Diverse Effects of Type II

Collagen on Osteogenic and

Adipogenic Differentiation of
Mesenchymal Stem Cells
LI-HSUAN CHIU,
1
TIEN-SHUN YEH,
2
HUEI-MEI HUANG,
1
SY-JYE LEU,
1,3,4
CHARNG-BIN YANG,
5
AND YU-HUI TSAI
1,4,6,7
*
1
Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan
2
Department of Anatomy and Cell Biology, National Yang-Ming University, Taipei, Taiwan
3
Department of Microbiology and Immunology, Taipei Medical University, Taipei, Taiwan
4
Center for Reproductive Medicine and Sciences, Taipei Medical University Hospital, Taipei, Taiwan
5
Department of Orthopaedic Surgery, Taipei County Hospital, Taipei, Taiwan
6
Department of Physical Medicine and Rehabilitation, Taipei Medical University Hospital, Taipei, Taiwan
7
Center for Nano-Tissue Engineering and Image Research, Taipei Medical University Hospital, Taipei Medical University,
Taipei, Taiwan
Type II collagen is known to modulate chondrogenesis of mesenchymal stem cells (MSCs). In this study, MSCs fromhuman bone marrow
aspirates were used to study the modulating effects of type II collagen on MSC differentiation during the early stages of osteogenesis and
adipogenesis. With osteogenic induction, MSCs cultured on the type II collagen-coated surface showed an enhanced calcium deposition
level with increasing mRNA expressions of RUNX2, osteocalcin, and alkaline phosphatase. A synthetic integrin binding peptide, which
specically interacts with the I-domain of a
1
b
1
/a
2
b
1
integrins signicantly blocks the mineralization-enhancing effect of type II collagen.
MSCs attached on the type II collagen-coated plates exhibited expanded cell morphology with increasing spreading area, and the
pretreatment of cells with integrin a
1
b
1
or a
2
b
1
-blocking antibody reduced the effect. The phosphorylation levels of FAK, ERK, and JNK
signicantly increased in the MSCs that attached on the type II collagen-coated plates. On the contrary, the mineralization-enhancing effect
of type II collagen was diminished by JNKand MEKinhibitors. Furthermore, type II collagen blocked the adipogenic differentiation of MSCs,
and this effect is rescued by JNK and MEK inhibitors. In conclusion, type II collagen facilitates osteogenesis and suppresses adipogenesis
during early stage MSC differentiation. Such effects are integrin binding-mediated and conducted through FAKJNK and/or FAKERK
signaling cascades. These results inspire a novel strategy encompassing type II collagen in bone tissue engineering.
J. Cell. Physiol. 227: 24122420, 2012. 2011 Wiley Periodicals, Inc.
Endochondral ossication is one of the rudimentary
mechanisms that govern the early stage bone development. It is
also an essential process, which controls the healing of bone
fracture (Ornitz and Marie, 2002). Endochondral ossication is
highly coordinated and multi-stepped. It initials with the
condensation of mesenchymal stem cells (MSCs) at the site of
impending bone formation. These MSCs proliferate and
differentiate into a very dense mass of chondrocytes as a
cartilaginous template in the shape of the ensuing bone. At this
stage, the extracellular matrix (ECM) of the cartilaginous
template contains primarily type II collagen and
glycosaminoglycans. By the invasion of the blood vessels, the
osteo-progenitor cells are brought into the template and result
in the calcication of the tissue. Eventually, the cartilaginous
template is replaced with bone matrices (Kronenberg, 2003).
These events are thought to be a sign of impending bone
development. During the process, type II collagen matrix
appears in the MSCcondensation region and forms the cartilage
template which is meant to be calcied (von der Mark and von
der Mark, 1977; Kirsch and von der Mark, 1991). The calcied
cartilage template is in contact with the osteo-progenitors and
nally forms bone. It is then hypothesized that the calcied
cartilaginous matrix, here in, type II collagen, regulates the
differentiation of the mesenchymal progenitor cells.
ECM components, such as type I collagen, type II collagen,
laminin-5, and vitronectin, have been demonstrated to play
crucial roles in coordinating and directing osteogenic
differentiation of MSCs (Salasznyk et al., 2004b; Chen et al.,
2005; Klees et al., 2005). As it is known, MSCs have a great
afnity to type I collagen. Upon their binding to the type I
collagen, the osteogenic differentiation of MSCs are stimulated
Abbreviations: MSC, mesenchymal stem cell; ECM, extracellular
matrix; IBP, integrin binding peptide; VLA, very late antigen; FAK,
focal adhesion kinase; MEK, mitogen-activated protein kinase;
ERK1/2, extracellular signal-regulated kinase 1/2; JNK, c-Jun N-
terminal kinase; RUNX2 (Cbfa1), core binding factor alpha1 gene;
OCN, osteocalcin gene; ALP, alkaline phosphatase gene; SOX9,
SRY-related high mobility group-box gene 9; AGN, aggrecan gene;
COL2A1, type II collagen alpha1 chain gene; ITGA2, integrin alpha-
2 gene; ITGB1, integrin beta-1 gene, PPAR-g, peroxisome
proliferator-activated receptor-gamma gene; ADN, adipsin gene;
GLUT4, glucose transporter type 4 gene.
Contract grant sponsor: National Science Council, Taiwan;
Contract grant number: 97-3112-B-038-003.
*Correspondence to: Yu-Hui Tsai, Graduate Institute of Medical
Sciences, Taipei Medical University, 250, Wu-Xing Street, Taipei,
Taiwan, 110. E-mail: cmbyht18@tmu.edu.tw
Received 1 June 2010; Accepted 28 July 2011
Published online in Wiley Online Library
(wileyonlinelibrary.com), 8 August 2011.
DOI: 10.1002/jcp.22976
ORIGINAL RESEARCH ARTICLE 2412
J ou r n al of J ou r n al of
Cellular
Physiology
Cellular
Physiology
2 0 1 1 W I L E Y P E R I O D I C A L S , I N C .
via an ERK1/2 signaling pathway (Mizuno and Kuboki, 2001;
Salasznyk et al., 2004a). On the other hand, type II collagen is
mainly presented in the cartilage tissue and considered as a
cartilaginous ECMmolecule. The role and signicance of type II
collagen are rarely addressed in the osteogenic differentiation
of MSC, nor has been applied to the enhancement of bone
formation in the previous researches. In this study, type II
collagen was shown to modulate early stage osteogenesis and
adipogenesis of MSCs. The possible mechanisms of type II
collagen for enhancing osteogenesis as well as inhibiting
adipogenesis of MSCs were also investigated. This is the rst
report to demonstrate the role of type II collagen in modulating
early stage osteogenic and adipogenic differentiation of MSCs.
Materials and Methods
Reagent
Antibodies against human antigens CD105, CD73, CD44, CD29,
CD45, CD14, and secondary antibody conjugated with FITC were
purchased fromBDBiosciences (San Jose, CA). Functional blocking
antibodies against integrin a
1
b
1
, a
2
b
1
, a
5
b
1
, and a
v
b
3
were
purchased from Millipore (Billerica, MA). Dulbeccos Modied
Eagle Medium-low glucose (DMEM-LG) medium, fetal bovine
serum (FBS) and other medium-related supplies were from
Invitrogen (Carlsbad, CA). Percoll solution was from GE
Healthcare Bio-Sciences. (Piscataway, NJ). Type II collagen of
chicken sternal cartilage (C9301) and type I collagen of rat tail
tendon (c3867) were obtainedfromSigmaAldrich (St. Louis, MO).
RT-PCR related reagents include TRIzol
1
and SuperScript
1
III RT
system were purchased from Invitrogen. SYBR Green I qPCR
systemwas obtained fromRoche applied science (Indianapolis, IN).
The synthetic integrin binding peptide (IBP) was purchased
from SigmaAldrich Genosys peptide synthesis service with the
sequence of [H]GP[Hyp]GP[Hyp]GF[Hyp]GERGP[Hyp]GP[Hyp]
GP[Hyp][NH2].
MSC isolation, cultivation, and storage
Bone marrow aspirates were obtained aseptically from donor
(65 years old) who received femoral surgery with informed
consent. Bone marrow was collected from the disposed aspirates
using a 10 ml syringe. The aspirates were immediately mixed with
sodium-heparin, and diluted in ve volumes of phosphate-buffered
saline (PBS). The cell suspension was then fractioned on a percoll
gradient (1.077 g/cm
3
of density) and centrifuged at 800g for
30 min. The MSC-enriched interface fraction was collected and
plated in a 10 cm dish containing 10 ml Dulbeccos Modied Eagles
Medium with 1 g/ml glucose (DMEM/LG), 10% FBS, 1 P/S/F
(penicillin/streptomycin/fungizone). The medium was changed
every 4 days. When the cells reached 80% conuence, they were
trypsinized and passaged into new 10 cm dishes at a cell density at
5 10
5
cells/dish. The cells were sub-cultured till P3 (passage 3). P3
cells were then seeded at designated condition and subjected to
experiments, and the remaining cells were stored for later use.
Osteogenic and adipogenic induction of MSCs
For osteogenic differentiation of human MSCs, cells were cultured
in DMEM/LG medium supplemented with 10% FBS, 50 mg/ml
L-ascorbate-2-phosphate, 10
7
M dexamethasone and 10 mM
b-glyceralphosphate (osteogenic medium). Adipogenesis was
induced in DMEM/HGmediumin the presence of 10%FBS, 10
6
M
dexamethasone, 0.5 mM methyl-isobutyl-methyl-xanthine, 0.2 mM
indomethacin, and 10 mg/ml insulin (adipogenic medium).
Flow cytometry analysis
Cells (5 10
5
) were xed with ethanol and then incubated
separately with uorochrome-conjugated antibodies against a
panel of cell surface markers, including CD105, CD73, CD29,
CD44, CD14, and CD45, for 45 min at 48C. Cells were
resuspended in Cons tube (BD Biosciences, San Jose, CA)
containing 200 ml of PBS/1% bovine serum albumin and then
analyzed by Flow Cytometry using Calibur software (BD
Biosciences, San Jose, CA).
Calcium deposition assay
To detect calcium deposition on the cell layer of differentiated
MSCs, cells were rinsed rapidly with distilled water. Then 1 ml
of pH 4.2 Alizarin Red S (ARS) solution was added to cover cell
surface for 5 min followed by washing thoroughly with distilled
water. The calcium deposits exhibited orange red coloration on
the cell surface and were recorded microscopically.
Total RNA isolation and RT-PCR
Total RNA was extracted by using RNeasy
1
RNA purication
columns (Qiagen, Valencia, CA) and stored at 808Cuntil used. To
reduce experimental variability, all RNAsamples were subjected to
reverse-transcription at the same time under similar condition.
Reverse-transcription was performed using SuperScript
1
III RT
System (Invitrogen). According to the protocol described by the
manufacturer, 500 ng of RNAwas reverse-transcribed to cDNAin
a 20 ml volume for each reaction. Aliquots of cDNA specimens in
each group were further analyzed by LightCycler real-time PCR
system (Roche Applied Science, Indianapolis, IN) using respective
specic primer sets (Table 1). The expression intensities of each
gene were normalized by b-actin gene product as internal control.
Collagen coating
The tissue culture plates were coated with 100 mg/ml of type I
collagen or type II collagen for 2 h at room temperature. The
remaining collagen solution was removed and the plates were
washed with PBS twice. The coated plates were dried and UV-
sterilized in a culture hood, and stored at 48C before use.
Statistical analysis
Each datum point obtained from three independent experiments
or an experiment of triplicate assay was presented as mean SD.
The statistical analysis was performed by One-way ANOVA and
Duncans Multiple Range Test.
Results
Surface marker identication of MSCs
MSCs of human bone marrow aspirates were fractionated and
cultured in DMEM/LG with 10% FBS. The cells were expanded
and their morphology was closely monitored. Colony forming
TABLE 1. Sequences of primer sets used for the target genes in realtime PCR analysis
Gene name Forward primer (5
0
3
0
) Reverse primer (5
0
3
0
)
RUNX2 TACCAGACCGAGACCAACAGAG CACCACCGGGCTCACGTCGC
OCN CCACCGAGACACCATGA CAGCCATTGATACAGGTAGC
ALP ACCATTCCCACGTCTTCACATTTG AGACATTCTCTCGTTCACCGCC
PPAR-g TTCAGGGCTGCCAGTTTC TGGTCGTTCAAGTCAAGATTTACA
ADN CATCGACCACGACCTCC CGTCGCAGAGAGTTCCC
GLUT4 CTTCGAGACAGCAGGGGTAG TGATGAAGTTGCTCGTCCAG
b-actin CGAGGACTTTGATTGCAC TATCACCTCCCCTGTGTG
JOURNAL OF CELLULAR PHYSIOLOGY
T Y P E I I C O L L A G E N A N D M S C D I F F E R E N T I A T I O N 2413
units were found in the passage 0 MSCprimary culture (Fig. 1A).
The rst to fourth passages of MSCs appeared broblast-like
(Fig. 1B). The surface markers of P
4
MSCs were characterized
by owcytometry analysis. The cells exhibited CD73

CD105

CD29

CD44

CD14

CD45

of cell surface markers

(Fig. 1C).
Type II collagen enhances osteogenic differentiation
of MSCs
To examine the modulating effect of type II collagen on MSC
osteogenesis, MSCs were cultured on type I collagen-coated,
type II collagen-coated, or non-coated control culture plates
with osteogenic mediuminduction. Cells were harvestedat 4, 8,
12, and 16 days, and subjected to 4% formaldehyde xation.
ARS staining were used to examine the mineralization status
of the culture. With osteogenic induction, MSCs cultured on
type II collagen-coated plates exhibited a signicant calcium
deposition level by day 12, which was much earlier than that did
the cells on the control (non-coated) plates by day 16.
Furthermore, MSCs cultured on type II collagen-coated plates
exhibited a greater level of calcium deposition as compared to
that on the type I collagen-coated plates at day 12 and day 16
(Fig. 2A).
To evaluate the possible mechanism associated with this
osteogenesis-modulating effect of type II collagen, a synthetic
IBP was used. IBP is recognized by the I-domain of integrin a
1
and a
2
subunits, thus competes and inhibits the binding of
collagens to a
1
b
1
or a
2
b
1
integrins (Knight et al., 2000;
Xu et al., 2000). MSCs were pre-treated and cultured in the
Fig. 1. Morphology of MSCs in culture: (A) Cell morphology of P
0
MSCs is presented. Colony forming units were noted under bright eld
observation. B: Fibroblast-likephenotypeof P
1
MSCs soonafter passage(100Tmagnicationview). C: Cell surfacemarker identicationof MSCs.
FACS analysis revealed that the P
4
MSCs exhibit SH2
R
(CD105), SH3
R
(CD73), CD44
R
, CD29
R
, CD45

, CD14

phenotype.
JOURNAL OF CELLULAR PHYSIOLOGY
2414 C H I U E T A L .
osteogenic medium with the presence of 100 mg/ml IBP
during the osteogenesis-induction period. As shown in the
Figure 2A, MSCs cultured in the IBP-treated groups
(CI-coated IBP; CII-coated IBP) showed a lesser extent of
calciumdepositionlevel than didthe MSCs cultured in the solely
type I-coated (CI-coated) or type II collagen-coated (CII-
coated) groups. Based on these observations, it was concluded
that the modulating effect of type I or type II collagen on MSC
calcication was conducted through specic integrin binding
which was inhibited by IBP.
To further examine the osteogenic marker gene expression
in MSCs, the mRNA expression of ALP, RUNX2, and OCN in
MSCs cultured on either type I collagen-coated, type II collagen-
coated, or non-coated plates with osteogenic induction for 4, 8,
12 days were assessed. As shown in the Figure 2B, the ALP
mRNA expression levels in both groups were gradually
elevated and peaked at day 8. During the 12-day period of
osteogenic induction, CII-coated group showed a relative
higher level of ALP as compared to those of the CI-coated and
control groups. Furthermore, the mRNA expression level of
RUNX2 in the CII-coated group was signicantly up-regulated
to a 10-fold of that in the control group and 5-fold of that in the
CI-coated group at day 12. Similarly, the mRNA expression
level of OCNmarkedly increased in the CII-coated group up to
a fourfold of that in the CI-coated group, while the expression
level in control group was not detectable.
Type II Collagen-MSC Interaction Involves a
1
b
1
and
a
2
b
1
Integrins
Since a
1
b
1
, a
2
b
1
, a
5
b
1
, and a
v
b
3
integrins has been shown to
bind type I and/or type II collagen (Tuckwell et al., 1994;
Schneider et al., 2001), the functional blocking antibodies of
these integrin complexes were used to study the integrin
Fig. 2. Calcium deposition levels and osteogenic marker gene expressions of osteogenesis-induced MSCs on type I or type II collagen-coated
plates: (A) MSCs wereculturedonvarious coatedcultureplates inosteogenicmediumfor4, 8, 12, and16days. Thecellswerethenxedandstained
with ARS. Control: MSCs culturedonnon-coatedplates; CI-Coated: MSCs culturedon100 mg/ml type I collagen-coatedplate; CII-Coated: MSCs
culturedon100 mg/ml typeII collagen-coatedplate; CI RIBP: MSCs culturedon100 mg/ml typeI collagen-coatedplatewiththepresenceof 100 mg/
ml IBP; CII RIBP: MSCs cultured on 100 mg/ml type II collagen-coated plate with the presence of 100 mg/ml IBP. For osteogenic marker gene
expressions in MSCs cultured on various coated culture plates, cells were cultured on type I collagen-coated (CI-coated), type II collagen-coated
(CII-coated) or non-coated (control) culture plates in osteogenic mediumfor 4, 8, and 12 days. Total RNAwas extracted at each time point and
subjected to realtime PCR analysis for (B) ALP, (C) RUNX2, or (D) OCN mRNA expression level. The expression intensity of each gene was
normalized by b-actin as internal control. [Color gure can be seen in the online version of this article, available at http://wileyonlinelibrary.com/
journal/jcp]
JOURNAL OF CELLULAR PHYSIOLOGY
T Y P E I I C O L L A G E N A N D M S C D I F F E R E N T I A T I O N 2415
subtypes involved in the interaction of MSCs to type I collagen-
coated or type II collagen-coated plates. MSCs were treated
with various blocking antibodies against a
1
b
1
, a
2
b
1
, a
5
b
1
, or
a
v
b
3
integrins for 30 min prior to their attachment to type I
collagen-coated or type II collagen-coated plates. After 2 h of
attachment, the attached cells were xed and examined for
their morphologies under microscope. As shown in Figure 3,
MSCs exhibited obvious shape changes with extended
cytoskeletons and increasing cell spreading area when attached
to either type I collagen-coated (Fig. 3B) or type II collagen-
coated (Fig. 3G) plates as compared to that in the non-coated
control plates (Fig. 3A). However, the pretreatment of a
1
b
1
(Fig. 3C) and a
2
b
1
antibodies (Fig. 3D) inhibited the attachment
and decreased the spreading area of MSCs to type I collagen-
coated plates, while the pretreatment of MSCs with a
5
b
1
(Fig.
3E), and a
v
b
3
antibodies (Fig. 3F) did not signicantly alter their
attachment and morphologies. On the other hand, the
pretreatment with a
1
b
1
(Fig. 3H) and a
2
b
1
antibodies (Fig. 3I)
greatly inhibited the attachment and decreased the cell
spreading area of MSCs attached to the type II collagen-coated
plates. However, the pretreatment of MSCs with a
5
b
1
(Fig. 3J)
and a
v
b
3
antibodies (Fig. 3K) showed no effects on their
morphology change and cell spreading area on type II collagen-
coated plates. These results indicated that integrins a
1
b
1
and
a
2
b
1
predominantly participated in the interaction of MSCs to
either type I or type II collagen-coated surface. Noteworthy,
MSCs attachment on type I collagen-coated plates (Fig. 3B)
appeared polygonal in shape with extended cell spreading
edges. However, MSCs attached to type II collagen-coated
plates (Fig. 3G) became predominantly round-shaped and were
fully expanded on the stratum. Taken together, the data imply
that a
1
b
1
and a
2
b
1
integrins are involved in the interaction of
type II collagen with MSCs.
Type II collagen-modulated MSC osteogenesis MSCs
with involves ERK and JNK signalings
Integrin activation is known to elicit FAKMAPK signalings.
Upon the binding of integrins with their ligands, FAK is
phosphorylated and recruits CAS/Crk complex. The complex
leads to the activation of JNK/SAPK signaling; on the other
hand, phosphorylated FAK can also recruit Grb2/SOS and lead
to the activation of ERK1/2 cascade (Giancotti and Ruoslahti,
1999; Schaller, 2001). Therefore, the involvement of JNK and
ERK1/2 in the type II collagen-induced signalings was examined.
MSCs were cultured in osteogenic medium on either control
(non-coated) plate, type I collagen-coated plate, or type II
collagen-coated plate with/without the presence of MEK
inhibitor (PD98059, 20 mM) or JNK inhibitor (SP600125,
10 mM). After 14 days, cells were xed and stained for the
evaluation of calcium deposition. Compared to that of type II
collagen-coated group, MEK inhibitor blocked both the
Fig. 3. Attachment of MSCs totypeI collagen-coatedor typeII collagen-coatedplates withthetreatment of various integrinblockingantibodies:
Cell morphologies of MSCs attached on the (A) control (non-coated) plates; (B) type I collagen-coated plates; as well as that on the type I
collagen-coatedplates withthetreatment of either (C) a
1
b
1
blocking antibody; (D) a
2
b
1
blocking antibody; (E) a
5
b
1
blocking antibody or (F) a
v
b
3
blocking antibody; and that of MSCs attached on the (G) type II collagen-coated plates; as well as that of MSCs attached on the type II
collagen-coatedwiththetreatmentof either(H) a
1
b
1
blockingantibody; (I) a
2
b
1
blockingantibody; (J) a
5
b
1
blockingantibody; or(K) a
v
b
3
blocking
antibody. The relative cell spreading areas of MSCs attached on the (L) type I collagen-coated plates and (M) type II collagen-coated plates with
various treatments were calculated with Image J software as presented.
JOURNAL OF CELLULAR PHYSIOLOGY
2416 C H I U E T A L .
mineralization-enhancing effect of type I and type II collagen,
and JNK inhibitor also signicantly but less effectively reduced
the calcium deposition level in both groups (Fig. 4A). It appears
that both ERK1/2 and JNKsignaling play crucial roles in the type
I and type II collagen-enhanced osteogenesis of MSCs.
Comparably, to further determine the signaling cascades
activated by type II collagen, the phosphorylation levels of FAK,
ERK1/2, and JNK were examined in MSCs attached on type II
collagen-coated plates. After 90 min of attaching, MSCs were
lysed for total protein isolation and Western blot analysis.
MSCs attached on type II collagen-coated plates showed an
activated FAK, ERK1/2, and JNK phosphorylation as compared
to that in the control (non-coated) group (Fig. 4B). The result
revealed that type II collagen directly induced the activation of
FAKJNK and FAKERK signaling cascades in MSCs.
Type II collagen suppresses MSC adipogenesis
The effect of type II collagen on MSC adipogenesis was also
investigated. MSCs were cultured in the adipogenic medium on
either control (non-coated) plate, type I collagen-coated plate,
or type II collagen-coated plate with or without the presence of
MEK inhibitor (PD98059, 20 mM) or JNK inhibitor (SP600125,
10 mM) (Fig. 5). After 14 days of adipogenic induction, MSCs
cultured on both type I collagen-coated plates (Fig. 5C) and type
II collagen-coated plates (Fig. 5F) showed remarkably reduced
oil red O staining as compared to the cells on the control (non-
coated) plates (Fig. 5B). Of great interest, while cells culturedon
type I and type II collagen-coated plates were exposed to either
JNK or MEK inhibitors, the inhibitory effect of both type I and
type II collagen on adipogenesis was signicantly rescued
(Fig. 5D,E,G,H).
The mRNA expression pattern of PPAR-g, ADN, and
GLUT4 in the MSCs cultured on either type I collagen-coated
(CI-coated), type II collagen-coated (CII-coated), or non-
coated (control) plates were assessed as well. In the CI-coated
and CII-coated group, the mRNA expression level of PPAR-g
was signicantly suppressed (Fig. 5I). Similarly, the mRNA
expressions of both ADN(Fig. 5J) and GLUT4 (Fig. 5K) showed
a sevenfold decrease in the CI-coated and CII-coated groups.
These observations indicated that both type II collagen and type
I collagen inhibited the adipogenic differentiation of MSCs
through MAPK signalings. Together with the data that JNK and
MEK inhibitors suppressed the osteogenesis-inducing effect of
type II collagen, and that type II collagen directly induces JNK
and ERK1/2 phosphorylation, these outcomes indicate that
type II collagen not only enhances MSC osteogenesis, but also
inhibits MSCadipogenesis through FAKERKand/or FAKJNK
signaling cascades.
Discussion
Vandenberg et al. (1991) found that transgenic mice carrying a
partially deleted human type II collagen gene developed a
chondrodysplasia phenotype with dwarsm, thick limbs, and
delayed mineralization of bone. Li et al. (1995) generated
transgenic mice with inactivated type II collagen gene and found
that there was no endochondral bone or epiphyseal growth
plate developed in long bones, however, many skeletal
structures such as the cranium and ribs were normally
developed and mineralized. These results lead to a hypothesis
that during early stage of bone development, type II collagen
matrix is required for completing the embryonic development
of axial and appendicular long bones.
Fig. 4. A: ARSstainingof MSCs culturedontypeI ortypeII collagencoated-plates inthepresenceof MEKor JNKinhibitor: MSCs wereculturedin
osteogenic medium on either type I collagen-coated plates (CI-coated) or type II collagen-coated plates (CII-coated) in the presence of MEK
inhibitor (PD98059, 20 mM) or JNK inhibitor (SP600125, 10mM). After 14 days of osteogenic induction, cells were xed and stained with ARS
for calcium deposition level evaluation. CI-coated: MSCs cultured on 100 mg/ml type I collagen-coated plate; CI-CoatedRPD98059: MSCs
cultured on 100mg/ml type I collagen-coated plate in the presence of 20 mMof PD98059 (MEKinhibitor); CI-CoatedRSP600125: MSCs cultured
on 100 mg/ml type I collagen-coated plate with the presence of 10 mM of SP600125 (JNK inhibitor); CII-Coated: MSCs cultured on 100 mg/ml
type II collagen-coated plate; CII-CoatedRPD98059: MSCs cultured on 100 mg/ml type II collagen-coated plate in the presence of 20mM of
PD98059 (MEK inhibitor); CII-CoatedRSP600125: MSCs cultured on 100 mg/ml type II collagen-coated plate with the presence of 10 mM of
SP600125 (JNKinhibitor). B: The effects of type II collagen-coated plates on FAK/JNK/ERK1/2 phosphorylation in MSCs: MSCs were attached to
typeII collagen-coatedplates for 90min, andthecells wereharvestedfor Westernblot analysis. Non-coated: MSCs attachedonnon-coatedplates;
CII-coated: MSCs attached on type II collagen-coated plates. [Color gure can be seen in the online version of this article, available at http://
wileyonlinelibrary.com/journal/jcp]
JOURNAL OF CELLULAR PHYSIOLOGY
T Y P E I I C O L L A G E N A N D M S C D I F F E R E N T I A T I O N 2417
Fig. 5. Adipogenesis of MSCs culturedontypeI or typeII collagencoated-plates inthepresenceof MEKor JNKinhibitor: MSCs wereculturedon
the (A) control (non-coated) plates without adipogenic medium induction; (B) control (non-coated) plates with adipogenic medium induction;
(C) type I collagen-coated plates with adipogenic mediuminduction; (D) type I collagen-coated plates with adipogenic mediuminduction, in the
presence of 10 mM SP600125 (JNK inhibitor); (E) type I collagen-coated plates with adipogenic medium induction, in the presence of 20mM
PD98059(MEKinhibitor); (F) typeII collagen-coatedplates withadipogenicmediuminduction; (G) typeII collagen-coatedplates withadipogenic
mediuminduction, inthepresenceof 10 mMSP600125(JNKinhibitor); and(H) typeII collagen-coatedplateswithadipogenicmediuminduction, in
thepresenceof 20 mMPD98059(MEKinhibitor). Theblackarrowsindicatetheoil droplet-positivecells, andthelowerleft insertsshowtheoil redO
positively-stainedcells ineachgroup. For adipogenic marker geneexpressions inMSCs platedoneither typeI collagen-coated(CI-coated), typeII
collagen-coated (CII-coated) or non-coated (control) plates, cells were cultured with adipogenic mediumin various conditions for 14 days. Total
RNAwasextractedandsubjectedtorealtimePCRanalysisfor(I)PPAR-g, (J)ADN, or(K)GLUT4mRNAexpressionlevel. Theexpressionintensity
of each gene was normalized by b-actin as internal control. [Color gure can be seen in the online version of this article, available at http://
wileyonlinelibrary.com/journal/jcp]
JOURNAL OF CELLULAR PHYSIOLOGY
2418 C H I U E T A L .
As implied in the bone development process, recent studies
with MSCs have given correlated results. Dickhut et al. (2009)
demonstrated that, the ectopic implant of MSC pellets in SCID
mice mineralized with persisted type II collagen expression,
however, non-mineralizing MSC pellets specically lost their
type II collagen expression. Similarly, Pelttari et al. (2006)
reported that, the subcutaneously implanted MSCpellets could
mineralize at the ectopic site with persisting type II collagen
production. These results suggested that type II collagen is
required for ectopic bone formation of MSC pellets in mice.
The data of this study support these in vivo observations.
Type II collagen increased the osteogenic marker gene
expression and enhanced the calcium deposition level of MSCs
(Fig. 2). However, it cannot be sure if type II collagen directly
induced RUNX2 mRNAexpression while it can be a secondary
effect. Type II collagen may facilitate the osteogenic
differentiation of MSCs through modulating RUNX2
phosphorylation as it directly activates FAKJNK and FAK
ERK signalings (Fig. 4B). Furthermore, the mineralization-
enhancing effect of type II collagen was inhibited by IBP (Fig. 2),
while the interaction of MSCs to type II collagen-coated plates
was signicantly inhibited by the functional blocking antibodies
to a
1
b
1
and a
2
b
1
integrins (Fig. 3). These observations imply
that the osteogenesis-enhancing effect of type II collagen to
MSCs is integrin-binding mediated, and conducted through
FAKJNK and/or FAKERK signaling cascades.
Osteoblasts have been reported to interact with type I
collagen through their surface integrin a
1
b
1
, a
2
b
1
, a
5
b
1
, and
a
v
b
3
(Takeuchi et al., 1997; Xiao et al., 1998; Jikko et al., 1999;
Schneider et al., 2001). Likewise, the binding of MSCs to type I
collagen is mainly mediated through integrin a
1
b
1
and a
2
b
1
(Gronthos et al., 2001). In this study, the interaction of MSCs
with type II collagen was identied mainly through integrin a
1
b
1
and a
2
b
1
. According to the previous report, native type II
collagen interacts with integrin a
2
b
1
through a RGD-
independent pathway, while denatured type II collagen binds to
integrin a
5
b
1
by a bronectin bridging mechanism (Tuckwell
et al., 1994). In this study, while integrin a
1
b
1
and a
2
b
1
were
shown to mediate the MSCs interacting with type II collagen,
the type II collagen-modulated osteogenesis of MSCs was then
considered conducting through them. This is supported by the
data that IBP inhibited the mineralization of MSCs cultured on
type II collagen-coated surface (Fig. 2). These outcomes imply
that the interaction of MSCs and the cartilaginous matrix,
herein, type II collagen, modulates early stage MSC
osteogenesis, and drives them along the osteogenic
differentiation process into mature bone cells.
Most of the known, integrin-related MAPKsignalings involve
FAK phosphorylation, followed by the downstream activation
of ERKand JNKcascades. (Schaller et al., 1994; Schlaepfer et al.,
1997; Tachibana et al., 1997; Cary et al., 1998; Ruest et al., 2000)
In this study, both ERK1/2 and JNK signalings were evaluated.
As a result, while type II collagen-coated plates enhanced the
calcium deposition level of MSCs as type I collagen-coated
plates did, MEKinhibitor completely blocks this effect, and JNK
inhibitor decreases the mineralization level to a minor extent
(Fig. 4). On the other hand, both type I collagen and type II
collagen-coated plates markedly inhibited the adipogenesis of
MSCs. However, either MEK or JNK inhibitor rescued the
adipogenic-blocking effect and resulted in the forming of
adipocytes (Fig. 5). These outcomes are in accordance with the
previous reports. Jaiswal et al. (2000) showed that both ERK
and JNK signalings regulate the commitment of MSCs, drive
them toward osteogenic differentiation and block adipogenic
differentiation pathways. Fu et al. (2008) alsoreported that ERK
and JNK inhibitors, but not the p38 inhibitor, block osteogenic
differentiation and stimulate adipogenic differentiation in bone
marrow stromal cells. These data imply that type I collagen and
type II collagen not only enhance osteogenesis at the early stage
of MSCdifferentiation, but alsoblock the adipogenesis of MSCs,
and switch them toward osteogenic differentiation pathway.
Amodel of type II collagen-modulated osteogenesis of MSCs
is suggested in this study. At the early stage of long bone
development, a cartilaginous template is formed with a
microenvironment consisted of abundant type II collagen
matrix which is destined to be calcied. Under this
circumstance, the binding of cells to type II collagen matrix
facilitates the differentiation of MSCs toward osteogenesis, and
shuts down the differentiation potential toward adipogenesis.
These effects are mediated through integrin-binding and the
downstream activation of ERK and JNK signaling cascades
(Fig. 6). In the case of chondrodysplasia (Vandenberg et al.,
1991; Spranger et al., 1994) or Kniest syndrome (Winterpacht
et al., 1993), in which the COL2A1 gene expression is
inactivated or attenuated during the early stage of bone
development, the absence of type II collagen matrix makes
the transient cartilaginous template fail to form. While a
suitable cartilaginous microenvironment is lost, the normal
development of endochondral bones is then partially hindered
or jeopardized.
Type II collagen not only presents in the cartilaginous
template of the developing bone, but also exists in the fracture
site (Einhorn, 1998). While MSCs reserve their own innate
capabilities for tissue homeostasis and wound repair, the
ndings of the present study may contribute to signicant
clinical implications. Type II collagen may be applied to bone
regeneration to modulate the MSC differentiation tendency at
the bone defect site. For instance, MSCs have been shown to
switch their differentiation potential from osteogenesis to
adipogenesis in the aging-related osteoporosis (Kajkenova
et al., 1997). Therefore, in the cases of osteoporosis-caused
fracture, type II collagen-coated matrices/composite materials
might be a superior bone implant of choice to accelerate the
bone healing process. In conclusion, a novel function of type II
collagen in modulating MSC differentiation during early stage
osteogenesis is demonstrated. The results may offer new
scopes for researchers to further understand the type II
collagenMSC interaction during early stage bone
Fig. 6. Amodel of type II collagen-modulatedosteogenesis of MSCs:
The binding of MSCs to type II collagen facilitates the differentiation
of MSCs towardosteogenesis andinhibits thedifferentiationpotential
toward adipogenesis. These effects are mediated through the binding
with integrins and the downstream activation of ERK1/2 and JNK
signalings.
JOURNAL OF CELLULAR PHYSIOLOGY
T Y P E I I C O L L A G E N A N D M S C D I F F E R E N T I A T I O N 2419
development, also provide new information for the design of
bone repair materials.
Acknowledgments
The authors would like to thank the National Science Council
for supporting this study via funding grants: 97-3112-B-038-003.
We would like to thank Dr. Wen-Fu T. Lai for providing us with
primers of adipogenic differentiation during the second
revision.
Literature Cited
Cary LA, Han DC, Polte TR, Hanks SK, Guan JL. 1998. Identication of p130Cas as a mediator
of focal adhesion kinase-promoted cell migration. J Cell Biol 140:211221.
Chen CW, Tsai YH, Deng WP, Shih SN, Fang CL, Burch JG, Chen WH, Lai WF. 2005. Type I
and II collagen regulation of chondrogenic differentiation by mesenchymal progenitor cells.
J Orthop Res 23:446453.
Dickhut A, Pelttari K, Janicki P, Wagner W, Eckstein V, Egermann M, Richter W. 2009.
Calcicationor dedifferentiation: Requirement tolock mesenchymal stemcells ina desired
differentiation stage. J Cell Physiol 219:219226.
Einhorn TA. 1998. The cell and molecular biology of fracture healing. Clin Orthop Relat Res
355 Suppl:S7S21.
Fu L, Tang T, MiaoY, Zhang S, Qu Z, Dai K. 2008. Stimulationof osteogenic differentiation and
inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via
ERK and JNK activation. Bone 43:4047.
Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science 285:10281032.
Gronthos S, Simmons PJ, Graves SE, Robey PG. 2001. Integrin-mediated interactions
between human bone marrow stromal precursor cells and the extracellular matrix. Bone
28:174181.
Jaiswal RK, Jaiswal N, Bruder SP, Mbalaviele G, Marshak DR, Pittenger MF. 2000. Adult human
mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated
by mitogen-activated protein kinase. J Biol Chem 275:96459652.
Jikko A, Harris SE, Chen D, Mendrick DL, Damsky CH. 1999. Collagen integrin receptors
regulate early osteoblast differentiation induced by BMP-2. J Bone Miner Res 14:1075
1083.
Kajkenova O, Lecka-Czernik B, Gubrij I, Hauser SP, Takahashi K, Partt AM, Jilka RL,
Manolagas SC, Lipschitz DA. 1997. Increased adipogenesis and myelopoiesis in the bone
marrow of SAMP6, a murine model of defective osteoblastogenesis and low turnover
osteopenia. J Bone Miner Res 12:17721779.
Kirsch T, von der Mark K. 1991. Isolation of human type Xcollagen and immunolocalization in
fetal human cartilage. Eur J Biochem 196:575580.
Klees RF, Salasznyk RM, Kingsley K, Williams WA, Boskey A, Plopper GE. 2005. Laminin-5
induces osteogenic gene expression in human mesenchymal stem cells through an ERK-
dependent pathway. Mol Biol Cell 16:881890.
Knight CG, Morton LF, Peachey AR, Tuckwell DS, Farndale RW, Barnes MJ. 2000. The
collagen-binding A-domains of integrins alpha(1)beta(1) and alpha(2)beta(1) recognize the
same specic amino acid sequence, GFOGER, in native (triple-helical) collagens. J Biol
Chem 275:3540.
Kronenberg HM. 2003. Developmental regulation of the growth plate. Nature 423:332336.
Li SW, Prockop DJ, Helminen H, Fassler R, Lapvetelainen T, Kiraly K, Peltarri A, Arokoski J,
Lui H, Arita M, Khillan JS. 1995. Transgenic mice withtargetedinactivationof the Col2alpha
1 gene for collagen II develop a skeleton with membranous and periosteal bone but no
endochondral bone. Genes Dev 9:28212830.
Mizuno M, Kuboki Y. 2001. Osteoblast-related gene expression of bone marrowcells during
the osteoblastic differentiation induced by type I collagen. J Biochem 129:133138.
Ornitz DM, Marie PJ. 2002. FGF signaling pathways in endochondral and intramembranous
bone development and human genetic disease. Genes Dev 16:14461465.
Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG, Aigner T, Richter W. 2006.
Premature induction of hypertrophy during in vitro chondrogenesis of human
mesenchymal stem cells correlates with calcication and vascular invasion after ectopic
transplantation in SCID mice. Arthritis Rheum 54:32543266.
Ruest PJ, Roy S, Shi E, Mernaugh RL, Hanks SK. 2000. Phosphospecic antibodies reveal focal
adhesion kinase activation loop phosphorylation in nascent and mature focal adhesions and
requirement for the autophosphorylation site. Cell Growth Differ 11:4148.
Salasznyk RM, Klees RF, Hughlock MK, Plopper GE. 2004a. ERK signaling pathways regulate
the osteogenic differentiation of human mesenchymal stem cells on collagen I and
vitronectin. Cell Commun Adhes 11:137153.
Salasznyk RM, Williams WA, Boskey A, Batorsky A, Plopper GE. 2004b. Adhesion to
vitronectin and collagen I promotes osteogenic differentiation of human mesenchymal
stem cells. J Biomed Biotechnol 2004:2434.
Schaller MD. 2001. Biochemical signals and biological responses elicited by the focal adhesion
kinase. Biochim Biophys Acta 1540:121.
Schaller MD, Hildebrand JD, Shannon JD, Fox JW, Vines RR, Parsons JT. 1994.
Autophosphorylation of the focal adhesion kinase, pp125FAK, directs SH2-dependent
binding of pp60src. Mol Cell Biol 14:16801688.
Schlaepfer DD, Broome MA, Hunter T. 1997. Fibronectin-stimulated signaling from a focal
adhesion kinase-c-Src complex: Involvement of the Grb2, p130cas, and Nck adaptor
proteins. Mol Cell Biol 17:17021713.
Schneider GB, Zaharias R, Stanford C. 2001. Osteoblast integrin adhesion and signaling
regulate mineralization. J Dent Res 80:15401544.
Spranger J, Winterpacht A, Zabel B. 1994. The type II collagenopathies: A spectrum of
chondrodysplasias. Eur J Pediatr 153:5665.
Tachibana K, Urano T, Fujita H, Ohashi Y, Kamiguchi K, Iwata S, Hirai H, Morimoto C. 1997.
Tyrosine phosphorylation of Crk-associated substrates by focal adhesion kinase. A
putative mechanismfor the integrin-mediated tyrosine phosphorylation of Crk-associated
substrates. J Biol Chem 272:2908329090.
Takeuchi Y, Suzawa M, Kikuchi T, Nishida E, Fujita T, Matsumoto T. 1997. Differentiation and
transforming growth factor-beta receptor down-regulation by collagen-alpha2beta1
integrin interaction is mediated by focal adhesion kinase and its downstream signals in
murine osteoblastic cells. J Biol Chem 272:2930929316.
Tuckwell DS, Ayad S, Grant ME, Takigawa M, Humphries MJ. 1994. Conformation
dependence of integrin-type II collagen binding. Inability of collagen peptides to support
alpha 2 beta 1 binding, and mediation of adhesion to denatured collagen by a novel alpha 5
beta 1-bronectin bridge. J Cell Sci 107:9931005.
Vandenberg P, Khillan JS, Prockop DJ, Helminen H, Kontusaari S, Ala-Kokko L. 1991.
Expression of a partially deleted gene of human type II procollagen (COL2A1) in transgenic
mice produces a chondrodysplasia. Proc Natl Acad Sci USA 88:76407644.
von der Mark K, von der Mark H. 1977. The role of three genetically distinct collagen types in
endochondral ossication and calcication of cartilage. J Bone Joint Surg Br 59-B:458464.
Winterpacht A, Hilbert M, Schwarze U, Mundlos S, Spranger J, Zabel BU. 1993. Kniest and
Stickler dysplasia phenotypes caused by collagen type II gene (COL2A1) defect. Nat Genet
3:323326.
XiaoG, Wang D, Benson MD, Karsenty G, Franceschi RT. 1998. Role of the alpha2-integrin in
osteoblast-specic gene expression and activation of the Osf2 transcription factor. J Biol
Chem 273:3298832994.
Xu Y, Gurusiddappa S, Rich RL, Owens RT, Keene DR, Mayne R, Hook A, Hook M. 2000.
Multiple binding sites in collagen type I for the integrins alpha1beta1 and alpha2beta1. J Biol
Chem 275:3898138989.
JOURNAL OF CELLULAR PHYSIOLOGY
2420 C H I U E T A L .