendo com que
animais de diversas espcies diferentes sejam obrigados a competir pela gua que ainda resta em
pequenas poas de gua, portanto uma competio por gua potvel.
A competio intra-especfica uma relao de competio entre indivduos da mesma espcie,
que concorrem pelos mesmos factores do ambiente, que existem em quantidade limitada. Machos
de uma mesma espcie precisam competir entre si pelas fmeas dessa mesma espcie, fenmeno
esse chamado "seleco sexual". Na verdade existe muito exibicionismo evidente nos
comportamentos relacionados competio que ocorre durante a seleco sexual nas populaes
das espcies em geral.

Machos de uma mesma espcie precisam competir entre si pelas fmeas dessa mesma espcie,
fenmeno esse chamado "seleco sexual". Na verdade existe muito exibicionismo evidente nos
comportamentos relacionados competio que ocorre durante a seleco sexual nas populaes
das espcies em geral.
Alguns exemplos:
O leo por exemplo tem que competir com os outros lees do bando porque os lees praticam a
poligamia patriarcal e necessrio competir, lutar para ganhar ou perder, a tentativa de se
acasalar com todas aquelas fmeas do bando. Para ser o "macho alfa" do bando o leo ter que
ser o mais corajoso dentre todos os lees daquele territrio porque ter que enfrentar todos os
outros machos que tambm pretendem essas mesmas leoas e apenas um leo eleito pelas fmeas
o "macho alfa" que ter o direito de cobrir todas as leoas do bando enquanto que os perdedores
no se reproduzem.

Instituto de Educao Aberta e Distncia 90

Alm de ter que ganhar a luta com todos os outros lees do bando, o "macho alfa" campeo
nessas lutas tem tambm que exibir seu urro forte para impressionar as leoas, exibir sua juba
linda, suas garras afiadas, exibir vigor fsico e autoridade superior, tudo isso para poder ser eleito
e aceito pelas leoas que tambm tm l seus critrios de avaliao pois so elas que elegem quem
ser o novo "macho alfa" que ter o direito de se acasalar com todas elas.


A competio pode-se representar da seguinte forma:



A- - B

Explicao: As influncias na competio so negativas para os organismos, neste caso, a
influncia negativa tanto para o organismo A, assim como para o organismo B.

Habitat um termo ecolgico que significa o lugar ou ambiente onde um determinado
organismo habita, existe ou vive ( na terra e na gua).

Ecossistemas - O ecossistema formado por um conjunto de diferentes comunidades
interagindo entre si com o ambiente no vivo (fsico e qumico) e energia:

Tipos de ecossistemas

Existem na natureza, vrios tipos de ecossistemas que ocorrem sobretudo no meio terrestre e
aqutico ( artificiais ou naturais ).

Exemplos: - machamba abandonada de um campons;
- os corais da ilha dos portugueses na Baa de Maputo;
- o mangal da praia de Murbu em Cabo Delgado.

Composio de um ecossistema

J dissemos que um ecossistema formado pela comunidade juntamente com o ambiente no
vivo: fsico e qumico. Isto , o solo, as rochas, o clima e no caso de um ecossistema aqutico, a
gua, tambm.

Exemplifiquemos a composio de um ecossistema com base numa machamba:
Na machamba encontram-se numerosos animais daninhos que utilizam as culturas para a sua
alimentao ou abrigo. Exemplo gafanhotos, larvas, pulges-de-plantas, besouros, caracis, ratos
e diferentes pssaros.

Porm, existem tambm outros animais, que comem os animais daninhos. Por exemplo, a
toutinegra come muitos gafanhotos e besouros. As joaninhas comem os pulges-de-plantas. As
garas-do-gado comem muitos gafanhotos e outros insectos que fogem do gado. A guia rabota
come muitos ratos. As trmites comem plantas mortas.


Instituto de Educao Aberta e Distncia 91
At aqui falmos apenas sobre os organismos que vivem em conjunto a comunidade, mas o
ecossistema no s isso, inclui tambm o ambiente no-vivo, chamado ambiente abitico. Os
elementos deste ambiente inanimado so chamados factores abiticos.

Um ecossistema composto por um conjunto de factores biticos e abiticos.
Em ecologia, denominam-se factores abiticos todas as influncias que os seres vivos possam
receber em um ecossistema, derivadas de aspectos fsicos, qumicos ou fsico-qumicos do meio
ambiente, tais como a luz, a temperatura, o vento, etc. Factores biticos so as relaes entre os
seres vivos no seu conjunto.
Podemos dividir os factores abiticos em dois tipos: factores fsicos e qumicos.

Factores fsicos so por exemplo, o sol, o tipo de estrutura do solo, a chuva, a nuvem, o vento, a
temperatura (= clima).

Factores qumicos so por exemplo a quantidade de H20, C02,02 e sais minerais no solo e no ar.

Biosfera - o invlucro ou camada da terra que inclui todos os ecossistemas aquticos e
terrestres do mundo. o nvel de organizao mais elevado.

Um ecossistema s pode ser sustentvel por um determinado perodo de tempo dependendo da
disponibilidade das fontes de energia e nutrientes necessrios para manter os organismos nele
residentes e para reciclar os seus detritos.


Processos comuns dentro de um ecossistema
Cadeia Alimentar e Teia Alimentar

Uma das relaes mais complexas e necessrias vida no Planeta a alimentao. Plantas e
animais precisam de obter energia para a manuteno da vida. Os vegetais "fabricam" sua
energia, ou seja, sintetizam seu prprio alimento (so autotrficos), por isso so chamados
produtores. J os animais no conseguem isso , obtm a energia de fontes externas, comendo
vegetais e outros animais. So por conseguinte, consumidores.
Ao morrer, tanto os produtores como os consumidores servem de fonte de energia para o
ambiente a partir dos processos de decomposio.

Os consumidores que se alimentam de plantas, chamam-se consumidores primrios ou da 1
ordem, porque obtm as substncias orgnicas directamente das plantas que as fabricam.
Exemplo: cabrito, galinhas-de-mato, boi etc. Este grupo de animais, so tambm designados
herbvoros, pois alimenta-se de ervas.

Os animais que se alimentam de organismos herbvoros So carnvoros e chamam-se
consumidores secundrios ou da 2 ordem. Por exemplo:
- o leo ao comer impala;
- a toutinegra ao comer a lagarta;
- a gara-de-gado ao comer os gafanhotos.


Instituto de Educao Aberta e Distncia 92
Os carnvoros que comem consumidores secundrios chamam-se consumidores de 3 ordem.
Exemplo: - o leo ao comer o homem que come a vaca;
- A lagarta rabota ao comer a toutinegra que come a lagarta;
- O leo ao comer o homem que come a vaca.
Consumidores de 4 ordem: por exemplo: o homem ao comer a guia rabota que come a
toutinegra, esta por sua vez come a lagarta que por sua vez come as folhas das ervas.
Consumidor de 5 ordem: por exemplo a guia marcial ao comer a gara-do-gado que come a
aranha que por sua vez come o louva-deus e esta come a mosca que suga a flor;

Repara que, por exemplo, o leo s vezes consumidor da 2 ordem e outras vezes, consumidor
da 3 ordem. Isto depende da natureza da sua presa, o que complica a classificao ecolgica.
Essa busca pela sobrevivncia origina a cadeia alimentar. Estas, representam o movimento das
substncias orgnicas. Ou seja, cadeia alimentar uma sequncia de organismos, em que um
serve de alimento ao outro

Ao conjunto de vrias cadeias forma uma teia alimentar.


Processos Comuns dentro de um ecossistema

Uma parte da matria orgnica proveniente dos alimentos quebrada e oxidada no corpo dos
seres vivos, fornecendo, assim, a energia necessria s suas actividades. Esse processo
denominado respirao, permite que uma parte das substncias ingeridas seja devolvida ao
ambiente, na forma de dixido de carbnico, gua e outras substncias minerais.
A outra parte que passa a formar o corpo do organismo em causa devolvida, mais tarde para o
ambiente, depois da sua morte( graas ao processo de respirao realizado principalmente por
fungos e bactrias, que vivem no solo e na gua). Estes seres so chamados decompositores, uma
vez que atacam os cadveres e os excrementos, quebrando e oxidando a matria orgnica.

Atravs desse processo de decomposio, eles obtm a energia necessria ao funcionamento dos
seus organismos.
Como as substncias minerais produzidas por essa degradao sero novamente utilizadas pelos
vegetais na fotossntese, podemos compreender o papel fundamental dos decompositores, na
reciclagem da matria orgnica contida nos cadveres, plantas mortas e fezes dos animais. Sem
os decompositores, certamente que a matria mineral necessria fotossntese esgotaria e o nosso
planeta seria transformado num aglomerado de cadveres e de lixo.

Assim sendo, as cadeias alimentares s esto completas com a presena dos decompositores.
Alm disso, como muitos animais tm uma alimentao variada, enquanto outras servem de
alimento para mais de uma espcie, encontramos na comunidade um conjunto de cadeias que se
cruzam, formando teia alimentar.




Instituto de Educao Aberta e Distncia 93
Pirmide Ecolgico
A Ecologia estuda, entre outros assuntos, a distribuio quantitativa da matria e da energia nos
ecossistemas.

Para facilitar esse estudo, agrupamos os seres vivos , de acordo com os seus hbitos alimentares,
ou seja, nveis trficos, tambm chamados de nveis alimentares. Assim todos os produtores da
comunidade ocupam o 1 nvel trfico: os consumidores primrios, o 2 nvel, consumidores
secundrios, e assim por diante.

Observamos, ento que o nmero de indivduos em cada nvel trfico tende a diminuir, a medida
que percorremos a cadeia.

Essa relao pode ser representada por uma pirmide, formada por rectngulos sobre postos: a
pirmide ecolgica.

A largura de cada rectngulo directamente proporcional ao n de indivduos em cada nvel
trfico. Tanto a biomassa (quantidade da matria orgnica) quanto a energia, diminuem, medida
que passamos para nveis superiores. Porqu?

Uma parte da substancias ingeridas por um animal eliminada pelas fezes, outra parte oxidada
pela respirao, produzindo a energia necessria ao movimento e s outras actividades do
organismo.

Em geral, apenas 10% de substncias orgnicas ingerida usada na construo e no crescimento
do corpo do animal. Portanto, a maior parte da matria e da energia do alimento no passa ao
nvel trfico seguinte, saindo da cadeia na forma de calor e de resduos de dixido de carbono,
gua, ureia e fezes.

Ciclos biogeoqumicos
Uma das caractersticas mais importantes dos ecossistemas naturais a circulao da matria em
seu interior. Sabemos que os organismos esto constantemente retirando da natureza os
elementos qumicos de que necessitam. No entanto, de uma forma ou de outra, esses elementos
acabam sempre voltando ao ambiente.

Ao processo contnuo de retirada e devoluo de elementos qumicos chama-se ciclos
biogeoqumicos.

Ciclo de carbono
Na Natureza, nada se cria, nada se perde, tudo se transforma. Este o princpio de conservao
da matria, enunciado por Lavoisier. Os elementos qumicos ora esto participando da estrutura
de molculas inorgnicas, na gua, no solo ou no ar, ora esto compondo molculas de
substncias orgnicas, nos seres vivos. Pela decomposio cadavrica ou por suas excrees e
seus excrementos, tais substncias se decompem e devolvem ao meio ambiente os elementos
qumicos, j na forma de compostos inorgnicos.

Instituto de Educao Aberta e Distncia 94

A vida uma consequncia da propriedade que tem o tomo de carbono de se ligar a outros
tomos, formando longas cadeias carbnicas. Essas cadeias so fabricadas pelos seres
autotrficos atravs do processo da fotossntese, a partir do dixido de carbono do
ambiente - C02.

O carbono passa a circular pela cadeia alimentar na forma de CO2, realiza-se pela respirao de
animais e vegetais, ou pela decomposio de seus corpos aps a morte.

O carbono ocorre na terra sob forma de compostos minerais, como os carbonetos, e nos depsitos
orgnicos fsseis, como o carvo e o petrleo. Neste caso o carbono volta atmosfera pela
eroso ou pela combusto. Esse retorno mais lento que o resultante da respirao, da
transpirao e da decomposio.

O processo natural de circulao do carbono nos ecossistemas ciclo do carbono, vem sofrendo
grande alterao com o incremento da civilizao e sobretudo a partir da revoluo industrial.
Com efeito, a aco do homem no aumento da queima de combustveis fsseis. Por consequncia
de tudo isso, bilies de toneladas do dixido de carbnico so lanadas anualmente na atmosfera.
As consequncias de tal facto so incalculveis. O aquecimento global, a subida dos nveis das
guas do mar, etc., so apenas alguns exemplos.

Ciclo de Nitrognio
O Nitrognio um elemento qumico importantssimo, pois entra na constituio de dois
compostos que no podem faltar em nenhum ser vivo: as protenas e os cidos nuclicos.
Entretanto, apesar de 78% da atmosfera ser constituda por nitrognio, a maioria dos seres vivos
no pode o usar directamente. Isso porque o nitrognio do ar atmosfrico, na forma de N2,
quimicamente muito estvel , com pouca tendncia para reagir com outros elementos.

Assim, os vegetais s podem us-lo sob a forma de amonaco ou nitrato, ao passo que os animais
o aproveitam em forma de aminocidos.

Somente as algas azuis (cianofcias) e algumas bactrias do solo conseguem utilizar o Nitrognio
atmosfrico, fazendo-o reagir com o Hidrognio e produzindo amonaco, que ento usando na
sntese de aminocidos. Essa reaco chamada fixao do Nitrognio que tambm pode ser
realizada industrialmente, muito usado na para a produo de amonaco.

Uma pequena quantidade de nitrognio do ar fixada na forma de nitratos graas forte energia
fornecida por relmpagos e raios csmicos. A maior parte da fixao do nitrognio realizada
pelas bactrias pelas algas azuis que geralmente tm vida livre.


A parte mais significativa desse processo realizada por bactrias que vivem no interior das
razes, principalmente das leguminosas, como, feijo, ervilha, amendoim, etc. Os ndulos que
aparecem nas razes dessas plantas contm milhes de bactrias fixadoras do nitrognio.



Instituto de Educao Aberta e Distncia 95
Ciclo de gua
Uma das condies necessrias para que um planeta tenha vida a presena de gua.
Dissolvendo as mais variadas substncias, ela possibilita a realizao de mltiplas reaces
qumicas, fundamentais para a vida. Alm disso, no processo de fotossntese, a gua funciona
como doadora de hidrognio para a sntese de molculas orgnicas, e de oxignio que libertado
para atmosfera. Acrescenta-se ainda o facto de a gua aquecer-se e resfriar-se lentamente, o que
impede grandes variaes de temperatura no ambiente aqutico. A sobrevivncia de cada ser
vivo e de toda a biosfera depende dessas e de outras propriedades da gua.

A energia solar desempenha um papel importante no ciclo de da gua: graas a energia, a gua
em estado lquido sofre constante evaporao e penetra na atmosfera em forma de vapor. O
retorno ao estado lquido se d por meio de precipitaes, como a chuva e a neve. Atravs de um
escoamento superficial, ela pode formar rios e lagos, e volta para o oceano. Pode tambm
infiltrar-se no solo, formando lenis de gua subterrnea, que pode ser absorvida pelos vegetais.
A gua retirada do ambiente pelos seres vivos retorna atmosfera atravs da transpirao,
excreo, respirao e decomposio dos cadveres.

O lanamento de uma quantidade excessiva de substncias orgnicas na gua, mesmo as
biodegradveis, pode causar um grave desequbrio ecolgico. Este fenmeno conhecido por
eutrofizao (eu = bem, trofo = nutrio), pode ser explicado do seguinte modo: a grande
quantidade de matria orgnica presente nos restos de alimentos, esgotos ou produtos industriais,
quando despejada em rios ou em lagos, favorece a proliferao de microorganismos
decompositores. Com o aumento desses microorganismos, o consumo de oxignio da gua
tambm cresce. Assim sendo, a quantidade de oxignio dissolvido na gua diminui, podendo
provocar a morte de peixe e outros animais, que necessitam de uma taxa mnima desse gs para
sobreviver. Alm disso, a decomposio


Tarefas resolvidas

01. Qual o conceito de poluio?

02. Como o lanamento de esgotos nos rios provoca a morte dos seres aerbios?

03. Em que consiste o processo de eutrofizao?

04. Quais so os danos provocados pela poluio do petrleo no mar?

05. Leia com ateno as questes que se seguem e resolva:

a) Indique a sequencia em que ocorrem os acontecimentos abaixo, causados pelo lanamento,
numa represa, de grande
quantidade de esgoto com resduos orgnicos.

(1) proliferao de seres anaerbios.
(2) proliferao intensa de microorganismos.

Instituto de Educao Aberta e Distncia 96
(3) aumento de matria orgnica disponvel.
(4) diminuio da quantidade de oxignio disponvel na gua.
(5) morte dos seres aerbios.

b) Qual desses acontecimentos conhecido como eutrofizao?

06. A concentrao de gs na atmosfera vem aumentando de modo significativo desde meados do
sculo XIX; estima-se que se quadruplicou no ano 2000. Qual dos factores abaixo o principal
responsvel por esse aumento?
a) ampliao da rea de terras cultivadas;
b) utilizao crescente de combustveis fsseis;
c) crescimento demogrfico das populaes humanas;
d) maior extraco de alimentos do mar;
e) extino de muitas espcies de seres fotossintetizantes.

07. O poluente atmosfrico que se liga permanentemente s molculas de hemoglobina
impossibilitando-as de transportar oxignio s clulas o:
a) ozono
b) hidrocarbonato
c) dixido de enxofre
d) dixido de carbono
e) monxido de carbono

08. A regio do nosso planeta ocupada pelos seres vivos constitui :
a) Biosfera
b) Biocora
c) Biologia
d) Bioma
e) Nicho Ecolgico

09. Um grande ecossistema, onde esto presentes clima, vegetao e animais da regio,
conhecido por:
a) Bioma
b) Biocenose
c) Biosfera
d) Bitipo
e) Biomassa

10. A energia radiante que chega Terra indispensvel vida. As regies que recebem mais
energia no nosso planeta so prximas do:
a) Crculo Polar rctico
b) Trpico de Cncer
c) Crculo Polar Antrctico
d) Trpico de Capricrnio
e) Equador



Instituto de Educao Aberta e Distncia 97
11. Analisando-se as trocas efectuadas entre o meio e cada nvel trfico de uma cadeia
alimentar, nota-se:
a) devoluo de energia, de CO
2
e de O
2
para o meio. A energia no pode ser reutilizada. O
CO
2
utilizado pelos produtores e o O
2
pelos seres vivos em geral;
b) devoluo de energia e de CO
2
para o meio. A energia e o CO
2
s podero ser reutilizados
pelos produtores;
c) devoluo de energia e de CO
2
para o meio. A energia pode ser reaproveitada. O CO
2
pode
ser reutilizado pelos produtores;
d) aproveitamento total da energia incorporada e desprendimento de O
2
, que poder ser
utilizada na respirao dos seres vivos;
e) aproveitamento total da energia incorporada e desprendimento de CO
2
, que poder ser
utilizado pelos produtores.

12. Seja a pirmide alimentar da sequencia seguinte:

plantas fotossintetizantes pequenos animais herbvoros pequenos carnvoros e
omnvoros maiores
a) o contedo energtico, a massa de protoplasma e o nmero de espcies aumentam a ordem
dada para a sequencia;
b) os trs parmetros dados diminuem na ordem da sequencia;
c) o contedo energtico aumenta e os dois outros parmetros diminuem;
d) o contedo energtico e a massa de protoplasma aumentam na ordem dada e o nmero de
espcies diminui;
e) na ordem dada para sequencia aumentam a massa dos protoplasmas e o nmero de
espcies, diminuindo o outro parmetro.


13. O que so decompositores? Exemplifique.

14. As alternativas apresentam os constituintes de uma cadeia alimentar de uma lagoa, onde foi
aplicado DDT, sabendo-se que o DDT tem efeito cumulativo, em qual dos elementos da
cadeia alimentar haver maior concentrao deste insecticida?

a) guaru-guarus
b) fitoplncton
c) larvas de mosquitos
d) cgados
e) zooplncton










Instituto de Educao Aberta e Distncia 98
15. O esquema abaixo representa uma teia alimentar em uma comunidade de lagos.













Sabendo-se que os peixes dessa comunidade servem de alimento para uma ave, podemos dizer
que, nessa teia alimentar, a ave comporta-se, exclusivamente, como:
a) consumidor de primeira ordem
b) consumidor de segunda ordem
c) consumidor de terceira ordem
d) consumidor de segunda e terceira ordens
e) consumidor de terceira e de quarta ordem.

16. Qual a importncia das algas planctnicas nos ecossistemas?
17. Qual o significado dos decompositores num ecossistema?
18. Quais so as diferenas existentes entre as cadeias de predadores e de parasitas?

Parasitas: indivduos menores e mais numerosos.

19. O esquema ao lado representa uma teia alimentar. Dentre as mltiplas relaes ecolgicas
mostradas pelas setas, destaque uma cadeia alimentar com cinco nveis trficos. Classifique
os elementos destacados de acordo com seu papel na cadeia.




Instituto de Educao Aberta e Distncia 99
20. Numa cadeia alimentar constituda por vegetais, gavies, gafanhotos, rs e cobras, qual dos
organismos ocupa o nvel trfico mais alto e qual ocupa o nvel mais baixo?

Ciclos Biogeoqumicos

21. O que plncton?
22. A quantidade de nitrognio atmosfrico, fixada industrialmente, vem dobrando a cada 6
anos. As actuais culturas de leguminosas fixam, anualmente, mais nitrognio (cerca de 10% que
todos os processos naturais somados). O crescimento da populao humana e das populaes de
animais domsticos aumenta a quantidade de excretas nitrogenados.
Esta interferncia do homem no ciclo do nitrognio:
a) poder causar um desequilbrio entre a fixao desse elemento e a desnitrificao, que s
feita por certas bactrias anaerbicas;
b) poder ser contrabalanada por tcnicas que aumentam o teor de oxignio no solo,
favorecendo a aco das bactrias desnitrificantes;
c) no alterar em nada o equilbrio entre reaces que levam fixao de nitrognio e s
reaces de desnitrificao, uma vez que elas obedecem a uma sequencia cclica;
d) no alterar em nada o ciclo, mas levar a um melhor rendimento dos compostos
nitrogenados;
e) no alterar em nada o ciclo, mas deslocar seu equilbrio para um outro ponto.

23. O que fazem as bactrias desnitrificantes?

24 Assinale a alternativa incorrecta:
a) os consumidores so heterotrficos
b) os heterotrficos dependem dos autotrficos
c) os decompositores decompem a matria orgnica
d) todos os vegetais so autotrficos, produtores
e) os herbvoros so heterotrficos

25. No ciclo da gua, abaixo esquematizado, indique quais so os fenmenos fisiolgicos
representados pelos
algarismos romanos.




Instituto de Educao Aberta e Distncia 100
26. Cite os principais processos responsveis pela perda de gua nos animais.

27. O ciclo da gua pode ocorrer na ausncia dos seres vivos? Justifique.

28. Todos os seres vivos participam de alguma forma do ciclo da gua na natureza
porque consomem gua do meio abitico e liberam-na em decorrncia do seu metabolismo vital.
Assinale:
a) se a afirmao e a razo estiverem correctas;
b) se a afirmao estiver correcta e a razo incorrecta;
c) se a afirmao estiver incorrecta e a razo correcta;
d) se a afirmao e a razo estiverem incorrectas;
e) se a afirmao e a razo estiverem correctas, mas a razo no justificar a afirmao.

29 No esquema anexo, que representa o ciclo do carbono na natureza, identifique os fenmenos
numerados de 1 a 5.


Factores Biticos

30. Em que condies as relaes entre os organismos so classificadas como harmnicas?

31. Cite exemplos de animais que formam colnias?

32. O que so colnias polimrficas? Cite exemplos.

33. Nas abelhas, como so produzidos os zanges?

34. As sociedades so:
a) relaes harmnicas interespecficas
b) relaes harmnicas intra-especficas
c) relaes desarmnicas interespecficas
d) relaes desarmnicas intra-especficas
e) relaes desarmnicas homotpicas

Instituto de Educao Aberta e Distncia 101
35. As relaes homotpicas so sempre:
a) harmnicas
b) positivas
c) interespecficas
d) intra-especfica
e) desarmnicas

36. O que so feromonas?

37. Na sociedade das abelhas:
a) todos os indivduos so diplides
b) a abelha rainha haplide
c) as obreiras so haplides
d) o zango haplide
e) os indivduos haplides so estreis

Factores Ecolgicos

38. O que se entende por factor ecolgico?

39. Em que condies um factor ecolgico desempenha o papel de factor limitante?

40. A mosca domstica uma espcie euricia. Qual o significado de tal expresso?

41. Qual o significado de valncia ecolgica?

42. De que maneira os factores ecolgicos agem sobre a densidade populacional?

43. Qual o enunciado da Lei de tolerncia?

44. A aco do clima mais pronunciada sobre os seres pecilotermos. Por qu?

45. Os organismos de meio areo reduzem a perda de gua atravs de vrios processos. Cite dois
deles.

46. Sabe-se que a gua um factor abitico essencial para todos os seres vivos. Contudo, existem
animais, como o caso do rato canguru, que jamais bebem tal lquido. De que maneira tais seres
satisfazem suas necessidades hdricas?

Sucesso Ecolgica
47. Em relao ao desenvolvimento de uma comunidade conceitue:
a) aco
b) reaco
c) coao
48. No desenvolvimento de uma comunidade o que significa ECESIS? O que so seres?
49. Que relao existe entre as actividades autotrficas e heterotrficas nos estgios iniciais e
climcicos de uma sucesso?

Instituto de Educao Aberta e Distncia 102

50. O que so sucesses destrutivas?
51. Um grande rochedo nu comea a ser colonizado por seres vivos. Os primeiros organismos a
se instalarem so:
a) gramneas
b) lquenes
c) fungos
d) brifitas
e) pteridfitas

52. Com relao ao nmero de nichos ecolgicos (I) e taxa de respirao (II), numa sucesso
ecolgica correcto afirmar que:
a) I aumenta e II diminui
b) I diminui e II aumenta
c) I aumenta e II permanece constante
d) ambos aumentam
e) ambos diminuem

53. Os organismos pioneiros na sucesso que ocorre em uma infuso so:
a) amebas
b) bactrias
c) crustceos
d) flagelados
e) paramcias

54. No processo de sucesso de um ecossistema h comummente:
a) aumento da eficincia no uso da energia e minerais do ambiente;
b) diminuio da eficincia no uso de energia e minerais do ambiente;
c) diminuio de eficincia no uso da energia e aumento da eficincia no uso de minerais do
ambiente;
d) aumento da eficincia no uso da energia e aumento da eficincia no uso de minerais do
ambiente;
e) manuteno do mesmo padro de eficincia no uso de minerais e energia do ambiente.

55. Considere dois ecossistemas fluviais, ambos em estgio inicial de sucesso, sendo um deles
(I) altamente poludo por detritos orgnicos biodegradveis e o outro (II) totalmente livre de
qualquer tipo de poluio. A relao P/R (P = produo primria bruta e R = respirao) da
comunidade , provavelmente:
a) igual a 1 em ambos os ecossistemas;
b) menor que 1 em ambos os ecossistemas;
c) maior que 1 em ambos os ecossistemas;
d) menor e maior que 1 em (I) e (II), respectivamente;
e) maior e menor que 1 em (I) e (II), respectivamente.




Instituto de Educao Aberta e Distncia 103
Resoluo das Tarefas

RESPOSTA 1: Alterao do equilbrio ecolgico provocado por resduos produzidos,
principalmente, pelo homem.

RESPOSTA 2: Aumento de matria orgnica proliferao de bactrias aerbias falta
de oxignio proliferao de
anaerbios.
RESPOSTA 3: Aumento de nutrientes nos ecossistemas aquticos.

RESPOSTA 4: Impermeabiliza a superfcie impedindo a passagem de oxignio.

RESPOSTA 5: a) 3 2 4 5 1
b) 3
RESPOSTA 6: B

RESPOSTA 7: E

RESPOSTA 8: A

RESPOSTA 9: A

RESPOSTA 10: E

RESPOSTA 11: C

RESPOSTA 12: B

RESPOSTA 13: Quando qualquer organismo morre, outros seres vivos podem usar substncias
que formam seu cadver, como fonte de energia. Fungos e bactrias so
especialistas nisso e merecem o nome de decompositores.
RESPOSTA 14: D

RESPOSTA 15: E

RESPOSTA 16: Principais produtores dos sistemas aquticos.

RESPOSTA 17: Reciclagem da matria.

RESPOSTA 18: Predadores: indivduos maiores e menos numerosos.
Parasitas: indivduos menores e mais numerosos.

RESPOSTA 19: Plantas (P) - Insecto (C
1
) - Perdiz (C
2
) - Cobra (C
3
) - guia (C
4
)

RESPOSTA 20: Respectivamente vegetais e cobras.



Instituto de Educao Aberta e Distncia 104
21. O que plncton?

RESPOSTA 21: Conjunto de seres que vivem em suspenso e so transportados pelas
correntes marinhas.

RESPOSTA 22: A

RESPOSTA 23: Convertem nitratos ou compostos amoniacais em nitrognio molecular
(N
2
).
RESPOSTA 24: D

RESPOSTA 25: I e II = respirao e transpirao; III = nutrio; IV = absoro; V =
egesto e excreo.

RESPOSTA 26: Respirao, transpirao, excreo e egesto.

RESPOSTA 27: Sim, atravs do ciclo curto: evaporao, condensao e precipitao.

RESPOSTA 28: A

RESPOSTA 29: 1 = fotossntese; 2 = combusto; 3, 4 e 5 = respirao

RESPOSTA 30: Quando no causam prejuzo a qualquer um dos associados.

RESPOSTA 31: Protozorios, espongirios, celenterados e tunicados.

RESPOSTA 32: Diferentes tipos de organismos com funes diferentes. Ex,: Caravela.

RESPOSTA 33: Atravs da partenognese.

RESPOSTA 34: B

RESPOSTA 35: D

RESPOSTA 36: Substncias usadas para reconhecimento, atraco e comunicao, entre os
indivduos de uma colnia.

RESPOSTA 37: D

RESPOSTA 38: Qualquer factor ambiental que age sobre um ser vivo.

RESPOSTA 39: Quando acontece abaixo do mnimo ou acima do mximo.

RESPOSTA 40: Suporta amplas variaes dos factores ecolgicos.

RESPOSTA 41: Capacidade de adaptao.


Instituto de Educao Aberta e Distncia 105
RESPOSTA 42: Actuando sobre mortalidade, natalidade, imigrao e emigrao.

RESPOSTA 43: Cada espcie apresenta limites de tolerncia (mnimo e mximo) para os
factores ecolgicos.

RESPOSTA 44: Porque a temperatura corprea varia em funo da ambiental.

RESPOSTA 45: Impermeabilizao do tegumento e rgos respiratrios internos.

RESPOSTA 46: Usando a gua contida nos alimentos.

RESPOSTA 47: a) Bitopo aco reaco Biocenose coao biocenose.

RESPOSTA 48: ECESIS comunidade pioneira
SERES comunidades de transio

RESPOSTA 49: Iniciais: autotrfica maior do que a heterotrfica
Climcicos: autotrfica igual heterotrfica.

RESPOSTA 50:Provocam a distribuio do bitopo e nunca atingem ao clmax.

RESPOSTA 51: B

RESPOSTA 52: D

RESPOSTA 53: D

RESPOSTA 54: A

RESPOSTA 55: D

















Instituto de Educao Aberta e Distncia 106
Questionrio no resolvido

1.Estabelea a diferena entre factores biticos e abiticos.

2.Das afirmaes que se seguem assinale com x a que for verdadeira:

a) ----- A ecologia estuda a relao entre os seres vivos e no vivos com o ambiente;
b) ----- A ecologia estuda a relao entre os seres vivos e entre eles e o ambiente;

c) ----- A ecologia estuda a relao entre os seres vivos e a aco do homem cm o
ambiente.

3. Define o conceito espcie. Exemplifique.

4. Com se chama o conjunto formado pela reunio e interaco do meio fsico com a
comunidade? D exemplos.

5. Os seres autotrficos so tambm chamados produtores. Explica porqu?

6. Marque com x a afirmao correcta:

a) .........Cadeia alimentar a sequncia de alimentos indispensveis para proporcionar
uma boa sade, de acordo com o PMA;
b) .........Cadeia alimentar a sequncia de organismos em que um serve de alimento ao
outro.
c) .........Cadeia alimentar a sequncia de organismos produtores, decompositores e
consumidores
d) .........Cadeia alimentar a sequncia de organismos em que um serve de alimento a
mais de um animal.

7.D exemplos de consumidores primrios e secundrios das cadeias alimentares terrestres e das
cadeias aquticas.

8.Qual a importncia dos decompositores para o ecossistema?

9. Assinale com V a afirmao verdadeira.

a) ........... Ciclo biogeoqumico o processo contnuo retirada e devoluo de elementos
qumicos nos organismos.
b) ........... Ciclo biogeoqumico o processo contnuo retirada e devoluo de elementos
qumicos no ecossistema;
c) ......... Ciclo biogeoqumico o processo contnuo retirada e devoluo de elementos qumicos
nos seres vivos.

10.Como voc explica a diminuio da biomassa e de energia ao longo da cadeia?

11. Esquematize a pirmide alimentar.

Instituto de Educao Aberta e Distncia 107

12. Desenvolva o esquema de uma cadeia alimentar de um ecossistema terrestre.

13. Faa o esquema representativo de uma teia alimentar

14. Que processo faz o carbono passar de forma mineral para a forma orgnica?

15. Qual a importncia da camada do Ozono para a vida em nosso planeta?

16. Assinale com V a afirmao verdadeira:

a) ...... O carbono e o Nitrognio so elementos importantssimos, pois entram na constituio das
protenas e dos aminocidos dois compostos que no podem faltar em nenhum ser vivo
b) ...... O carbono o nico elemento importantssimo, pois entra na constituio das protenas e
dos aminocidos dois compostos que no podem faltar em nenhum ser vivo;

c) ...... O Nitrognio o nico elemento importantssimo, pois entra na constituio das protenas
e dos aminocidos dois compostos que no podem faltar em nenhum ser vivo.

17. Defina relao harmnica, desarmnica, intra-especfica e interespecfica?

18. Qual a diferena entre habitat e nicho ecolgico?

19. Qual a diferena entre mutualismo e simbiose?

20. Escolha a frase verdadeira assinalando com V.

a) ....... Numa relao de competio entre dois organismos, as influncias so negativas para
ambos.
b)..... Numa relao de competio entre dois organismos, as influncias so positivas para quem
ganha a competio;
c)....... Numa relao de competio entre dois organismos, as influncias so negativas para
ambos.

23. Faa um esquema representativo de uma relao de competio.

24. Explica como ocorre a perda de energia a passagem de um nvel trfico para o outro.

25. Como que os parasitas resolvem o problema de transporte de um hospedeiro para o outro?

26. Porque as queimadas so prejudiciais?
Depois resolvidos com xito todos exerccios e corrigidos pelo teu docente de disciplina, o passo
seguinte dirigir se ao respectivo CAA, para realizar as avaliaes do fim do bloco
correspondente a ecologia. Boa sorte




Instituto de Educao Aberta e Distncia 108
26. Considere as afirmativas:

1. Sucesso ecolgica o nome que se d ao processo de transformaes graduais na
constituio das
comunidades de organismos.
2. Quando se atinge um estgio de estabilidade em uma sucesso, a comunidade
correspondente a
comunidade clmax.
3. Numa sucesso ecolgica, a diversidade de espcies aumenta inicialmente, atingindo o
ponto mais alto
no clmax estabilizando-se ento.
4. Numa sucesso ecolgica ocorre aumento de biomassa.

Assinale:
a) se todas as afirmativas estiverem incorrectas;
b) se todas as afirmativas estiverem correctas;
c) se somente as afirmativas 1 e 4 estiverem correctas;
d) se somente as afirmativas 1 e 4 estiverem incorrectas;

Grupos Sanguneos
01. Na presena de aglutinina correspondente, as hemcias que contm o aglutinognio se
aglutinam. Pode-se dessa forma, determinar o grupo sanguneo do sistema ABO a que pertencem
os indivduos. Foi testado o sangue de dois indivduos (I e II) com os soros-padro anti-A e anti-
B, obtendo-se os seguintes resultados:



A que grupos sanguneos pertencem, respectivamente, os indivduos I e II?

RESOLUO 1: I do grupo B; II pertence ao grupo O.

02. Por que o indivduo do grupo O pode doar seu sangue a qualquer pessoa? Por que uma pessoa
do grupo AB pode receber sangue de qualquer tipo?

RESOLUO 2: O doador universal por no apresentar aglutinognios nas hemcias.
AB receptor universal por no possuir aglutininas no plasma.

Instituto de Educao Aberta e Distncia 109
03. Um homem do grupo sanguneo AB casado com uma mulher cujos avs paternos e
maternos pertencem ao grupo sanguneo O. Esse casal poder ter apenas descendentes:
a) do grupo O;
b) do grupo AB;
c) dos grupos AB e O;
d) dos grupos A e B;
e) dos grupos A, B e AB.

RESPOSTA 3: D

04. Um banco de sangue possui 5 litros de sangue tipo AB, 3 litros tipo A, 8 litros tipo B e 2
litros tipo O. Para transfuses em indivduos dos tipos O, A, B e AB esto disponveis,
respectivamente:
a) 2, 5, 10 e 18 litros;
b) 2, 3, 5 e 8 litros;
c) 2, 3, 8 e 16 litros;
d) 18, 8, 13 e 5 litros;
e) 7, 5, 10 e 11 litros.

RESPOSTA 4: A

05. Dois caracteres com segregao independente foram analisados em uma famlia: grupos
sanguneos do sistema ABO e miopia. A partir dessa anlise, obtiveram os seguintes dados:
I 1, 2 e 3 pertencem ao grupo O.
II 4 pertence ao grupo AB.
III 4 e 5 so mopes.



Qual a probabilidade de o casal 5 e 6 ter uma criana do grupo sanguneo O e mope?

a) 1 / 16
b) 1 / 8
c) 1 / 4
d) 1 / 2
e) 3 / 4



Instituto de Educao Aberta e Distncia 110
RESPOSTA 5: C

06. Como se forma o anti-Rh no corpo humano?

RESOLUO 6: O anti-Rh produzido nos organismos Rh negativos que recebem,
injectado, sangue Rh
+
.

07. Uma mulher que nunca recebeu transfuso sangunea teve trs filhos. O primeiro e o terceiro
nasceram normais e o segundo, com eritroblastose fetal. Quais so os fentipos e os gentipos
para o factor Rh dos indivduos acima citados?

RESOLUO 7: Mulher Rh
-
(rr); marido Rh
+
(Rr); 1 filho Rh
+
(Rr); 2 filho Rh
+
(Rr); 3
filho Rh
-
(rr).

08. (FEI) Para que haja possibilidade de ocorrncia de eritroblastose fetal (doena hemoltica do
recm-nascido), preciso que o pai, a me e o filho tenham, respectivamente, os tipos
sanguneos:

a) Rh
+
, Rh
-
, Rh
+

b) Rh
+
, Rh
-
, Rh
-

c) Rh
+
, Rh
+
, Rh
+

d) Rh
+
, Rh
+
, Rh
-

e) Rh
-
, Rh
+
, Rh
+


RESPOSTA 8: A
09. Um indivduo de tipo sanguneo O, Rh
-
, filho de pais tipo sanguneo A, Rh
+
, pretende se
casar com uma jovem de tipo sanguneo A, Rh
-
, filha de pai de tipo sanguneo O, Rh
-
e me AB,
Rh
+
. A probabilidade de o casal ter filhos com o mesmo fentipo do pai ser:
a) 1/4
b) 1/2
c) 1/3
d) 1/8
e) 1/16

RESPOSTA 9: B

10. Um casal cujo filho do grupo sanguneo A, com factor Rh positivo, pode ter os seguintes
gentipos:
a) |
A
|
B
Rhrh e |
B
|
B
rhrh
b) |
A
|
A
rhrh e |
B
|
B
RhRh
c) |
B
| Rh
rh
e ii rhrh
d) |
B
|
B
rhrh e |
A
|
B
RhRh
e) |
A
|
B
rhrh e ii Rhrh

RESPOSTA 10: E


Instituto de Educao Aberta e Distncia 111



REFERNCIAS BIBLIOGRFICAS






Biologia das Populaes ( Srgio Linhares/ Fernando Gewandsznajder
Gentica Clnica (Oswaldo Frota Pessoa, Paulo Alberto Otto, Priscila Guimares Otto)
Gentica Mdica (W. Beak e O. Frota Pessoa)
http://www.virtual.epm.br/cursos/genetica/htm/had.htm
http://www.medisa.pt/a_ocular/ocular_2.htm
http://www.virtual.epm.br/cursos/genetica/htm/had.htm
http://www.medisa.pt/a_ocular/ocular_2.htm