Abstract Yeast whole-cell biocatalysts for lipase-cata-

lyzed reactions were constructed by intracellularly over-

producing Rhizopus oryzae lipase (ROL) in Saccharomy-
ces cerevisiae MT81. The gene encoding lipase from R.
oryzae IFO4697 was cloned, and intracellular overpro-
duction systems of a recombinant ROL with a pro-se-
quence (rProROL) were constructed. When rProROL
from R. oryzae IFO4697 was produced under the control
of the 5-upstream region of the isocitrate lyase gene of
Candida tropicalis (UPR-ICL) at 30 C for 98 h by two-
stage cultivation using SDC medium (SD medium with
2% casamino acids) containing 2.0% and 0.5% glucose,
intracellular lipase activity reached levels up to
474.5 IU/l. These whole-cell biocatalysts were permea-
bilized by air-drying and used for the synthesis of methyl
esters (MEs), a potential biodiesel fuel, from plant oil
and methanol in a solvent-free and water-containing
system. The ME content in the reaction mixture
was71 wt% after a 165-h reaction at 37 C with stepwise
addition of methanol. These results indicate that an effi-
cient whole-cell biocatalyst can be prepared by intracel-
lular overproduction of lipase in yeast cells and their
permeabilization.
Introduction
Lipases are enzymes that catalyze the hydrolysis of ester
bonds of triglycerides. In nonaqueous systems, lipases
catalyze the reverse reaction, namely ester synthesis and
transesterification. They can also catalyze stereoselective
and regioselective reactions. Lipases are therefore one of
the most commonly used enzymes in industrial process-
es. For the industrial bioconversion process, however,
the utilization of intracellularly accumulated lipases in
the form of whole-cell biocatalysts is both more cost-ef-
fective and more advantageous. This is because whole-
cell biocatalysts are prepared simply by cultivation, and
the enzymes trapped inside the cells are regarded as im-
mobilized and can be separated easily. Moreover, floccu-
lent microbial cells containing lipase can be spontane-
ously immobilized within porous support particles dur-
ing cultivation (Liu et al. 1998).
In the present study, yeast expression systems for the
intracellular production of active lipase were constructed
and used for preparation of whole-cell biocatalysts.
Yeast cells have a relatively rigid cell wall and they re-
tain their structure in the presence of organic compounds
and solvents. Moreover, several methods to permeabilize
yeast cells which significantly improve their reactivity
have been developed (Gowda et al. 1991; Seip and
Cosimo 1992; Inoue et al. 1994; Liu et al. 1999; Kondo
et al. 2000). Yeasts are thus a useful tool in the develop-
ment of whole-cell biocatalysts. Lipase from Rhizopus
oryzae (ROL) was chosen because its secretory produc-
tion has been accomplished in Saccharomyces cerevisiae
(Takahashi et al. 1998, 1999). To construct whole-cell
biocatalysts for lipase-catalyzed reactions, recombinant
lipase with a pro-sequence from R. oryzae IFO4697
(rProROL) was intracellularly overexpressed under the
control of the glyceraldehyde-3-phosphate dehydroge-
nase (GAPDH) promoter and the 5-upstream region of
the isocitrate lyase gene of Candida tropicalis (UPR-
ICL) (Umemura et al. 1995). UPR-ICL-mediated tran-
scription is strongly induced by either glucose exhaus-
tion or a non-fermentable carbon source such as ethanol
T. Matsumoto H. Fukuda
Division of Molecular Science,
Graduate School of Science and Technology, Kobe University,
11 Rokkodaicho, Nada-ku, Kobe, 6578501, Japan
S. Takahashi M. Ueda A. Tanaka
Department of Synthetic Chemistry and Biological Chemistry,
Graduate School of Engineering, Kyoto University, Yoshida,
Sakyo-ku, Kyoto, 6068501, Japan
M. Kaieda A. Kondo (

)
Department of Chemical Science and Engineering,
Faculty of Engineering, Kobe University, 11 Rokkodaicho,
Nada-ku, Kobe, 6578501, Japan
e-mail: kondo@cx.kobe-u.ac.jp
Tel.: +81-78-8036196, Fax: +81-78-8036206
Appl Microbiol Biotechnol (2001) 57:515520
DOI 10.1007/s002530100733
ORI GI NAL PAP ER
T. Matsumoto S. Takahashi M. Kaieda M. Ueda
A. Tanaka H. Fukuda A. Kondo
Yeast whole-cell biocatalyst constructed by intracellular
overproduction of Rhizopus oryzae lipase is applicable
to biodiesel fuel production
Received: 11 April 2001 / Received revision: 11 May 2001 / Accepted: 18 May 2001 / Published online: 17 August 2001
Springer-Verlag 2001
or acetate (Kanai et al. 1996). The content of active li-
pase in yeast cells was maximized by optimizing the cul-
tivation procedure, and whole-cell biocatalysts were pre-
pared by permeabilization of yeast cells.
To test the applicability of whole-cell biocatalysts
containing lipase to industrially significant reactions,
they were used for biodiesel fuel production. Biodiesel
fuel refers to methylesters (MEs) synthesized from natural
triglycerides and methanol (Cvengros and Cvengrosava
1994; Masujuki and Sapuan 1995; Linco et al. 1998).
Since biodiesel is a clean fuel (Varese and Varese 1996)
and can be produced from waste oil, the development of
an efficient biodiesel fuel production process using li-
pase (Nelson et al. 1996; Shimada et al. 1999) is consid-
ered of great importance in helping to overcome environ-
mental problems by utilizing non-petroleum and renew-
able sources of fuel. Recently, Kaieda et al. (1999) found
that ROL from R. oryzae IFO4697 efficiently catalyzes
the synthesis of MEs from natural triglycerides and
methanol (methanolysis reaction) in a solvent-free and
water-containing system. Based on this, the applicability
of whole-cell biocatalysts to the methanolysis reaction in
a solvent-free and water-containing system was studied.
Materials and methods
Strains, media and general methods
The S. cerevisiae strain used in this work was MT81 (MATa
ura31 trp11 ade21 leu23,112 his3) (Takahashi et al. 1998).
The Escherichia coli strain used for genetic manipulation was No-
vablue [endA1 hsdR17 (r
K

m
K
+
) supE44 thi-1 gyrA96 relA1 lac
recA1/F {proAB
+
lac I
q
ZM15 Tn10 (tet
r
)}] (Novagen, Madison,
Wis., USA). Rhizopus oryzae IFO4697 was used for cloning of the
lipase gene.
Yeasts were grown in complete (YPD: 1% yeast extract, 2%
peptone, 2% glucose) or selective (SD: 0.67% yeast nitrogen base
supplemented with appropriate amino acids and nucleotides, 2%
glucose, unless otherwise noted) medium. To prepare plates, 2%
agar was added to these media. E. coli was grown in LB medium
(1% tryptone, 0.5% yeast extract, 1% sodium chloride) containing
100 g/ml ampicillin.
Plasmids were transformed into S. cerevisiae cells using Yeast
Maker (Clontech Laboratories, Calif., USA), and the transform-
ants were selected on SD-medium plates.
Construction of expression plasmids
For efficient intracellular overproduction of rProROL in yeast
cells, plasmids pWGP3ProROL and pWI3ProROL were construct-
ed for the constitutive and inducible expression, respectively, of
ProROL (Fig. 1). R. oryzae IFO4697 chromosomal DNA was pre-
pared by stirring the cells vigorously with glass beads followed by
phenol-chloroform extraction. To amplify the gene encoding ROL
together with the pro-sequence (ProROL) from chromosomal
DNA, the following two oligonucleotides were used as primers:
ICs (5 CTCCGGATCCATGGTTCCTGTTTCTGG TAAATCTG-
GATCT 3) and ROLrvSalI (5 CGATGTCGACTTACAAACAG-
CTTCC 3). PCR was carried out using pfu turbo polymerase
(Strategene Cloning Systems, Calif., USA). The resulting frag-
ment was ligated into the multicopy plasmid pWGP3 (Tajima et
al. 1985) or pWI3 (Kanai et al. 1996) by the following procedures.
pWGP3 was digested with BamHI and SalI. Subsequently, the
DNA fragment containing ProROL gene was digested with the
same nucleases and inserted into the plasmid. The resulting plas-
mid was named pWGP3ProROL. In the same way, plasmid
pWI3ProROL was constructed from the DNA fragment containing
ProROL and the plasmid pWI3, which was digested with BglII
and SalI. In plasmid pWGP3ProROL, ProROL was expressed un-
der the control of the GAPDH promoter, and in plasmid
pWI3ProROL, the gene was expressed under the control of UPR-
ICL.
Intracellular expression experiments
Transformants harboring the plasmid for intracellular overproduc-
tion of rProROL were precultivated in SD medium at 30 C for
30 h (OD
600
>1.5). These cultures were used to inoculate 150 ml of
SDC medium (SD medium containing 2% casamino acids) in
500-ml shaking flasks. The initial OD
600
was 0.03 and the initial
glucose concentration was 0.5%.
Measurement of lipase activity
The hydrolytic activities of lipase in culture broth and yeast cells
were measured with Lipase Kit S (Dainippon Pharmaceutical,
Osaka, Japan) according to the protocol specified by the supplier
and indicated by international units (IU). One IU of lipase activity
was defined as the amount of enzyme catalyzing the formation of
1 mol of 2,3-dimercaptopropan-1-ol from 2,3-dimercaptopropan-
1-ol tributyl ester per min. To measure the lipase activity in yeast
cells, intracellular soluble fractions were extracted by the follow-
ing procedure. Harvested yeast cells were washed twice with
5 mM EDTA in 50 mM Tris-HCl buffer (pH 8.0) and resuspended
in the same buffer with 1 mM phenylmethylsulfonyl fluoride
(PMSF), 3 mg leupeptin/l and 3 mg pepstatin A/l to inhibit the ac-
tivity of certain proteases. This mixture was agitated with a half
volume of glass beads for 30 s using a vortex mixer at maximum
speed and then cooled on ice. After ten cycles of agitation and
cooling, the intracellular soluble fraction was obtained as the su-
pernatant by centrifugation at 12,000 rpm at 4 C for 10 min.
Western blot analysis of rProROL
rProROL produced in yeast cells was analyzed by Western blot.
Yeast cell homogenate was obtained as described above. Proteins
from culture supernatants and cell extracts were separated by
SDS-PAGE using a 12.5% gel. The proteins separated on the gel
were electroblotted on polyvinylidene difluoride (PVDF) mem-
516
Fig. 1 Construction of expression plasmids pWGP3ProROL and
pWI3ProROL for expression of ProROL from Rhizopus oryzae
strain IFO4697 under the control of the GAPDH promoter and
UPR-ICL, respectively
brane (Millipore, Boston, Mass., USA) and reacted with primary
rabbit-anti-ROL IgG antibodies (Takahashi et al. 1998) and sec-
ondary goat-anti-rabbit IgG alkaline phosphatase (AP)-conjugated
antibodies (Promega). Then the membrane was stained with nitro-
blue tetrazolium chloride (NBT, Promega) and 5-bromo-4-chloro-
3-indolylphosphate toluidine salt (BCIP, Promega).
Preparation of yeast whole-cell biocatalyst by permeabilization
Yeast whole-cell biocatalysts were prepared from cells intracellu-
larly overproducing rProROL as follows. Yeast cells grown by
two-stage cultivation were harvested by centrifugation at 3,000 g
and washed with distilled water. Cell pellets were air-dried at
42 C for 3 h or frozen at 50 C and thawed at room temperature
to improve the permeability of the cell membrane.
Methanolysis using whole-cell biocatalysts
Methanolysis was performed as follows. Yeast cells (0.4 g wet
weight) intracellularly overproducing rProROL were suspended in
2 ml of 0.1 M acetate buffer (pH 7.0) and used as a catalyst. The
yeast cell suspension was added into a mixture of soybean oil and
methanol (9.65/0.35 g/g=1/1, mol/mol). The reaction was carried
out in 30-ml screw-cap vials at 37 C at 150 oscillations per min.
When the ME content reached approximately 33% and 67%,
0.35 g of methanol was added.
The amount of MEs produced by methanolysis was measured
by capillary gas chromatography GC-18A (Shimadzu, Kyoto,
Japan) connected to a DB-5 capillary column according to the
method previously reported (Kaieda et al. 1999), with minor mod-
ifications. Aliquots of 150 l were taken from the reaction mixture
and centrifuged at 14,000 rpm to obtain the upper layer. Then,
80 l of upper layer and 20 l of tricaprylin were mixed in a 10-ml
bottle to which a specified amount of sodium sulfate, as dehydro-
genizing agent, and 3.0 ml of hexane were added. A 1.0-l aliquot
of the treated sample was subjected to gas chromatography to
quantify ME content.
Results
Difference of deduced amino acid sequences
of ProROL genes from R. oryzae IFO4697
and R. oryzae DSM853
Since ROL from R. oryzae IFO4697 was found to be
very effective for biodiesel production (Kaieda et al.
1999), its gene was cloned and the DNA sequence deter-
mined. Comparison of the deduced peptide sequences of
ProROL genes from R. oryzae IFO4697 and R. oryzae
DSM853 (Beer et al. 1998) shows six amino-acid re-
placements. Four were in the pro-region, namely, I30N,
S39A, Y67N and G111S, and two were in the mature re-
gion, namely, N250H and L369I. Two rProROL expres-
sion systems under the control of either the GAPDH pro-
moter or UPR-ICL, the 5-upstream region of the isoci-
trate lyase gene of Candida tropicalis, were constructed
(Fig. 1). Since preliminary overexpression experiments
showed that the intracellular activity of R. oryzae
IFO4697 lipase was much higher than that of DSM853
lipase (data not shown), the former was used in the ex-
periments described below.
Constitutive and inducible intracellular production
of rProROL from R. oryzae IFO4697
The effect of expression systems on intracellular rPro-
ROL productivity was investigated using a constitutive
expression system with the GAPDH promoter and induc-
ible expression system with UPR-ICL. Figure 2 shows
the time courses of intracellular lipase activity in differ-
ent expression systems in flask-cultivated yeast cells. In
all cases, lipase activity was not detected in the culture
supernatant. In the constitutive expression system with
the GAPDH promoter, the intracellular lipase activity
of yeast strain MT81 harboring pWGP3ProROL
(MT81/pWGP3ProROL) reached 99.3 IU/l at 225 h. In
the inducible expression system with UPR-ICL, the in-
tracellular lipase activity of MT81/pWI3ProROL in-
creased rapidly as soon as glucose was exhausted and
reached 350.6 IU/l at 175 h.
To more tightly regulate ProROL expression, the gene
was intracellularly expressed during two-stage cultiva-
tion of yeast cells, i.e. cell growth in SDC medium with
2.0% glucose and induction in SDC medium with 0.5%
glucose (Fig. 3). Using this method, rProROL was pro-
duced rapidly after induction, and intracellular lipase ac-
tivity reached 474.5 IU/l after 98 h of cultivation.
Western blot analysis of intracellular rProROL
Since a relatively large amount of active rProROL can
accumulate inside the yeast cells, the molecular states
and production levels of rProROL in each expression
system were analyzed. Figure 4 shows the Western blot
517
Fig. 2 Comparison of intracellular lipase activity of MT81/
pWGP3ProROL and that of MT81/pWI3ProROL. Cell density
(open symbols) and intracellular lipase activity (solid symbols)
of MT81/pWGP3ProROL (L, L) and MT81/pWI3ProROL
(G, G) are shown. Cultivation was carried out in SDC medium at
30 C with an initial glucose concentration of 0.5%
analysis of proteins prepared from soluble cell homoge-
nates. Intracellular rProROL was observed at a position
of approximately 46 kDa, which is the predicted molecu-
lar weight of the 11.6-kDa pro-sequence and the 35-kDa
mature region of ROL in all soluble cell-homogenate
fractions.
The amount of rProROL was measured with NIH im-
age (version 1.62). The amounts of whole proteins cross-
reacting with anti-ROL antibody correlated well with the
lipase activity of the homogenate (data not shown). The
production level of rProROL in the inducible UPR-ICL
system (lane 2) was higher than that of the constitutive
GAPDH promoter system (lane 1), although degradation
bands of rProROL were observed. Furthermore, rPro-
ROL production level was highest when two-stage culti-
vation was carried out (lane 3).
Effect of cell permeabilization on methanolysis using
whole-cell biocatalyst
In the methanolysis of plant oil, reaction substrates such
as methanol and triglyceride must permeate both the cell
wall and the cell membrane. Therefore, whole-cell bio-
catalysts were prepared by permeabilizing yeast cells.
Yeast cells harboring plasmid pWI3ProROL were grown
in two-stage cultivation and permeabilized by freeze-
thawing and air-drying. Figure 5 shows the effect of cell
permeabilization on methanolysis using whole yeast
cells as biocatalysts. The reaction profile using free en-
zyme with the same activity as that inside the cells is
also shown. In the methanolysis reaction using free en-
zyme, the ME content reached 80 wt% after a 72-h reac-
tion; during this time methanol was added twice. In air-
dried cells, ME content reached 71 wt% when methanol
was added twice during the 165-h reaction. Comparison
of these two reaction profiles indicated that the perme-
ability of the cell membrane increased significantly by
air-drying, and that air-dried cells possessed a sufficient-
ly high reaction rate. The reaction rate of air-dried cells
was much higher than that of freeze-thawed cells. In the
case of non-treated cells, ME content was less than 1%
even after a 232-h reaction.
518
Fig. 3 Two-stage cultivation for efficient intracellular expression
of rProROL in MT81/pWI3ProROL. Cell density (G) and intra-
cellular lipase activity (G) are shown. The yeast cells were grown
in SDC medium containing 2.0% glucose, harvested after 22 h of
cultivation (dashed line) and transferred to freshly prepared SDC
medium containing 0.5% glucose for induction of rProROL. Culti-
vation was carried out at 30 C
Fig. 4 Comparison of intracellularly produced rProROL by im-
munoblotting. In lanes 13, soluble cell homogenate containing
20 g protein from Saccharomyces cerevisiae MT81 harboring
each plasmid was applied. Lane 1 MT81/pWGP3ProROL (175-h
cultivation), lane 2 MT81/pWI3ProROL (175-h cultivation), lane
3 two-stage cultivation of MT81/pWI3ProROL (98-h cultivation)
Fig. 5 Time course of methanolysis using yeast whole cells. The
weight percentages of methyl esters (MEs) in the reaction mixture
are plotted against the reaction time. Arrows show the time for the
addition of 0.35 g ethanol. I Non-treated cells, L freeze-thawed
cells, G air-dried cells. The reaction profile using free enzyme
with the same activity as that inside the cells is also shown (open
diamonds)
Discussion
In the present study, an intracellular overproduction
system of active lipase (Fig. 1) was developed in order to
obtain whole-cell biocatalysts with high lipase activity.
Since a previous study showed that rProROL has high
hydrolysis activity and higher thermostability than
r28ROL, a lipase from R. oryzae that has 28 amino acids
of the prosequence (Takahashi et al. 1999), intracellular
overeproduction of rProROL was investigated. Two dif-
ferent promoter systems were tested to obtain high activ-
ity whole-cell biocatalysts. The promoter system signifi-
cantly affects the intracellular production of active rPro-
ROL. From the results presented in Fig. 2, strong over-
expression of ProROL using the constitutive GAPDH
promoter system reduced the productivity of intracellular
rProROL. Furthermore, no remarkable intracellular rPro-
ROL activity was observed in the inducible UPR-ICL
system using sodium acetate or ethanol as sole carbon
source (data not shown), although these carbon sources
are thought to strongly induce the protein production
(Umemura et al. 1995; Kanai et al. 1996). Since rPro-
ROL was not observed in the insoluble fraction in all
cases (data not shown), overproduction during the
growth phase probably caused its proteolytic degrada-
tion. In addition, overproduction of rProROL during
growth inhibited the cell growth (data not shown), prob-
ably because of the toxicity of ProROL, which has phos-
pholipase activity (Beer et al. 1996). By contrast, a suffi-
ciently large amount of active rProROL accumulated
during cultivation of cells containing the inducible UPR-
ICL system using glucose. Furthermore, higher intracel-
lular lipase activity was obtained by two-stage cultiva-
tion, which leads to the induction at the late-logarithmic
growth phase and more strict regulation of rProROL pro-
duction (Fig. 3). Therefore intracellular overproduction
of rProROL in late-logarithmic phase may improve cell
growth and suppress its proteolytic degradation. In this
case, intercellular lipase activity reached 474.5 IU/l.
Yeast cells containing high lipase activity were used
as the whole-cell biocatalysts for methanolysis in a sol-
vent-free system. Various methods of cell permeabilizat-
ion to construct whole-cell biocatalysts have been report-
ed (Felix 1982; Gowda et al. 1991; Seip and Cosimo
1992; Inoue et al. 1994; Liu et al. 1999; Kondo et al.
2000). In our previous study, permeabilization with 40%
isopropyl alcohol was found to significantly improve the
activity of yeast whole-cell biocatalysts (Liu et al. 1999;
Kondo et al. 2000). However, in the present study,
freeze-thawing and air-drying were used to prepare yeast
whole-cell biocatalysts, since ROL is inactivated by al-
cohol at such a high concentration (data not shown). The
permeabilized cells that contained rProROL, and espe-
cially those which had been air-dried, could interact with
the substrates and catalyze methanolysis. In addition, li-
pase activity was not detected from the water phase cor-
rected after the reaction, indicating that ROL was firmly
trapped inside the yeast cells. Comparison of the reaction
rates of air-dried cells with that of free enzyme indicates
that the barrier for the diffusion of substrates and prod-
ucts was reduced significantly by permeabilization.
Since a large amount of whole-cell biocatalysts was easi-
ly prepared by cultivation and are regarded as a kind of
self-immobilized enzyme, the permeabilized whole-cell
biocatalysts offer several advantages regarding their in-
dustrial application. Further improvement of intracellular
production levels of active lipase will increase the reac-
tion rate of whole-cell biocatalysts.
The above results demonstrate that yeast whole-cell
biocatalysts, which intracellularly overproduced rPro-
ROL, efficiently catalyzed methanolysis in a solvent-free
reaction system. This is the first example of the accumu-
lation of active lipase, which is secreted in the R. oryzae
wild-type strain, in yeast cells, and its utilization in
whole-cell biocatalysts for an industrially important re-
action. This whole-cell biocatalyst with high lipase ac-
tivity may be applicable to many other reaction systems
catalyzed by lipases.
References
Beer HD, Wohlfahrt G, Shmid RD, McCarthy JEG (1996) The fold-
ing and activity of the extracellular lipase of Rhizopus oryzae
are modulated by a prosequence. Biochem J 319:351359
Beer HD, McCarthy JEG, Bornscheuer UT, Schmid RD (1998)
Cloning, expression, characterization and role of the leader se-
quence of a lipase from Rhizopus oryzae. Biochem Biophys
Acta 1399:173180
Cvengros J, Cvengrosava Z (1994) Quality control of rapeseed oil
methyl esters by determination of acyl composition. JAOCS
71:13491352
Felix H (1982) Permeabilized cells. Anal Biochem 120:211234
Gowda LR, Bachhwat N, Bhat SG (1991) Permeabilization of
bakers' yeast by cetyltrimethylammonium bromide for intra-
cellular enzyme catalysis. Enzyme Microb Technol 13:154
157
Inoue Y, Tsuchiyama H, Kimura A. (1994) Continuous production
of S-lactoylglutathione by immobilized Hansenula mrakii
cells. Process Biochem 29: 271275
Kaieda M, Samukawa T, Matsumoto T, Ban K, Kondo A, Shimada
Y, Noda H, Nomoto F, Ohtuka K, Izumoto E, Fukuda H (1999)
Biodiesel fuel production from plant oil catalyzed by Rhizopus
oryzae lipase in a water-containing system without an organic
solvent. J Biosci Bioeng 88:627631
Kanai T, Atomi H, Umemura K, Ueno H, Teranishi Y, Ueda M,
Tanaka A (1996) A novel heterologous gene expression
system in Saccharomyces cerevisiae using the isocitrate lyase
gene promoter from Candida tropicalis. Appl Microbiol Bio-
technol 44:759765
Kondo A, Liu Y, Furuta M, Fujita Y, Matsumoto T, Fukuda H
(2000) Preparation of high activity whole cell biocatalyst by
permeabilization of recombinant flocculent yeast with alcohol.
Enzyme Microb Technol 27:806811
Linco YY, Lamsa M, Wu X, Uosukainen E, Seppala J, Linko P
(1998) Biodegradable products by lipase biocatalysis. J Bio-
technol 66:4150
Liu Y, Kondo A, Ohkawa H, Shiota N, Fukuda H (1998) Biocon-
version using immobilized recombinant flocculent yeast cells
carrying a fused enzyme gene in an intelligent bioreactor.
Biochem Eng J 2:229235
Liu Y, Hama H, Fujita Y, Kondo A, Inoue Y, Kimura A, Fukuda H
(1999) Production of S-lactoylglutathione by high activity
whole cell biocatalysts prepared by permeabilization of re-
combinant Saccharomyces cerevisiae with alcohols. Bio-
technol Bioeng 64:5460
519
Masujuki HH, Sapuan SM (1995) Palm oil methyl esters as lu-
bricant additive in a small diesel engine. JAOCS 72:609
612
Nelson LA, Foglia TA, Marmer WN (1996) Lipase-catalyzed pro-
duction of biodiesel. JAOCS 73:11911195
Seip JE, Cosimo RD (1992) Optimization of accessible catalase
activity in polyacrylamide gel-immobilized Saccharomyces
cerevisiae. Biotechnol Bioeng 40:638642
Shimada Y, Watanabe Y, Samukawa T, Sugihara A, Noda H,
Fukuda H, Tominaga Y (1999) Conversion of plant oil to bio-
diesel using immobilized Candida antarctica lipase. JAOCS
76:789793
Tajima M, Nogi Y, Fukasawa T (1985) Primary structure of the
Saccharomyces cerevisiae GAL7 gene. Yeast 1:6777
Takahashi S, Ueda M, Atomi H, Beer HD, Bornscheuer UT,
Schmid RD, Tanaka A (1998) Extracellular production of ac-
tive Rhizopus oryzae lipase by Saccharomyces cerevisiae. J
Ferment Bioeng 86:164168
Takahashi S, Ueda M, Tanaka A (1999) Independent production of
two molecular forms of a recombinant Rhizopus oryzae lipase
by KEX2-engineered strains of Saccharomyces cerevisiae.
Appl Microbiol Biotechnol 52:53440
Umemura K, Atomi H, Kanai T, Teranishi Y, Ueda M, Tanaka A
(1995) A novel promoter, derived from the isocitrate lyase
gene of Candida tropicalis, inducible with acetate in Saccha-
romyces cerevisiae. Appl Microbiol Biotechnol 43:489492
Varese R, Varese M (1996) Methyl ester biodiesel: opportunity or
necessity? INFORM 7:816824
520