Assignment 2 – Bioinformatics: Desmin

Callum Highmore
From the School of Biological Sciences, University of Southampton

A sequence of DNA has been ggcgagctgctggacttctcgctggcagacgccgtcaacc

found in several different species ag”
and compared, to examine the
similarities between the The sequence was entered into the
organisms. The way in which this website:
is carried out is explained in
“http://blast.ncbi.nlm.nih.gov/Blast.cgi”1
Materials and Methods, and the
results found are presented in
Using the nucleotide blast program,
Results. These results are
the DNA sequence was identified as
investigated in Discussion,
to what protein it coded for and in
regarding the function of the DNA
which organisms it was expressed.
sequence and the presence of
similar sequences in different
Five organisms were selected,
species.
according to how accurate the DNA
sequence matched known
This paper explores the function of
sequences in their own genes.
one particular sequence of DNA and
The organisms’ DNA sequences
its occurrence in organisms. The
could then be compared with each
sequence investigated in this paper
other to achieve an understanding of
will be used to determine what
how genetically similar these
protein it codes for, the function of
organisms are and how they are
the protein and in which organisms it
related. This was carried out using
is present. Also, this investigation will
the “EMBOSS” tool on the website:
use the DNA sequence to compare
how genetically different organisms “http://www.ebi.ac.uk/Tools/emboss/align/ind
expressing this protein are, giving an ex.html” 2
idea of the relationship between the
organisms, evolutionarily. When the CDS of two organisms are
compared, a score is assigned,
Materials and Methods showing the relative similarities
between the two organisms, these
This investigation was all carried out scores can be represented
in silico, using various websites to graphically to show similarities
analyse the sequence of DNA. The between organisms.
DNA sequence investigated was:

“gccccgagcttcccgctcggctcgccgctgagctcgcccg
tgttcccgcgcgcgggcttcggcaccaagggctcctcgag
ctcggtgacctcccgagtgtaccaggtgtcgcgcacgtcgg
gcggggccgggggcctggggccgctgcgggccagccg
gctgggggccacccgcgtgccctcctcatcctacggcgca
 Results
Using emboss, the DNA sequence
The list of hits from the BLAST1 found in these organisms were
search is shown below. compared to receive a score based
on how similar they are. The table on
the opposite column shows these
scores and their percentage identity.

Table 2 – Quantified similarity

between compared organisms
Organisms Similarity Identity
compared score percentage
Sus scrofa / 232.0 60.9
Bos Taurus

The organisms found to have similar Sus scrofa / 127.0 31.6

sequences of DNA, identified Homo sapiens
Sus scrofa / 223.0 60.7
through this list, have been displayed Macaca
with their accession numbers below. fascicularis
Sus scrofa / 221.5 60.5
Mesocricetus
Table 1 – Organisms with DNA auratus
sequence Bos taurus / 129.0 31.9
Homo sapiens
Organism Accession Maximum Bos taurus / 228.0 61.1
Latin name number identity (%) Macaca
Wild boar NM_001001535.1 100 fascicularis
Bos taurus / 222.0 60.6
Sus scrofa Mesocricetus
auratus
European cattle NM_001081575.1 100 Homo sapiens / 144.0 32.6
Macaca
fascicularis
Bos taurus
Homo sapiens / 117.0 31.5
Mesocricetus
Human AK300654.1 100
auratus
Macaca 218.0 60.9
Homo sapiens
fascicularis /
Mesocricetus
crab-eating AB445461.1 100
auratus
Macaque
Macaca
fascicularis The higher score means that the
Syrian hamster AB071371.1 100 DNA sequences in the organisms
Mesocricetus are more alike, this suggests that the
auratus organisms are more closely related
evolutionarily. From this, a
phylogenetic diagram can be
It was found that the protein the produced showing how the
sequence coded for in Sus scrofa organisms are related, dependent on
was muscle-specific intermediate the similarity between them as
filament desmin, and the gene is discovered in this investigation.
called LOC396725.
Phylogenetic tree of organisms
investigated
This graphically shows that the
investigation found the Sus scrofa
and Bos taurus to be most similar,
and Homo sapiens to be most similar
to Macaca fascicularis, although is
the least similar organism genetically
to the other organisms. Mesocricetus
auratus was more closely related to
Bos taurus and Sus scrofa than it
was to Homo sapiens and Macaca
fascicularis.
Discussion
The protein the DNA sequence
codes for is desmin, a protein that
helps make up the sarcomeres of
muscle cells4. It is found near the Z
line, the central dark line on the
picture shown below5:
Two sarcomeres of a myofibril
Although its exact function has yet to
be determined, it has been found
that it connects the Z disc to the
cytoskeleton of the muscle cell4.
The phylogenetic tree produced from
the scores achieved through
EMBOSS2 corresponds to
evolutionary relationship between the
organisms, when comparing the
organisms’ classifications3. This
implies that the differences between
each organisms’ DNA sequence is a
good representation of how each
organism has evolved, relative to
each other.
It is also worth noting that the score
Homo sapiens received when
compared to other organisms is
considerably lower than when the
other species were compared.
Excluding humans, the range of the
identity percentage is 60.5 - 61.1.
The range of percentage identity
when Homo sapiens are compared
to other organisms is 31.5 – 32.6.
This means that the Homo sapiens
DNA sequence is more dissimilar to
the other organisms examined than
any other organism considered in
this investigation. This would suggest
that humans have evolutionarily
branched off from the other
organisms earlier on, however when
analysing the classification3 of Homo
sapiens, it is found that Homo
sapiens only differentiate from
Macaca fascicularis at the ‘family’
level, and all the organisms
considered are of the same class.
The reason for the more different
sequence found in Homo sapiens
could be that that sequence has
undergone more mutations than the
sequences found in the other
organisms, remembering that while
the similarities between the
sequences may be a good
representation of how each organism
is related to each other, the
differences between one sequence
of DNA does not necessarily mean
all the genes of that organism are at
the same level of dissimilarity.
The fact that all the organisms
examined are in the same class
implies common ancestry across all
the organisms which supports the
idea that the DNA sequence first
analysed is a derivation of an earlier
sequence that mutated, which along
with other mutations in the
organisms’ genes produced the
differentiation of different species.
Because of the high level of similarity
between the different organisms’
DNA sequences, it is fair to conclude
that it is the same strand, but after
undergoing mutations to different
bases, it has over time been
changed across the species.

References

1. blast.ncbi.nlm.nih.gov/Blast.cgi –
08/12/2009

2. ebi.ac.uk/Tools/emboss/align/index.html –
08/12/2009

3. animaldiversity.ummz.umich.edu/site/inde
x.html – 09/12/2009

4. en.wikipedia.org/wiki/Desmin –
08/12/2009

5.colorado.edu/intphys/Class/IPHY3430-
200/image/sarcomer1.jpg – 10/12/2009